WO2013063340A1 - Transgenic mice expressing chimeric major histocompatibility complex (mhc) class ii molecules - Google Patents
Transgenic mice expressing chimeric major histocompatibility complex (mhc) class ii molecules Download PDFInfo
- Publication number
- WO2013063340A1 WO2013063340A1 PCT/US2012/062029 US2012062029W WO2013063340A1 WO 2013063340 A1 WO2013063340 A1 WO 2013063340A1 US 2012062029 W US2012062029 W US 2012062029W WO 2013063340 A1 WO2013063340 A1 WO 2013063340A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- human
- mhc
- mouse
- chimeric
- polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0278—Knock-in vertebrates, e.g. humanised vertebrates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0271—Chimeric vertebrates, e.g. comprising exogenous cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70539—MHC-molecules, e.g. HLA-molecules
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
Definitions
- Present invention relates to a non-human animal, e.g., a rodent (e.g., a mouse or a rat) that is genetically engineered to express a humanized Major Histocompatibility
- MHC Complex
- the invention further relates to methods for making a genetically modified non-human animal that expresses a humanized MHC II protein. Also provided are methods for using non-human animals, cells, and tissues that express a humanized MHC class II protein for identifying peptides that activate lymphocytes and engage T cells, and for developing human vaccines and other therapeutics.
- MHC molecules are encoded by multiple loci that are found as a linked cluster of genes that spans about 4 Mb. In mice, the MHC genes are found on chromosome 17, and for historical reasons are referred to as the histocompatibility 2 (H-2) genes. In humans, the genes are found on chromosome 6 and are called human leukocyte antigen (HLA) genes.
- HLA human leukocyte antigen
- MHC loci exhibit the highest polymorphism in the genome; some genes are represented by >300 alleles (e.g., human HLA-DR and human HLA-B). All class I and II MHC genes can present peptide fragments, but each gene expresses a protein with different binding characteristics, reflecting polymorphisms and allelic variants. Any given individual has a unique range of peptide fragments that can be presented on the cell surface to B and T cells in the course of an immune response.
- HLA-DP HLA-DP
- HLA-DQ HLA-DR
- H-2A and H-2E H-2A and H-2E
- Additional proteins encoded by genes in the MHC II locus, HLA-DM and H LA-DO in humans, and H-2M and H-20 in mice, are not found on the cell surface, but reside in the endocytic compartment and ensure proper loading of MHC II molecules with peptides.
- Class II molecules consist of two polypeptide chains: chain and ⁇ chain.
- the extracellular portion of the chain contains two extracellular domains, «1 and cx2; and the extracellular portion of the ⁇ chain also contains two extracellular domains, ⁇ 1 and ⁇ 2 (see FIG. 1 ).
- the a and the ⁇ chains are non-covalently associated with each other.
- MHC class II molecules are expressed on antigen-presenting cells (APCs), e.g., B cells, macrophages, dendritic cells, endothelial cells during a course of inflammation, etc.
- APCs antigen-presenting cells
- MHC II molecules expressed on the surface of APCs typically present antigens generated in intracellular vesicles to CD4+ T cells.
- the MHC class II complex with the antigen of interest In order to participate in CD4+ T cell engagement, the MHC class II complex with the antigen of interest must be sufficiently stable to survive long enough to engage a CD4+ T cell.
- a CD4+ T helper cell is engaged by a foreign peptide/MHC II complex on the surface of APC, the T cell is activated to release cytokines that assist in immune response to the invader.
- peptides derived from self- proteins become the target of the cellular component of the immune system, which results in destruction of cells presenting such peptides.
- antigens that are clinically significant (e.g., antigens associated with various types of cancer).
- antigens associated with various types of cancer.
- in order to improve identification and selection of peptides that will provoke a suitable response in a human T cell in particular for peptides of clinically significant antigens, there remains a need for in vivo and in vitro systems that mimic aspects of human immune system.
- biological systems e.g., genetically modified non-human animals and cells
- a biological system for generating or identifying peptides that associate with human MHC class II proteins and chimeras thereof, and bind to CD4+ T cells is provided.
- Non-human animals comprising non-human cells that express humanized molecules that function in the cellular immune response are provided.
- Humanized rodent loci that encode humanized MHC II proteins are also provided.
- Humanized rodent cells that express humanized MHC molecules are also provided.
- In vivo and in vitro systems are provided that comprise humanized rodent cells, wherein the rodent cells express one or more humanized immune system molecules.
- a non-human animal e.g., a rodent (e.g., a mouse or a rat) comprising in its genome a nucleotide sequence encoding a humanized MHC II complex, wherein a human portion of the humanized MHC II complex comprises an extracellular domain of a human MHC II complex, e.g., a humanized MHC II a extracellular domain and a humanized MHC II ⁇ extracellular domain.
- a rodent e.g., a mouse or a rat
- a human portion of the humanized MHC II complex comprises an extracellular domain of a human MHC II complex, e.g., a humanized MHC II a extracellular domain and a humanized MHC II ⁇ extracellular domain.
- a non-human animal comprising at an endogenous MHC II a gene locus a nucleotide sequence encoding a chimeric human/non- human MHC II polypeptide.
- a human portion of such chimeric human/non-human MHC II a polypeptide comprises a human MHC II a extracellular domain.
- the non-human animal expresses a functional MHC II complex on a surface of a cell of the animal.
- the human MHC II extracellular domain in the animal comprises human MHC II a1 and a2 domains; in one embodiment, a non-human portion of the chimeric human/non-human MHC II a polypeptide comprises transmembrane and cytoplasmic domains of an endogenous non-human MHC II a polypeptide.
- the nucleotide sequence encoding a chimeric human/non- human MHC II a polypeptide is expressed under regulatory control of endogenous non- human MHC II promoter and regulatory elements.
- the human portion of the chimeric polypeptide is derived from a human HLA class II protein selected from the group consisting of HLA-DR, HLA-DQ, and HLA-DP, e.g., the human portion is derived from HLA-DR4 protein.
- the non-human animal may be a rodent, e.g., a mouse.
- the non-human animal comprising at an endogenous MHC II a gene locus a nucleotide sequence encoding a chimeric human/non-human MHC II a polypeptide further comprises at an endogenous MHC II ⁇ gene locus a nucleotide sequence encoding a chimeric human/non-human MHC II ⁇ polypeptide.
- a method of making a genetically modified non-human animal comprising at an endogenous MHC II a gene locus a nucleotide sequence encoding a chimeric human/non-human MHC II a polypeptide.
- Such method may comprise replacing at an endogenous MHC II a gene locus a nucleotide sequence encoding an endogenous non-human MHC II a polypeptide with a nucleotide sequence encoding a chimeric human/non-human MHC II polypeptide.
- non-human animal comprising at an endogenous MHC II ⁇ gene locus a nucleotide sequence encoding a chimeric human/non-human MHC II ⁇ polypeptide.
- a human portion of such chimeric human/non-human MHC II ⁇ polypeptide comprises a human MHC II ⁇ extracellular domain.
- the non-human animal expresses a functional MHC II complex on a surface of a cell of the animal.
- the human MHC II ⁇ extracellular domain in the animal comprises human MHC II ⁇ 1 and ⁇ 2 domains; in one embodiment, a non-human portion of the chimeric human/non-human MHC II ⁇ polypeptide comprises transmembrane and cytoplasmic domains of an endogenous non-human MHC II ⁇ polypeptide.
- the nucleotide sequence encoding a chimeric human/non-human MHC II ⁇ polypeptide is expressed under regulatory control of endogenous non-human MHC II ⁇ promoter and regulatory elements.
- the human portion of the chimeric polypeptide is derived from a human HLA class II protein selected from the group consisting of HLA-DR, HLA-DQ, and H LA-DP, e.g., the human portion is derived from HLA-DR4 protein.
- the non-human animal may be a rodent, e.g., a mouse.
- the non- human animal comprising at an endogenous MHC II ⁇ gene locus a nucleotide sequence encoding a chimeric human/non-human MHC II ⁇ polypeptide further comprises at an endogenous MHC II « gene locus a nucleotide sequence encoding a chimeric human/non- human MHC II a polypeptide.
- Also provided herein is a method of making a genetically modified non-human animal comprising at an endogenous MHC II ⁇ gene locus a nucleotide sequence encoding a chimeric human/non-human MHC II ⁇ polypeptide.
- Such method may comprise replacing at an endogenous MHC II ⁇ gene locus a nucleotide sequence encoding an endogenous non-human MHC II ⁇ polypeptide with a nucleotide sequence encoding a chimeric human/non-human MHC II ⁇ polypeptide.
- a non-human animal comprising at an endogenous MHC II gene locus a first nucleotide sequence encoding a chimeric human/non-human MHC II a polypeptide and a second nucleotide sequence encoding a chimeric human/non-human MHC II ⁇ polypeptide, wherein a human portion of the chimeric human/non-human MHC II a polypeptide comprises a human MHC II « extracellular domain and a human portion of the chimeric human/non-human MHC II ⁇ polypeptide comprises a human MHC II ⁇ extracellular domain.
- the chimeric human/non-human MHC II a and ⁇ polypeptides form a functional chimeric MHC I I complex (e.g. , human/non-human MHC II complex) on a surface of a cell.
- the human MHC II a extracellular domain comprises human a1 and a2 domains of human MHC II.
- the human MHC II ⁇ extracellular domain comprises human ⁇ 1 and ⁇ 2 domains of human MHC II.
- the first nucleotide sequence is expressed under regulatory control of endogenous non-human MHC II a promoter and regulatory elements.
- the second nucleotide sequence is expressed under regulatory control of endogenous non-human MHC II ⁇ promoter and regulatory elements.
- a non-human portion of the chimeric human/non-human MHC II a polypeptide comprises transmembrane and cytoplasmic domains of an endogenous non-human MHC II a polypeptide.
- a non-human portion of the chimeric human/non-human MHC II ⁇ polypeptide comprises transmembrane and cytoplasmic domains of an endogenous non-human MHC II ⁇ polypeptide.
- the non-human animal is a rodent
- the human portions of the chimeric human/rodent MHC II a and ⁇ polypeptides comprise human sequences derived from HLA class II protein selected from the group consisting of HLA-DR, HLA-DQ, and H LA-DP.
- the human portions of the chimeric human/rodent MHC II a and ⁇ sequences are derived from a human H LA-DR4 sequence; thus, the nucleotide sequence encoding the MHC II a extracellular domain is derived from a sequence of an HLA-DR «*01 gene, and the nucleotide sequence encoding the MHC II ⁇ extracellular domain is derived from a sequence encoding an ⁇ 1_ ⁇ - ⁇ 1 *04 gene.
- the first and the second nucleotide sequences are located on the same chromosome.
- the animal comprises two copies of the MHC II locus containing the first and the second nucleotide sequences, while in other aspects, the animal comprises one copy of the MHC II locus containing the first and the second nucleotide sequences.
- the animal may be homozygous or heterozygous for the MHC II locus containing the first and the second nucleotide sequences.
- the chimeric MHC II a polypeptide and/or the chimeric MHC II ⁇ polypeptide is operably linked to a non-human leader sequence.
- the genetically engineered non-human animal is a rodent.
- the rodent is selected from the group consisting of a mouse and a rat.
- non-human sequences of the chimeric MHC II a and ⁇ genes are derived from nucleotide sequences encoding mouse MHC II protein, e.g., a mouse H-2E protein.
- the rodent e.g., the mouse or the rat
- the rodent does not express functional endogenous MHC II polypeptides from their endogenous loci.
- the rodent is a mouse
- the mouse does not express functional endogenous H-2E and H-2A polypeptides from their endogenous loci.
- a mouse comprising at an endogenous mouse MHC II locus a first nucleotide sequence encoding a chimeric human/mouse MHC II polypeptide and a second nucleotide sequence encoding a chimeric human/mouse MHC II ⁇ polypeptide, wherein a human portion of the chimeric MHC II a polypeptide comprises an extracellular domain derived from an a polypeptide of a human HLA-DR4 protein and a human portion of the chimeric human/mouse MHC II ⁇ polypeptide comprises an
- extracellular domain derived from a ⁇ polypeptide of a human HLA-DR4 protein wherein a mouse portion of the chimeric MHC II polypeptide comprises transmembrane and cytoplasmic domains of a mouse H-2E a chain and a mouse portion of the chimeric MHC II ⁇ polypeptide comprises transmembrane and cytoplasmic domains of a mouse H-2E ⁇ chain, and wherein the mouse expresses a functional chimeric HLA-DR4/H-2E MHC II complex.
- the extracellular domain of the chimeric MHC II polypeptide comprises human 1 and a2 domains; in some aspects, the extracellular domain of the chimeric MHC II ⁇ polypeptide comprises human ⁇ 1 and ⁇ 2 domains. In some
- the first nucleotide sequence is expressed under regulatory control of endogenous mouse MHC I! a promoter and regulatory elements
- the second nucleotide sequence is expressed under regulatory control of endogenous mouse MHC II ⁇ promoter and regulatory elements.
- the mouse does not express functional endogenous MHC II polypeptides, e.g., H-2E and H-2A polypeptides, from their endogenous loci.
- the mouse comprises two copies of the MHC II locus containing the first and the second nucleotide sequences, while in other aspects, the mouse comprises one copy of the MHC II locus containing the first and the second nucleotide sequences.
- non-human animals e.g., rodents, e.g., mice or rats
- methods of making genetically engineered non-human animals are also provided.
- non- human animals e.g., rodents, e.g., mice or rats
- non- human animals of the invention are made by replacing endogenous MHC II sequences with nucleotide sequences encoding chimeric human/non- human (e.g., human/mouse) MHC II a and ⁇ polypeptides.
- the invention provides a method of modifying an MHC II locus of a rodent (e.g., a mouse or a rat) to express a chimeric human/rodent MHC II complex comprising replacing at the endogenous mouse MHC II locus a nucleotide sequence encoding a rodent MHC II complex with a nucleotide sequence encoding a chimeric human/rodent MHC II complex.
- a rodent e.g., a mouse or a rat
- the nucleotide sequence encoding the chimeric human/rodent MHC II complex comprises a first nucleotide sequence encoding an extracellular domain of a human MHC II chain and transmembrane and cytoplasmic domains of a rodent MHC II a chain and a second nucleotide sequence encoding an extracellular domain of a human MHC II ⁇ chain and transmembrane and cytoplasmic domains of a rodent MHC II ⁇ chain.
- a rodent portion of the chimeric MHC II complex is derived from a mouse H-2E protein, and a human portion is derived from a human HLA-DR4 protein.
- the replacement of the endogenous MHC II loci described herein is made in a single ES cell, and the single ES cell is introduced into a rodent (e.g., mouse or rat) embryo to make a genetically modified rodent (e.g., mouse or rat).
- a rodent e.g., mouse or rat
- a genetically modified rodent e.g., mouse or rat
- cells e.g., isolated antigen-presenting cells, derived from the non-human animals (e.g., rodents, e.g., mice or rats) described herein. Tissues and embryos derived from the non-human animals described herein are also provided.
- non-human animals e.g., rodents, e.g., mice or rats
- FIG. 1 is a schematic drawing of the MHC II class molecule expressed on the surface of an antigen presenting cell (APC), containing four domains: «1 , «2, ⁇ 1 , and ⁇ 2.
- the gray circle represents a peptide bound in the peptide-binding cleft.
- FIG. 2 is a schematic representation (not to scale) of the relative genomic structure of the human HLA, showing class I, II and III genes.
- FIG. 3 is a schematic representation (not to scale) of the relative genomic structure of the mouse MHC, showing class I, II and III genes.
- FIG. 4 (A-D) is a schematic illustration (not to scale) of the strategy for generating a targeting vector comprising humanized l-E ⁇ and l-E (i.e., H-2E /HLA-DRpi*04 and H- 2Ea/HLA-DRa*01 chimera, respectively).
- the final humanized MHC II sequence from FIG. 4B is ligated between Pl-Scel and l-Ceul restriction sites of the final construct from FIG. 4A, to generate a construct comprising humanized MHC II and exon 1 of l-Ea from BALB/c.
- Pg pseudogene
- BHR bacterial homologous recombination;
- CM chloramphenicol
- spec spectinomycin
- hyg hygromycin
- neo neomycin
- FIG. 5 shows a schematic illustration, not to scale, of MHC class II l-E and I -A genes, showing knockout of the mouse locus using a hygromycin cassette, followed by introduction of a vector comprising a humanized l-E ⁇ and l-E a (i.e., H-2E /HLA-DR i *04 and H-2Ea/HLA-DRa*01 chimera, respectively).
- Open triangles represent human exons; filled triangles represent mouse exons.
- Probes used for genotyping are encircled.
- FIG. 6 shows a schematic illustration, not to scale, of Cre-mediated removal of the neomycin cassette of FIG. 5.
- Open triangles represent human exons; filled triangles represent mouse exons.
- Top two strands represent MHC II loci in humanized MHC II heterozygous mouse harboring a neomycin selection cassette, and bottom two strands represent MHC II loci in humanized MHC II heterozygous mouse with neomycin cassette removed.
- FIG. 7 shows a schematic comparative illustration, not to scale, of mouse and human class II loci.
- Class II genes are represented by boxes, and empty boxes represent pseudogenes.
- Relative sizes (kb) of various nucleic acid fragments are included.
- FIG. 8 is a schematic illustration (not to scale) of humanization strategy for the MHC II a chain; in particular, the figure shows a replacement of a1 and a2 domains, encoded by exons 2 and 3 of MHC II a gene, while retaining mouse
- the MHC II a leader sequence is derived from the mouse BALB/c strain.
- the right panel illustrates humanization of the MHC II ⁇ chain; in particular, the figure shows a replacement of ⁇ 1 and ⁇ 2 domains, encoded by exons 2 and 3 of MHC II ⁇ gene, while retaining the mouse leader and mouse transmembrane and cytoplasmic tail sequences.
- Top row are all human sequences; middle row are all mouse sequences; bottom row are all humanized sequences, with exons 2 and 3 derived from human HLA-DR genes.
- FIG. 9 shows FACS analysis with anti-HLA-DR antibody of B cells from a mouse heterozygous for a chimeric HLA-DR4 (neo cassette removed) in the presence (1681 HET + poly(l:C) or absence (1681 HET) of poly(l:C), and a wild-type mouse (WT mouse).
- the present invention provides genetically modified non-human animals (e.g., mice, rats, rabbits, etc.) that express human or humanized MHC II polypeptide; embryos, cells, and tissues comprising the same; methods of making the same; as well as methods of using the same.
- genetically modified non-human animals e.g., mice, rats, rabbits, etc.
- human or humanized MHC II polypeptide e.g., embryos, cells, and tissues comprising the same; methods of making the same; as well as methods of using the same.
- conservative amino acid substitution when used to describe a conservative amino acid substitution, includes substitution of an amino acid residue by another amino acid residue having a side chain R group with similar chemical properties (e.g., charge or hydrophobicity). Conservative amino acid substitutions may be achieved by modifying a nucleotide sequence so as to introduce a nucleotide change that will encode the conservative substitution. In general, a conservative amino acid substitution will not substantially change the functional properties of interest of a protein, for example, the ability of MHC II to present a peptide of interest.
- groups of amino acids that have side chains with similar chemical properties include aliphatic side chains such as glycine, alanine, valine, leucine, and isoleucine; aliphatic-hydroxyl side chains such as serine and threonine; amide-containing side chains such as asparagine and glutamine; aromatic side chains such as phenylalanine, tyrosine, and tryptophan; basic side chains such as lysine, arginine, and histidine; acidic side chains such as aspartic acid and glutamic acid; and, sulfur-containing side chains such as cysteine and methionine.
- Conservative amino acids substitution groups include, for example, valine/leucine/isoleucine, phenylalanine/tyrosine, lysine/arginine, alanine/valine,
- a conservative amino acid substitution can be a substitution of any native residue in a protein with alanine, as used in, for example, alanine scanning mutagenesis.
- a conservative substitution is made that has a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. ((1992) Exhaustive Matching of the Entire Protein
- the substitution is a moderately conservative substitution wherein the substitution has a nonnegative value in the PAM250 log-likelihood matrix.
- a genetically modified non-human animal whose genome comprises a nucleotide sequence encoding a human or humanized MHC II polypeptide, wherein the polypeptide comprises conservative amino acid
- nucleic acid residues encoding a human or humanized MHC II polypeptide described herein due to the degeneracy of the genetic code, other nucleic acids may encode the polypeptide of the invention. Therefore, in addition to a genetically modified non-human animal that comprises in its genome a nucleotide sequence encoding MHC II polypeptide with conservative amino acid substitutions, a non-human animal whose genome comprises a nucleotide sequence that differs from that described herein due to the degeneracy of the genetic code is also provided.
- identity when used in connection with sequence includes identity as determined by a number of different algorithms known in the art that can be used to measure nucleotide and/or amino acid sequence identity. In some embodiments described herein, identities are determined using a ClustalW v. 1 .83 (slow) alignment employing an open gap penalty of 10.0, an extend gap penalty of 0.1 , and using a Gonnet similarity matrix (MacVectorTM 10.0.2, MacVector Inc., 2008). The length of the sequences compared with respect to identity of sequences will depend upon the particular sequences. In various embodiments, identity is determined by comparing the sequence of a mature protein from its N-terminal to its C-terminal.
- the human portion of the chimeric human/non-human sequence (but not the non-human portion) is used in making a comparison for the purpose of ascertaining a level of identity between a human sequence and a human portion of a chimeric human/non-human sequence (e.g., comparing a human ectodomain of a chimeric human/mouse protein to a human ectodomain of a human protein).
- homologous in reference to sequences, e.g., nucleotide or amino acid sequences, means two sequences which, upon optimal alignment and comparison, are identical in at least about 75% of nucleotides or amino acids, at least about 80% of nucleotides or amino acids, at least about 90-95% nucleotides or amino acids, e.g., greater than 97% nucleotides or amino acids.
- the targeting construct should contain arms homologous to endogenous DNA sequences (i.e., "homology arms”); thus, homologous recombination can occur between the targeting construct and the targeted endogenous sequence.
- operably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
- a nucleic acid sequence encoding a protein may be operably linked to regulatory sequences (e.g., promoter, enhancer, silencer sequence, etc.) so as to retain proper transcriptional regulation.
- regulatory sequences e.g., promoter, enhancer, silencer sequence, etc.
- various portions of the chimeric or humanized protein of the invention may be operably linked to retain proper folding, processing, targeting, expression, and other functional properties of the protein in the cell. Unless stated otherwise, various domains of the chimeric or humanized protein of the invention are operably linked to each other.
- MHC II complex include the complex between an MHC II a polypeptide and an MHC II ⁇ polypeptide.
- MHC II a polypeptide or “MHC II ⁇ polypeptide” (or the like), as used herein, includes the MHC I a polypeptide alone or MHC II ⁇ polypeptide alone, respectively.
- HLA-DR4 complex refers to complex between and ⁇ polypeptides.
- human MHC and “HLA” are used interchangeably.
- replacement in reference to gene replacement refers to placing exogenous genetic material at an endogenous genetic locus, thereby replacing all or a portion of the endogenous gene with an orthologous or homologous nucleic acid sequence.
- nucleic acid sequence of endogenous MHC II locus was replaced by a nucleotide sequence comprising sequences encoding portions of human MHC II a and ⁇ polypeptides; specifically, encoding the extracellular portions of the MHC II a and ⁇ polypeptides.
- a replacement at an endogenous locus e.g., replacement at an endogenous non-human MHC II locus
- the invention generally provides genetically modified non- human animals that comprise in their genome a nucleotide sequence encoding a human or humanized MHC II complex; thus, the animals express a human or humanized MHC II complex (e.g., MHC II a and ⁇ polypeptides).
- MHC genes are categorized into three classes: class I, class II, and class III, all of which are encoded either on human chromosome 6 or mouse chromosome 17. A schematic of the relative organization of the human and mouse MHC classes is presented in FIGs. 2 and 3, respectively. The majority of MHC genes are polymorphic, in fact they are the most polymorphic genes of the mouse and human genomes.
- MHC polymorphisms are presumed to be important in providing evolutionary advantage; changes in sequence can result in differences in peptide binding that allow for better antigen presentation.
- One exception is the human HLA-DR chain and its mouse homolog, E (i.e., H-2Ea), which are monomorphic.
- MHC class II complex comprises two non-covalently associated domains: an a chain and a ⁇ chain, also referred herein as an a polypeptide and a ⁇ polypeptide (FIG. 1 ).
- the protein spans the plasma membrane; thus it contains an extracellular domain, a transmembrane domain, and a cytoplasmic domain.
- the extracellular portion of the a chain includes 1 and a2 domains
- the extracellular portion of the ⁇ chain includes ⁇ 1 and ⁇ 2 domains.
- the a1 and ⁇ 1 domains form a peptide-binding cleft on the cell surface. Due to the three-dimensional confirmation of the peptide-binding cleft of the MHC II complex, there is theoretically no upper limit on the length of the bound antigen, but typically peptides presented by MHC II are between 13 and 17 amino acids in length.
- the peptide-binding cleft of the MHC II molecule interacts with invariant chain (li) during the processes of MHC II complex formation and peptide acquisition.
- the / ⁇ MHC II dimers assemble in the endoplasmic reticulum and associate with li chain, which is responsible for control of peptide binding and targeting of the MHC II into endocytic pathway.
- li undergoes proteolysis, and a small fragment of li, Class ll-associated invariant chain peptide (CLIP), remains at the peptide-binding cleft.
- CLIP Class ll-associated invariant chain peptide
- MHC II interacts with T cell co-receptor CD4 at the hydrophobic crevice at the junction between 2 and ⁇ 2 domains.
- Wang and Reinherz (2002) Structural Basis of T Cell Recognition of Peptides Bound to MHC Molecules, Molecular Immunology, 38:1039-49.
- CD4 and T cell receptor bind the same MHC II molecule complexed with a peptide, the sensitivity of a T cell to antigen is increased, and it requires 100-fold less antigen for activation. See, Janeway's Immunobiology, 7 th Ed., Murphy et al. eds., Garland Science, 2008, incorporated herein by reference.
- actin cytoskeleton is a site of localized signal transduction activity, which can effect antigen presentation.
- recent studies have also shown that up to 20% of all HLA-DR molecules constitutively reside in the lipid rafts of APCs, which are microdomains rich in cholesterol and glycosphingolipids, and that such localization is important for antigen presentation, immune synapse formation, and MHC ll-mediated signaling. See, e.g., Dolan et al.
- the cytoplasmic domain of MHC II in particular the ⁇ chain, contains a leucine residue that is subject to ubiquitination by ubiquitin ligase, membrane-associated
- MARCH I RING-CH I
- Transmembrane domains of a and ⁇ chains of MHC II interact with each other and this interaction is important for proper assembly of class II MHC complex.
- MHC II molecules in which the transmembrane domains of the and ⁇ chains were replaced by the chain of IL-2 receptor were retained in the ER and were barely detectable at the cell surface. Id.
- conserved Gly residues at the a and ⁇ transmembrane domains were found to be responsible for MHC II assembly at the cell surface. Id.
- both transmembrane and cytoplasmic domains are crucial for the proper function of the MHC II complex.
- the invention provides a genetically modified non-human animal (e.g., mouse, rat, rabbit, etc.) that comprises in its genome a nucleotide sequence encoding a human or humanized MHC II complex, e.g., a human or humanized MHC II a and/or ⁇ polypeptide(s).
- a genetically modified non-human animal e.g., mouse, rat, rabbit, etc.
- a nucleotide sequence encoding a human or humanized MHC II complex, e.g., a human or humanized MHC II a and/or ⁇ polypeptide(s).
- the non-human animal may comprise in its genome a nucleotide sequence that encodes an MHC II complex that is partially human and partially non-human, e.g., a non-human animal that expresses a chimeric human/non-human MHC II complex (e.g., a non-human animal that expresses chimeric human/non-human MHC II a and ⁇ polypeptides).
- the non-human animal only expresses the human or humanized MHC II complex, e.g., a chimeric human/non-human MHC II complex, and does not express an endogenous non-human MHC II complex from an endogenous MHC II locus.
- the animal is incapable of expressing any endogenous non-human MHC II complex from an endogenous MHC II locus, but only expresses the human or humanized MHC II complex.
- the genetically modified non-human animal e.g., mouse, rat, rabbit, etc.
- a chimeric human/non-human MHC II complex comprises a chimeric human/non-human MHC II a polypeptide and a chimeric human/non-human MHC II ⁇ polypeptide.
- a human portion of the chimeric MHC II a polypeptide and/or a human portion of the chimeric MHC II ⁇ polypeptide comprises a peptide-binding domain of a human MHC II a polypeptide and/or human MHC II ⁇ polypeptide, respectively.
- a human portion of the chimeric MHC II and/or ⁇ polypeptide comprises an extracellular domain of a human MHC II and/or ⁇ polypeptide, respectively.
- a human portion of the chimeric MHC II a polypeptide comprises 1 domain of a human MHC II a polypeptide; in another embodiment, a human portion of the chimeric MHC II polypeptide comprises 1 and a2 domains of a human MHC II a polypeptide.
- a human portion of the chimeric MHC II ⁇ polypeptide comprises ⁇ 1 domain of a human MHC II ⁇ polypeptide; in another embodiment, a human portion of the chimeric MHC II ⁇ polypeptide comprises ⁇ 1 and ⁇ 2 domains of a human MHC II ⁇ polypeptide.
- the human portion of the MHC II a and ⁇ polypeptides described herein may be encoded by any of H LA-DP, -DQ, and -DR loci.
- HLA-DP Human Leukocyte Antigen
- -DQ Human Leukocyte Antigen
- -DR loci A list of commonly used HLA antigens and alleles is described in Shankarkumar et al. ((2004) The Human Leukocyte Antigen (HLA) System, Int. J. Hum. Genet. 4(2):91 -1 03), incorporated herein by reference.
- Shankarkumar et al. also present a brief explanation of HLA nomenclature used in the art. Additional information regarding HLA nomenclature and various HLA alleles can be found in
- HLA dictionary 2008 a summary of HLA-A, -B, -C, - DRB 1 /3/4/5, and DQB1 alleles and their association with serologically defined HLA-A, -B, - C, -DR, and -DQ antigens, Tissue Antigens 73:95-170, and a recent update by Marsh et al. (2010) Nomenclature for factors of the HLA system, 2010, Tissue Antigens 75:291 -455, both incorporated herein by reference.
- the human or humanized MHC II polypeptide may be derived from any functional human HLA molecules described therein.
- the human portions of the humanized MHC II complex described herein are derived from human HLA-DR, e.g., HLA-DR4.
- HLA-DR a chains are monomorphic, e.g., the a chain of HLA-DR complex is encoded by HLA-DRA gene (e.g., HLA-DR *01 gene).
- HLA-DR ⁇ chain is polymorphic.
- HLA-DR4 comprises an a chain encoded by HLA-DRA gene and a ⁇ chain encoded by HLA-DRB1 gene (e.g., ⁇ 1 *04 gene).
- HLA-DR4 is known to be associated with incidence of a number of autoimmune diseases, e.g., rheumatoid arthritis, type I diabetes, multiple sclerosis, etc.
- the HLA-DRA allele is HLA-DRcx*01 allele, e.g., HLA-DRa*01 :01 :01 :01 .
- the HLA-DRB allele is ⁇ _ ⁇ - ⁇ 1 * 04, e.g., HLA-DRpi *04:01 :01 .
- any suitable HLA- DR sequences are encompassed herein, e.g., polymorphic variants exhibited in human population, sequences with one or more conservative or non-conservative amino acid modifications, nucleic acid sequences differing from the sequences described herein due to the degeneracy of genetic code, etc.
- the human portions of the humanized MHC II complex may be encoded by nucleotide sequences of HLA alleles known to be associated with common human diseases.
- HLA alleles include, but are not limited to, HLA-DRB1 *0401 , -DRB1*0301 , - DQA1 *0501 , -DQB1*0201 , -DRB1 501 , -DRB1 *1502, -DQBT0602, -DQA1*0102, - DQA1*0201 , -DQB1 * 0202, -DQA1 *0501 , and combinations thereof.
- a non-human portion of the chimeric human/non-human MHC II complex comprises transmembrane and/or cytoplasmic domains of an endogenous non-human (e.g., rodent, e.g., mouse, rat, etc.) MHC II complex.
- a non-human portion of the chimeric human/non-human MHC II a polypeptide may comprise transmembrane and/or cytoplasmic domains of an endogenous non-human MHC II a polypeptide.
- a non-human portion of the chimeric human/non-human MHC II ⁇ polypeptide may comprise
- transmembrane and/or cytoplasmic domains of an endogenous non-human MHC II ⁇ polypeptide is an endogenous non-human MHC II ⁇ polypeptide.
- the animal is a mouse, and non-human portions of the chimeric a and ⁇ polypeptides are derived from a mouse H-2E protein.
- non-human portions of the chimeric a and ⁇ polypeptides may comprise transmembrane and cytoplasmic domains derived from a mouse H-2E protein.
- any suitable sequences e.g., polymorphic variants, conservative/non- conservative amino acid substitutions, etc., are encompassed herein.
- the sequence(s) encoding a chimeric human/non-human MHC II complex are located at an endogenous non-human MHC II locus (e.g., mouse H-2A and/or H-2E locus). In one embodiment, this results in a replacement of an endogenous MHC II gene(s) or a portion thereof with a nucleotide sequence(s) encoding a human or humanized MHC II protein, e.g., a chimeric gene encoding a chimeric human/non-human MHC II protein described herein.
- an endogenous MHC II locus e.g., mouse H-2A and/or H-2E locus
- the replacement comprises a replacement of an endogenous nucleotide sequence encoding an MHC II (x and ⁇ polypeptides with a nucleotide sequence encoding a chimeric human/non- human MHC a polypeptide and a chimeric human/non-human MHC ⁇ polypeptide.
- the replacement comprises replacing nucleotide sequences representing one or more (e.g., two) endogenous MHC II genes.
- the non-human animal contains a chimeric human/non-human nucleotide sequence at an endogenous MHC II locus, and expresses a chimeric human/non-human MHC II protein from the endogenous non-human locus.
- a non-human animal comprising at an endogenous MHC II gene locus a first nucleotide sequence encoding a chimeric human/non-human MHC II polypeptide and a second nucleotide sequence encoding a chimeric human/non-human MHC II ⁇ polypeptide, wherein a human portion of the chimeric human/non-human MHC II a polypeptide comprises a human MHC II a extracellular domain and a human portion of the chimeric human/non-human MHC II ⁇ polypeptide comprises a human MHC II ⁇ extracellular domain, and wherein the chimeric human/non-human MHC II a and MHC II ⁇ polypeptides form a functional MHC II complex on a surface of a cell.
- a chimeric human/non-human polypeptide may be such that it comprises a human or a non-human leader (signal) sequence.
- the chimeric M HC II a polypeptide comprises a non-human leader sequence of an endogenous MHC II a polypeptide.
- the chimeric MHC II ⁇ polypeptide comprises a non- human leader sequence of an endogenous MHC II ⁇ polypeptide.
- the chimeric MHC II and/or MHC II ⁇ polypeptide comprises a non-human leader sequence of MHC II a and/or MHC II ⁇ polypeptide, respectively, from another non- human animal, e.g., another rodent or another mouse strain.
- the nucleotide sequence encoding the chimeric MHC II a and/or MHC II ⁇ polypeptide may be operably linked to a nucleotide sequence encoding a non-human MHC II a and/or MHC II ⁇ leader sequence, respectively.
- the chimeric MHC II a and/or MHC II ⁇ polypeptide comprises a human leader sequence of human MHC II a and/or human MHC II ⁇
- polypeptide e.g., a leader sequence of human HLA-DRA and/or human HLA- DF ⁇ 1 *Q4, respectively.
- a chimeric human/non-human MHC II a and/or MHC II ⁇ polypeptide may comprise in its human portion a complete or substantially complete extracellular domain of a human MHC II a and/or human MHC II ⁇ polypeptide, respectively.
- a human portion may comprise at least 80% , preferably at least 85%, more preferably at least 90%, e.g., 95% or more of the amino acids encoding an extracellular domain of a human MHC II a and/or human MHC II ⁇ polypeptide (e.g., human HLA-DRA and/or human ⁇ _ ⁇ - ⁇ 1 *04).
- substantially complete extracellular domain of the human MHC II a and/or human MHC II ⁇ polypeptide lacks a human leader sequence.
- the chimeric human/non-human MHC II a and/or the chimeric human/non-human MHC II ⁇ polypeptide comprises a human leader sequence.
- the chimeric MHC II a and/or MHC I! ⁇ polypeptide may be expressed under the control of endogenous non-human promoter and regulatory elements, e.g., mouse MHC II a and/or MHC II ⁇ regulatory elements, respectively. Such arrangement will facilitate proper expression of the chimeric MHC II polypeptides in the non-human animal, e.g., during immune response in the non-human animal.
- the genetically modified non-human animal may be selected from a group consisting of a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey).
- bovine e.g., cow, bull, buffalo
- deer sheep
- goat chicken
- cat cat
- dog ferret
- primate e.g., marmoset, rhesus monkey
- Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo.
- a non-ES cell genome e.g., a fibroblast or an induced pluripotent cell
- a suitable cell e.g., an oocyte
- gestating the modified cell e.g., the modified oocyte
- the non-human animal is a mammal.
- the non- human animal is a small mammal, e.g., of the superfamily Dipodoidea or Muroidea.
- the genetically modified animal is a rodent.
- the rodent is selected from a mouse, a rat, and a hamster.
- the rodent is selected from the superfamily Muroidea.
- the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamster, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rates, bamboo rats, and zokors).
- Calomyscidae e.g., mouse-like hamsters
- Cricetidae e.g., hamster, New World rats and mice, voles
- Muridae true mice and rats, gerbils, spiny mice, crested rats
- Nesomyidae climbing mice, rock mice, with
- the genetically modified rodent is selected from a true mouse or rat (family Muridae), a gerbil, a spiny mouse, and a crested rat.
- the genetically modified mouse is from a member of the family Muridae.
- the animal is a rodent.
- the rodent is selected from a mouse and a rat.
- the non-human animal is a mouse.
- the non-human animal is a rodent that is a mouse of a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and
- the mouse is a 129 strain selected from the group consisting of a strain that is 129P1 , 129P2, 129P3, 129X1 , 129S1 (e.g., 129S1/SV, 129S1/Svlm), 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac), 129S7, 129S8, 129T1 , 129T2 (see, e.g., Festing et al.
- the genetically modified mouse is a mix of an aforementioned 129 strain and an aforementioned C57BL/6 strain.
- the mouse is a mix of aforementioned 129 strains, or a mix of aforementioned BL/6 strains.
- the 129 strain of the mix is a 129S6 (129/SvEvTac) strain.
- the mouse is a BALB strain, e.g., BALB/c strain.
- the mouse is a mix of a BALB strain and another aforementioned strain.
- the non-human animal is a rat.
- the rat is selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti.
- the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.
- the invention relates to a genetically modified mouse that comprises in its genome a nucleotide sequence encoding a chimeric human/mouse MHC II complex, e.g., chimeric human/mouse MHC II a and ⁇ polypeptides.
- a human portion of the chimeric human/mouse MHC II a polypeptide comprises a human MHC II a peptide binding or extracellular domain and a human portion of the chimeric human/mouse MHC II ⁇ polypeptide comprises a human MHC II ⁇ peptide binding or extracellular domain.
- the mouse does not express a peptide binding or an extracellular domain of endogenous mouse a and/or ⁇ polypeptide from an endogenous mouse locus (e.g., H-2A and/or H-2E locus).
- the mouse comprises a genome that lacks a gene that encodes a functional MHC class II molecule comprising an H-2Ab1 , H-2Aa, H-2Eb1 , H-2Eb2, H-2Ea, and a combination thereof.
- the peptide-binding domain of the human MHC II a polypeptide may comprise a1 domain and the peptide-binding domain of the human MHC II ⁇ polypeptide may comprise a ⁇ 1 domain; thus, the peptide-binding domain of the chimeric MHC II complex may comprise human 1 and ⁇ 1 domains.
- the extracellular domain of the human MHC II a polypeptide may comprise a1 and a2 domains and the extracellular domain of the human MHC II ⁇ polypeptide may comprise ⁇ 1 and ⁇ 2 domains; thus, the extracellular domain of the chimeric MHC II complex may comprise human ⁇ 1 , a2, ⁇ 1 and ⁇ 2 domains.
- the mouse portion of the chimeric MHC II complex comprises transmembrane and cytosolic domains of mouse MHC II, e.g. mouse H-2E (e.g., transmembrane and cytosolic domains of mouse H-2E a and ⁇ chains).
- mouse H-2E e.g., transmembrane and cytosolic domains of mouse H-2E a and ⁇ chains.
- a genetically modified mouse comprising at an endogenous mouse MHC II locus a first nucleotide sequence encoding a chimeric human/mouse MHC II a polypeptide and a second nucleotide sequence encoding a chimeric human/mouse MHC II ⁇ polypeptide, wherein a human portion of the chimeric MHC II a polypeptide comprises an extracellular domain derived from an a
- polypeptide of a human HLA-DR4 protein and the human portion of the chimeric MHC II ⁇ polypeptide comprises an extracellular domain derived from a ⁇ polypeptide of a human HLA-DR4 protein, wherein a mouse portion of the chimeric MHC II a polypeptide comprises transmembrane and cytoplasmic domains of a mouse H-2E a chain and a mouse portion of the chimeric MHC II ⁇ polypeptide comprises transmembrane and cytoplasmic domains of a mouse H-2E ⁇ chain, and wherein the mouse expresses a functional chimeric HLA-DR4/H- 2E MHC II complex.
- the chimeric HLA-DR4/H-2E MHC II complex comprises an MHC II chain that includes extracellular domains (e.g., ⁇ 1 , and a2 domains) derived from HLA-DR4 protein (HLA-DRA 1 , and a2 domains) and transmembrane and cytoplasmic domains from a mouse H-2E a chain, as well as an MHC II ⁇ chain that includes extracellular domains (e.g., ⁇ 1 and ⁇ 2 domains) derived from HLA-DR4 ( ⁇ _ ⁇ - ⁇ 1*04 ⁇ 1 and ⁇ 2 domains) and transmembrane and cytoplasmic domains from mouse H-2E ⁇ chain.
- extracellular domains e.g., ⁇ 1 , and a2 domains
- HLA-DRA 1 , and a2 domains HLA-DRA 1 , and a2 domains
- transmembrane and cytoplasmic domains from a mouse H-2E a chain
- the mouse does not express functional endogenous H-2A and H-2E polypeptides from their endogenous mouse loci (e.g., the mouse does not express H-2Ab1 , H-2Aa, H-2Eb1 , H-2Eb2, and H-2Ea polypeptides).
- expression of the first and second nucleotide sequences is under the control of respective endogenous mouse promoters and regulatory elements.
- the first and the second nucleotide sequences are located on the same chromosome.
- the mouse comprises two copies of the chimeric MHC II locus containing the first and the second nucleotide sequences, while in other aspects, the mouse comprises one copy of the MHC II locus containing the first and the second nucleotide sequences.
- the mouse may be homozygous or heterozygous for the chimeric MHC II locus containing the first and the second nucleotide sequences.
- the first and the second nucleotide sequences are comprises in the germline of the mouse.
- a mouse that comprises a chimeric MHC II locus at an endogenous mouse MHC II locus, e.g., via replacement of endogenous mouse H-2A and H-2E genes.
- the chimeric locus comprises a nucleotide sequence that encodes an extracellular domain of a human HLA-DRA and transmembrane and cytoplasmic domains of a mouse H-2E a chain, as well as an extracellular domain of a human HLA-DR(3 ⁇ 41 *04 and transmembrane and cytoplasmic domains of a mouse H-2E ⁇ chain.
- the various domains of the chimeric locus are linked in such a fashion that the locus expresses a functional chimeric human/mouse MHC II complex.
- a non-human animal e.g., a rodent, e.g., a mouse or rat
- a functional chimeric MHC II protein from a chimeric MHC II locus as described herein displays the chimeric protein on a cell surface.
- the non-human animal expresses the chimeric MHC II protein on a cell surface in a cellular distribution that is the same as observed in a human.
- the cell displays a peptide fragment (antigen fragment) bound to an extracellular portion (e.g., human HLA-DR4 extracellular portion) of the chimeric MHC II protein.
- a cell displaying the chimeric MHC II protein is an antigen-presenting cell (APC) e.g., a macrophage, a dendritic cell, or a B cell.
- APC antigen-presenting cell
- the peptide fragment presented by the chimeric protein is derived from a tumor.
- the peptide fragment presented by the chimeric MHC II protein is derived from a pathogen, e.g., a bacterium, a virus, or a parasite.
- the chimeric MHC II protein described herein may interact with other proteins on the surface of the same cell or a second cell.
- the chimeric MHC II protein interacts with endogenous non-human proteins on the surface of said cell.
- the chimeric MHC II protein may also interact with human or humanized proteins on the surface of the same cell or a second cell.
- the second cell is a T cell, and the chimeric MHC II protein interacts with T cell receptor (TCR) and its co-receptor CD4.
- T cell is an endogenous mouse T cell.
- the T cell is a human T cell.
- the TCR is a human or humanized TCR.
- the CD4 is a human or humanized CD4. In other embodiment, either one or both of TCR and CD4 are non-human, e.g., mouse or rat.
- a genetically modified non-human animal as described herein that does not develop tumors at a higher rate than a wild-type animal that lacks a chimeric MHC II gene.
- the animal does not develop hematological malignancies, e.g., various T and B cell lymphomas, leukemias, composite lymphomas (e.g., Hodgkin's lymphoma), at a higher rate than the wild-type animal.
- the embryo comprises a donor ES cell that is derived from a non-human animal (e.g., a rodent, e.g., a mouse or a rat) as described herein.
- the embryo comprises an ES donor cell that comprises the chimeric MHC II gene, and host embryo cells.
- tissue wherein the tissue is derived from a non-human animal (e.g., a rodent, e.g., a mouse or a rat) as described herein, and expresses the chimeric MHC II protein (e.g., HLA-DR4/H-2E protein).
- a non-human animal e.g., a rodent, e.g., a mouse or a rat
- the chimeric MHC II protein e.g., HLA-DR4/H-2E protein
- a non-human cell isolated from a non-human animal as described herein is provided.
- the cell is an ES cell.
- the cell is an antigen-presenting cell, e.g., dendritic cell, macrophage, B cell.
- the cell is an immune cell.
- the immune cell is a lymphocyte.
- non-human cell comprising a chromosome or fragment thereof of a non-human animal as described herein.
- the non-human cell comprises a nucleus of a non-human animal as described herein.
- the non-human cell comprises the chromosome or fragment thereof as the result of a nuclear transfer.
- a non-human induced pluripotent cell comprising gene encoding a chimeric MHC II protein (e.g., HLA-DR4/H-2E protein) as described herein is provided.
- the induced pluripotent cell is derived from a non-human animal as described herein.
- a hybridoma or quadroma is provided, derived from a cell of a non-human animal as described herein.
- the non-human animal is a mouse or rat.
- an in vitro preparation comprising a first cell that bears a chimeric human/rodent MHC II surface protein that comprises a bound peptide to form a chimeric human/rodent MHC ll/peptide complex, and a second cell that binds the chimeric human/rodent MHC ll/peptide complex.
- the second cell comprises a human or humanized T-cell receptor, and in one embodiment further comprises a human or humanized CD4.
- the second cell is a rodent (e.g., mouse or rat) cell comprising a human or humanized T-cell receptor and a human or humanized CD4 protein.
- the second cell is a human cell.
- a method for making a genetically engineered non-human animal e.g., a genetically engineered rodent, e.g., a mouse or rat
- the method for making a genetically engineered non-human animal results in the animal whose genome comprises a nucleotide sequence encoding a chimeric MHC II protein (e.g., chimeric MHC II a and ⁇ polypeptides).
- the method results in a genetically engineered mouse, whose genome comprises at an endogenous MHC II locus a nucleotide sequence encoding a chimeric human/mouse MHC II protein, wherein a human portion of the chimeric MHC II protein comprises an extracellular domain of a human HLA- DR4 and a mouse portion comprises transmembrane and cytoplasmic domains of a mouse H-2E.
- the method utilizes a targeting construct made using
- the ES cells are a mix of 129 and C57BL/6 mouse strains; in one embodiment, the ES cells are a mix of BALB/c and 129 mouse strains.
- a nucleotide construct used for generating genetically engineered non-human animals described herein comprises: 5' and 3' non-human homology arms, a DNA fragment comprising human HLA- DR a and ⁇ chain sequences, and a selection cassette flanked by recombination sites.
- the human HLA-DR a and ⁇ chain sequences are genomic sequences that comprise introns and exons of human HLA-DR a and ⁇ chain genes.
- the non-human homology arms are homologous to non-human MHC II genomic sequence.
- the human HLA-DR a chain sequence comprises an a1 and a2 domain coding sequence. In a specific embodiment, it comprises, from 5' to 3': a1 exon (exon 2), 1 /a2 intron (intron 2), and a2 exon (exon 3). In one embodiment, the human HLA-DR ⁇ chain sequence comprises a ⁇ 1 and ⁇ 2 domain coding sequence. In a specific embodiment, it comprises, from 5' to 3': ⁇ 1 exon (exon 2), ⁇ 1 / ⁇ 2 intron (intron 2), and ⁇ 2 exon (exon 3).
- a selection cassette is a nucleotide sequence inserted into a targeting construct to facilitate selection of cells (e.g., ES cells) that have integrated the construct of interest.
- cells e.g., ES cells
- a number of suitable selection cassettes are known in the art. Commonly, a selection cassette enables positive selection in the presence of a particular antibiotic (e.g., Neo, Hyg, Pur, CM, SPEC, etc.).
- a selection cassette may be flanked by recombination sites, which allow deletion of the selection cassette upon treatment with recombinase enzymes.
- a selection cassette may be located anywhere in the construct outside the coding region. In one embodiment, the selection cassette is located in the ⁇ chain intron, e.g., domain intron (intron 3).
- 5' and 3' homology arms comprise genomic sequence at 5' and 3' locations of endogenous non-human MHC II locus. In one embodiment, the 5' homology arm comprises genomic sequence upstream of mouse H-2Ab1 gene and the 3' homology arm comprises genomic sequence downstream of mouse H-2Ea gene. In this embodiment, the construct allows replacement of both mouse H-2E and H-2A genes.
- a nucleotide construct comprising, from 5' to 3': a 5' homology arm containing mouse genomic sequence upstream of mouse H-2Ab1 gene, a first nucleotide sequence comprising a sequence encoding a chimeric human/mouse MHC II ⁇ chain, a second nucleotide sequence comprising a sequence encoding a chimeric human/mouse MHC II a chain, and a 3' homology arm containing mouse genomic sequence downstream of mouse H-2Ea gene.
- the first nucleotide sequence comprising a sequence encoding a chimeric human/mouse MHC II ⁇ chain comprises human ⁇ 1 exon, ⁇ 1 / ⁇ 2 intron, ⁇ 2 exon, an a selection cassette flanked by recombination sites inserted in the intronic region between the human ⁇ 2 exon sequence and the sequence of a mouse transmembrane domain exon.
- the second nucleotide sequence comprising a sequence encoding a chimeric human/mouse MHC II a chain comprises human a1 exon, a1 /a2 intron, and human a2 exon.
- An exemplary construct of the invention is depicted in FIG. 5 (MAID 1680).
- ES cells or genetically modified non-human animals are screened to confirm successful incorporation of exogenous nucleotide sequence of interest or expression of exogenous polypeptide.
- Numerous techniques are known to those skilled in the art, and include (but are not limited to) Southern blotting, long PGR, quantitative PCT (e.g., real-time PGR using TAQMAN®), fluorescence in situ hybridization, Northern blotting, flow cytometry, Western analysis, immunocytochemistry,
- non-human animals e.g., mice bearing the genetic modification of interest
- non-human animals e.g., mice bearing the genetic modification of interest
- the disclosure also provides a method of modifying an MHC II locus of a non- human animal to express a chimeric human/non-human MHC II complex described herein.
- the invention provides a method of modifying an MHC II locus of a mouse to express a chimeric human/mouse MHC II complex comprising replacing at the endogenous mouse MHC !l locus a nucleotide sequence encoding a mouse MHC II complex with a nucleotide sequence encoding a chimeric human/mouse MHC II complex.
- the nucleotide sequence encoding the chimeric human/mouse MHC II complex comprises a first nucleotide sequences encoding an extracellular domain of a human MHC II a chain (e.g., HLA-DR4 a chain) and transmembrane and cytoplasmic domains of a mouse MHC II a chain (e.g., H-2E chain) and a second nucleotide sequence encoding an extracellular domain of a human MHC II ⁇ chain (e.g., HLA-DR4 ⁇ chain) and transmembrane and cytoplasmic domains of a mouse MHC II ⁇ chain (e.g., H-2E ⁇ chain, e.g., H-2Eb1 chain).
- the modified mouse MHC II locus expresses a chimeric HLA-DR4/H-2E protein.
- a method for making a chimeric human HLA class ll/non-human MHC class II molecule comprising expressing in a single cell a chimeric HLA- DR4/H-2E protein from a nucleotide construct as described herein.
- the nucleotide construct is a viral vector; in a specific embodiment, the viral vector is a lentiviral vector.
- the cell is selected from a CHO, COS, 293, HeLa, and a retinal cell expressing a viral nucleic acid sequence (e.g., a PERC.6TM cell).
- a cell that expresses a chimeric HLA-DR4/H-2E protein comprises an expression vector comprising a chimeric MHC class II sequence as described herein.
- the cell is selected from CHO, COS, 293, HeLa, and a retinal cell expressing a viral nucleic acid sequence (e.g., a PERC.6TM cell).
- a chimeric MHC class II molecule made by a non-human animal as described herein is also provided, wherein the chimeric MHC class II molecule comprises 1 , «2, ⁇ 1 , and ⁇ 2 domains from a human MHC II protein, e.g., HLA-DR4 protein, and transmembrane and cytoplasmic domains from a non-human MHC II protein, e.g., mouse H-2E protein.
- the chimeric MHC II complex comprising an extracellular domain of HLA-DR4 described herein maybe detected by anti-HLA-DR antibodies.
- a cell displaying chimeric human/non- human MHC II polypeptide may be detected and/or selected using anti-HLA-DR antibody.
- an additional embodiment of the invention is directed to a genetically engineered animal whose genome comprises a nucleotide sequence encoding a chimeric HLA-DQ/H-2A protein.
- the nucleotide sequence encodes a chimeric HLA-DQ2.5/H-2A protein. In another embodiment, the nucleotide sequence encodes a chimeric HLA-DQ8/H- 2A protein.
- introduction of multiple humanized MHC II molecules e.g., chimeric HLA-DR/H-2E and HLA-DQ/H-2A is also contemplated.
- the genetically modified non-human animals described herein make APCs with human or humanized MHC II on the cell surface and, as a result, present peptides derived from cytosolic proteins as epitopes for T cells in a human-like manner, because substantially all of the components of the complex are human or humanized.
- the genetically modified non-human animals of the invention can be used to study the function of a human immune system in the humanized animal; for identification of antigens and antigen epitopes that elicit immune response (e.g., T cell epitopes, e.g., unique human cancer epitopes), e.g., for use in vaccine development; for evaluation of vaccine candidates and other vaccine strategies; for studying human autoimmunity; for studying human infectious diseases; and otherwise for devising better therapeutic strategies based on human MHC expression.
- T cell epitopes e.g., unique human cancer epitopes
- MHC II complex binds peptides derived from extracellular proteins, e.g., extracellular bacterium, neighboring cells, or polypeptides bound by B cell receptors and internalized into a B cell. Once extracellular proteins enter endocytic pathway, they are degraded into peptides, and peptides are bound and presented by MHC II. Once a peptide presented by MHC II is recognized by CD4+ T cells, T cells are activated, proliferate, differentiate to various T helper subtypes (e.g., T H 1 , T H 2), and lead to a number of events including activation of macrophage-mediated pathogen killing, B cell proliferation, and antibody production.
- T helper subtypes e.g., T H 1 , T H 2
- MHC II Because of MHC II role in immune response, understanding of MHC II peptide presentation is important in the development of treatment for human pathologies.
- presentation of antigens in the context of mouse MHC II is only somewhat relevant to human disease, since human and mouse MHC complexes recognize antigens differently, e.g., a mouse MHC II may not recognize the same antigens or may present different epitopes than a human MHC II.
- the most relevant data for human pathologies is obtained through studying the presentation of antigen epitopes by human MHC II.
- the genetically engineered animals of the present invention are useful, among other things, for evaluating the capacity of an antigen to initiate an immune response in a human, and for generating a diversity of antigens and identifying a specific antigen that may be used in human vaccine development.
- a method for determining antigenicity in a human of a peptide sequence comprising exposing a genetically modified non-human animal as described herein to a molecule comprising the peptide sequence, allowing the non-human animal to mount an immune response, and detecting in the non-human animal a cell that binds a sequence of the peptide presented by a humanized MHC II complex described herein.
- a method for determining whether a peptide will provoke an immune response in a human comprising exposing a genetically modified non- human animal as described herein to the peptide, allowing the non-human animal to mount an immune response, and detecting in the non-human animal a cell that binds a sequence of the peptide by a chimeric human/non-human MHC class II molecule as described herein.
- the non-human animal following exposure comprises an MHC class II- restricted CD4+ T cell that binds the peptide.
- a method for identifying a human CD4+ T cell epitope comprising exposing a non-human animal as described herein to an antigen comprising a putative T cell epitope, allowing the non-human animal to mount an immune response, and identifying the epitope bound by the MHC class ll-restricted CD4+ T cell.
- a method for identifying an antigen that generates a CD4+ T cell response in a human comprising exposing a putative antigen to a mouse as described herein, allowing the mouse to generate an immune response, detecting a CD4+ T cell response that is specific for the antigen in the context of a human MHC II molecule (e.g., an HLA-DR molecule), and identifying the antigen bound by the human MHC ll-restricted molecule (e.g., human HLA-DR restricted molecule).
- a human MHC II molecule e.g., an HLA-DR molecule
- identifying the antigen bound by the human MHC ll-restricted molecule e.g., human HLA-DR restricted molecule.
- the antigen comprises a bacterial protein. In one embodiment, the antigen comprises a bacterial protein.
- the antigen comprises a human tumor cell antigen. In one embodiment, the antigen comprises a putative vaccine for use in a human, or another biopharmaceutical. In one embodiment, the antigen comprises a human epitope that generates antibodies in a human. In yet another embodiment, an antigen comprises a yeast or fungal cell antigen. In yet another embodiment, an antigen is derived from a human parasite.
- a method for determining whether a putative antigen contains an epitope that upon exposure to a human immune system will generate an HLA- DR-restricted immune response (e.g., HLA-DR4-restricted response), comprising exposing a mouse as described herein to the putative antigen and measuring an antigen-specific HLA- DR-restricted (e.g., HLA-DR4-restricted) immune response in the mouse.
- a method is provided for determining wherein a putative antigen contains an epitope that upon exposure to a human immune system will generate an HLA-DQ-restricted response.
- an antigen e.g., an antigen derived from bacterium, parasite, etc.
- the immune response comprises antibody production, and isolating an antibody that recognizes the antigen presented in the context of human MHC II complex.
- the MHC II humanized mouse is immunized with a peptide-MHC II immunogen.
- a method for identifying a T cell receptor variable domain that recognizes an antigen presented in the context of MHC II comprising exposing a mouse comprising a humanized MHC II complex described herein to the antigen, allowing the mouse to generate an immune response, and isolating from the mouse a nucleic acid sequence encoding a variable domain of a T cell receptor that binds MHC ll-restricted antigen.
- the antigen is presented in the context of a humanized MHC II (e.g., human HLA II ectodomain/mouse MHC II transmembrane and/or cytoplasmic domain).
- transmembrane and/or cytoplasmic domain can be measured by a number of techniques known in the art, e.g., T cell proliferation assays, cytokine release assays, etc.
- the genetically modified animals of the invention can be used to identify autoantigens of relevance to human autoimmune disease, and otherwise study human autoimmune disease progression. It is known that polymorphisms within the HLA loci play a role in predisposition to human autoimmune disease. In fact, specific
- HLA-DR and HLA-DQ loci have been identified that correlate with development of rheumatoid arthritis, type I diabetes, Hashimoto's thyroiditis, multiple sclerosis, myasthenia gravis, Graves' disease, systemic lupus erythematosus, celiac disease, Crohn's disease, ulcerative colitis, and other autoimmune disorders. See, e.g., Wong and Wen (2004) What can the HLA transgenic mouse tell us about autoimmune diabetes?, Diabetologia 47:1476-87; Taneja and David (1998) HLA Transgenic Mice as Humanized Mouse Models of Disease and Immunity, J. Clin. Invest.
- the methods of making a humanized MHC II complex animals described herein can be used to introduce MHC II molecules thought to be associated with specific human autoimmune diseases, and progression of human autoimmune disease can be studied.
- non-human animals described herein can be used to develop animal models of human autoimmune disease.
- Mice according to the invention carrying humanized MHC II proteins described herein can be used to identify potential autoantigens, to map epitopes involved in disease progression, and to design strategies for autoimmune disease modulation.
- genetically modified animals described herein may be used in the study of human allergic response. As allergic responses appear to be associated with MHC II alleles, genetically modified animals described herein may be used to determine HLA restriction of allergen specific T cell response and to develop strategies to combat allergic response.
- the targeting vector for introducing a deletion of the endogenous MHC class II H- 2Ab1 , H-2Aa, H-2Eb1 , H-2Eb2, and H-2Ea genes was made using VELOCIGENE® genetic engineering technology (see, e.g., US Pat. No. 6,586,251 and Valenzuela et al., supra). Bacterial Artificial Chromosome (BAC) RP23-458i22 (Invitrogen) DNA was modified to delete the endogenous MHC class II genes H-2Ab1 , H-2Aa, H-2EM , H-2Eb2, and H-2Ea.
- BAC Bacterial Artificial Chromosome
- upstream and downstream homology arms were derived by PCR of mouse BAC DNA from locations 5' of the H-2Ab1 gene and 3' of the H-2Ea gene, respectively. As depicted in FIG. 5, these homology arms were used to make a cassette that deleted -79 kb of RP23-458i22 comprising genes H-2Ab1 , H-2Aa, H-2EM , H-2Eb2, and H-2Ea of the MHC class II locus by bacterial homologous recombination (BHR). This region was replaced with a hygromycin cassette flanked by lox66 and lox71 sites.
- the final targeting vector from 5' to 3' included a 34 kb homology arm comprising mouse genomic sequence 5' to the H-2Ab1 gene of the endogenous MHC class II locus, a 5' lox66 site, a hygromycin cassette, a 3' lox71 site and a 63 kb homology arm comprising mouse genomic sequence 3' to the H-2Ea gene of the endogenous MHC class II locus (MAID 51 1 1 , see FIG. 5).
- the BAC DNA targeting vector (described above) was used to electroporate mouse ES cells to create modified ES cells comprising a deletion of the endogenous MHC class II locus. Positive ES cells containing a deleted endogenous MHC class II locus were identified by the quantitative PCR assay using TAQMANTM probes (Lie and Petropoulos (1998) Curr. Opin. Biotechnology 9:43-48). The upstream region of the deleted locus was confirmed by PCR using primers 51 1 1 U F (CAGAACGCCAGGCTGTAAC; SEQ ID NO:1 ) and 51 1 1 U R (GGAGAGCAGGGTCAGTCAAC; SEQ ID NO:2) and probe 51 1 1 U P
- TGCGGCCGATCTTAGCC SEQ ID NO:7
- HYGR TGACCGATTCCTTGCGG; SEQ ID NO:8
- probe HYGP ACGAGCGGGTTCGGCCCATTC; SEQ ID NO:9
- the nucleotide sequence across the upstream deletion point included the following, which indicates endogenous mouse sequence upstream of the deletion point (contained within the parentheses below) linked contiguously to cassette sequence present at the deletion point: (TTTGTAAACA AAGTCTACCC AGAGACAGAT GACAGACTTC AGCTCCAATG CTGATTGGTT CCTCACTTGG GACCAACCCT) CTCGAGTACC
- nucleotide sequence across the downstream deletion point included the following, which indicates cassette sequence contiguous with endogenous mouse sequence downstream of the deletion point (contained within the parentheses below): CCTCGACCTG CAGCCCTAGG ATAACTTCGT ATAATGTATG CTATACGAAC GGTAGAGCTC
- Targeted ES cells described above were used as donor ES cells and introduced into an 8-cell stage mouse embryo by the VELOCIMOUSE® method (see, e.g., US Pat. No. 7,294,754 and Poueymirou et al. (2007) FO generation mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyses, Nature Biotech. 25(1 ):91-99).
- mice bearing a deletion of H-2Ab1 , H-2Aa, H-2Eb1 , H-2Eb2, and H- 2Ea genes in the endogenous MHC class II locus were identified by genotyping using a modification of allele assay (Valenzuela et al., supra) that detected the presence of the hygromycin cassette and confirmed the absence of endogenous MHC class II sequences.
- mice bearing a deletion of H-2Ab1 , H-2Aa, H-2Eb1 , H-2Eb2, and H-2Ea genes in the endogenous MHC class II locus can be bred to a Cre deletor mouse strain (see, e.g., International Patent Application Publication No. WO 2009/1 14400) in order to remove any loxed hygromycin cassette introduced by the targeting vector that is not removed, e.g., at the ES cell stage or in the embryo.
- the hygromycin cassette is retained in the mice.
- a targeting vector to introduce humanized MHC II sequences was designed as depicted in FIG. 4.
- Bacterial Artificial Chromosome (BAC) RP23-458i22 DNA was modified in various steps to: (1 ) create a vector comprising a functional l-E a exon 1 from BALB/c H-2Ea gene (FIG. 4A); (2) create a vector comprising replacement of exons 2 and 3 of mouse l-E ⁇ gene with those of human DRpi *04 and replacement of exons 2 and 3 of mouse l-E a with those of human DRa1*01 (FIGs.
- a vector comprising a functional l-E a exon 1 from BALB/c H-2Ea gene was created (FIG. 4A).
- RP23-458i22 BAC was modified by bacterial homologous recombination (1.BHR) to replace chloramphenicol resistance gene with that of spectromycin.
- the resultant vector was further modified by BHR to replace the entire l-A and l-E coding region with a neomycin cassette flanked by recombination sites (2. BHR).
- Another round of BHR (3.
- BHR with the construct comprising an exon encoding BALB/c l-E leader (exon 1) and chloramphenicol gene flanked by Pl-Scel and l-Ceul restriction sites resulted in a vector comprising a functional BALB/c H-2Ea exon .
- RP23-458i22 BAC was modified via several homologous recombination steps, 4. BHR - 8. BHR (FIG. 4B).
- the resultant nucleic acid sequence was flanked by Pl-Scel/I-Ceul restriction sites to allow ligation into the construct carrying BALB/c l-Ea exon 1 , mentioned above (FIG. 4C).
- the sequence of the final construct depicted in FIG. 4C contained a cryptic splice site at the 3' end of the BALB/c intron.
- Several BHR steps (1 1. BHR - 12. BHR) followed by a deletion step were performed to obtain the final targeting vector (MAID 1680) that was used to electroporate into ES cells (FIG. 4D).
- the final targeting vector (MAID 1680), from 5' to 3', was comprised of a 5' mouse homology arm consisting of ⁇ 26 kb of mouse genomic sequence ending just upstream of the H-2Ab1 gene of the endogenous MHC class II locus; an ⁇ 59 kb insert containing the humanized MHC II ⁇ chain gene (humanized H-2Eb1 gene) and humanized MHC II a chain gene (humanized H-2Ea gene) and a floxed neomycin cassette; and a 3' mouse homology arm consisting of ⁇ 57 kb of mouse genomic sequence beginning just downstream of the H-2Ea gene of the endogenous MHC class II locus.
- the nucleotide sequence across the junction between the 5' arm and the insert included the following: (TGCTGATTGG TTCCTCACTT GGGACCAACC C) TAAGCTTT/A
- the nucleotide sequence across the junction between the insert and the 3' arm included the following: CACATCAGTG AGGCTAGAAT AAATTAAAAT CGCTAATATG AAAATGGGG (ATTTGTACCT CTGAGTGTGA AGGCTGGGAA GACTGCTTTC AAGGGAC), where the mouse genomic sequence in the 3' homology arm is in parentheses.
- the H-2Eb1 gene was modified as follows: a 5136 bp region of H-2Eb1 , including the last 153 bp of intronl , exon 2, intron 2, exon 3, and the first 122 bp of intron 3, was replaced with the 31 1 1 bp homologous region of human HLA- DRB1*04, including the last 148 bp of intron 1 , exon 2, intron 2, exon 3, and the first 132 bp of intron 3.
- a cassette consisting of a 5' lox2372 site, UbC promoter, neomycin resistance gene, and a 3' lox2372 site, was inserted.
- the resulting gene encoded a chimeric HLA-DRB1 * 04/H-2Eb1 protein comprised of the mouse H-2Eb1 leader, the human ⁇ 1 and ⁇ 2 domains from DRB1 *04, and the mouse transmembrane domain and cytoplasmic tail.
- the nucleotide sequence across the mouse/human junction in intron 1 included the following:
- AAGTTATAJG CATGGCCTCC GCGCCGGGTT where the 5' lox2372 site is italicized, and human intron 3 sequence is in parentheses.
- the nucleotide sequence across the junction between the neomycin cassette and mouse intron 3 included the following: ATAACTTCGT ATAAGGTATC CTATACGAAG TTATCJCGAG (TGGCTTACAG
- H-2Ea gene was modified as follows: a 1 185 bp region of H-2Ea, including the last 101 bp of introni , exon 2, intron 2, exon 3, and the first 66 bp of intron 3, was replaced with the 1 189 bp homologous region of human HLA-DRA1 *01 , including the last 104 bp of intron 1 , exon 2, intron 2, exon 3, and the first 66 bp of intron 3.
- H-2Ea exon 1 and the remainder of intron 1 were replaced with the equivalent 2616 bp region from the BALB/c allele of H-2Ea, which is functional.
- the resulting gene encoded a chimeric H-2Ea/HLA-DRA1 * 01 protein comprised of the mouse H-2Ea leader from BALB/c, the human a1 and o2 domains from DRA1 * 01 , and the mouse transmembrane domain and cytoplasmic tail.
- the nucleotide sequence across the mouse/human junction in intron 1 included the following:
- CTGTTTCTTC CCTAACTCCC ATTCTATGCT CTTCCATCCC GA CCGCGGCCCA ATCTCTCTCC ACTACTTCCT GCCTACATGT ATGTAGGT, where the italicized sequence is a restriction enzyme site introduced during the cloning steps, and the BALB/c intron 1 sequences are in parentheses.
- the nucleotide sequence across the human/mouse junction in intron 3 included the following: CAAGGTTTCC TCCTATGATG
- CTTGTGTGAA ACTCGGGGCC GGCC (AGCATTTAAC AGTACAGGGA TGGGAGCACA GCTCAC), where the italicized sequence is a restriction enzyme site introduced during the cloning steps, and the mouse intron 3 sequences are in parentheses.
- the nucleotide sequence across the C57BL/6-BALB/C junction 5' of exon 1 included the following: (GAAAGCAGTC TTCCCAGCCT TCACACTCAG AGGTACAAAT) CCCCATTTTC ATATTAGCGA TTTTAATTTA TTCTAGCCTC, where the C57BL/6-specific sequences are in parentheses.
- the nucleotide sequence across the BALB/C-C57BL/6 junction 3' of exon 1 included the following: TCTTCCCTAA CTCCCATTCT ATGCTCTTCC ATCCCGA CCG CGG (CCCAATC TCTCTCCACT ACTTCCTGCC TACATGTATG), where Sacll restriction site is italicized, and C57BL/6 sequences are in parenthesis.
- MAID1680 BAC DNA (described above) was used to electroporate MAID51 1 1 ES cells to create modified ES cells comprising a replacement of the
- TGCGGCCGATCTTAGCC SEQ ID NO:7
- HYGR TGACCGATTCCTTGCGG; SEQ ID NO:8
- probe HYGP ACGAGCGGGTTCGGCCCATTC; SEQ ID NO:9
- VELOCIMOUSE® method to generate a litter of pups containing a replacement of the endogenous l-A and l-E loci with a chimeric human DR4/mouse l-E locus.
- Targeted ES cells described above were used as donor ES cells and introduced into an 8-cell stage mouse embryo by the VELOCIMOUSE® method. Mice bearing a chimeric human
- DR4/mouse l-E locus were identified by genotyping using a modification of allele assay (Valenzuela et a!., supra) that detected the presence of a chimeric human DR4/mouse l-E locus.
- mice bearing a chimeric human DR4/mouse l-E locus can be bred to a Cre deletor mouse strain (see, e.g., International Patent Application Publication No. WO 2011/001100600A1600A1600A1600A1600A1600A1600A1600A1600A1600A1600A1600A1600A1600A1600A1600A1600A1600A1600, a Cre deletor mouse strain (see, e.g., International Patent Application Publication No. WO
- Spleens from WT or heterozygous humanized HLA-DR4 mice (“1681 HET”) were perfused with Collagenase D (Roche Bioscience) and erythrocytes were lysed with ACK lysis buffer. Splenocytes were cultured for two days with 25 micrograms/mL poly(l:C) to stimulate the expression of MHC-II genes.
- Cell surface expression of human HLA-DR4 was analyzed by FACS using fluorochrome-conjugated anti-CD3 (17A2), anti-CD19 (1 D3), anti- CD1 1 c (N418), anti-F480 (BM8), anti-l-A/l-E (M15) and anti-HLADR (L243). Flow cytometry was performed using BD-LSRII. Expression of human HLA-DR4 was clearly detectable on the surface of CD19+ B cells and was significantly upregulated upon stimulation by toil-like receptor agonist poly(l:C) (see FIG. 9).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Environmental Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biodiversity & Conservation Biology (AREA)
- Animal Husbandry (AREA)
- Animal Behavior & Ethology (AREA)
- Biophysics (AREA)
- Veterinary Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (35)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RS20170897A RS56330B1 (sr) | 2011-10-28 | 2012-10-26 | Genetski modifikovani miševi sa ekspresijom himernih molekula klase ii glavnog kompleksa histokompatibilnosti (mhc) |
| MX2017013492A MX379060B (es) | 2011-10-28 | 2012-10-26 | Ratones transgenicos que expresan moleculas quimericas del complejo mayor de histocompatibilidad (cmh) clase ii. |
| PL17171524T PL3272214T3 (pl) | 2011-10-28 | 2012-10-26 | Genetycznie zmodyfikowane cząsteczki, w których zachodzi ekspresja chimerycznego głównego układu zgodności tkankowej (MHC) II myszy |
| NZ623146A NZ623146B2 (en) | 2011-10-28 | 2012-10-26 | Transgenic mice expressing chimeric major histocompatibility complex (mhc) class ii molecules |
| EP12806199.1A EP2770822B9 (en) | 2011-10-28 | 2012-10-26 | Genetically modified mice expressing chimeric major histocompatibility complex (mhc) ii molecules |
| SM20170437T SMT201700437T1 (it) | 2011-10-28 | 2012-10-26 | Topi geneticamente modificati esprimenti molecole del complesso maggiore di istocompatibilità (mhc) ii chimeriche |
| CN201280065075.7A CN104039133B (zh) | 2011-10-28 | 2012-10-26 | 表达嵌合主要组织相容性复合物(mhc)ii类分子的基因修饰小鼠 |
| BR112014009941-3A BR112014009941B1 (pt) | 2011-10-28 | 2012-10-26 | Métodos para produzir uma célula tronco embrionária (es) de roedor geneticamente modificada |
| AU2012327205A AU2012327205B2 (en) | 2011-10-28 | 2012-10-26 | Genetically modified major histocompatibility complex mice |
| PL19189533T PL3590332T3 (pl) | 2011-10-28 | 2012-10-26 | Genetycznie zmodyfikowane myszy eksprymujące chimeryczne cząsteczki głównego układu zgodności tkankowej (MHC) II |
| RU2014116577A RU2660564C2 (ru) | 2011-10-28 | 2012-10-26 | Генетически модифицированные мыши, экспрессирующие химерные молекулы главного комплекса гистосовместимости |
| LTEP12806199.1T LT2770822T (lt) | 2011-10-28 | 2012-10-26 | Genetiškai modifikuotos pelės, kuriose vyksta chimerinio didžiojo audinių suderinamumo komplekso (mhc) ii molekulių raiška |
| KR1020187034955A KR102113108B1 (ko) | 2011-10-28 | 2012-10-26 | 키메라 주요 조직적합성 복합체 (mhc) 제ii부류 분자들을 발현하는 유전자전이 마우스 |
| EP19189533.3A EP3590332B1 (en) | 2011-10-28 | 2012-10-26 | Genetically modified mice expressing chimeric major histocompatibility complex (mhc) ii molecules |
| IN3892CHN2014 IN2014CN03892A (https=) | 2011-10-28 | 2012-10-26 | |
| JP2014539027A JP6285361B2 (ja) | 2011-10-28 | 2012-10-26 | キメラ主要組織適合複合体(mhc)ii分子を発現する遺伝子改変されたマウス |
| HRP20171327TT HRP20171327T1 (hr) | 2011-10-28 | 2012-10-26 | Genetski modificirani miševi s ekspresijom kimernih molekula s glavnim sustavom tkivne podudarnosti (mhc) skupine ii |
| ES12806199.1T ES2640241T3 (es) | 2011-10-28 | 2012-10-26 | Ratones modificados genéticamente que expresan moléculas quiméricas del complejo de histocompatibilidad mayor (MHC) de clase II |
| SI201231056T SI2770822T1 (sl) | 2011-10-28 | 2012-10-26 | Gensko spremenjene miši, ki izražajo molekule himernega poglavitnega histokompatibilnega kompleksa (mhc) ii |
| KR1020147014315A KR101926442B1 (ko) | 2011-10-28 | 2012-10-26 | 키메라 주요 조직적합성 복합체 (mhc) ii 분자들을 발현하는 유전자 변형된 마우스 |
| HK14110588.1A HK1196999B (en) | 2011-10-28 | 2012-10-26 | Genetically modified mice expressing chimeric major histocompatibility complex (mhc) ii molecules |
| DK12806199.1T DK2770822T3 (en) | 2011-10-28 | 2012-10-26 | GENETICALLY MODIFIED MICE EXPRESSING CHEMICAL MAJOR HISTOCOMPATIBILITY COMPLEX (MHC) -II MOLECULES |
| EP22152099.2A EP4052572B8 (en) | 2011-10-28 | 2012-10-26 | Genetically modified mice expressing chimeric major histocompatibility complex (mhc) ii molecules |
| SG11201400938UA SG11201400938UA (en) | 2011-10-28 | 2012-10-26 | Transgenic mice expressing chimeric major histocompatibility complex (mhc) class ii molecules |
| CA2852962A CA2852962C (en) | 2011-10-28 | 2012-10-26 | Genetically modified mice expressing chimeric major histocompatibility complex (mhc) ii molecules |
| MX2014004896A MX355726B (es) | 2011-10-28 | 2012-10-26 | Ratones transgenicos que expresan moleculas quimericas del complejo mayor de histocompatibilidad (cmh) clase ii. |
| EP17171524.6A EP3272214B1 (en) | 2011-10-28 | 2012-10-26 | Genetically modified mice expressing chimeric major histocompatibility complex (mhc) ii molecules |
| IL231895A IL231895B (en) | 2011-10-28 | 2014-04-03 | Transgenic mice expressing chimeric mhc type ii molecules |
| IL243565A IL243565A (en) | 2011-10-28 | 2016-01-11 | Genetically matched mice expressing type II molecules of chimeric mhc |
| AU2016202317A AU2016202317B2 (en) | 2011-10-28 | 2016-04-13 | Genetically Modified Major Histocompatibility Complex Mice |
| CY20171100934T CY1119283T1 (el) | 2011-10-28 | 2017-09-05 | Γενετικα τροποποιημενοι ποντικοι εκφραζοντες χιμαιρικα μορια μειζονος συμπλεγματος ιστοσυμβατοτητας (mhc) ii |
| AU2018201402A AU2018201402C1 (en) | 2011-10-28 | 2018-02-27 | Genetically Modified Major Histocompatibility Complex Mice |
| IL260209A IL260209B (en) | 2011-10-28 | 2018-06-21 | (major histocompatibility complex) mice with genetically modified tissue compatible complex |
| CY20201100178T CY1122700T1 (el) | 2011-10-28 | 2020-02-26 | Γενετικα τροποποιημενοι ποντικοι εκφραζοντες χιμαιρικα μορια μειζονος συμπλεγματος ιστοσυμβατοτητας (μηc) ii |
| AU2021200438A AU2021200438B2 (en) | 2011-10-28 | 2021-01-22 | Genetically Modified Major Histocompatibility Complex Mice |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161552584P | 2011-10-28 | 2011-10-28 | |
| US61/552,584 | 2011-10-28 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013063340A1 true WO2013063340A1 (en) | 2013-05-02 |
Family
ID=47430036
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/062029 Ceased WO2013063340A1 (en) | 2011-10-28 | 2012-10-26 | Transgenic mice expressing chimeric major histocompatibility complex (mhc) class ii molecules |
Country Status (25)
| Country | Link |
|---|---|
| US (7) | US8847005B2 (https=) |
| EP (4) | EP3590332B1 (https=) |
| JP (2) | JP6285361B2 (https=) |
| KR (2) | KR101926442B1 (https=) |
| CN (3) | CN108707608A (https=) |
| AU (4) | AU2012327205B2 (https=) |
| BR (1) | BR112014009941B1 (https=) |
| CA (1) | CA2852962C (https=) |
| CY (3) | CY1119283T1 (https=) |
| DK (3) | DK3590332T3 (https=) |
| ES (4) | ES3058981T3 (https=) |
| HR (3) | HRP20220616T1 (https=) |
| HU (2) | HUE048511T2 (https=) |
| IL (3) | IL231895B (https=) |
| IN (1) | IN2014CN03892A (https=) |
| LT (3) | LT3272214T (https=) |
| MX (2) | MX379060B (https=) |
| PL (3) | PL2770822T3 (https=) |
| PT (3) | PT3590332T (https=) |
| RS (3) | RS63220B1 (https=) |
| RU (1) | RU2660564C2 (https=) |
| SG (3) | SG11201400938UA (https=) |
| SI (3) | SI3272214T1 (https=) |
| SM (3) | SMT201700437T1 (https=) |
| WO (1) | WO2013063340A1 (https=) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014164638A1 (en) * | 2013-03-11 | 2014-10-09 | Regeneron Pharmaceuticals, Inc. | Transgenic mice expressing chimeric major histocompatibility comples (mhc) class ii molecules |
| US9585373B2 (en) | 2011-10-28 | 2017-03-07 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex mice |
| US9700025B2 (en) | 2011-10-28 | 2017-07-11 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex animals |
| US9848587B2 (en) | 2013-02-20 | 2017-12-26 | Regeneron Pharmaceuticals, Inc. | Humanized T cell co-receptor mice |
| US10154658B2 (en) | 2013-02-22 | 2018-12-18 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex mice |
| US10314296B2 (en) | 2013-02-22 | 2019-06-11 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex mice |
| JP2021094035A (ja) * | 2014-06-19 | 2021-06-24 | リジェネロン・ファーマシューティカルズ・インコーポレイテッドRegeneron Pharmaceuticals, Inc. | ヒト化プログラム細胞死1遺伝子を持つ非ヒト動物 |
| US11259510B2 (en) | 2015-04-06 | 2022-03-01 | Regeneron Pharmaceuticals, Inc. | Humanized T cell mediated immune responses in non-human animals |
| US12376573B2 (en) | 2021-03-31 | 2025-08-05 | Regeneron Pharmaceuticals, Inc. | Genetically modified mice comprising humanized cellular immune system components with improved diversity of TCRB repertoire |
| WO2025212991A1 (en) | 2024-04-05 | 2025-10-09 | Regeneron Pharmaceuticals, Inc. | Rodent models of disease |
Families Citing this family (34)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008054865A2 (en) | 2006-04-26 | 2008-05-08 | L-3 Communications Security And Detection Systems, Inc. | Multi-source surveillance systems |
| WO2013063556A1 (en) | 2011-10-28 | 2013-05-02 | Regeneron Pharmaceuticals, Inc. | Humanized il-6 and il-6 receptor |
| CN105592695B (zh) | 2013-09-23 | 2018-04-10 | 瑞泽恩制药公司 | 具有人源化信号调节蛋白基因的非人动物 |
| ES2715949T3 (es) * | 2013-10-15 | 2019-06-07 | Regeneron Pharma | Animales con IL-15 humanizada |
| CA2929846C (en) | 2013-11-19 | 2020-09-15 | Regeneron Pharmaceuticals, Inc. | Non-human animals having a humanized b-cell activating factor gene |
| HUE051088T2 (hu) | 2014-04-08 | 2021-03-01 | Regeneron Pharma | Humanizált FC-gamma receptorokkal rendelkezõ nem humán élõlények |
| NO2785538T3 (https=) | 2014-05-07 | 2018-08-04 | ||
| CA2959428A1 (en) | 2014-09-19 | 2016-03-24 | Regeneron Pharmaceuticals, Inc. | Chimeric antigen receptors |
| RU2020122439A (ru) | 2014-11-24 | 2020-09-24 | Регенерон Фармасьютикалз, Инк. | Не относящиеся к человеку животные, экспрессирующие гуманизированный комплекс cd3 |
| SI3086637T1 (sl) | 2014-12-05 | 2019-04-30 | Regeneron Pharmaceuticals, Inc. | Nehumane živali s humaniziranim označevalcem diferenciacije gena CD47 |
| HUE052606T2 (hu) | 2014-12-09 | 2021-05-28 | Regeneron Pharma | Humanizált differenciációs klaszter 274 génnel rendelkezõ nem humán állatok |
| SG11201803409UA (en) | 2015-11-20 | 2018-05-30 | Regeneron Pharma | Non-human animals having a humanized lymphocyte-activation gene 3 |
| MX2018009513A (es) * | 2016-02-04 | 2019-01-31 | Regeneron Pharma | Animales no humanos que tienen un gen angptl8 modificado genéticamente. |
| CN109068621B (zh) | 2016-02-29 | 2021-07-20 | 再生元制药公司 | 具有人源化的tmprss基因的啮齿类动物 |
| HUE061619T2 (hu) | 2016-06-03 | 2023-07-28 | Regeneron Pharma | Exogén terminális dezoxinukleotid-transzferázt expresszáló rágcsálók |
| IL310006A (en) | 2017-11-30 | 2024-03-01 | Regeneron Pharma | Non-human animals containing a humanized TRKB locus |
| WO2019190922A1 (en) | 2018-03-24 | 2019-10-03 | Regeneron Pharmaceuticals, Inc. | Genetically modified non-human animals for generating therapeutic antibodies against peptide-mhc complexes, methods of making and uses thereof |
| KR20250121150A (ko) | 2018-03-26 | 2025-08-11 | 리제너론 파마슈티칼스 인코포레이티드 | 치료제를 시험하기 위한 인간화된 설치류 |
| IL278267B2 (en) | 2018-07-16 | 2025-02-01 | Regeneron Pharma | Non-human animal models of DITRA disease and their uses |
| EP4048802A4 (en) * | 2019-10-22 | 2023-11-22 | The Trustees of Columbia University in the City of New York | Transgenic swine, methods of making and uses thereof, and methods of making human immune system mice |
| JP7726881B2 (ja) | 2019-12-02 | 2025-08-20 | リジェネロン・ファーマシューティカルズ・インコーポレイテッド | ペプチド-mhc iiタンパク質構築物およびそれらの使用 |
| WO2023240124A1 (en) | 2022-06-07 | 2023-12-14 | Regeneron Pharmaceuticals, Inc. | Pseudotyped viral particles for targeting tcr-expressing cells |
| KR20250035053A (ko) | 2022-06-07 | 2025-03-11 | 리제너론 파아마슈티컬스, 인크. | T 세포 활성을 조절하기 위한 다중특이적 분자 및 이의 용도 |
| US20230417899A1 (en) * | 2022-06-27 | 2023-12-28 | Oshkosh Corporation | Position tracking for a lift device |
| IL319406A (en) | 2022-09-22 | 2025-05-01 | Regeneron Pharma | Genetically modified mice expressing components of the human cellular immune system |
| EP4654982A1 (en) | 2023-01-27 | 2025-12-03 | Regeneron Pharmaceuticals, Inc. | Modified rhabdovirus glycoproteins and uses thereof |
| WO2025064470A1 (en) | 2023-09-19 | 2025-03-27 | Regeneron Pharmaceuticals, Inc. | Viral peptides and uses thereof |
| WO2025064761A1 (en) | 2023-09-22 | 2025-03-27 | Regeneron Pharmaceuticals, Inc. | Kras10-18 g12d off-target peptides and uses thereof |
| WO2025064738A1 (en) | 2023-09-22 | 2025-03-27 | Regeneron Pharmaceuticals, Inc. | Dntt 250-258 off-target peptides and uses thereof |
| WO2025136809A2 (en) | 2023-12-19 | 2025-06-26 | Regeneron Pharmaceuticals, Inc. | Foxp3 peptides and uses thereof |
| WO2025178991A1 (en) | 2024-02-21 | 2025-08-28 | Regeneron Pharmaceuticals, Inc. | Splicing factor gene mutation-associated neoantigenic peptides and uses thereof |
| WO2026006724A1 (en) | 2024-06-28 | 2026-01-02 | Regeneron Pharmaceuticals, Inc. | Prame off-target peptides and uses thereof |
| WO2026006734A1 (en) | 2024-06-28 | 2026-01-02 | Regeneron Pharmaceuticals, Inc. | Off-target peptide-mhc complex conformation modeling systems and methods for antigen-recognition molecule development |
| WO2026030428A2 (en) | 2024-08-01 | 2026-02-05 | Regeneron Pharmaceuticals, Inc. | Prostate-specific antigen peptides and uses thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005004592A2 (en) * | 2003-07-30 | 2005-01-20 | Institut Pasteur | Transgenic mice having a human major histocompatibility complex (mhc) phenotype, experimental uses and applications |
| US20070209083A1 (en) * | 2001-07-13 | 2007-09-06 | Genoway | Cell and transgenic animal modelling human antigenic presentation and their uses |
Family Cites Families (45)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU633958B2 (en) | 1989-07-25 | 1993-02-11 | Cell Genesys, Inc. | Homologous recombination for universal donor cells and chimeric mammalian hosts |
| US5413923A (en) | 1989-07-25 | 1995-05-09 | Cell Genesys, Inc. | Homologous recombination for universal donor cells and chimeric mammalian hosts |
| US5574205A (en) | 1989-07-25 | 1996-11-12 | Cell Genesys | Homologous recombination for universal donor cells and chimeric mammalian hosts |
| US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| GB9100481D0 (en) | 1991-01-10 | 1991-02-20 | Inst Nat Sante Rech Med | Genetically engineered mice |
| AU2661692A (en) | 1991-09-19 | 1993-04-27 | President And Fellows Of Harvard College | Transgenic mhc class i and class ii antigen-deficient mammals |
| EP0663952A4 (en) | 1992-09-11 | 1997-06-11 | Univ California | Transgenic non-human animals having targeted lymphocyte transduction genes. |
| US5523226A (en) | 1993-05-14 | 1996-06-04 | Biotechnology Research And Development Corp. | Transgenic swine compositions and methods |
| GB9315303D0 (en) | 1993-07-23 | 1993-09-08 | Zeneca Ltd | Polypeptide |
| US5965787A (en) | 1995-08-31 | 1999-10-12 | Mayo Foundation For Medical Education And Research | HLA-DRBI peptides with specific binding affinity for HLA-DQ molecules: prevention and treatment of rheumatoid arthritis |
| US6002066A (en) | 1996-01-16 | 1999-12-14 | Ortho Pharmaceutical Corp. | H2-M modified transgenic mice |
| EP0910409A4 (en) | 1996-03-05 | 2003-03-19 | Scripps Research Inst | RECOMBINANT GENE CONSTRUCTS ENCODING T-CELL RECEPTORS SPECIFIC TO HUMAN-RESTRICTED TUMORANTANTIGENS |
| EP1500329B1 (en) | 1996-12-03 | 2012-03-21 | Amgen Fremont Inc. | Human antibodies that specifically bind human TNF alpha |
| DK1017721T3 (da) | 1997-09-16 | 2009-04-20 | Univ Oregon Health & Science | Rekombinante MHC molekyler, der kan anvendes til manipulation af antigenspecifikke T-celler |
| US6372955B1 (en) | 1998-02-17 | 2002-04-16 | Ortho Mcneil Pharmaceutical, Inc. | Methods for Producing B cells and antibodies from H2-O modified transgenic mice |
| JP2002509736A (ja) * | 1998-03-30 | 2002-04-02 | リサーチ ディベロップメント ファンデーション | 副腎皮質刺激ホルモン放出因子レセプター−1欠損マウス |
| WO2001027291A1 (en) | 1999-10-12 | 2001-04-19 | Institut Pasteur | Design of a polyepitopic construct for the induction of hla-a2.1 restricted hiv 1 specific ctl responses using hhd mice |
| US7067308B1 (en) * | 2000-03-28 | 2006-06-27 | Bioagri Corporation | Vector for genetically modifying non-human animals |
| WO2002000933A2 (en) | 2000-06-23 | 2002-01-03 | Interleukin Genetics, Inc. | Screening assays for identifying modulators of the inflammatory or immune responses |
| US6596541B2 (en) | 2000-10-31 | 2003-07-22 | Regeneron Pharmaceuticals, Inc. | Methods of modifying eukaryotic cells |
| US6586251B2 (en) | 2000-10-31 | 2003-07-01 | Regeneron Pharmaceuticals, Inc. | Methods of modifying eukaryotic cells |
| US7105348B2 (en) | 2000-10-31 | 2006-09-12 | Regeneron Pharmaceuticals, Inc. | Methods of modifying eukaryotic cells |
| US20050050580A1 (en) | 2000-12-13 | 2005-03-03 | Masashi Gotoh | Transgenic animal expressing hla-a24 and utilization thereof |
| EP1409646B1 (en) | 2000-12-19 | 2012-06-13 | Altor BioScience Corporation | Transgenic animals comprising a humanized immune system |
| US20040072262A1 (en) | 2002-10-11 | 2004-04-15 | Montero-Julian Felix A. | Methods and systems for detecting MHC class I binding peptides |
| DE10347710B4 (de) | 2003-10-14 | 2006-03-30 | Johannes-Gutenberg-Universität Mainz | Rekombinante Impfstoffe und deren Verwendung |
| WO2005085438A1 (ja) | 2004-03-09 | 2005-09-15 | Nagoya Industrial Science Research Institute | ヒト関節リウマチの病態を再現するトランスジェニック非ヒト哺乳動物 |
| AU2005295269B2 (en) | 2004-10-19 | 2010-05-13 | Regeneron Pharmaceuticals, Inc. | Method for generating an animal homozygous for a genetic modification |
| EP1878342A1 (en) * | 2006-07-13 | 2008-01-16 | Institut Pasteur | Immunodeficient mice transgenic for HLA class I and HLA class II molecules and their uses |
| EP1878798A1 (en) | 2006-07-13 | 2008-01-16 | Institut Pasteur | Method of producing a multichimeric mouse and applications to study the immunopathogenesis of human tissue-specific pathologies |
| HU0700534D0 (en) | 2006-11-24 | 2007-10-29 | Mezoegazdasagi Biotechnologiai | Transgenic animal with enhanced immune response and method for the preparation thereof |
| NO347649B1 (no) | 2006-12-14 | 2024-02-12 | Regeneron Pharma | Humant antistoff eller antistoff fragment som spesifikt binder human deltaliknende ligand 4 (hDII4), nukleinsyremolekyl som koder for slike og vektor og vert-vektorsystemer, samt fremgangsmåte for fremstilling, sammensetning og anvendelse. |
| EP2262898B1 (en) | 2008-03-07 | 2018-01-24 | Regeneron Pharmaceuticals, Inc. | Es cell-derived mice from diploid host embryo injection |
| US20090328240A1 (en) | 2008-06-24 | 2009-12-31 | Sing George L | Genetically modified mice as predictors of immune response |
| BR112012000536A2 (pt) | 2009-07-08 | 2020-08-11 | Kymab Limited | métodos para produção de anticorpo ou cadeia leve ou pesada de anticorpo específico para um antígeno desejado, para produção de anticorpo ou cadeia de anticorpo e seu uso, composição farmacêutica e derivado de anticorpo quimérico |
| CN101695587B (zh) * | 2009-10-21 | 2012-08-29 | 上海中山医疗科技发展公司 | 一种基因修饰及调控的内皮祖细胞捕获支架的制备方法 |
| WO2012007951A1 (en) | 2010-07-15 | 2012-01-19 | Technion Research & Development Foundation Ltd. | Isolated high affinity entities with t-cell receptor like specificity towards native complexes of mhc class ii and glutamic acid decarboxylase (gad) autoantigenic peptides |
| WO2012039779A1 (en) | 2010-09-24 | 2012-03-29 | The United States Of America As Represented By The Secretary Of The Navy | Humanized transgenic mouse model |
| DK3590332T3 (da) | 2011-10-28 | 2022-05-23 | Regeneron Pharma | Genmodificerede mus, der eksprimerer kimære major histokompatibilitetskompleks (MHC) II-molekyler |
| US9043996B2 (en) | 2011-10-28 | 2015-06-02 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex animals |
| KR102714111B1 (ko) | 2013-02-20 | 2024-10-11 | 리제너론 파아마슈티컬스, 인크. | 사람화된 t-세포 보조-수용체를 발현하는 마우스 |
| PL2958937T3 (pl) | 2013-02-22 | 2019-01-31 | Regeneron Pharmaceuticals, Inc. | Myszy ekspresjonujące humanizowany główny układ zgodności tkankowej |
| US20150342163A1 (en) | 2013-02-22 | 2015-12-03 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex mice |
| CA3249218A1 (en) | 2013-03-11 | 2026-03-02 | Regeneron Pharmaceuticals, Inc. | Transgenic mice expressing chimeric major histocompatibility complex (mhc) class ii molecules |
| CN113349159B (zh) | 2015-04-06 | 2022-11-11 | 瑞泽恩制药公司 | 非人动物中的人源化t细胞介导的免疫应答 |
-
2012
- 2012-10-26 DK DK19189533.3T patent/DK3590332T3/da active
- 2012-10-26 HR HRP20220616TT patent/HRP20220616T1/hr unknown
- 2012-10-26 MX MX2017013492A patent/MX379060B/es unknown
- 2012-10-26 EP EP19189533.3A patent/EP3590332B1/en active Active
- 2012-10-26 ES ES22152099T patent/ES3058981T3/es active Active
- 2012-10-26 BR BR112014009941-3A patent/BR112014009941B1/pt active IP Right Grant
- 2012-10-26 KR KR1020147014315A patent/KR101926442B1/ko active Active
- 2012-10-26 SG SG11201400938UA patent/SG11201400938UA/en unknown
- 2012-10-26 HU HUE17171524A patent/HUE048511T2/hu unknown
- 2012-10-26 SM SM20170437T patent/SMT201700437T1/it unknown
- 2012-10-26 EP EP17171524.6A patent/EP3272214B1/en active Active
- 2012-10-26 IN IN3892CHN2014 patent/IN2014CN03892A/en unknown
- 2012-10-26 JP JP2014539027A patent/JP6285361B2/ja active Active
- 2012-10-26 RS RS20220473A patent/RS63220B1/sr unknown
- 2012-10-26 SG SG10201510056SA patent/SG10201510056SA/en unknown
- 2012-10-26 SI SI201231738T patent/SI3272214T1/sl unknown
- 2012-10-26 SM SM20220205T patent/SMT202200205T1/it unknown
- 2012-10-26 EP EP12806199.1A patent/EP2770822B9/en active Active
- 2012-10-26 KR KR1020187034955A patent/KR102113108B1/ko active Active
- 2012-10-26 ES ES12806199.1T patent/ES2640241T3/es active Active
- 2012-10-26 DK DK12806199.1T patent/DK2770822T3/en active
- 2012-10-26 CA CA2852962A patent/CA2852962C/en active Active
- 2012-10-26 EP EP22152099.2A patent/EP4052572B8/en active Active
- 2012-10-26 CN CN201810239690.4A patent/CN108707608A/zh active Pending
- 2012-10-26 DK DK17171524.6T patent/DK3272214T3/da active
- 2012-10-26 PT PT191895333T patent/PT3590332T/pt unknown
- 2012-10-26 PL PL12806199T patent/PL2770822T3/pl unknown
- 2012-10-26 SM SM20200114T patent/SMT202000114T1/it unknown
- 2012-10-26 HR HRP20171327TT patent/HRP20171327T1/hr unknown
- 2012-10-26 ES ES19189533T patent/ES2914374T3/es active Active
- 2012-10-26 MX MX2014004896A patent/MX355726B/es active IP Right Grant
- 2012-10-26 LT LTEP17171524.6T patent/LT3272214T/lt unknown
- 2012-10-26 ES ES17171524T patent/ES2774488T3/es active Active
- 2012-10-26 AU AU2012327205A patent/AU2012327205B2/en active Active
- 2012-10-26 PT PT171715246T patent/PT3272214T/pt unknown
- 2012-10-26 CN CN201280065075.7A patent/CN104039133B/zh active Active
- 2012-10-26 LT LTEP12806199.1T patent/LT2770822T/lt unknown
- 2012-10-26 WO PCT/US2012/062029 patent/WO2013063340A1/en not_active Ceased
- 2012-10-26 SG SG10201909638U patent/SG10201909638UA/en unknown
- 2012-10-26 RS RS20170897A patent/RS56330B1/sr unknown
- 2012-10-26 SI SI201231056T patent/SI2770822T1/sl unknown
- 2012-10-26 RU RU2014116577A patent/RU2660564C2/ru active
- 2012-10-26 SI SI201231999T patent/SI3590332T1/sl unknown
- 2012-10-26 LT LTEP19189533.3T patent/LT3590332T/lt unknown
- 2012-10-26 PL PL17171524T patent/PL3272214T3/pl unknown
- 2012-10-26 US US13/661,116 patent/US8847005B2/en active Active
- 2012-10-26 PL PL19189533T patent/PL3590332T3/pl unknown
- 2012-10-26 CN CN201810239986.6A patent/CN108401986B/zh active Active
- 2012-10-26 HU HUE12806199A patent/HUE034374T2/en unknown
- 2012-10-26 PT PT128061991T patent/PT2770822T/pt unknown
- 2012-10-26 RS RS20200224A patent/RS59997B1/sr unknown
-
2014
- 2014-04-03 IL IL231895A patent/IL231895B/en active IP Right Grant
- 2014-08-08 US US14/455,237 patent/US9585373B2/en active Active
-
2016
- 2016-01-11 IL IL243565A patent/IL243565A/en active IP Right Grant
- 2016-04-13 AU AU2016202317A patent/AU2016202317B2/en active Active
-
2017
- 2017-01-24 US US15/413,785 patent/US10219493B2/en active Active
- 2017-08-17 JP JP2017157497A patent/JP6652529B2/ja active Active
- 2017-09-05 CY CY20171100934T patent/CY1119283T1/el unknown
-
2018
- 2018-02-27 AU AU2018201402A patent/AU2018201402C1/en active Active
- 2018-06-21 IL IL260209A patent/IL260209B/en active IP Right Grant
-
2019
- 2019-01-10 US US16/244,892 patent/US11219195B2/en active Active
- 2019-01-10 US US16/244,912 patent/US10986822B2/en active Active
-
2020
- 2020-02-24 HR HRP20200305TT patent/HRP20200305T1/hr unknown
- 2020-02-26 CY CY20201100178T patent/CY1122700T1/el unknown
-
2021
- 2021-01-22 AU AU2021200438A patent/AU2021200438B2/en active Active
- 2021-03-17 US US17/204,526 patent/US20210195878A1/en not_active Abandoned
-
2022
- 2022-05-20 CY CY20221100349T patent/CY1125196T1/el unknown
-
2024
- 2024-07-23 US US18/781,796 patent/US20240365761A1/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070209083A1 (en) * | 2001-07-13 | 2007-09-06 | Genoway | Cell and transgenic animal modelling human antigenic presentation and their uses |
| WO2005004592A2 (en) * | 2003-07-30 | 2005-01-20 | Institut Pasteur | Transgenic mice having a human major histocompatibility complex (mhc) phenotype, experimental uses and applications |
Non-Patent Citations (1)
| Title |
|---|
| ITO K ET AL: "HLA-DR4-IE CHIMERIC CLASS II TRANSGENIC, MURINE CLASS II-DEFICIENT MICE ARE SUSCEPTIBLE TO EXPERIMENTAL ALLERGIC ENCEPHALOMYELITIS", THE JOURNAL OF EXPERIMENTAL MEDICINE, ROCKEFELLER UNIVERSITY PRESS, US, vol. 183, no. 6, 1 June 1996 (1996-06-01), pages 2635 - 2644, XP000994711, ISSN: 0022-1007, DOI: 10.1084/JEM.183.6.2635 * |
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9585373B2 (en) | 2011-10-28 | 2017-03-07 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex mice |
| US9700025B2 (en) | 2011-10-28 | 2017-07-11 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex animals |
| US12063915B2 (en) | 2013-02-20 | 2024-08-20 | Regeneron Pharmaceuticals, Inc. | Humanized T cell co-receptor mice |
| US9848587B2 (en) | 2013-02-20 | 2017-12-26 | Regeneron Pharmaceuticals, Inc. | Humanized T cell co-receptor mice |
| EP2958938B1 (en) * | 2013-02-20 | 2019-04-17 | Regeneron Pharmaceuticals, Inc. | Mice expressing humanized t-cell co-receptors |
| US10820581B2 (en) | 2013-02-20 | 2020-11-03 | Regeneron Pharmaceuticals, Inc. | Humanized T cell co-receptor mice |
| US10154658B2 (en) | 2013-02-22 | 2018-12-18 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex mice |
| EP3421490A1 (en) * | 2013-02-22 | 2019-01-02 | Regeneron Pharmaceuticals, Inc. | Mice expressing humanized major histocompatibility complex |
| US10314296B2 (en) | 2013-02-22 | 2019-06-11 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex mice |
| EP3699190A1 (en) * | 2013-02-22 | 2020-08-26 | Regeneron Pharmaceuticals, Inc. | Murine cell expressing humanized major histocompatibility complex |
| US12414551B2 (en) | 2013-02-22 | 2025-09-16 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex mice |
| US11224208B2 (en) | 2013-02-22 | 2022-01-18 | Regeneron Pharmaceuticals, Inc. | Genetically modified major histocompatibility complex mice |
| EP4249507A3 (en) * | 2013-03-11 | 2023-12-27 | Regeneron Pharmaceuticals, Inc. | Transgenic mice expressing chimeric major histocompatibility complex (mhc) class ii molecules |
| EP2967015B1 (en) | 2013-03-11 | 2023-06-07 | Regeneron Pharmaceuticals, Inc. | Transgenic mice expressing chimeric major histocompatibility complex (mhc) class ii molecules |
| WO2014164638A1 (en) * | 2013-03-11 | 2014-10-09 | Regeneron Pharmaceuticals, Inc. | Transgenic mice expressing chimeric major histocompatibility comples (mhc) class ii molecules |
| US11684050B2 (en) | 2014-06-19 | 2023-06-27 | Regeneran Pharmaceuticals, Inc. | Non-human animals having a humanized programmed cell death 1 gene |
| JP7612475B2 (ja) | 2014-06-19 | 2025-01-14 | リジェネロン・ファーマシューティカルズ・インコーポレイテッド | ヒト化プログラム細胞死1遺伝子を持つ非ヒト動物 |
| JP2021094035A (ja) * | 2014-06-19 | 2021-06-24 | リジェネロン・ファーマシューティカルズ・インコーポレイテッドRegeneron Pharmaceuticals, Inc. | ヒト化プログラム細胞死1遺伝子を持つ非ヒト動物 |
| US11259510B2 (en) | 2015-04-06 | 2022-03-01 | Regeneron Pharmaceuticals, Inc. | Humanized T cell mediated immune responses in non-human animals |
| US12376573B2 (en) | 2021-03-31 | 2025-08-05 | Regeneron Pharmaceuticals, Inc. | Genetically modified mice comprising humanized cellular immune system components with improved diversity of TCRB repertoire |
| WO2025212991A1 (en) | 2024-04-05 | 2025-10-09 | Regeneron Pharmaceuticals, Inc. | Rodent models of disease |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240365761A1 (en) | Genetically modified major histocompatibility complex mice | |
| US9700025B2 (en) | Genetically modified major histocompatibility complex animals | |
| CA2903025A1 (en) | Transgenic mice expressing chimeric major histocompatibility complex (mhc) class ii molecules | |
| HK40080877A (en) | Genetically modified mice expressing chimeric major histocompatibility complex (mhc) ii molecules | |
| HK40017625B (en) | Genetically modified mice expressing chimeric major histocompatibility complex (mhc) ii molecules | |
| HK40017625A (en) | Genetically modified mice expressing chimeric major histocompatibility complex (mhc) ii molecules | |
| HK1250131B (en) | Genetically modified mice expressing chimeric major histocompatibility complex (mhc) ii molecules | |
| HK1196999B (en) | Genetically modified mice expressing chimeric major histocompatibility complex (mhc) ii molecules | |
| NZ717130B2 (en) | Transgenic mice expressing chimeric major histocompatibility complex (mhc) class ii molecules |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| ENP | Entry into the national phase |
Ref document number: 2012327205 Country of ref document: AU Date of ref document: 20121026 Kind code of ref document: A |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12806199 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 231895 Country of ref document: IL |
|
| ENP | Entry into the national phase |
Ref document number: 2852962 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2014/004896 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2014539027 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2012806199 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012806199 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20147014315 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2014116577 Country of ref document: RU Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112014009941 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 243565 Country of ref document: IL |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112014009941 Country of ref document: BR Free format text: APRESENTE DOCUMENTO DE CESSAO DA PRIORIDADE US 62/552,584 ASSINADO E DATADO POR JOHN MCWHIRTER CONTENDO, PELO MENOS, NUMERO E DATA DE DEPOSITO DO DOCUMENTO DE PATENTE QUE ESTA SENDO CEDIDO, UMA VEZ QUE O DOCUMENTO DE CESSAO ENVIADO NA PETICAO NO 860140061865, O INVENTOR NAO ESTA COMO CEDENTE. A NAO APRESENTACAO DESSE DOCUMENTO ACARRETARA NA PERDA DA PRIORIDADE. |
|
| ENP | Entry into the national phase |
Ref document number: 112014009941 Country of ref document: BR Kind code of ref document: A2 Effective date: 20140425 |