WO2013055058A9 - 항체결합 펩타이드-페리틴 융합단백질 및 이의 용도 - Google Patents

항체결합 펩타이드-페리틴 융합단백질 및 이의 용도 Download PDF

Info

Publication number
WO2013055058A9
WO2013055058A9 PCT/KR2012/007993 KR2012007993W WO2013055058A9 WO 2013055058 A9 WO2013055058 A9 WO 2013055058A9 KR 2012007993 W KR2012007993 W KR 2012007993W WO 2013055058 A9 WO2013055058 A9 WO 2013055058A9
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
ferritin
nanoparticles
binding peptide
binding
Prior art date
Application number
PCT/KR2012/007993
Other languages
English (en)
French (fr)
Other versions
WO2013055058A2 (ko
WO2013055058A3 (ko
Inventor
정상전
강세병
강효진
강영지
이영미
Original Assignee
한국생명공학연구원
국립대학법인 울산과학기술대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원, 국립대학법인 울산과학기술대학교 산학협력단 filed Critical 한국생명공학연구원
Publication of WO2013055058A2 publication Critical patent/WO2013055058A2/ko
Publication of WO2013055058A9 publication Critical patent/WO2013055058A9/ko
Publication of WO2013055058A3 publication Critical patent/WO2013055058A3/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/06—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations
    • A61K49/18—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by a special physical form, e.g. emulsions, microcapsules, liposomes
    • A61K49/1818—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by a special physical form, e.g. emulsions, microcapsules, liposomes particles, e.g. uncoated or non-functionalised microparticles or nanoparticles
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a fusion protein (FcBP-ferritin) of the antibody-binding peptide and ferritin and its use.
  • the present invention is a nanoparticle comprising 24 antibody-binding peptide-ferritin fusion protein monomers, six substructures having a 4-fold symmetry point is formed by ferritin, 4- of ferritin Nanoparticles characterized in that the antibody-binding peptide is fused in the range of ⁇ 10 aa (amino acid) of the fold symmetry point so that four antibody-binding peptides are located near the 4-fold symmetry point; And uses thereof.
  • Ferritin is a protein that stores iron and is widely present in prokaryotes and eukaryotes.
  • Ferritin has a molecular weight of about 500,000 Da, which is composed of a heavy chain and a light chain, and exhibits a unique characteristic of forming spherical particles due to its self-assembling ability.
  • Ferritin is a protein composed of 24 monomers (a single monomer or a heterologous monomer composed of either a heavy chain or a light chain) to form a giant spherical tertiary structure.
  • the outer diameter is about 12 nm and the inner diameter is about 8 nm.
  • Ferritin is scattered into monomers depending on the pH conditions and forms nanoparticles with 24 monomers bound together, which can be used to trap various substances within ferritin (Wang, Z .; Li, C .; Ellenburg, M). Soistman, E .; Ruble, J .; Wright, B .; Ho, JX; and Carter, DC, (2006) Acta Crystallographica Section D: Biological Crystallography , 62: 800-806.
  • nanoparticle-shaped ferritin has iron oxide inside, but in addition, manganese oxide (Mn (O) OH and Mn 3 O 4 ) and cobalt oxide (Co (O) OH and Co 3 O 4 ), Chromium oxide (Cr (OH) 3 ), nickel oxide (Ni (OH) 3 ), indium oxide (In 2 O 3 ), iron sulfide (FeS), cadmium sulfide (CdS), selenium cadmium (CdSe), and Cases have been reported for the preparation of ferritin, including various inorganic metals such as selenium (ZnSe) (Mackle, P .; Charnock, JM; Garner, CD; Meldrum, FC; and Mann, S., (1993) J Am.
  • ZnSe selenium
  • ferritin has been reported to capture Gd-HPDOTA (gadolinium- [10- (2-hydroxypropyl) -1,4,7,10-tetraazacyclododecane-1,4,7-triacetic acid), an MRI contrast agent (Aime, S).
  • Gd-HPDOTA gadolinium- [10- (2-hydroxypropyl) -1,4,7,10-tetraazacyclododecane-1,4,7-triacetic acid
  • an MRI contrast agent Aime, S.
  • Configuration Protein nanoparticles is 24 have a uniform formula, and consequently to a transporter functions to transport the 24 metal ions with a Ferritin is a very sophisticated form of nanoparticles.
  • Targeted drug delivery system refers to a technology designed to selectively deliver drugs to the treatment site, thereby not exposing healthy tissue to the drug, and at the same time having a good therapeutic effect with only a small amount of drug.
  • a targeted drug delivery system By using a targeted drug delivery system, it is possible to maximize the effects of drug treatment by concentrating drugs on specific parts of the human body with diseases, and minimize side effects caused by highly toxic drugs such as anticancer drugs.
  • the technology that can be done is the Terragnosis technology.
  • liposomes are composed mainly of phospholipids, which are components of biological cell membranes, and can trap water-soluble or insoluble (hydrophobic) drugs therein.
  • Liposomes have the advantage of controlling the composition and surface components in a variety of ways, but high intracellular toxicity and has problems such as loss in the circulatory system due to phagocytosis of macrophages when injected into the drug.
  • a liposome was prepared by binding PEG to the end of phospholipid, or a stealth liposome coated with a liposome surface with PEG or polysaccharide was developed.
  • Micell is a carrier consisting of chain-like molecules having both hydrophilic and hydrophobic sites.
  • the hydrophobic moieties are spherical to form a spherical form. do.
  • drug carriers using nanoparticles are selectively accumulated in cancer tissues through an enhanced permeability and retention (EPR) effect, a passive target-oriented method.
  • EPR enhanced permeability and retention
  • cancer tissue is supplied with nutrients and oxygen through the neovascularization, the blood vessels are formed in a short period of time, unlike the normal cells have a poor structure.
  • Loose vascular tissues formed in cancerous tissues can accumulate tens to hundreds of nanometers of nanoparticles around cancerous tissues and have a slow discharge rate so that they stay in cancerous tissues for a long time.
  • EPR enhanced permeability and retention
  • a biological material such as nucleic acid or protein is fixed on a substrate surface, and is also called a biological array.
  • a protein chip refers to a biochip that integrates various biomolecules and analyzes them effectively by integrating dozens or thousands of different peptides or proteins that can react with a specific biomaterial on a solid surface. Recently, it has been applied to disease diagnosis chips, new drug candidate ultra-fast screening system, protein expression pattern research, and discovery of new protein markers.
  • a protein, an antigen, an antibody, an affinity ligand, a cell receptor or an enzyme, a nucleic acid, or a nucleic acid or protein capable of binding together with a small molecule may be used in a biochip.
  • Biochip technology has become an important tool for large scale and high throughput in biological research as a result of the development and integration of information analysis technology.
  • Proteins can be adhered to various types of protein chip solid substrate surfaces by diffusion, adsorption / absorption, covalent bonding, and affinity.
  • proteins generally accumulate randomly on the surface of the substrate, and since the structure of the protein is easily modified, it inhibits the activity of the protein. As a result, binding with surface molecules is impossible, and thus, specific binding is not efficient.
  • the specificity of the binding between the protein probe and the target material applied to the protein chip is very sensitive depending on the structure of the protein. Therefore, the protein having the active structure must be immobilized at a position and orientation suitable for high sensitivity recognition of the target material.
  • inefficient immobilization processes such as inactivation due to masking of active sites or instability due to non-specific protein clustering, and reduced density have been recognized as inhibitors of high sensitivity detection.
  • the most popular biochip technology using nanoparticles is a technology for binding proteins, peptides, antigens, and antibodies to the surface of semiconductor quantum dots (QDs).
  • QDs semiconductor quantum dots
  • the quantum dot has a light emitting area of a narrow range, there is an advantage that the light emitting area can be easily adjusted.
  • the manufacturing process is complicated, the manufacturing cost is expensive, and the quantum dot manufacturing environment is different from the stabilization conditions of biological materials.
  • the inventors of the present invention sought to develop antibody structures that can be used for biochips, drug delivery systems, disease diagnosis and therapeutic development by binding strongly with specificity without damaging the antibody structure.
  • nanoparticles having a higher binding capacity than a single antibody and having high reactive cysteines were prepared to prepare variously modified nanoparticles, thereby completing the present invention.
  • a first object of the present invention is a nanoparticle comprising 24 antibody-binding peptide-ferritin fusion protein monomers; And a method for producing the same.
  • a second object of the present invention is an antibody-binding peptide-ferritin fusion protein; Nucleic acids encoding them; A recombinant vector comprising the nucleic acid; And it provides a transformant transformed with the nucleic acid or the recombinant vector.
  • a third object of the present invention is a drug delivery system using the nanoparticles according to the present invention; Protein chips; Diagnostic kits; And an antigen detection method.
  • the present invention is to prepare a fusion protein by introducing the sequence of the antibody-binding peptide to ferritin, and by using the antibody to bind to ferritin without damaging the structure of the antibody, biochip, drug delivery system, disease diagnosis and therapeutic drug development It can be utilized.
  • FIG. 1 is a diagram illustrating a conceptual diagram illustrating the present invention.
  • FIG. 2 is a view showing a 90 ° rotated structure of the microorganism-derived ferritin.
  • Figure 3 is a schematic diagram showing a process for preparing ferritin-antibody binding peptide fusion protein and nanoparticles formed therefrom.
  • TEM 5 is a transmission electron microscope (TEM) analysis result confirming the shape of the spherical ferritin-FcBP complex.
  • Figure 7 is a binding measurement result of the ferritin-antibody binding peptide complex and antibody using a quartz crystal microbalance (QCM).
  • QCM quartz crystal microbalance
  • Figure 8 is a fluorescence micrograph showing the results of Herceptin-CY3 and human IgG-CY3 treatment for SKBR3 (HER2 / neu +) and MCF10A according to Example 4-1.
  • FIG. 9 is a fluorescence image of a ferritin-FcBP-herceptin complex applied to SKBR3 (HER2 / neu +) according to Example 4-2.
  • Example 10 is a fluorescence image of a ferritin-FcBP-herceptin complex applied to MCF10A (HER2 / neu-) according to Example 4-3.
  • Figure 11 is a result of the targeting experiment to change the conditions for mixing ferritin-FcBP and Herceptin in order to establish the stabilization conditions of ferritin-FcBP-Herceptin complex.
  • the ferritin-FcBP-Herceptin complex which is newly applied to SKBR3 (HER2 / neu +), showed much reduced non-selective protein precipitation compared to previous experiments.
  • 12 is a structural diagram of human-derived ferritin.
  • FIG. 13 is the result of a 15% SDS-PAGE gel confirming the results of overexpression and purification of human derived ferritin into which the antibody binding peptide was introduced, according to Example 6. (lane 5: final purified human ferritin)
  • FIG. 14 is a diagram showing the results of analyzing the binding force between the human-derived ferritin and human-derived antibody (herceptin, IgG1) to which the antibody-binding peptide is introduced by SPR.
  • FIG. 15 is a diagram showing the results of purification after substitution and overexpression of cysteine residues in human-derived ferritin-FcBP into which antibody-binding peptides were introduced to introduce specific ligands (drugs or imaging contrast agents): (a) E61C, ( b) E137C, (c) A102C and (d) S19C.
  • FIG. 16 shows the results of overexpression by additionally inserting cysteine residues into microorganism-derived ferritin-FcBP into which antibody-binding peptides were introduced in order to introduce specific ligands (drugs or imaging contrast agents): (a) and (b) Cysteine is introduced after 161 and 174 amino acids at 164C and 177C, respectively, and is the result for parine containing cysteine residues at 164th and 177th amino acid sequence, and (c) is 2C after 1st amino acid, i.e. This is the result for parine with cysteine introduced at the second amino acid sequence.
  • cysteine residues into microorganism-derived ferritin-FcBP into which antibody-binding peptides were introduced in order to introduce specific ligands (drugs or imaging contrast agents): (a) and (b) Cysteine is introduced after 161 and 174 amino acids at 164C and 177C, respectively, and is the result for parine containing cysteine residues at
  • FIG. 17 is a diagram showing an example of a chelate capable of binding to a metal ion comprising a reactor capable of binding to cysteine introduced into ferritin-FcBP according to the present invention.
  • a first aspect of the present invention is a nanoparticle comprising 24 antibody-binding peptide-ferritin fusion protein monomers, wherein six substructures having 4-fold symmetry points are formed by ferritin, The antibody-binding peptide is fused in the range of ⁇ 10 aa (amino acid) of the 4-fold symmetry point to provide four nanoparticles in the vicinity of the 4-fold symmetry point.
  • the antibody is preferably bound to the antibody-binding peptide.
  • a second aspect of the present invention provides a ⁇ 10 a.a. of the 4-fold symmetry point in ferritin upon nanoparticle formation by self-assembly of ferritin.
  • Antibody-binding peptide-ferritin fusion protein in which antibody-binding peptide is fused in a range; Nucleic acids encoding them; A recombinant vector comprising the nucleic acid; And a transformant transformed with the nucleic acid or the recombinant vector.
  • the third aspect of the present invention comprises the steps of i) preparing a recombinant expression vector comprising the nucleic acid according to the present invention; ii) preparing a transformant transduced with the recombinant expression vector; iii) expressing the antibody-binding peptide-ferritin fusion protein from the transformant of step ii); And iv) purifying the nanoparticles having six substructures having a 4-fold symmetry point by self-assembly of the expressed antibody-binding peptide-ferritin fusion protein. To provide a production method.
  • a fourth aspect of the present invention provides a targeted drug delivery agent characterized by delivering a drug to the inside or surface of a nanoparticle according to the present invention.
  • the fifth aspect of the present invention provides a protein chip comprising the nanoparticles according to the present invention.
  • the sixth aspect of the present invention comprises the steps of preparing a protein chip according to the present invention; Immobilizing the antibody against the antigen to be detected on the protein chip; Reacting a sample with a protein chip comprising the immobilized antibody; And it provides an antigen detection method comprising the step of measuring the antigen-antibody reaction.
  • a seventh aspect of the invention provides a diagnostic kit comprising a protein chip according to the invention.
  • Ferritin a bio-derived nanostructure, forms six substructures with structurally 4-fold symmetry points when 24 ferritin monomers form nanoparticles, at which point the same portion of each protein monomer (Amino acid sequence) meet (refer FIG. 2). Therefore, when modifying the protein part forming the symmetry point, the four formulas meet in the same place.
  • the antibody binding peptide may be a peptide capable of recognizing a specific site of the Fc domain of an antibody and specifically adjacent to or binding to that site. That is, the peptide may be a peptide capable of binding in vitro, preferably in vivo, with sufficient affinity and specificity for the Fc domain.
  • the bond may be due to non-covalent bonding such as hydrogen bonding, ionic bonding, hydrophobic interaction, Van der Waals interaction, and the like. have. It may be a linear peptide or a circular peptide having a disulfide bond therein, and the circular peptide having a disulfide bond therein may include two or more cysteine residues separated by one or more amino acids.
  • Non-limiting examples can be used as long as they can recognize and specifically bind or bind the Fc region of an antibody, but non-limiting examples are described in EP 1757701A1. On the other hand, the content described in EP 1757701A1 is incorporated herein.
  • the Fc regioselective peptide may be naturally expressed, but is not limited thereto, and may be artificially synthesized.
  • antibody-binding peptide of the present invention can be used as well as peptide derivatives such as peptide mimetics and analogs as well as peptides as long as they can specifically adjacent or bind to specific regions of the antibody Fc domain. peptide analogues).
  • the antibody-binding peptide may be composed of about 40 amino acids or less, preferably 30 or less amino acids, and more preferably 10 to 15 amino acids.
  • the amino acid may be an amino acid derivative such as an amino acid mimetic or analog in addition to the twenty known amino acids.
  • Mimics or analogs of the peptides or amino acids include natural amino acids or non-amino acid compound structures having structures similar to the antibody binding peptides according to the invention. Such mimetics or analogs are defined as substances that exhibit similar physical properties, such as size, charge or hydrophobicity, exhibited by the corresponding amino acid or peptide in the appropriate spatial orientation.
  • a peptide mimetic compound is a compound in which an amide bond present between one or more amino acids is a carbon-carbon bond or It may be a compound substituted with other bonds known in the art.
  • amino acid of the present invention includes not only L-amino acids or their residues naturally occurring in a broad sense, but also D-amino acids and chemically modified amino acids.
  • amino acid mimetics and analogs may be included, and in the present invention, the mimetics and analogs may include functional equivalents.
  • the antibody-binding peptide of the present invention is composed of 11 amino acids, for example, amino acids 1 and 11 form a disulfide bond in a molecule to form a ring-shaped peptide, immunoglobulin G (immunoglobulin present in humans, pigs, rabbits, etc.). G, IgG) is known to have a specific binding to the Fc region. This is shown in Table 1.
  • the antibody binding peptides can be prepared by phage-display.
  • phage-display is an experimental technique for studying protein-protein, protein-peptide and protein-DNA interactions using bacteriophages to link proteins and genetic information encoding them.
  • the phage-display can be used to prepare constrained and unconstrained peptide libraries.
  • the library can be used to identify and select peptides that bind specific target molecules. That is, the peptide-display technique can be used to identify and select peptides that specifically bind to the Fc region of an antibody, which may be referred to as antibody binding peptides.
  • the present inventors have introduced the antibody-binding peptides previously developed by molecular biological methods and the above-described structural properties of ferritin to introduce the antibody-binding peptide near the symmetry point of the ferritin protein so that the four antibody-binding peptides are identical on the surface of the ferritin nanoparticle. By making it into place, a ferritin structure with a new function was developed.
  • Example 3 the antibody bound to the nanoparticles of the antibody-binding peptide-ferritin was confirmed that the binding of the two proteins did not break even if the phosphate buffer was flowed for 2 hours or more. In addition, it was confirmed that even when the nanoparticles of the antibody-binding peptide-ferritin conjugated with human antibodies were exposed to an excess of rabbit serum, the antibodies remained intact on the nanoparticles.
  • the use of the nanoparticles of the antibody-binding peptide-ferritin according to the present invention by simple mixing with the antibody was able to induce the formation of a strong nanoparticle-antibody complex through self-assembly without damaging the structure of the antibody.
  • nanoparticles may be formed even when the antibody is mixed with the antibody-binding peptide-ferritin fusion protein even before the nanoparticles are formed.
  • nanoparticle formation may be delayed due to steric hindrance caused by the antibodies, but after a long time, a part of the antibody attached to the antibody-binding peptide-ferritin fusion protein is dissociated and stable nano It is inferred that they may also form particle-antibody complexes. Therefore, it is also within the scope of the present invention to form nanoparticles after mixing the antibody to the antibody-binding peptide-ferritin fusion protein.
  • protein nanoparticles into which an antibody-binding peptide is introduced into ferritin according to the present invention can be easily prepared without damaging the structure of the antibody by inducing strong nanoparticle-antibody complex formation through self-assembly by simple mixing with the antibody. Not only can chips be formed, but also target-oriented drug delivery systems. In addition, simple mixing with various antibodies can form new forms of targeted terragnosis formulations (see FIG. 1).
  • the antibody-binding peptide-ferritin fusion protein according to the present invention 24 can form spherical nanoparticles by self-assembly.
  • the diameter of the nanoparticles may be 1 to 20 nm.
  • the ferritin of the fusion protein monomer forming the nanoparticles according to the present invention may be homogeneous or heterogeneous.
  • the ferritin may be all derived from the same, it may be used to mix the ferritin derived from different species.
  • Ferritin may be a microorganism-derived ferritin, such as a bacterium, or an eukaryotic cell-derived ferritin. Preferably human derived ferritin.
  • ferritin of the fusion protein monomer forming the nanoparticles according to the present invention may be a mutein, one or more amino acid residues in the natural amino acid sequence is substituted with cysteine or additionally inserted cysteine.
  • Cysteine itself has a high affinity with heavy metals, and also includes a highly reactive thiol group can be easily combined with other reactors to facilitate drug introduction using a bond directly or through a linker.
  • the cysteine is the second Ser (serine), the 19th Ser (serine), the 61st Glu (glutamic acid), the 68th Lys (lysine), the 102nd Ala (alanine), the 113th Asp of the human-derived ferritin amino acid sequence.
  • One or more sequences may be inserted.
  • the inserted sequence may be a single cysteine residue or a GGC sequence, but may be used without limitation as long as it contains one or more cysteines and does not modify the structure of a native protein. Substitution or insertion into the cysteine can be carried out using methods known to those skilled in the art without limitation, but preferably by site-directed mutagenesis.
  • a second Ser (serine), a 19th Ser (serine), a 102th Ala (alanine), or a 113th Asp (aspartic acid) of a human-derived ferritin amino acid sequence may be replaced with one or more cysteines, or the amino acid sequence of Pyrococcus furiosus .
  • One or more additional insertions between the first and second amino acids may be used to prepare nanoparticles comprising cysteine that can bind to the drug exposed to the outer surface.
  • Glu glutamic acid
  • 68th Lys lysine
  • 137th Glu glutamic acid
  • one or more additional amino acid sequences including cysteine or cysteine may be inserted to prepare nanoparticles comprising cysteine that can bind to the drug exposed on the inner surface.
  • the antibody-binding peptide-ferritin fusion protein of the present invention is ⁇ 10 a.a. of 4-fold symmetry point in ferritin.
  • the antibody-binding peptide is fused in the range. At this time, four antibody-binding peptides are located near one 4-fold symmetry point.
  • the nanoparticles according to the present invention may be coupled to one or two or more antibodies to four antibody binding peptides located near one 4-fold symmetry point.
  • both ends of the antibody-binding peptide in the ⁇ 10 aa range of the 4-fold symmetry of ferritin may be independently fused through or without a linker.
  • the length and / or amino acid composition of the linker can be adjusted to control the spacing and orientation between antibody binding peptides near the 4-fold symmetry point.
  • Non-limiting examples of linkers include (Gly) 5 or (GlySer) 3 .
  • the length of the linker is adjustable by controlling the number of amino acids introduced.
  • One aspect of the invention is ⁇ 10 a.a. of the 4-fold symmetry point of ferritin upon nanoparticle formation by self-assembly of ferritin. It provides an antibody-binding peptide-ferritin fusion protein in which the antibody-binding peptide is fused in the range.
  • an aspect of the present invention provides a nucleic acid encoding an antibody-binding peptide-ferritin fusion protein according to the present invention, a recombinant vector comprising the nucleic acid, the nucleic acid or a transformant transformed with the recombinant vector.
  • one aspect of the present invention comprises the steps of i) preparing a recombinant expression vector comprising a nucleic acid according to the present invention; ii) preparing a transformant transduced with the recombinant expression vector; iii) expressing the antibody-binding peptide-ferritin fusion protein from the transformant of step ii); And iv) purifying the expressed antibody-binding peptide-six substructured nanoparticles having a 4-fold symmetry point by the self-assembly of the ferritin fusion protein.
  • the term 'vector' refers to a nucleic acid construct that is an expression vector capable of expressing a protein of interest in a suitable host cell and that includes essential regulatory elements operably linked to express the nucleic acid insert.
  • the present invention can produce a recombinant vector comprising a nucleic acid encoding the antibody-binding peptide-ferritin fusion protein.
  • a nucleic acid encoding an antibody-binding peptide-ferritin fusion protein or a recombinant vector including the nucleic acid may be transformed or transfected into a host cell.
  • the recombinant vector of the present invention can be obtained by linking (inserting) the nucleic acid of the present invention into an appropriate vector.
  • the vector into which the nucleic acid of the present invention is to be inserted is not particularly limited as long as it can be replicated in the host.
  • plasmid DNA, phage DNA and the like can be used.
  • Specific examples of plasmid DNA include commercial plasmids such as pCDNA3.1 + (Invitrogen).
  • Other examples of plasmids that may be used in the present invention include E.
  • coli derived plasmids pYG601BR322, pBR325, pUC118 and pUC119
  • Bacillus subtilis -derived plasmids pUB110 and pTP5
  • yeast-derived plasmids YEp13, YEp24 and YCp50.
  • phage DNA include ⁇ -phage (Charon4A, Charon21A, EMBL3, EMBL4, ⁇ gt10, ⁇ gt11 and ⁇ ZAP).
  • animal viruses such as retroviruses, adenoviruses or vaccinia viruses, insect viruses such as baculoviruses can also be used.
  • a fusion plasmid (eg, pJG4-5) to which a nucleic acid expression activating protein (eg, B42) is linked may be used, and such a fusion plasmid may be GST, GFP, His- tag, Myc-tag and the like, but the fusion plasmid of the present invention is not limited by the above examples.
  • a method of cutting the purified DNA with a suitable restriction enzyme and inserting it into a restriction site or a cloning site of the appropriate vector DNA can be used.
  • the nucleic acid of the present invention is preferably operably linked to a vector.
  • the vector of the present invention is a cis element such as an enhancer, a splicing signal, a poly A addition signal, and a selection marker. ), A ribosome binding sequence (ribosome binding sequence, SD sequence) and the like can be further included.
  • a selection marker chloramphenicol resistance nucleic acid, ampicillin resistance nucleic acid, dihydrofolate reductase, neomycin resistance nucleic acid, and the like may be used, but the additional components that are operably linked by the above examples are limited. no.
  • the term 'transformation' means that DNA is introduced into a host so that the DNA can be reproduced as a factor of a chromosome or by completion of chromosome integration. It means a phenomenon causing change.
  • transformation methods include CaCl 2 precipitation method, CaCl 2 method, Hanahan method which improves efficiency by using DMSO (dimethyl sulfoxide), electroporation, calcium phosphate precipitation, plasma fusion method, silicon carbide Agitation with fibers, agrobacterial mediated transformation, transformation with PEG, dextran sulfate, lipofectamine and dry / inhibition mediated transformation.
  • CaCl 2 precipitation method CaCl 2 method
  • Hanahan method which improves efficiency by using DMSO (dimethyl sulfoxide)
  • electroporation calcium phosphate precipitation
  • plasma fusion method silicon carbide Agitation with fibers
  • agrobacterial mediated transformation transformation with PEG, dextran sulfate, lipofectamine and dry / inhibition mediated transformation.
  • the method for transforming a nucleic acid encoding a antibody-binding peptide-ferritin fusion protein of the present invention or a vector comprising the same is not limited to the above examples, and transformation or transfection methods commonly used in the art may be used without limitation. Can be.
  • the transformant of the present invention can be obtained by introducing a nucleic acid encoding an antibody-binding peptide-ferritin fusion protein as a target nucleic acid or a recombinant vector comprising the same into a host.
  • the host is not particularly limited as long as the host is allowed to express the nucleic acid of the present invention.
  • Specific examples of hosts that can be used in the present invention include Escherichia genus bacteria such as E. coli; Bacillus Bacillus (Bacillus) in bacteria such subtilis (Bacillus subtilis); Pseudomonas genus bacteria such as Pseudomonas putida ; Lactic acid bacteria such as Lactobacillus and Enterococcus; Yeasts such as Saccharomyces cerevisiae , Schizosaccharomyces pombe ; Animal cells and insect cells.
  • the recombinant vector of the present invention is capable of autonomous replication in the host and consists of a promoter, a ribosomal binding sequence, a nucleic acid of the present invention, and a transcription termination sequence. have.
  • the promoter of the present invention can be used as long as it allows expression of the nucleic acid of the present invention in a host such as E. coli.
  • E. coli or phage-derived promoters such as, for example, trp promoter, lac promoter, PL promoter or PR promoter; E. coli infected phage-derived promoters such as the T7 promoter can be used.
  • Artificially modified promoters can also be used, such as the tac promoter.
  • Nucleotide sequences encoding antibody-binding peptide-ferritin fusion proteins according to the present invention can be optionally linked to appropriate regulatory nucleotide sequence (s) using methods known in the art to control expression of such coding sequences (e.g. See, eg, Sambrook et al. , 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, Cold Spring Harbor Laboratory Press, NY.
  • operably linked refers to the linking of nucleotide sequence elements in a functional relationship.
  • an “operably linked” promoter may have regulatory elements present at appropriate positions and orientations relative to the nucleotide coding sequence to control RNA polymerase initiation and expression of the nucleic acid (eg, it may affect transcription of the coding sequence). Effect).
  • the promoter region may be a promoter present in any prokaryotic cell.
  • the antibody binding peptide-ferritin fusion protein coding sequence can be operably linked to a nucleotide sequence encoding a signal peptide (SP) such that the gene product is secreted out of the bacteria and introduced into the culture medium.
  • SP signal peptide
  • the plasmid vector may further comprise other sequences as necessary.
  • the sequence which may be further included may be a tag sequence for protein purification, such as glutathione S-transferase (Pharmacia, USA), MBP (maltose binding protein, USA), FLAG (IBI, USA) and hexahistidine ( hexahistidine; Quiagen, USA) and the like, and most preferably MBP, but the examples do not limit the type of sequence required for purification of the target protein.
  • a fusion protein expressed by a vector containing the fusion sequence it can be purified by affinity chromatography.
  • glutathione-S-transferase which is a substrate of the enzyme
  • MBP amylose column
  • Host cells transformed by the above method to express the antibody-binding peptide-ferritin fusion protein of the present invention can be cultured by conventional methods used in the art.
  • the transformant expressing the antibody-binding peptide-ferritin fusion protein can be cultured in various media, fed-batch culture, continuous culture, etc.
  • the method for culturing the transformant of the present invention is not limited.
  • the carbon source that may be included in the medium for the growth of the host cell may be appropriately selected according to the judgment of those skilled in the art according to the type of transformant produced, and appropriate culture conditions may be adopted to control the timing and amount of culture. Can be.
  • the transformant which has been successfully transformed with the target protein produces an antibody-binding peptide-ferritin fusion protein, and the antibody-binding produced according to the composition of the vector and the characteristics of the host cell.
  • Peptide-ferritin fusion proteins can be secreted into the cytoplasm of the host cell, into the periplasmic space or extracellularly.
  • the protein of interest may also be expressed in soluble or insoluble form.
  • Proteins expressed in or outside the host cell can be purified in a conventional manner.
  • purification methods include salting out (eg, ammonium sulfate precipitation, sodium phosphate precipitation, etc.), solvent precipitation (eg, protein fraction precipitation with acetone, ethanol, etc.), dialysis, gel filtration, ion exchange, reverse phase column chromatography. Techniques such as chromatography and ultrafiltration may be applied alone or in combination to purify the proteins of the invention.
  • the kind of the antibody that binds to the antibody-binding peptide in the nanoparticles of the present invention is not limited as long as it can bind to the antibody-binding peptide, and includes an Fc, a fragment thereof, or a derivative / analogue thereof that can bind to the antibody-binding peptide.
  • an antibody, fragment, derivative or analog of the antibody Preferably the antibody is an IgG.
  • Antibody derivatives include, but are not limited to, antibodies modified by glycosylation, acetylation, PEGylation, phosphorylation, amidation, induction by known protecting / blocking groups, proteolysis, intracellular ligands or other proteins, and the like. Any of a variety of chemical modifications can be performed by known techniques including, but not limited to, specific chemical degradation, acetylation, formylation, metabolic synthesis of tunicamycin, and the like. In addition, the derivative may contain one or more nonclassical amino acids.
  • Antibodies include both polyclonal and monoclonal antibodies, as well as specific recombinant antibodies such as chimeric, humanized or human antibodies.
  • the antibody may be a receptor-specific antibody or a ligand-specific antibody.
  • Antibodies in the present invention may also be receptor-specific antibodies that do not prevent ligand binding but prevent receptor activation.
  • the antibody binding to the nanoparticles according to the present invention may be a therapeutic antibody, an antibody capable of binding to a separate therapeutic agent or a diagnostic agent, an antibody for targeting without a therapeutic effect, or simply an antigen- It may be an antibody capable of an antibody reaction.
  • the therapeutic or diagnostic agent may bind to the antibody, but may be carried by the nanoparticles according to the present invention.
  • therapeutic antibodies have been approved by the FDA and have almost the same properties as IgG present in vivo, and their safety is very high.
  • Therapeutic antibodies are used for a wide range of disease treatments (e.g. transplant rejection, cancer, autoimmune diseases and inflammation, heart disease, infectious infections, etc.) and these antibodies are receptor proteins or antigenic proteins that are specific to the diseased tissue. Because it recognizes and binds, its specificity is very high. Therefore, combining molecular imaging probes or drug carriers with therapeutic antibodies can convert them to terragnosis formulations that can monitor the course of treatment with drug co-effects.
  • the present invention can provide a technique for developing a target-oriented terragnosis material with an antibody after introducing an FcBP fusion protein into biologically derived ferritin, introducing molecular imaging probes, therapeutic drugs, and the like.
  • Drugs carried by the nanoparticles of the present invention include therapeutic agents, diagnostic agents / detectors.
  • Non-limiting examples of therapeutic agents include antibodies, antibody fragments, drugs, toxins, nucleases, hormones, immunomodulators, chelators, boron compounds, photoactive agents or dyes, and radioisotopes. do.
  • Non-limiting examples of diagnostic / detection agents include radioisotopes, dyes (e.g., biotin-streptavidin complexes), contrast agents, fluorescent compounds or fluorescent proteins, and magnetic resonance imaging (MRI) imaging. Enhancers (paramagnetic ions).
  • the diagnostic agent includes radioisotopes, magnetic resonance imaging (MRI) contrast enhancers, and fluorescent compounds.
  • MRI magnetic resonance imaging
  • the tail is a polymer such as polylysine, polysaccharide, or ethylenediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTPA), porphyrin, polyamine, crown ether, bis-thiosememi It may be a derivatized or derivatized chain having pendant groups that can be combined with chelating groups such as thiazemicarbazone, polyoximes and having groups known to be useful for this purpose. Chelates are bound to antibodies using standard chemistry. Chelates can normally be linked to antibodies by groups capable of forming a bond to the molecule with minimal loss of immunoreactivity and minimal aggregation and / or internal crosslinking.
  • Fluorescent materials for the diagnosis and detection include fluorescent compounds such as rhodamine, Alexa derivatives, cyanine derivatives, FAM, TAMRA, FITC, PE, PerCP, APC, coumarin or derivatives thereof, or GFP, eGFP, CFP, eCFP, YFP It may be, but not limited to, fluorescent proteins such as RFP. Preferably may be cyanine derivatives such as Cy3, Cy3.5, Cy5, Cy5.5 and Cy7.
  • the fluorescent material may bind to the nanoparticles of the present invention directly or through a linker.
  • useful metal-chelate combinations include diagnostic isotopes and 2-benzyl-DTPA and monomethyl and cyclohexyl analogs thereof used in the general energy range of 60 to 4,000 keV, for example imaging agents and / or therapeutic agents Radioisotopes used as 125 I, 131 I, 123 I, 124 I, 62 Cu, 64 Cu, 67 Cu, 186 Re, 188 Re, 82 Rb, 177 Lu, 18 F, 153 Sm, 213 Bi, 111 In, 67 Ga, 68 Ga, 89 Sr, 169 Er, 192 Ir, 111 In, 90 Y, 99 mTc, 94 mTc, 11 C, 13 N, 15 O, 76 Br and the like.
  • transition metal ions such as manganese (Mn), iron (Fe), and gadolinium (Gd) among non-radioactive metals are useful for MRI as paramagnetic materials.
  • the chelating agent may be complexed with a macrocyclic chelating agent such as DTPA, NOTA, DOTA, MS325, HPDO3A, EDTA, NTA and TETA, depending on the type of metal, and the complex may be a nanoparticle or an antibody of the present invention. Can be used in combination.
  • Radionuclides of gallium, yttrium and copper can be preferably used with radionuclides of gallium, yttrium and copper, respectively, and the metal-chelate complex can be prepared very stably by tailoring the ring size to the metal of interest.
  • Cyclic chelates such as macrocyclic polyethers useful for stably binding to nuclides such as 223 Ra used in radiation and imaging technology (RAIT) may also be included within the scope of the present invention.
  • a nanoparticle comprising a mutein substituted or inserted with cysteine in the natural ferritin of the present invention
  • cysteine itself has a high affinity with heavy metals, and also includes a highly reactive thiol group, which facilitates the coupling with other reactors, thereby facilitating the introduction of drugs using the linkage directly or through a linker. Can be.
  • the chelating agent to be bound to the metal ions listed above to include maleimide or acetamide capable of binding to the thiol group of cysteine, covalent bonds can be formed with the cysteine exposed to the inside / outside of the nanoparticles.
  • the nanoparticles prepared using the mutein introduced with the cysteine for the same reason as described above, not only metal elements but also other types of drugs such as antibodies, antibody fragments, drugs, toxins, nucleases, hormones, and immunity.
  • Diagnosis of therapeutic agents and dyes such as modulators, chelators, boron compounds, photoactive agents or dyes (e.g. biotin-streptavidin complexes), contrast agents, fluorescent compounds or fluorescent proteins Delivery of the agent / detector may also be facilitated.
  • Immunoconjugates are conjugates of therapeutic or diagnostic agents with antibody components.
  • the diagnostic agent may include a radioactive or nonradioactive label, a contrast agent (contrast agent suitable for magnetic resonance imaging, computed tomography, or ultrasound), and the radiolabel may be gamma-, beta-, alpha-, Auger electron- or Positron emitting isotopes.
  • Immunomodulators are therapeutic agents, as defined herein, and are typically immune or proliferated or activated in an immune response cascade, such as macrophage, B-cell, and / or T-cell. Stimulates cells Examples of such immunomodulators are cytokines. Those skilled in the art will understand that interleukins and interferons are a type of cytokine that stimulates T-cell or other immune cell activity.
  • One aspect of the present invention provides a protein chip comprising the nanoparticles for immobilizing the antibody according to the present invention.
  • the antibody may be bound to the antibody-binding peptide of the nanoparticles.
  • an aspect of the present invention comprises the steps of preparing the protein chip; Immobilizing the antibody against the antigen to be detected on the protein chip; Reacting a sample with a protein chip comprising the immobilized antibody; And it provides an antigen detection method comprising the step of measuring the antigen-antibody reaction.
  • the antibody-immobilized nanoparticles of the present invention may be immobilized on a solid substrate.
  • the solid substrate is not limited as long as it is used in a biochip. However, preferably, commonly used polymers or gels such as gold, glass, modified silicon, tetrafluoroethylene, polystyrene, and polypropylene may be used.
  • the surface of the substrate may also be surface treated with polymers, plastics, resins, carbohydrates, silicas, silica derivatives, carbons, metals, inorganic glasses and films.
  • the substrate not only serves as a support but also provides a place for the binding reaction between the immobilized antibody and the antigen to occur.
  • the size of the substrate and the position, size, and shape of the substrate to be fixed on the substrate may vary depending on the purpose of the analysis, a spotting machine, a scanner, and the like.
  • an immobilized antibody on the protein chip of the present invention may be collected from a sample, preferably a patient.
  • Antigens can be detected by reacting with a blood or body fluid or the like to confirm antigen-antibody reaction.
  • different chromophores may be used depending on the type of antibody, and at the same time, various types of antigens may be searched using fluorescence of various colors.
  • the antigen to be detected is not particularly limited as all bioactive materials detectable by immunoassay methods, for example, autoantibodies, ligands, natural extracts, peptides, proteins, metal ions, synthetic drugs , Natural drugs, metabolites, genomes, viruses and virus-producing materials, and bacteria and viruses-producing materials may be one or more selected from the group consisting of, but is not limited thereto.
  • the target sample for measuring the concentration or the concentration of such an antigen may be used without any treatment or diluted with a suitable buffer solution. After incubation for a suitable time, the target material that has not yet been bound to the capture antibody and the other material in the sample that cannot be bound may be further washed and removed before performing the next step.
  • Recombinant DNA production method for producing an antibody-binding peptide-ferritin fusion protein is as follows (Fig. 3).
  • ferritin (SEQ ID NO: 1) derived from the existing microorganism ( Pyrococcus furiosus ) was used.
  • the microorganism-derived ferritin gene was amplified with primers P1 (SEQ ID NO: 2; 5'-aaaacatatgttgagcgaaagaatgctcaaggc-3 ') and P2 (SEQ ID NO: 3; 5'-aaaaaggatccttactctcctcccctgc-3'), and then the vector pET using restriction enzymes NdeI, BamHI. Cloned to 30 (b). The cloned ferritin gene was confirmed by sequencing.
  • An antibody binding peptide sequence (SEQ ID NO: 4) with linker amino acid was introduced between 144 and 145 of the ferritin protein.
  • SEQ ID NO: 4 CGGGGGG DCAWHLGELVWCT GGGGGAS
  • the underlined portion is an antibody binding peptide (FcBP), and the sequences in the FcBP sock end are each linkers.
  • FcBP antibody binding peptide
  • a primer P3 of SEQ ID NO: 13 and P4 of SEQ ID NO: 14 (5'-aaactagtctggtgcaccggtggtggtggtggtggtgctagcgacagtcctcaaatattgttc-3 '; 5'-aaactagttctcccaggtacccactcaccaccacactcactcaccgtcaccgtcacccgtcacccgtcacccgtcacccgtcacccgtcacccgtcacccgtcacccgtcacccgtccccgtcacccgtcacccgtca
  • a circular plasmid DNA was obtained through conjugation after processing with the restriction enzyme SpeI. DNA base sequence measurements confirmed the insertion of the DNA base sequence encoding the FcBP sequence.
  • E. coli (Rosetta DE3, Novagen) was transformed with plasmid DNA corresponding to ferritin-FcBP, and IPTG (Isopropyl- ⁇ -D-thio-galactoside) was added to 1 mM and incubated at 18 ° C. for 16 hours. Expression of the protein was induced.
  • E. coli expressing ferritin-FcBP was suspended in cell lysate (50 mm Tris pH 7.5, 250 mM NaCl, 5% glycerol, 0.5% 2-mercaptoethanol) and disrupted with an ultrasonic generator. This was centrifuged to heat only the supernatant for 30 minutes at 100 °C and centrifuged to separate the supernatant again. The separated supernatant was purified by passing through a Superose-6 (GE Healthcare) column using 50 mM Na 2 HPO 4 pH6.5, 100 mM NaCl to purify the final ferritin-FcBP protein. Purified protein was confirmed by SDS-PAGE analysis of protein monomer size and purified protein purity.
  • Purified ferritin-FcBP forms an aggregate structure of 24 monomers, and the size of the complex was confirmed by confirming the time point at which protein was eluted from Superose-6 (FIG. 4), and spherical form was determined using a transmission electron microscope (TEM). The form of the ferritin-FcBP complexes were confirmed (FIG. 5).
  • the BIAcore 3000 analyzer (BIACORE, Uppsala, Sweden) was used to determine the mutual binding between H IgG and PyFn-FcBP by the SPR method.
  • H IgG protein (20 ⁇ g) at a flow rate of 10 ⁇ l / min was applied to CM5 sensor chips (BIACORE, Uppsala, Sweden) activated with EDC / NHS (N '-(3-dimethylaminopropyl) carbodiimide hydrochloride / N-hydroxysuccinimide).
  • EDC / NHS N '-(3-dimethylaminopropyl) carbodiimide hydrochloride / N-hydroxysuccinimide
  • Ml in 10 mM Sodium acdetate, pH 4.5 was fixed for 7 minutes by flowing.
  • the active part remaining on the surface of the sensor chip was deactivated by adding 1.0 M ethanolamine (pH 8.0).
  • PyFn-FcBP was diluted in a buffer solution (1 X PBS, pH 7.4) for each concentration, and the binding sensorgram and dissociation sensorgram were confirmed while flowing at a flow rate of 30 ⁇ l / min (FIG. 6).
  • a buffer solution (1 X PBS, pH 7.4) for each concentration, and the binding sensorgram and dissociation sensorgram were confirmed while flowing at a flow rate of 30 ⁇ l / min (FIG. 6).
  • BSA bovine serum albumin
  • the surface of the sensor chip was regenerated by flowing a regeneration buffer (20 mM NaOH).
  • Example 3-1 In order to measure the degree of mutual binding between R IgG and PyFn-FcBP by the SPR method, a BIAcore 3000 analyzer (BIACORE, Uppsala, Sweden) was used as in Example 3-1, and sensor chip surface treatment was performed in the same manner.
  • R IgG protein (20 ⁇ g / ml in 10) at a flow rate of 10 ⁇ l / min on a CM5 sensor chip (BIACORE, Uppsala, Sweden) activated with EDC / NHS (N '-(3-dimethylaminopropyl) carbodiimide hydrochloride / N-hydroxysuccinimide) mM Sodium acdetate (pH 4.5) was fixed for 7 minutes by flowing. The active part remaining on the sensor chip surface was deactivated by adding 1.0 M ethanolamine (pH 8.0).
  • PyFn-FcBP was diluted in a buffer solution (1 X PBS, pH 7.4) for each concentration, and the binding sensorgram and dissociation sensorgram were confirmed while flowing at a flow rate of 30 ⁇ l / min (FIG. 7).
  • a buffer solution (1 X PBS, pH 7.4) for each concentration
  • the binding sensorgram and dissociation sensorgram were confirmed while flowing at a flow rate of 30 ⁇ l / min (FIG. 7).
  • cells that were completely inactivated with BSA were used, and nonspecific binding was corrected by subtracting sensorgrams of BSA from sensorgrams of PyFn-FcBP.
  • the surface of the sensor chip was regenerated by flowing regeneration buffer (20 mM NaOH).
  • the PyFn-FcBP protein was added to the antibody protein immobilized on the CM5 sensor chip.
  • the bound sensorgrams were examined while flowing at a concentration of 500, 250, 100, 50, 25, 10, 5 nM.
  • the PyFn-FcBP protein shows a sensorgram that specifically binds to the antibody Fc domain, and the increase in RU value according to the amount of PyFn-FcBP bound is increased in proportion to the concentration of PyFn-FcBP. It can be seen.
  • the PyFn-FcBP protein was added to the antibody protein immobilized on the CM5 sensor chip.
  • the binding sensorgrams were examined while flowing at a concentration of 500, 250, 100, 50, 25, 10 nM.
  • the PyFn-FcBP protein shows a sensorgram that specifically binds to the antibody Fc domain, and the increase in the RU value according to the amount of PyFn-FcBP bound increases in proportion to the concentration of PyFn-FcBP. It can be seen.
  • Herceptin In order to confirm whether or not Herceptin, an antibody therapeutic drug, is selectively delivered to specific cells using ferritin-FcBP, SKBR3 (HER2 / neu +), a breast cancer cell overexpressing the HER2 / neu receptor, was selected, and as a control, HER2 / neu receptor was expressed. MCF10A, which is not a breast cell, was selected. Herceptin is a commercially available breast cancer drug that binds to HER2 / neu receptors and interferes with downstream signaling, resulting in anti-cancer antibodies. SKBR3 was cultured using Dulbecco's Modified Eagle's Medium (DMEM, Gibco) medium containing 10% FBS (fetal calf serum) and 1% penicillin / streptomycin.
  • DMEM Dulbecco's Modified Eagle's Medium
  • MCF10A was prepared using DMEM / F12 (Gibco) medium containing 5% horse serum, 20 ng / ml EGF, 0.5 mg / ml hydrocortisone, 100 ng / ml cholera toxin, 10 ⁇ g / ml insulin, and 1% penicillin / streptomycin. Incubated.
  • Ferritin-FcBP, Herceptin, and human IgG used in the experiments were labeled with fluorescent materials.
  • Ferritin-FcBP introduced fluorescein-5-maleimide (Invitrogen), and antibodies Herceptin and human IgG were introduced with CY3 (GE Healthcare).
  • the method of introducing a fluorescent material is as follows. The fluorescent material corresponding to the molar number of about 10 times or more with respect to the protein was reacted for 1 to 2 hours at room temperature in the presence of phosphate buffer (pH 7.5 to 8.0). PD10 (GE Healthcare), a desalting column, was used to remove excess fluorescent material that did not participate in the reaction and recover only the protein into which the fluorescent material was introduced. The recovered protein was quantified using the Bradford Assay.
  • Example 4-2 SKBR3 (HER2 / neu +)
  • SKBR3 was cultured using DMEM (Gibco) medium containing 10% FBS and 1% penicillin / streptomycin. Herceptin-CY3 and ferritin-FcBP-fluorescein-5-maleimide and human IgG-CY3 and ferritin-FcBP-fluorescein-5-maleimide were reacted for 15 minutes in the presence of DMEM to bind each antibody to ferritin. SKBR3 was treated with two kinds of antibody-ferritin, washed with PBS after reaction for 30 minutes, and fluorescence images were observed (FIG. 9).
  • Fluorescence images showed that fluorescence of CY3 and fluorescein were observed simultaneously in Herceptin-CY3 and ferritin-FcBP-fluorescein-5-maleimide-treated samples. Through this, SKBR3 cells were targeted by Herceptin and ferritin construct and Herceptin It was confirmed that the binding.
  • MCF10A was prepared using DMEM / F12 (Gibco) medium containing 5% horse serum, 20 ng / ml EGF, 0.5 mg / ml hydrocortisone, 100 ng / ml cholera toxin, 10 ⁇ g / ml insulin, and 1% penicillin / streptomycin. Incubated. Herceptin-CY3 and ferritin-FcBP reacted with fluorescein-5-maleimide and human IgG-CY3 and ferritin-FcBP reacted with fluorescein-5-maleimide for 15 minutes in the presence of DMEM to bind each antibody to ferritin. After treating two kinds of antibody-ferritin to MCF10A and reacting with PBS for 30 minutes, the fluorescence image was observed (Fig. 10). No fluorescence was observed in the MCF10A cell line.
  • Figure 11 is a fluorescence image showing the results of the treatment in the SKBR3 cell line after changing the binding conditions of ferritin-FcBP and Herceptin to solve the problem of protein precipitation occurs in the experiment performed in FIG.
  • Ferritin-FcBP-fluorescein-5-maleimide was reacted for 15 minutes in the presence of DMEM containing 0.05% TWEEN 20 to bind each antibody to ferritin.
  • SKBR3 was treated with antibody-ferritin, reacted for 30 minutes, washed with PBS, and fluorescence images were observed. As a result, it was observed that excessively occurring protein precipitation was reduced.
  • Human-derived ferritin genes (SEQ ID NOs: 5, 6, FIG. 12) were distributed from the 21st Century Frontier Human Gene Bank (clone numbers: hMU001607, hMU011497).
  • the human-derived ferritin gene was amplified using primers P1 (SEQ ID NO: 7; 5'-gggaattc catatg agctcccagattcgtcagaat-3 ') and P2 (SEQ ID NO: 8'5'-ccgctcgagttagtcgtgcttgagagtgagcct-3'), followed by restriction enzymes NdeI and XhoI.
  • P1 SEQ ID NO: 7; 5'-gggaattc catatg agctcccagattcgtcagaat-3 '
  • P2 SEQ ID NO: 8'5'-ccgctcgagttagtcgtgcttgagagtgagcc
  • An antibody binding peptide sequence was introduced between 157 and 158 of the ferritin protein. Mutagenesis-directed with murine It was. Subsequently, a human peptide was introduced using a mutation to bind the antibody by using Q3 (SEQ ID NO: 11; 5'-gactgtgcatggcacctgggagaactggtctggtgcaccgaggctgggctgggcgagtat-3 ') and Q4 (SEQ ID NO: 12; 5'-atactcgcccagcccagcctcggtgcaccagaccagttctcccaggtgccatgcacagtc-3). Ferritin gene was constructed.
  • the plasmid DNA corresponding to human-derived ferritin-FcBP was transformed with Escherichia coli (Rosetta DE3, Novagen), and then incubated for 16 hours at 18 ° C. after adding IPTG (Isopropyl- ⁇ -D-thio-galactoside) to 1 mM. Expression of the protein was induced.
  • E. coli expressing human-derived ferritin-FcBP was suspended in cell lysate (50 mm Tris pH 7.5, 250 mM NaCl, 5% glycerol, 0.5% ⁇ -mercaptoethanol) and disrupted with an ultrasonic generator. The supernatant was centrifuged and purified by a batch method using Talon resin (Clontech). The protein purification using the batch method is described in detail as follows. 10 ml column buffer solution (50 mM Tris pH 7.5, 250 mM NaCl, 5% glycerol, 0.05% ⁇ -mercaptoethanol) was washed twice with activation of talon resin (1 ml), and the supernatant separated above was added thereto.
  • cell lysate 50 mm Tris pH 7.5, 250 mM NaCl, 5% glycerol, 0.5% ⁇ -mercaptoethanol
  • the protein is adsorbed onto the talon resin by shaking slowly at 4 ° C. for 1 hour. After the aqueous solution was filtered off, the Talon resin was washed twice with column buffer solution (10 mL), and then 10 mL of elution buffer (100 mM imidazole) was added, followed by slow rocking for 1 hour. Filtration was repeated once more using 5 ml of elution buffer to increase yield. Protein purified by the above method was quantified by Bradford assay, and the result of overexpression and purification of human-derived ferritin into which antibody-binding peptide was introduced by estimating the size of the protein through 15% SDS-PAGE gel. (FIG. 13).
  • Example 7 Determination of antibody binding capacity of human-derived ferritin-antibody binding peptide complex
  • the BIAcore 3000 analyzer (BIACORE, Uppsala, Sweden) was used to determine the mutual binding between H IgG and human derived ferritin-FcBP by the SPR method.
  • H IgG protein (20 ⁇ g) at a flow rate of 10 ⁇ l / min was applied to CM5 sensor chips (BIACORE, Uppsala, Sweden) activated with EDC / NHS (N '-(3-dimethylaminopropyl) carbodiimide hydrochloride / N-hydroxysuccinimide).
  • EDC / NHS N '-(3-dimethylaminopropyl) carbodiimide hydrochloride / N-hydroxysuccinimide
  • Ml in 10 mM Sodium acdetate, pH 4.5 was fixed for 7 minutes by flowing.
  • the active part remaining on the surface of the sensor chip was deactivated by adding 1.0 M ethanolamine (pH 8.0).
  • Human-derived ferritin-FcBP was diluted in a buffer solution (1 X PBS, pH 7.4) for each concentration, and the binding sensorgram and dissociation sensorgram were checked while flowing at a flow rate of 30 ⁇ l / min (FIG. 14).
  • a buffer solution (1 X PBS, pH 7.4) for each concentration
  • the binding sensorgram and dissociation sensorgram were checked while flowing at a flow rate of 30 ⁇ l / min (FIG. 14).
  • cells completely deactivated only with BSA were used, and nonspecific binding was corrected by subtracting BSA sensorgrams from human-derived ferritin-FcBP sensorgrams.
  • the surface of the sensor chip was regenerated by flowing regeneration buffer (20 mM NaOH).
  • Example 8 Incorporation of cysteine residues into human-derived ferritin-antibody-binding peptide complex
  • SEQ ID NO: 35 is the amino acid sequence of the human-derived ferritin-antibody-binding peptide complex and includes a linker sequence (CGGGGGGD and TGGGGGAS) at the end of the antibody-binding peptide (CAWHLGELVWC).
  • E 61 (Glu), 68 K (Lys), and 137 E (Glu) were substituted with cysteine and 2 S (to introduce cysteine to the outside of the nanostructure).
  • E61C forward (SEQ ID NO: 15): 5'-gccgaggagaagcgctgcggctacgagcgtctcctg-3 '
  • E61C reverse (SEQ ID NO: 16): 5'-caggagacgctcgtagccgcagcgcttctcctcggc-3'
  • K68C forward (SEQ ID NO: 17): 5'-ggctacggcgtctaaa (SEQ ID NO: 18): 5'-acgctggttttgcatgcacaggagacgctcgtagcc-3 '
  • E137C forward (SEQ ID NO: 19): 5'-actcacttcctagattgcgaagtgaagcttatcaag-3'
  • E137C reverse (SEQ ID NO: 20): 5'-cttgataagcttcacttcg2g
  • PCR for site-directed mutagenesis involves initial denaturation at 95 ° C for 5 minutes, denaturation at 95 ° C for 30 seconds, primer binding at 45 ° C for 1 minute, and elongation at 68 ° C for 12 minutes.
  • DNA was amplified by repeating 17 to 19 times, and treated with the restriction enzyme DpnI to remove the template DNA, transformed into E. coli and confirmed the DNA sequence was confirmed that the mutation is induced.
  • human-derived ferritin-FcBP genes with cysteines inserted at various positions were constructed. Plasmid DNA corresponding to cysteine-incorporated ferritin-FcBP was transformed with Escherichia coli (Rosetta DE3, Novagen), and 16 hours at 18 ° C.
  • E. coli expressing the human-derived ferritin-FcBP introduced with cysteine prepared in Example 8 was suspended in cell lysate (50 mM Tris pH 7.5, 250 mM NaCl, 5% glycerol, 0.5% ⁇ -mercaptoethanol). It was crushed by an ultrasonic generator. The supernatant was centrifuged and purified by a batch method using Talon resin (Clontech). The protein purification using the batch method is described in detail as follows.
  • Protein purified by the above method was quantitated by Bradford assay, and the result of overexpression and purification of human-derived ferritin into which antibody-binding peptide was introduced by estimating the size of the protein through 15% SDS-PAGE gel. (FIG. 15).
  • Example 10 Pyrococcus furiosus Introduction of cysteine residues into the derived ferritin-antibody-binding peptide complex (microbial ferritin-FcBP)
  • SEQ ID NO: 38 is the amino acid sequence of the human-derived ferritin-antibody-binding peptide complex and includes a linker sequence (CGGGGGGD and TGGGGGAS) at the end of the antibody-binding peptide (CAWHLGELVWC).
  • GGC amino acid sequence containing at least one cysteine residue was inserted after positions 161 and 174 to introduce cysteines into the nanostructure, and the first and second portions to introduce cysteines to the outside of the nanostructure. Cysteine was inserted between amino acids. The inserted sites are based on native ferritin sequences, not complexes with antibody binding peptides.
  • the base sequence of the primer used is as follows.
  • Cysteine-inserted ferritin-FcBP gene was constructed by performing site-directed mutagenesis. Plasmid DNA corresponding to cysteine-inserted ferritin-FcBP was transformed into Escherichia coli (BL21 DE3, Novagen), and 16 hours at 18 ° C. after adding IPTG (Isopropyl- ⁇ -D-thio-galactoside) to 1 mM Incubated to induce expression of the protein. In the case of ferritin-FcBP, three kinds of mutants having cysteine residues inserted at different positions were prepared, and these mutants were confirmed to be expressed in the form of water-soluble proteins when incubated at 18 ° C. for 16 hours (FIG. 16). .
  • Bacterial or human-derived protein nanoparticles were dissolved in 50 mM phosphate buffer at pH 7.5 deoxygenated, treated with 10 mM TCEP for 30 minutes, and excess organic reagent was removed using a PD10 column to recover proteins.
  • the recovered protein nanoparticle solution was then (S) -2- (4- (2-bromoacetamido) benzyl) -DOTA ((S) -2- (4- (2-bromoacetamido) benzyl shown in FIG. 17.
  • -DOTA diethylene triamine pentaacetic acid-maleimidoethylamide
  • DTPA-MEA diethylene triamine pentaacetic acid-maleimidoethylamide
  • DTPA-BAEA diethylene triamine pentaacetic acid-bromoacetamidoethylamide
  • DTPA-BAEA bromoacetamidoethylamide

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Radiology & Medical Imaging (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Nanotechnology (AREA)
  • Molecular Biology (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)

Abstract

본 발명은 항체결합 펩타이드-페리틴 융합단백질 단량체 24개를 포함하는 나노입자로서, 페리틴에 의해 4-폴드 대칭점(4-fold symmetry point)을 가진 6개의 부분구조가 형성되며, 페리틴 중 4-폴드 대칭점의 ±10 a.a. 범위에 항체결합 펩타이드가 융합되어 4-폴드 대칭점 부근에 4개의 항체결합 펩타이드가 위치하는 것이 특징이 나노입자; 및 이의 용도에 관한 것이다. 본 발명은 항체 결합펩타이드의 서열을 페리틴에 도입함으로써 융합단백질을 제조하고 이를 이용하여 항체가 항체의 구조를 손상시키지 않고도 강력하게 페리틴에 결합하게 함으로써, 바이오칩, 약물전달시스템, 질병진단 및 치료제 개발 등에 활용할 수 있다.

Description

항체결합 펩타이드-페리틴 융합단백질 및 이의 용도
본 발명은 항체결합 펩타이드와 페리틴의 융합단백질(FcBP-페리틴) 및 이의 용도에 관한 것이다.
또한, 본 발명은 항체결합 펩타이드-페리틴 융합단백질 단량체 24개를 포함하는 나노입자로서, 페리틴에 의해 4-폴드 대칭점(4-fold symmetry point)을 가진 6개의 부분구조가 형성되며, 페리틴 중 4-폴드 대칭점의 ±10 a.a.(amino acid) 범위에 항체결합 펩타이드가 융합되어 4-폴드 대칭점 부근에 4개의 항체결합 펩타이드가 위치하는 것이 특징인 나노입자; 및 이의 용도에 관한 것이다.
페리틴은 철을 저장하는 단백질로써 원핵생물과 진핵생물에 널리 존재하고 있다. 페리틴의 분자량은 약 500,000 Da으로, 중쇄(Heavy chain)와 경쇄(Light chain)로 구성되어 있고, 자가 조립 능력이 있어 구형 입자를 형성하는 독특한 특성을 나타낸다. 페리틴은 24개의 단량체(중쇄 혹은 경쇄 중 하나로 구성된 단일 단량체 혹은 이종 단량체)가 모여서 거대한 구 형태의 삼차구조를 형성한 단백질로써, 인간 페리틴의 경우 외경은 약 12 nm이고 내경은 약 8 nm이다. 페리틴은 pH 조건에 따라 단량체로 흩어지기도 하고 24개의 단량체가 결합한 나노입자를 형성하기도 하는데 이러한 특성을 이용하면 페리틴 내에 다양한 물질을 포집할 수 있다(Wang, Z.; Li, C.; Ellenburg, M.; Soistman, E.; Ruble, J.; Wright, B.; Ho, J. X.; and Carter, D. C., (2006) Acta Crystallographica Section D: Biological Crystallography, 62: 800-806). 일반적으로는 나노입자 모양의 페리틴은 내부에 산화철(iron oxide)을 가지고 있으나, 이 외에도 산화망간(Mn(O)OH and Mn3O4), 산화코발트(Co(O)OH and Co3O4), 산화크롬(Cr(OH)3), 산화니켈(Ni(OH)3), 산화인듐(In2O3), 황화철(FeS), 황화카드뮴(CdS), 셀레노카드뮴(CdSe), 및 셀레노아연(ZnSe) 등 다양한 무기 금속을 포함한 페리틴의 제조에 대한 사례들이 보고되어 있다(Mackle, P.; Charnock, J. M.; Garner, C. D.; Meldrum, F. C.; and Mann, S., (1993) J. Am. Chem. Soc., 115: 8471; Meldrum, F. C.; Douglas, T.; Levi, S.; Arosio, P.; and Mann, S., (1995) J. Inorg. Biochem., 58: 59; Tsukamoto, R.; Iwahor, K.; Muraoka, M.; and Yamashita, I., (2005) Bull. Chem.Soc. Jpn., 78: 2075; Okuda, M.; Iwahori, K.; Yamashita, I.; and Yoshimura, H., (2003) Biotechnol. Bioeng., 84: 187; Ueno, T.; Suzuki, M.; Goto, T.; Matsumoto, T.; Nagayama, K.; and Watanabe, Y., (2004) Angew. Chem. Int. Ed., 43: 2527). 또한, 금속과 선택적으로 결합하는 펩타이드를 이용하여, 예를 들어 은과 결합하는 펩타이드를 이용하여 은을 포집한 페리틴을 합성한 사례도 보고되고 있다(Kramer, R. M.; Li, C.; Carter, D. C.; Stone, M. O.; and Naik, R. R., (2004) J. Am. Chem. Soc., 126(13): 282). 특히 MRI 조영제인 Gd-HPDOTA(gadolinium-[10-(2-hydroxypropyl)-1,4,7,10-tetraazacyclododecane-1,4,7-triacetic acid]를 포집시킨 페리틴도 보고되어 있다(Aime, S.; Frullano, L.; and Crich, S. G., (2002) Angew. Chem. Int. Ed., 41: 1017). 이처럼 페리틴의 내ㆍ외부는 분자생물학적 방법을 통해 다양한 기능단을 도입할 수 있으며, 다양한 기능단이 도입된 페리틴 구조체는 선택적인 방법으로 적절한 기능단을 이용한 수식(modification)이 가능하며 필요한 다양한 물리화학적 성질을 부여할 수 있는 장점을 가지게 된다. 한 예로, 특정 금속에 선택적으로 결합하는 펩타이드 서열을 페리틴의 적절한 위치에 도입하면 해당 금속이온을 선택적으로 결합하여 단백질과 함께 운반할 수 있게 된다. 이 과정에서 페리틴 단백질 단량체에 하나의 수식을 도입하여도 이들이 자기조립을 통하여 24개의 복합체로 구성된 단백질 나노입자는 24개의 균일한 수식을 가지게 되며, 결과적으로 하나의 페리틴 나노입자가 매우 정교한 형태로 24개의 금속이온을 수송하는 수송체 역할을 할 수 있다.
표적지향형 약물전달시스템이란 약물을 치료부위에 선택적으로 전달함으로써 건강한 조직을 약물에 노출시키지 않음과 동시에 소량의 약물만으로도 우수한 치료효과를 나타낼 수 있도록 설계된 기술을 말한다. 표적지향적 약물전달시스템을 이용하게 되면 질병이 있는 인체의 특정 부위에 약물을 집중시킴으로써 약물치료 효과를 극대화할 수 있으며, 항암제 등 독성이 강한 약물에 의한 부작용을 최소화시킬 수 있다. 뿐만 아니라, 최근에는 표적지향형 약물전달시스템을 질병진단에 활용하는 시도가 활발히 이루어지고 있다. 더 최근에는 표적지향적 약물전달 시스템을 이용하여 치료와 진단을 동시에 할 수 있는 테라그노시스(Theragnosis = Therapy+diagnosis)기술개발이 활발히 진행되고 있다. 즉, 표적지향적 약물전달 시스템에 분자영상 추적자(molecular imaging probe)를 부착하고 비침습성 생체영상화 장비(non-invasive in vivo imaging)를 이용하여 추적자를 영상화함으로써, 약물전달과 동시에 치료과정을 실시간으로 모니터링할 수 있는 기술이 테라그노시스 기술이다.
의약품에 사용되는 나노구조체 중 리포좀은 생체 세포막의 구성성분인 인지질을 주성분으로 하고 있으며 내부에 수용성 혹은 불용성(소수성) 약물을 포집시킬 수 있다. 리포좀은 구성성분 및 표면성분을 다양하게 조절할 수 있는 장점이 있으나 세포내 독성이 높고 약물로 주입되었을 때 대식세포의 식작용으로 순환계에서 소실되는 등의 문제점을 가지고 있다. 이러한 문제점을 해결하는 기술로써 인지질의 말단에 PEG를 결합시켜 리포좀을 제작하거나 리포좀 표면을 PEG 또는 다당류로 코팅한 스텔스리포좀(stealth liposome)이 개발되었다. 마이셀은 친수성과 소수성 부위를 동시에 가진 사슬형 분자로 이루어진 전달체로서, 수용액 상에서 중심부는 소수성 부분이 서로 모여 구형을 이루게 되며, 보통 난용성 약물을 중심부에 포집시켜 용해도를 증가시키고 생체 이용률을 높이는데 이용된다. 항암치료제의 경우 나노입자를 이용한 약물전달체는 수동적 표적지향 방법인 EPR(enhanced permeability and retention) 효과를 통해 암조직에 선택적으로 축적이 된다. 일반적으로 암조직은 신생혈관을 통해 영양분과 산소를 공급받게 되는데, 이때 생성되는 혈관은 짧은 기간 내에 형성되기 때문에 정상 세포와는 달리 엉성한 구조를 갖게 된다. 암조직에 형성된 느슨한 혈관 조직을 통해 수십 내지 수백 나노미터 크기의 나노입자들이 암조직 주위에 축적될 수 있고 배출속도가 느려서 장기간 암조직에 체류하게 되는데 이러한 현상을 EPR(enhanced permeability and retention) 효과라고 한다. 그러나 이러한 효과는 암 주변 환경을 이용한 수동적 방법으로써 항상 일정한 효과를 기대하기 어렵다. 따라서 보다 효과적인 표적화를 위하여 표적 부위에서 발현되는 항원이나 수용체를 인지할 수 있는 항체가 결합된 약물전달체를 사용하는 방법이 개발되었다. 그 외에도 항암치료를 위한 방사능 동위원소나 첨단 영상의학에 쓰이는 다양한 조영제에 선택적인 항체를 결합시키게 되면 전신부작용을 줄이고, 치료의 효과는 높이며, 영상이미지의 정확도를 더욱 높여 줄 수 있게 된다. 현재 표적화를 위한 항체의 고정화 방법으로 사용되는 화학적 공유결합 형성 방법은 재현성이 떨어지고 항체의 고유한 기능을 손상시킬 우려가 있다. 일반의약품과 마찬가지로 생물유래 의약품의 경우도 제조과정에서 구조적 변화가 동반될 경우, 식약청으로부터 의약품으로 허가를 받기 위해서는 구조변화의 정확한 규명, 약물의 약효 증명 및 독성시험 등을 수행하여야 한다. 따라서 항체 고정화의 재현성 확보 없이는 항체를 이용한 표적지향형 약물전달시스템을 인체에 적용하는 것은 거의 불가능한 실정이다.
한편, 바이오 칩은 핵산, 단백질 등 생물학적 물질이 기판(template surface) 위에 고정되어 있는 것으로, 생물학적 배열(biological array)이라고도 불린다. 이 중 단백질 칩이란, 특정 생체물질과 반응할 수 있는 수십 내지 수천 종류 이상의 서로 다른 펩타이드 또는 단백질을 고체 표면에 집적화하여 다양한 생체분자와 결합하여 효과적으로 분석하는 바이오 칩을 의미한다. 최근에는 질병 진단용 칩, 신약 후보물질 초고속 스크리닝 시스템 구축, 단백질 발현 패턴 연구 및 신규 단백질 마커 발굴에 응용되고 있다. 기판에 고정된 단백질, 항원, 항체, 친화성 리간드인 세포 수용체나 효소, 핵산, 또는 저분자 물질과 함께 결합할 수 있는 핵산 또는 단백질 등이 바이오 칩에 이용될 수 있다. 바이오 칩 기술은 정보 분석 기술의 발전과 집적의 결과로 생물 연구에 있어서 대형화 및 높은 작업 처리량을 가능하게 하는 중요한 도구가 되고 있다.
단백질 칩 기술에 있어서 중요한 요소는 단백질의 활성화와 활성 부위의 노출, 고집적도, 표적물질과의 특이적 결합이다. 단백질은 확산, 흡착/흡수, 공유 결합, 친화 작용에 의해 다양한 종류의 단백질 칩 고체 기판 표면에 접착될 수 있다. 그러나 단백질은 일반적으로 기판 표면 위에서 무작위로 집적되고, 단백질의 구조가 쉽게 변형되므로 단백질의 활성을 저해하며, 이로 인해 표면 분자와의 결합이 불가능해져 특이적 결합이 효율적이지 못한 큰 문제점을 가지고 있다. 단백질 칩에 적용되는 단백질 탐침과 표적물질 간 결합 특이성은 단백질의 구조에 따라 매우 민감하게 결정되므로 활성형 구조의 단백질을 표적물질의 고감도 인지에 적합한 위치 및 방향성으로 고정화시켜야 한다. 그러나 고정화 단계에서 활성부위가 은폐(masking)되거나 비특이적인 단백질 클러스터링(clustering)에 의한 불안정성, 집적도 저하 등, 비효율적인 고정화 공정이 고감도 탐지의 저해요인으로 인식되어 왔다.
현재, 나노입자를 활용한 바이오 칩 기술 중에서 각광받는 것은 반도체 양자점(QD, Quantum dot) 표면에 단백질, 펩타이드, 항원, 항체 등을 결합시키는 기술이다. 양자점은 좁은 범위의 발광 영역을 가지며, 발광 영역 조절이 용이하다는 장점이 있다. 하지만, 제조 공정이 복잡하며, 제작 비용이 고가이고, 양자점 제조 환경이 생물 물질의 안정화 조건과 상이하다는 단점이 있다.
이에 본 발명자들은 항체구조를 손상시키지 않으면서 특이성을 가지고 강력하게 결합함으로써, 바이오칩, 약물전달시스템, 질병진단 및 치료제 개발에 활용할 수 있는 항체구조물을 개발하고자 예의 연구노력한 결과, 항체결합 펩타이드 서열을 페리틴에 도입한 융합단백질을 제조함으로써, 단일 항체보다 높은 결합력을 가지며, 반응성이 높은 시스테인 등을 도입하여 다양하게 수식이 가능한 나노입자를 제조하고 본 발명을 완성하였다.
본 발명의 제1목적은 항체결합 펩타이드-페리틴 융합단백질 단량체 24개를 포함하는 나노입자; 및 이의 생산 방법을 제공하는 것이다.
본 발명의 제2목적은 항체결합 펩타이드-페리틴 융합단백질; 이를 코딩하는 핵산; 상기 핵산을 포함하는 재조합 벡터; 및 상기 핵산 또는 상기 재조합 벡터로 형질전환된 형질전환체를 제공하는 것이다.
본 발명의 제3목적은 본 발명에 따른 나노입자를 이용한 약물 전달체; 단백질 칩; 진단 키트; 및 항원 검출방법을 제공하는 것이다.
본 발명은 항체결합 펩타이드의 서열을 페리틴에 도입함으로써 융합단백질을 제조하고 이를 이용하여 항체가 항체의 구조를 손상시키지 않고도 강력하게 페리틴에 결합하게 함으로써, 바이오칩, 약물전달시스템, 질병진단 및 치료제 개발 등에 활용할 수 있다.
도 1은 본 발명을 설명하는 개념도를 도시한 도면이다.
도 2는 미생물 유래 페리틴의 구조를 90°회전하여 도시한 도면이다.
도 3은 페리틴-항체결합 펩타이드 융합단백질 및 이로부터 형성된 나노입자 제조과정을 도시한 모식도이다.
도 4는 크기배제크로마토그래피(size-exclusion chromatography)를 이용한 페리틴의 정제 결과 도면이다.
도 5는 구형을 이루고 있는 페리틴-FcBP 복합체의 형태를 확인하는 투과전자현미경(transmission electron microscope; TEM) 분석 결과이다.
도 6은 SPR(surface plasmon resonance)을 이용한 페리틴-항체결합 펩타이드 복합체와 항체의 결합측정 결과도이다.
도 7은 QCM(quartz crystal microbalance)을 이용한 페리틴-항체결합 펩타이드 복합체와 항체의 결합측정 결과도이다.
도 8은 실시예 4-1에 따라, SKBR3(HER2/neu+) 및 MCF10A에 대한 Herceptin-CY3 와 human IgG-CY3 처리 결과를 보여주는 형광현미경 사진이다.
도 9는 실시예 4-2에 따라, SKBR3(HER2/neu+) 에 적용된 페리틴-FcBP-허셉틴 복합체의 형광이미지이다.
도 10은 실시예 4-3에 따라, MCF10A(HER2/neu-) 에 적용된 페리틴-FcBP-허셉틴 복합체의 형광이미지이다.
도 11은 페리틴-FcBP-허셉틴 복합체의 안정화 조건 확립을 위해, 페리틴-FcBP와 허셉틴을 혼합하는 조건에 변화를 주어 표적화 실험을 진행한 결과이다. SKBR3(HER2/neu+) 에 새롭게 적용된 페리틴-FcBP-허셉틴 복합체는 이전 실험에 비해 비선택적인 단백질 침전이 많이 감소된 양상을 보였다.
도 12는 사람 유래 페리틴의 구조도이다.
도 13은 실시예 6에 따라, 항체결합 펩타이드가 도입된 사람유래 페리틴의 과발현 및 정제 결과를 확인하는 15% SDS-PAGE 젤의 결과물이다. (lane 5: 최종 정제된 사람유래 페리틴)
도 14는 항체결합펩타이드가 도입된 사람유래 페리틴과 사람유래 항체(herceptin, IgG1) 간의 결합력을 SPR로 분석한 결과를 나타낸 도이다.
도 15는 특정 리간드(약물 혹은 이미징용 조영제)를 도입하기 위하여 항체결합펩타이드가 도입된 사람유래 페리틴-FcBP에 시스테인 잔기를 치환하고 과발현시킨 후 정제한 결과를 나타낸 도이다: (a) E61C, (b) E137C, (c) A102C 및 (d) S19C.
도 16은 특정 리간드(약물 혹은 이미징용 조영제)를 도입하기 위하여 항체결합펩타이드가 도입된 미생물유래 페리틴-FcBP에 시스테인 잔기를 추가적으로 삽입하여 과발현시킨 결과를 나타낸 도이다: (a)와 (b)는 각각 164C 및 177C로 161번째 및 174번째 아미노산 이후에 시스테인이 도입되어 아미노산 서열의 164번째 및 177번째에 시스테인 잔기를 포함하는 패리틴에 대한 결과이며, (c)는 2C로 1번째 아미노산 이후에 즉 아미노산 서열의 2번째에 시스테인이 도입된 패리틴에 대한 결과이다.
도 17은 본 발명에 따른 페리틴-FcBP에 도입된 시스테인에 결합할 수 있는 반응기를 말단에 포함하는 금속이온과 결합가능한 킬레이트의 예를 나타낸 도이다.
본 발명의 제1양태는 항체결합 펩타이드-페리틴 융합단백질 단량체 24개를 포함하는 나노입자로서, 페리틴에 의해 4-폴드 대칭점(4-fold symmetry point)을 가진 6개의 부분구조가 형성되며, 페리틴 중 4-폴드 대칭점의 ±10 a.a.(아미노산) 범위에 항체결합 펩타이드가 융합되어 4-폴드 대칭점 부근에 4개의 항체결합 펩타이드가 위치하는 것이 특징이 나노입자를 제공한다.
이때, 항체결합 펩타이드에 항체가 결합된 것이 바람직하다.
본 발명의 제2양태는 페리틴의 자기조립에 의해 나노입자 형성시 페리틴 중 4-폴드 대칭점(4-fold symmetry point)의 ±10 a.a. 범위에 항체결합 펩타이드가 융합되어 있는 항체결합 펩타이드-페리틴 융합단백질; 이를 코딩하는 핵산; 상기 핵산을 포함하는 재조합 벡터; 및 상기 핵산 또는 상기 재조합 벡터로 형질전환된 형질전환체를 제공한다.
본 발명의 제3양태는 i) 상기 본 발명에 따른 핵산을 포함하는 재조합 발현 벡터를 제작하는 단계; ii) 상기 재조합 발현 벡터를 형질도입한 형질전환체를 제작하는 단계; iii) 단계 ii)의 형질전환체로부터 항체결합 펩타이드-페리틴 융합단백질을 발현시키는 단계; 및 iv) 발현된 항체결합 펩타이드-페리틴 융합단백질이 자가조립에 의해 4-폴드 대칭점(4-fold symmetry point)을 가진 6개의 부분구조가 형성된 나노입자를 정제하는 단계;를 포함하는 융합 단백질 나노입자의 생산 방법을 제공한다.
본 발명의 제4양태는 본 발명에 따른 나노입자의 내부 또는 표면에 약물을 운반하는 것이 특징인 표적지향적 약물 전달체를 제공한다.
본 발명의 제5양태는 본 발명에 따른 나노입자를 포함하는 단백질 칩을 제공한다.
본 발명의 제6양태는 상기 본 발명에 따른 단백질 칩을 준비하는 단계; 상기 단백질 칩에 검출 대상의 항원에 대한 항체를 고정화하는 단계; 상기 고정화된 항체를 포함하는 단백질 칩에 시료를 반응시키는 단계; 및 항원-항체반응 여부를 측정하는 단계를 포함하는 항원 검출방법을 제공한다.
본 발명의 제7양태는 본 발명에 따른 단백질 칩을 포함하는 진단 키트를 제공한다.
이하, 본 발명을 자세히 설명한다.
생물유래 나노구조체인 페리틴은 24개의 페리틴 단량체가 나노입자를 형성할 때 구조적으로 4-폴드 대칭( 4-fold symmetry point)을 가진 6개의 부분구조가 형성되고, 이 대칭점에 각 단백질 단량체의 동일한 부분(아미노산 서열)이 만나게 된다(도 2 참조). 따라서 대칭점을 형성하는 단백질 부분을 수식할 경우 4 개의 수식이 동일 장소에서 만나게 된다.
항체결합 펩타이드(FcBP)는 항체의 Fc 도메인의 특정 부위를 인식하여 해당부위에 특이적으로 인접 또는 결합할 수 있는 펩타이드일 수 있다. 즉, Fc 도메인에 충분한 친화력(affinity)과 특이성(specificity)을 가지고 시험관 내에서, 바람직하게는 생체 내에서 결합할 수 있는 펩타이드일 수 있다. 상기 결합은 수소결합(hydrogen bonding), 이온결합(ionic bonding), 소수성 상호작용(hydrophobic interaction), 반데르 발스 상호작용(Van der Waals interaction) 등의 비공유결합(non-covalent bonding)에 의한 것일 수 있다. 선형 또는 내부에 이황결합을 갖는 원형 펩타이드일 수 있으며, 내부에 이황결합을 형성하는 원형 펩타이드의 경우 하나 이상의 아미노산으로 분리된 두 개 이상의 시스테인 잔기를 포함할 수 있다. 항체의 Fc 영역을 인식하여 특이적으로 인접 또는 결합할 수 있는 것이면 제한없이 사용될 수 있으나, 비제한적인 예는 EP 1757701A1에 기재되어 있다. 한편, 상기 EP 1757701A1에 기재된 내용은 본 명세서에 통합된다. 상기 Fc 위치선택적 펩타이드는 자연적으로 발현되는 것일 수 있으나, 이에 제한되지 않으며, 인공적으로 합성될 수 있다.
또한 본 발명의 항체결합 펩타이드는 항체 Fc 도메인의 특정부위에 특이적으로 인접 또는 결합할 수 있는 한 펩타이드뿐만 아니라 펩타이드 유도체(peptide derivatives), 예를 들어, 펩타이드 모방체(peptide mimetics) 및 유사물(peptide analogues)을 포함할 수 있다.
상기 항체결합 펩타이드는 약 40개 이하의 아미노산으로 구성될 수 있고, 바람직하게는 30개 이하의 아미노산으로 구성될 수 있으며, 보다 바람직하게는 10 내지 15개의 아미노산으로 구성될 수 있다. 이미 언급한 바와 같이 상기 아미노산은 공지된 20개의 아미노산 이외에 아미노산 모방체 또는 유사물과 같은 아미노산 유도체일 수 있다.
상기 펩타이드 또는 아미노산의 모방체 또는 유사물은 천연의 아미노산 또는 본 발명에 따른 항체결합 펩타이드와 유사한 구조를 갖는 비아미노산 화합물 구조체를 포함한다. 상기 모방체 또는 유사물은 적절한 공간적 배향에서 이에 상응하는 아미노산 또는 펩타이드가 나타내는 크기, 전하 또는 소수성 등의 유사한 물리적 특성을 나타내는 물질로서 정의된다. 구체적인 예로서, 펩타이드 모방 화합물은 하나 또는 그 이상의 아미노산 사이에 존재하는 아미드 결합이 탄소-탄소 결합 또는 당업계에 공지된 다른 결합으로 치환된 화합물일 수 있다.
따라서, 본 발명의 용어 "아미노산"은 광의적인 개념에서 자연적으로 발생하는 L α-아미노산 또는 그 잔기(residue) 뿐만 아니라, 더불어 D-아미노산 및 화학적으로 변형된(chemically modified) 아미노산을 포함한다. 예를 들어, 상기한 아미노산 모방체 및 유사물을 포함하며, 본 발명에서 상기 모방체 및 유사물은 기능적 등가물을 포함할 수 있다.
본 발명의 항체결합 펩타이드는 예컨대 11개의 아미노산으로 구성되며, 1번과 11번 아미노산이 분자 내 이황결합을 형성하여 고리모양의 구조를 가진 펩타이드로 사람, 돼지, 토끼 등에 존재하는 면역글로불린 G (immunoglobulin G, IgG)의 Fc 영역에 특이적 결합을 하는 것으로 알려져 있다. 이를 표 1에 나타내었다.
표 1
Figure PCTKR2012007993-appb-T000001
상기 항체결합 펩타이드는 파아지-디스플레이(phage-display)에 의해 제조될 수 있다. 본 발명에서 용어 "파아지-디스플레이"는 단백질과 이를 코딩하는 유전정보를 연결시키기 위하여 박테리오파지를 이용하여 단백질-단백질, 단백질-펩타이드 및 단백질-DNA 상호작용을 연구하기 위한 실험기법이다. 상기 파아지-디스플레이를 이용하여 제약된(constrained) 및 제약되지 않은(unconstrained) 펩타이드 라이브러리를 제조할 수 있다. 상기 라이브러리는 특정한 표적 분자와 결합하는 펩타이드를 동정하고 선별하기 위하여 사용될 수 있다. 즉, 상기 파이지-디스플레이 기법을 이용하여 항체의 Fc 영역에 특이적으로 결합하는 펩타이드를 동정하고 선별할 수 있으며, 이를 항체결합 펩타이드라 할 수 있다.
본 발명자들은 분자생물학적 방법에 의하여 종전에 개발된 항체결합 펩타이드 및 전술한 페리틴의 구조적 특성을 이용하여, 항체결합 펩타이드를 페리틴 단백질의 대칭점 부근에 도입하여 네 개의 항체결합 펩타이드가 페리틴 나노입자 표면의 동일한 지점에 위치하도록 제작하여, 새로운 기능을 가진 페리틴 구조체를 개발하였다.
이렇게 제작된 항체결합 펩타이드-페리틴 융합단백질의 자가조립에 의해 형성된 나노입자와 항체의 결합력을 측정한 결과, 기존 단일 항체결합 펩타이드에서 관찰할 수 없었던 매우 높은 결합력을 관찰하였다. 실시예 3에서는 항체결합 펩타이드-페리틴의 나노입자에 결합한 항체는 인산완충액을 2시간 이상 흘려주어도 두 단백질의 결합이 파괴되지 않는 것을 확인하였다. 또한, 인간 항체가 결합된 항체결합 펩타이드-페리틴의 나노입자를 과량의 토끼혈청에 노출했을 경우에도 항체가 나노입자에 그대로 남아있는 것을 확인하였다.
또한, 본 발명에 따른 항체결합 펩타이드-페리틴의 나노입자를 사용하면, 항체와의 단순 혼합에 의하여 항체의 구조 손상없이 자기조립을 통한 강력한 나노입자-항체 복합체 형성을 유도할 수 있었다.
통상 항체결합 펩타이드-페리틴 융합단백질을 발현시키면 나노입자가 형성된 채로 정제할 수 있으므로, 항체의 혼합은 자기조립에 의해 나노입자 형성 후에 수행될 수 있다. 하지만, 나노입자 형성 전에도 항체결합 펩타이드-페리틴 융합단백질에 항체를 혼합시키더라도 나노입자가 형성될 수 있다. 항체결합 펩타이드-페리틴 융합단백질에 항체를 혼합할 경우 항체들에 의한 입체장애 때문에 나노입자 형성이 늦어질 수 있으나 오랜 시간이 흐르면 항체결합 펩타이드-페리틴 융합단백질에 붙었던 항체의 일부가 해리되면서 안정한 나노입자-항체 복합체를 형성할 수도 있을 것으로 유추된다. 따라서, 항체결합 펩타이드-페리틴 융합단백질에 항체를 혼합한 후 나노입자를 형성시키는 것도 본 발명의 범주에 속한다.
이와 같이, 본 발명에 따라 페리틴에 항체 결합 펩타이드가 도입된 단백질 나노입자는, 항체와의 단순 혼합에 의하여 자기조립을 통한 강력한 나노입자-항체 복합체 형성을 유도함으로써 항체의 구조를 손상시키지 않고도 쉽게 항체 칩을 형성할 수 있을 뿐만아니라 표적지향적 약물전달시스템을 형성할 수 있다. 또한, 다양한 항체와 단순 혼합하여 새로운 형태의 표적지향형 테라그노시스 제제를 형성할 수 있다(도 1 참조).
항체결합 펩타이드-페리틴 융합단백질을 포함하는 나노입자
본 발명에 따른 항체결합 펩타이드-페리틴 융합단백질은 24개가 자가조립에 의해 구형의 나노입자를 형성할 수 있다. 이때, 나노입자의 직경은 1 내지 20 nm일 수 있다.
이때, 본 발명에 따른 나노입자를 형성하는 융합단백질 단량체 중 페리틴들은 동종 또는 이종일 수 있다. 또한, 상기 페리틴은 모두 동일 유래일 수 있으며, 이종 유래의 페리틴들을 혼용할 수도 있다. 페리틴은 박테리아와 같은 미생물 유래 페리틴일 수도, 진핵세포 유래의 페리틴일 수 있다. 바람직하게는 사람유래 페리틴일 수 있다.
또한, 본 발명에 따른 나노입자를 형성하는 융합단백질 단량체 중 페리틴들은 천연형 아미노산 서열에서 하나 이상의 아미노산 잔기가 시스테인으로 치환되거나 시스테인이 추가로 삽입된 뮤테인(mutein)일 수 있다. 시스테인은 자체로도 중금속과의 친화성이 높고, 나아가 반응성이 높은 티올(thiol)기를 포함하여 다른 반응기와의 결합이 용이하여 직접 또는 링커를 통한 결합을 이용한 약물도입을 용이하게 할 수 있다. 바람직하게 상기 시스테인은 사람유래 페리틴 아미노산 서열의 2번째 Ser(serine), 19번째 Ser(serine), 61번째 Glu(glutamic acid), 68번째 Lys(lysine), 102번째 Ala(alanine), 113번째 Asp(aspartic acid) 또는 137번째 Glu(glutamic acid) 중 하나 이상의 아미노산 잔기에 치환되거나, Pyrococcus furiosus의 아미노산 서열의 1번째와 2번째, 161번째와 162번째 또는 174번째 이후에 시스테인 또는 시스테인을 포함하는 아미노산 서열이 하나 이상 추가로 삽입될 수 있다. 상기 삽입되는 서열은 단일 시스테인 잔기이거나 GGC 서열일 수 있으나, 시스테인을 하나 이상 포함하고 천연형 단백질의 구조를 변형시키지 않는 서열이면 제한없이 사용될 수 있다. 상기 시스테인으로의 치환 또는 삽입은 당업자에 공지된 방법을 제한없이 이용하여 수행될 수 있으나, 바람직하게는 자리지정 돌연변이유발(site-directed mutagenesis)에 의해 수행될 수 있다.
예컨대, 사람유래 페리틴 아미노산 서열의 2번째 Ser(serine), 19번째 Ser(serine), 102번째 Ala(alanine) 또는 113번째 Asp(aspartic acid)를 하나 이상의 시스테인으로 치환하거나, Pyrococcus furiosus의 아미노산 서열의 1번째와 2번째 아미노산 사이에 하나 이상 추가로 삽입하여 외부표면에 노출된 약물과 결합가능한 시스테인을 포함하는 나노입자를 제조할 수 있다. 또한, 사람유래 페리틴 아미노산 서열의 61번째 Glu(glutamic acid), 68번째 Lys(lysine) 또는 137번째 Glu(glutamic acid)를 하나 이상의 시스테인으로 치환하거나, Pyrococcus furiosus의 아미노산 서열의 161번째와 162번째 또는 174번째 이후에 시스테인 또는 시스테인을 포함하는 아미노산 서열을 하나 이상 추가로 삽입하여 내부표면에 노출된 약물과 결합가능한 시스테인을 포함하는 나노입자를 제조할 수 있다.
본 발명의 항체결합 펩타이드-페리틴 융합단백질은 페리틴 중 4-폴드 대칭점(4-fold symmetry point)의 ±10 a.a. 범위에 항체결합 펩타이드가 융합되어 있는 것이 특징이다. 이때, 하나의 4-폴드 대칭점 부근에 4개의 항체결합 펩타이드가 위치하게 된다. 또한, 본 발명에 따른 나노입자는 하나의 4-폴드 대칭점 부근에 위치한 4개의 항체결합 펩타이드에 하나 또는 두 개 이상의 항체가 결합될 수 있다.
이때, 페리틴 중 4-폴드 대칭점의 ±10 a.a. 범위에 항체결합 펩타이드 양 말단이 각각 독립적으로 링커를 통해 또는 링커 없이 융합되어 있을 수 있다. 링커의 길이 및/또는 아미노산 조성을 조절하여 4-폴드 대칭점 부근 항체결합 펩타이드들 간의 간격 및 배향을 조절할 수 있다. 링커의 비제한적인 예로 (Gly)5 혹은 (GlySer)3 등이 있다. 링커의 길이는 도입하는 아미노산의 수를 조절하여 조절가능하다.
항체결합 펩타이드-페리틴 융합단백질
본 발명의 일 양태는 페리틴의 자기조립에 의해 나노입자 형성시 페리틴 중 4-폴드 대칭점(4-fold symmetry point)의 ±10 a.a. 범위에 항체결합 펩타이드가 융합되어 있는 항체결합 펩타이드-페리틴 융합단백질을 제공한다.
또한, 본 발명의 일 양태는 본 발명에 따른 항체결합 펩타이드-페리틴 융합단백질을 코딩하는 핵산, 상기 핵산을 포함하는 재조합 벡터, 상기 핵산 또는 상기 재조합 벡터로 형질전환된 형질전환체를 제공한다.
나아가, 본 발명의 일 양태는 i) 본 발명에 따른 핵산을 포함하는 재조합 발현 벡터를 제작하는 단계; ii) 상기 재조합 발현 벡터를 형질도입한 형질전환체를 제작하는 단계; iii) 단계 ii)의 형질전환체로부터 항체결합 펩타이드 - 페리틴 융합단백질을 발현시키는 단계; 및 iv) 발현된 항체결합 펩타이드 - 페리틴 융합단백질이 자가조립에 의해 4-폴드 대칭점(4-fold symmetry point)을 가진 6개의 부분구조가 형성된 나노입자를 정제하는 단계;를 포함하는 융합 단백질 나노입자의 생산 방법을 제공한다.
본 발명에서 용어, '벡터'란 적당한 숙주 세포에서 목적 단백질을 발현할 수 있는 발현 벡터로서, 핵산 삽입물이 발현되도록 작동 가능하게 연결된 필수적인 조절 요소를 포함하는 핵산 작제물을 말한다. 본 발명은 항체결합 펩타이드-페리틴 융합단백질을 코딩하는 핵산을 포함하는 재조합 벡터를 제조할 수 있다.
한편, 본 발명에 따라 항체결합 펩타이드-페리틴 융합단백질을 코딩하는 핵산 또는 상기 핵산을 포함하는 재조합 벡터는 숙주 세포에 형질전환(transformation) 또는 형질감염(transfection) 시킬 수 있다.
본 발명의 재조합 벡터는 본 발명의 핵산을 적당한 벡터에 연결(삽입)하여 획득할 수 있다. 본 발명의 핵산이 삽입될 벡터는 그것이 숙주 안에서 복제될 수 있는 한 특별히 제한되지는 않는다. 예를 들어, 플라스미드 DNA, 파아지 DNA 등이 사용될 수 있다. 플라스미드 DNA의 구체적인 예로는 pCDNA3.1+(Invitrogen) 같은 상업적인 플라스미드를 포함한다. 본 발명에 사용될 수 있는 플라스미드의 다른 예로는 대장균 유래 플라스미드 (pYG601BR322, pBR325, pUC118 및 pUC119), 바실러스 서브틸리스 (Bacillus subtilis)-유래 플라스미드 (pUB110 및 pTP5) 및 효모-유래 플라스미드(YEp13, YEp24 및 YCp50)가 있다. 파아지 DNA의 구체적인 예로는 λ-파아지(Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11 및 λZAP)가 있다. 또한, 리트로바이러스(retrovirus), 아데노바이러스(adenovirus) 또는 백시니아 바이러스(vaccinia virus)와 같은 동물 바이러스, 배큘로바이러스(baculovirus)와 같은 곤충 바이러스가 또한 사용될 수 있다.
아울러 본 발명의 벡터로서, 핵산 발현 활성화 단백질(예를 들어, B42같은)이 연결된 융합 플라스미드(fusion plasmid, 예를 들어, pJG4-5)가 사용될 수 있으며, 이러한 융합 플라스미드에는 GST, GFP, His-tag, Myc-tag 등이 있으나, 상기 예들에 의해 본 발명의 융합 플라스미드가 한정되는 것은 아니다.
본 발명의 핵산을 벡터로 삽입하기 위해, 정제된 DNA를 적당한 제한효소로 절단하여 적당한 벡터 DNA의 제한 부위 또는 클로닝 부위에 삽입하는 방법이 사용될 수 있다.
본 발명의 핵산은 벡터에 작동 가능하게 연결되는 것이 바람직하다. 본 발명의 벡터는 프로모터 및 본 발명의 핵산 외에 인핸서(enhancer)와 같은 시스 요소(cis element), 스플라이싱 시그널(splicing signal), 폴리 A 추가 시그널(poly A addition signal), 선택 마커(selection marker), 라이보좀 결합 서열(ribosome binding sequence, SD sequence) 등을 추가로 포함할 수 있다. 선택 마커의 예로, 클로람페니콜 저항 핵산, 암피실린 저항 핵산, 디하이드로폴레이트 환원효소(dihydrofolate reductase), 네오마이신 저항 핵산 등이 사용될 수 있으나, 상기 예들에 의해 작동 가능하도록 연결되는 추가적 구성요소가 제한되는 것은 아니다.
본 발명에서 사용되는 용어, '형질전환(transformation)'이란 DNA를 숙주로 도입하여 DNA가 염색체의 인자로서 또는 염색체 통합 완성에 의해 복제 가능하게 되는 것으로 외부의 DNA를 세포 내로 도입하여 인위적으로 유전적인 변화를 일으키는 현상을 의미한다.
본 발명의 형질전환 방법은 임의의 형질전환 방법이 사용될 수 있으며, 당업계의 통상적인 방법에 따라 용이하게 수행할 수 있다. 일반적으로 형질전환 방법에는 CaCl2 침전법, CaCl2 방법에 DMSO(dimethyl sulfoxide)라는 환원물질을 사용함으로써 효율을 높인 Hanahan 방법, 전기천공법(electroporation), 인산칼슘 침전법, 원형질 융합법, 실리콘 카바이드 섬유를 이용한 교반법, 아그로박테리아 매개된 형질전환법, PEG를 이용한 형질전환법, 덱스트란 설페이트, 리포펙타민 및 건조/억제 매개된 형질전환 방법 등이 있다.
본 발명의 항체결합 펩타이드-페리틴 융합단백질을 코딩하는 핵산 또는 이를 포함하는 벡터를 형질전환시키기 위한 방법은 상기 예들에 국한되지 않으며, 당업계에서 통상적으로 사용되는 형질전환 또는 형질감염 방법이 제한 없이 사용될 수 있다.
목적 핵산인 항체결합 펩타이드-페리틴 융합단백질를 코딩하는 핵산 또는 이를 포함하는 재조합 벡터를 숙주로 도입함으로써 본 발명의 형질전환체(transformant)를 획득할 수 있다.
숙주는 본 발명의 핵산을 발현하도록 하는 한 특별히 제한되지는 않는다. 본 발명에 사용될 수 있는 숙주의 특정한 예로는 대장균(E. coli)과 같은 에스케리키아(Escherichia)속 세균; 바실러스 서브틸리스(Bacillus subtilis) 같은 바실러스 (Bacillus)속 세균; 슈도모나스 푸티다(Pseudomonas putida) 같은 슈도모나스 (Pseudomonas)속 세균; 락토바실러스와 엔테로코커스 등 유산균; 사카로마이세스 세레비지애(Saccharomyces cerevisiae), 스키조사카로마이세스 폼베(Schizosaccharomyces pombe) 같은 효모; 동물세포 및 곤충 세포가 있다.
대장균과 같은 세균이 숙주로서 사용될 때, 본 발명의 재조합 벡터는 숙주 내에서 자율적인 복제를 할 수 있고, 프로모터, 라이보좀 결합서열, 본 발명의 핵산 및 전사 종료 서열(transcription termination sequence)로 구성되어 있다.
본 발명의 프로모터는, 본 발명의 핵산을 대장균과 같은 숙주에서 발현하도록 하는 한 어떠한 프로모터도 사용될 수 있다. 예를 들어, trp 프로모터, lac 프로모터, PL 프로모터 또는 PR 프로모터 같은 대장균 또는 파아지-유래 프로모터; T7 프로모터 같은 대장균 감염 파아지-유래 프로모터가 사용될 수 있다. 또한 tac 프로모터 같은 인공적으로 변형된 프로모터도 사용될 수 있다.
본 발명에 따른 항체결합 펩타이드-페리틴 융합단백질을 코딩하는 뉴클레오티드 서열은 당업계에 공지된 방법을 이용하여 적절한 조절 뉴클레오티드 서열(들)에 임의로 연결되어 상기 코딩 서열의 발현을 제어할 수 있다(예를 들면, 문헌 [Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, Cold Spring Harbor Laboratory Press, NY] 참조).
본 발명에서 사용되는 용어 "작동가능하게 연결된"은 뉴클레오티드 서열 요소가 기능적 관계로 연결되는 것을 나타낸다. 예를 들면, "작동가능하게 연결된" 프로모터는 조절 요소가 뉴클레오티드 코딩 서열과 관련하여 적절한 위치 및 배향으로 존재하여 RNA 폴리머라제 개시 및 핵산의 발현을 제어함(예를 들면, 이는 코딩 서열의 전사에 영향을 미침)을 의미한다. 프로모터 영역은 임의의 원핵 세포에 존재하는 프로모터일 수 있다.
몇몇 실시양태에서, 항체결합 펩타이드-페리틴 융합단백질 코딩 서열은 시그널 펩타이드(SP)를 코딩하는 뉴클레오티드 서열에 작동가능하게 연결되어 유전자 생성물이 박테리아 외부로 분비되어 배양 배지에 도입되도록 할 수 있다.
본 발명에서 회수되는 목적 단백질의 정제를 용이하게 하기 위하여, 플라스미드 벡터는 필요에 따라 다른 서열을 추가로 포함할 수 있다. 상기 추가로 포함될 수 있는 서열은 단백질 정제용 태그 서열일 수 있으며, 예컨대, 글루타티온 S-트랜스퍼라제(Pharmacia, USA), MBP(말토스 결합 단백질, USA), FLAG(IBI, USA) 및 헥사히스티딘(hexahistidine; Quiagen, USA) 등이 있고, 가장 바람직하게는 MBP 일 수 있으나, 상기 예들에 의하여 목적 단백질의 정제를 위하여 필요한 서열의 종류가 제한되는 것은 아니다.
또한, 상기 융합 서열이 포함되어 있는 벡터에 의해 발현된 융합 단백질의 경우, 친화성 크로마토그래피에 의해 정제될 수 있다. 예컨대, 글루타티온-S-트랜스퍼라제가 융합된 경우에는 이 효소의 기질인 글루타티온을 이용할 수 있고, MBP가 이용된 경우에는 아밀로오즈 컬럼을 이용하여 원하는 목적 단백질을 용이하게 회수할 수 있다.
본 발명의 항체결합 펩타이드-페리틴 융합단백질을 발현시키기 위해 상기의 방법으로 형질전환된 숙주 세포는 당업계에서 사용되는 통상적인 방법으로 배양할 수 있다. 예를 들면, 상기 항체결합 펩타이드-페리틴 융합단백질을 발현하는 형질전환체는 다양한 배지에서 배양할 수 있으며, 유가식(fed-batch) 배양 및 연속 배양 등을 수행할 수 있으나, 상기 예에 의해 본 발명의 형질전환체의 배양방법이 제한되는 것은 아니다. 또한, 숙주 세포의 생장을 위하여 배지 중에 포함될 수 있는 탄소원은 제조된 형질전환체의 종류에 따라 당업자의 판단에 의해 적절하게 선택될 수 있고, 배양 시기 및 양을 조절하기 위해 적당한 배양 조건을 채택할 수 있다.
적절한 숙주 세포를 선택하여 배지 조건을 조성하여 주면 목적 단백질이 성공적으로 형질전환된 형질전환체는 항체결합 펩타이드-페리틴 융합단백질을 생산하게 되며, 벡터의 구성 및 숙주 세포의 특징에 따라 생산된 항체결합 펩타이드-페리틴 융합단백질은 숙주 세포의 세포질 내, 페리플라즈믹 스페이스(periplasmic space) 또는 세포 외로 분비될 수 있다. 또한 목적 단백질은 가용성 형태 또는 불용성 형태로 발현될 수 있다.
숙주 세포 내 또는 외에서 발현된 단백질은 통상의 방식으로 정제될 수 있다. 정제 방법의 예로는 염석(예를 들어 황산암모늄 침전, 인산 나트륨 침전 등), 용매 침전(예를 들어, 아세톤, 에탄올 등을 이용한 단백질 분획 침전 등), 투석, 겔 여과, 이온 교환, 역상 컬럼 크로마토그래피와 같은 크로마토그래피 및 한외여과 등의 기법을 단독 또는 조합으로 적용하여 본 발명의 단백질을 정제할 수 있다.
항체결합 펩타이드-페리틴 융합단백질을 포함하는 나노입자에 결합시키는 항 체
본 발명의 나노입자 중 항체결합 펩타이드에 결합되는 항체의 종류는 항체결합 펩타이드에 결합할 수 있는 한 제한되지 아니하며, 항체결합 펩타이드에 결합할 수 있는 Fc, 또는 이의 단편 또는 이의 유도체/유사체를 포함하는 하는 항체, 항체의 단편, 유도체 또는 유사체일 수 있다. 항체는 IgG인 것이 바람직하다.
항체 유도체는 당화, 아세틸화, 페길화, 인산화, 아미드화, 공지된 보호/블로킹기에 의한 유도, 단백질 분해, 세포내 리간드 또는 기타 단백질 등에 의해 변형된 항체를 포함하나, 이에 제한되지 않는다. 임의의 다양한 화학적 변형이 특이적 화학적 분해, 아세틸화, 포르밀화, 튜니카마이신의 대사적 합성 등을 포함하나 이에 제한되지 않는 공지된 기술에 의해 수행될 수 있다. 추가적으로, 유도체는 하나 이상의 비고전 아미노산을 함유할 수 있다.
항체는 키메라, 인간화된 또는 인간 항체 등의 특정 재조합 항체뿐만 아니라, 폴리클론 및 단클론 항체를 모두 포함한다.
본 발명에서 항체는 수용체-특이적 항체 또는 리간드-특이적 항체일 수 있다. 본 발명에서 항체는 또한 리간드 결합을 방지하지 않으나 수용체 활성화를 방지하는 수용체-특이적 항체일 수 있다.
본 발명에 따른 나노입자에 결합하는 항체는 치료용 항체일 수도 있고, 별도의 치료제제 또는 진단제제와 결합할 수 있는 항체일 수도 있고, 치료 효과가 없는 표적화를 위한 항체일 수도 있고, 단순히 항원-항체 반응을 할 수 있는 항체일 수도 있다.
상기 치료제제 또는 진단제제는 항체에 결합할 수도 있으나, 본 발명에 따른 나노입자에 의해 운반될 수도 있다.
한편, 치료용 항체는 현재 약 30 종이 FDA의 승인을 받았으며 생체 내 존재하는 IgG와 성질이 거의 흡사하여 그 안전성이 매우 높다. 치료용 항체는 광범위한 질병 치료제 (예. 이식거부반응, 암, 자가면역질환과 염증, 심장질환, 전염성 감염 등)로 사용되고 있으며 이들 항체는 질병이 생긴 조직에 특이적으로 존재하는 수용체 단백질 혹은 항원단백질을 인식하여 결합하기 때문에 그 특이성이 매우 높다. 따라서 치료용 항체에 분자영상프로브나 약물전달체를 결합시키면 약물병용효과와 함께 치료과정을 모니터링 할 수 있는 테라그노시스 제제로 전환 할 수 있다. 또한 단순한 표적화 항체에도 분자영상프로브나 약물전달체를 결합시킴으로써 진단, 치료, 혹은 진단과 치료를 동시에 진행하는 테라그노시스 제제를 개발할 수 있다. 본 발명은 생물 유래 페리틴을 FcBP 융합 단백질화하고, 분자영상프로브, 치료용 약물 등을 도입한 후, 항체와 함께 표적지향적 테라그노시스용 소재를 개발하는 기술을 제공할 수 있다.
본 발명의 나노입자에 의해 운반되는 약물
본 발명의 나노입자에 의해 운반되는 약물은 치료제제, 진단제제/검출제제를 포함한다.
치료제제의 비제한적인 예로는 항체, 항체단편, 약물, 독소, 핵산가수분해효소(nuclease), 호르몬, 면역조절제, 킬레이터, 붕소화합물, 광활성(photoactive)제제 또는 염료, 및 방사성동위원소를 포함한다.
진단제제/검출제제의 비제한적인 예로는 방사성동위원소, 염료(예를 들어, 비오틴(biotin)-스트렙타비딘(streptavidin) 복합체), 조영제, 형광화합물 또는 형광단백질 및 MRI(magnetic resonance imaging) 조영 증강제(상자성 이온)을 포함한다. 바람직하게, 진단제제는 방사성동위원소, MRI(magnetic resonance imaging) 조영 증강제, 및 형광화합물을 포함한다. 항체성분을 방사성 금속 또는 상자성 이온과 부하하기 위해, 이온을 결합하는데 킬레이트기의 다수와 부착된 긴 꼬리를 갖는 반응물과 반응하는 것이 필요할 수도 있다. 상기의 꼬리는 폴리리신, 폴라사카라이드와 같은 고분자, 또는 에틸렌디아민테트라아세트산(EDTA), 디에틸렌트리아민펜타아세트산(DTPA; diethylenetriaminepentaacetic acid), 포르피린(porphyrin), 폴리아민, 크라운 에테르, 비스-티오세미카르바존(thiosemicarbazone), 폴리옥심(polyoximes)과 같은 킬레이트기와 결합될 수 있는 펜던트기를 갖고 상기 목적에 유용하다고 알려진 기를 갖는 유도화되거나 유도될 수 있는 사슬일 수 있다. 킬레이트는 표준화학을 사용하여 항체에 결합된다. 킬레이트는 정상적으로 면역반응성의 최소 손실과 최소 집합체 및/또는 내부 교차연결로 분자에 결합을 형성할 수 있는 기에 의해 항체에 연결될 수 있다.
상기 진단 및 검출을 위한 형광물질로는 로다민, 알렉사 유도체, 시아닌 유도체, FAM, TAMRA, FITC, PE, PerCP, APC, 쿠마린 또는 이들의 유도체 등의 형광화합물 또는 GFP, eGFP, CFP, eCFP, YFP, RFP 등의 형광단백질일 수 있으나 이에 제한되지 않는다. 바람직하게는 Cy3, Cy3.5, Cy5, Cy5.5 및 Cy7 등의 시아닌 유도체일 수 있다. 상기 형광물질은 직접 또는 링커를 통해 본 발명의 나노입자에 결합할 수 있다.
특히, 유용한 금속-킬레이트 조합은 진단성 동위원소와 60 내지 4,000 keV의 일반적인 에너지 범위에서 사용되는 2-벤질-DTPA 및 이의 모노메틸 및 시클로헥실 유사체를 포함하고, 예를 들어 영상화제 및/또는 치료제로 사용되는 방사성동위원소로는 125I, 131I, 123I, 124I, 62Cu, 64Cu, 67Cu, 186Re, 188Re, 82Rb, 177Lu, 18F, 153Sm, 213Bi, 111In, 67Ga, 68Ga, 89Sr, 169Er, 192Ir, 111In,, 90Y, 99mTc, 94mTc, 11C, 13N, 15O, 76Br 등이 있다. 비-방사성 금속 중 망간(Mn), 철(Fe) 및 가돌리늄(Gd)과 같은 대표적인 전이금속 이온은 상자성 물질로서 MRI에 유용하다. 그러나 상기 이온들 및 방사성동위원소는 자체 독성이 강하므로 킬레이트제 등과 복합화하여 사용할 수 있다. 상기 킬레이트제로는 금속의 종류에 따라, DTPA, NOTA, DOTA, MS325, HPDO3A, EDTA, NTA 및 TETA와 같은 거대고리(macrocyclic) 킬레이트제와 복합화할 수 있으며, 상기 복합체는 본 발명의 나노입자 또는 항체에 결합시켜 사용될 수 있다. 바람직하게는 갈륨, 이트륨(yttrium) 및 구리의 방사성핵종과 각각 사용될 수 있고, 상기 금속-킬레이트 복합체는 대상의 금속에 고리크기를 맞춤으로써 매우 안정하게 제조될 수 있다. RAIT(radiation and imaging technology)에 사용되는 223Ra와 같은 핵종과 안정하게 결합하는데 유용한 거대고리 폴리에테르류와 같은 고리형 킬레이트 또한 본 발명의 범주에 포함될 수 있다.
바람직하게 본 발명의 천연형 페리틴에 시스테인을 치환 또는 삽입한 뮤테인을 포함하는 나노입자를 이용하면, 진단 및/또는 치료약물로서 상기 금속원소를 포함하는 약물의 도입을 용이하게 할 수 있다. 전술한 바와 같이 시스테인은 자체로도 중금속과의 친화성이 높고, 나아가 반응성이 높은 티올(thiol)기를 포함하여 다른 반응기와의 결합이 용이하여 직접 또는 링커를 통한 결합을 이용한 약물도입을 용이하게 할 수 있다. 따라서, 상기 열거된 금속이온과 결합하는 킬레이트제에 시스테인의 티올기와 결합가능한 말레이미드 또는 아세트아미드 등을 포함하도록 수식하여 이용하면 나노입자의 내/외부로 노출된 시스테인과 공유결합을 형성할 수 있다. 한편, 위와 동일한 이유로 상기 시스테인을 도입한 뮤테인을 이용하여 제조한 나노입자는 금속원소 뿐만 아니라 다른 종류의 약물 예컨대, 항체, 항체단편, 약물, 독소, 핵산가수분해효소(nuclease), 호르몬, 면역조절제, 킬레이터, 붕소화합물, 광활성(photoactive)제제 또는 염료 등의 치료제제 및 염료(예를 들어, 비오틴(biotin)-스트렙타비딘(streptavidin) 복합체), 조영제, 형광화합물 또는 형광단백질 등의 진단제제/검출제제의 전달도 용이하게 할 수 있다.
이뮤노컨쥬게이트(immunoconjugate)는 치료제제 또는 진단제제와 항체 성분의 컨쥬게이트이다. 상기 진단제제는 방사성 또는 비방사성 라벨, 조영제(자기공명영상화, 컴퓨터단층촬영(computed tomography), 또는 초음파에 적절한 조영제)를 포함하고, 방사성 라벨은 감마-, 베타-, 알파-, 오제 전자- 또는 양전자 방출 동위원소일 수 있다.
면역조절제는 본 발명에서 정의된 바와 같이 치료제제이며, 전형적으로 대식세포(macrophage), B-세포, 및/또는 T-세포와 같은 면역반응 캐스캐이드(immune response cascade)에서 증식하거나 활성화되는 면역세포를 자극한다. 상기 면역조절제의 예는 시토킨이다. 당업자들은 인터루킨 및 인터페론이 T-세포 또는 기타 면역세포 활성을 자극하는 시토킨의 일종임을 이해할 것이다.
단백질 칩 및 항원 검출방법
본 발명의 일 양태는 본 발명에 따른 항체 고정화용 나노입자를 포함하는 단백질 칩을 제공한다. 이때, 나노입자 중 항체결합 펩타이드에 항체가 결합되어 있을 수 있다.
또한, 본 발명의 일 양태는 상기 단백질 칩을 준비하는 단계; 상기 단백질 칩에 검출 대상의 항원에 대한 항체를 고정화하는 단계; 상기 고정화된 항체를 포함하는 단백질 칩에 시료를 반응시키는 단계; 및 항원-항체반응 여부를 측정하는 단계를 포함하는 항원 검출방법을 제공한다.
본 발명의 단백질 칩은 본 발명의 항체 고정화용 나노입자가 고체 기질에 고정된 것일 수 있다. 고체 기질은 바이오 칩에 사용되는 것이라면 한정되지 않는다. 그러나 바람직하게는 금, 유리, 변형된 실리콘, 테트라플루오로에틸렌(tetrafluoroethylene), 폴리스티렌(polystyrene) 및 폴리프로필렌(polyprophylene) 등 흔히 사용되는 중합체나 겔 등을 사용할 수 있다. 또한 상기 기판의 표면은 중합체, 플라스틱, 수지, 탄수화물, 실리카, 실리카 유도물질, 탄소, 금속, 무기 유리 및 막 등으로 표면 처리될 수 있다. 상기 기판은 지지체로서의 역할 뿐 아니라, 고정된 항체와 항원 간의 결합 반응이 일어나는 장소를 제공한다. 상기 기판의 규격 및 기판 상에 고정되는 위치, 크기 및 모양은 분석의 목적, 점적 기기(spotting machine) 및 스캐너(scanner) 등의 장치에 따라 변화될 수 있다.
본 발명에서 항원을 검출하는 방법에는 본 발명의 단백질 칩을 사용하는 것 이외에 당업계에 공지된 방법이 적용될 수 있으며, 구체적으로 본 발명의 단백질 칩 상의 고정화된 항체를 시료, 바람직하게는 환자로부터 채취한 혈액 또는 체액 등과 반응시켜 항원-항체 반응 여부를 확인함으로써 항원을 검출할 수 있다. 상기 항원-항체 반응 여부를 확인하기 위해서 항체의 종류에 따라 각각 다른 발색 물질을 사용할 수 있으며, 동시에 여러 색의 형광을 사용하여 여러 종류의 항원을 검색할 수도 있다.
상기 검출 대상이 되는 항원은 면역분석 방법에 의하여 검출 가능한 모든 생체활성물질(bioactive materials)로서 특별한 제한이 없으며, 예컨대, 자가항체(autoantibody), 리간드, 천연 추출물, 펩타이드, 단백질, 금속 이온, 합성 약물, 천연 약물, 대사체, 유전체, 바이러스 및 바이러스에 의한 생성 물질, 및 박테리아 및 바이러스에 의한 생성 물질로 이루어진 군에서 선택된 1종 이상의 것일 수 있으나 이에 제한되는 것은 아니다. 상기와 같은 항원을 포함하는지 여부 또는 그 농도를 측정하기 위한 대상 시료는 어떤 처리도 거치지 않은 상태로 사용되거나 적당한 완충용액에 의해서 희석된 상태로 사용될 수 있다. 적당한 시간 동안 인큐베이션한 후, 포획항체와 미처 결합하지 못한 표적 물질 및 결합이 가능하지 않은 시료 내 다른 물질은 다음 단계 수행 전에 세척하여 제거하는 단계를 추가로 수행할 수 있다.
이하, 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 실시하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 항체결합 펩타이드-페리틴 융합단백질 제조를 위한 재조합 DNA 제작방법 및 아미노산 서열분석
항체결합 펩타이드-페리틴 융합단백질을 제조하기 위한 재조합 DNA 제작방법은 다음과 같다(도 3).
모델정립 단계에서는 기존에 보유하고 있는 미생물(Pyrococcus furiosus)유래의 페리틴(서열번호 1)을 이용하였다. 미생물 유래의 페리틴 유전자를 프라이머 P1(서열번호 2; 5'-aaaacatatgttgagcgaaagaatgctcaaggc-3') 및 P2(서열번호 3; 5'-aaaaaggatccttactctcctccctgc-3')로 증폭시킨 다음 제한효소 NdeI, BamHI을 이용하여 벡터 pET 30(b)에 클로닝하였다. 클로닝된 페리틴 유전자는 염기서열 분석을 통해 확인하였다.
페리틴 단백질의 144번과 145번 사이에 링커아미노산과 함께 항체결합 펩타이드 서열(서열번호 4)을 도입하였다.
서열번호 4: CGGGGGG DCAWHLGELVWCT GGGGGAS
상기 밑줄 친 부분은 항체결합 펩타이드(FcBP)이고, FcBP 양말단에 있는 서열은 각각 링커이다.
FcBP 서열을 코드하는 DNA 염기 서열을 미생물 유래 페리틴의 유전자에 삽입하기 위해 서열번호 13의 프라이머 P3 및 서열번호 14의 P4(5'-aaactagtctggtgcaccggtggtggtggtggtgctagcgacagtcctcaaatattgttc-3'; 5'-aaactagttctcccaggtgccatgcacagtcaccaccaccaccaccacccttggcaaactttaacttgtcc-3')를 이용하여 증폭시킨 다음 제한 효소 SpeI를 처리한 후 연결시킨 접합을 통해 원형의 플라스미드 DNA를 얻었다. DNA 염기 서열 측정을 통해 FcBP 서열을 코드하는 DNA 염기 서열의 삽입을 확인하였다.
페리틴-FcBP 에 해당되는 플라스미드 DNA으로 대장균(Rosetta DE3, Novagen)을 형질 전환시켰으며, IPTG(Isopropyl-β-D-thio-galactoside)를 1 mM이 되도록 첨가한 뒤 18 ℃에서 16시간동안 배양하여 단백질의 발현을 유도하였다.
실시예 2: 페리틴-FcBP의 정제 및 특성 분석
페리틴-FcBP가 발현된 대장균을 세포 파쇄액(50 mm Tris pH 7.5, 250 mM NaCl, 5 % glycerol, 0.5 % 2-mercaptoethanol)에 현탁하였고, 초음파 발생기로 파쇄시켰다. 이를 원심분리하여 상층액만을 100 ℃에서 30분간 가열하고 원심분리하여 상층액을 다시 분리하였다. 분리된 상층액을 50 mM Na2HPO4 pH6.5, 100 mM NaCl를 이용하여 Superose-6(GE Healthcare) 컬럼을 통과시켜 최종 페리틴-FcBP 단백질을 정제하였다. 정제된 단백질은 SDS-PAGE 분석을 통하여 단백질 단량체의 크기 및 정제된 단백질의 순도를 확인하였다.
정제된 페리틴-FcBP 는 24개의 단량체가 모인 집합구조를 이루게 되는데 Superose-6에서 단백질이 용출되는 시점을 확인하여 복합체의 사이즈를 확인하였으며(도 4), TEM(transmission electron microscope)을 이용하여 구형을 이루고 있는 페리틴-FcBP 복합체의 형태를 확인하였다(도 5).
실시예 3: 페리틴-항체결합 펩타이드 복합체의 항체 결합력 측정
실시예 3-1 : H IgG 및 PyFn-FcBP을 이용한 SPR(Surface Plasmon Resonance) 측정법
H IgG 및 PyFn-FcBP간의 상호 결합도를 SPR 방법으로 측정하기 위하여 BIAcore 3000 분석기 (BIACORE, Uppsala, Sweden)를 사용하였다. 바이오센서 분석에서는 EDC / NHS(N'-(3-dimethylaminopropyl) carbodiimide hydrochloride / N-hydroxysuccinimide)로 활성화한 CM5 센서 칩(BIACORE, Uppsala, Sweden)에 10 ㎕/min의 유속으로 H IgG 단백질(20 μg/㎖ in 10 mM Sodium acdetate, pH 4.5)을 7 분간 흘려주어 고정화시켰다. 센서 칩 표면에 남아있는 활성화 부분은 1.0 M 에탄올아민(ethanolamine, pH 8.0)을 첨가하여 비활성화시켰다.
PyFn-FcBP는 각 농도별로 완충용액(1 X PBS, pH 7.4)에 희석한 후, 30 ㎕/min의 유속으로 흘러주면서 결합 센서그램과 해리 센서그램을 확인하였다(도 6). 센서 칩과의 비특이적 결합에 의해 발생하는 센서그램을 보정하기 위해서 BSA(bovine serum albumin)로만 완전히 비활성화된 셀을 사용하였고 PyFn-FcBP의 센서그램에서 BSA의 센서그램을 빼줌으로써 비특이성 결합을 보정하였다. 센서 칩의 표면은 재생(regeneration) 완충용액(20 mM NaOH)을 흘려줌으로써 재생하였다.
실시예 3-2: R IgG 및 PyFn-FcBP을 이용한 SPR 측정법
R IgG 및 PyFn-FcBP간의 상호 결합도를 SPR 방법으로 측정하기 위하여 실시예 3-1와 같이 BIAcore 3000 분석기 (BIACORE, Uppsala, Sweden)를 사용하였으며 센서 칩 표면처리도 같은 방법으로 진행하였다.
EDC / NHS (N'-(3-dimethylaminopropyl) carbodiimide hydrochloride / N-hydroxysuccinimide)로 활성화한 CM5 센서 칩(BIACORE, Uppsala, Sweden)에 10 ㎕/min의 유속으로 R IgG 단백질(20 μg/㎖ in 10 mM Sodium acdetate, pH 4.5)을 7 분간 흘려주어 고정화시켰다. 센서 칩 표면에 남아있는 활성화 부분은 1.0 M 에탄올아민(ethanolamine, pH 8.0)을 첨가하여 비활성화 시켰다.
PyFn-FcBP는 각 농도별로 완충용액(1 X PBS, pH 7.4)에 희석한 후, 30 ㎕/min의 유속으로 흘러주면서 결합 센서그램과 해리 센서그램을 확인하였다(도 7). 센서 칩과의 비특이적 결합에 의한 발생하는 센서그램을 보정하기 위해서 BSA로만 완전히 비활성화된 셀을 사용하였고 PyFn-FcBP의 센서그램에서 BSA의 센서그램을 빼줌으로써 비특이성 결합을 보정하였다. 센서 칩의 표면은 재생 완충용액(20 mM NaOH)을 흘려줌으로써 재생하였다.
실시예 3-3: SPR 측정법에 의한 항체(H IgG) 단백질 및 PyFn-FcBP 단백질간 상호작용 측정
상기 실시예 3-1의 SPR 방법이 선택적으로 PyFn-FcBP 단백질의 FcBP 부분과 항체 Fc 도메인의 결합을 측정할 수 있는지의 여부를 확인하기 위하여, CM5 센서 칩에 고정화된 항체 단백질에 PyFn-FcBP 단백질을 500, 250, 100, 50, 25, 10, 5 nM의 농도로 흘려주면서, 결합 센서그램을 조사하였다. 그 결과, 도 6에서 나타난 바와 같이 PyFn-FcBP 단백질은 항체 Fc 도메인에 특이적으로 결합하는 센서그램을 보여주며 결합한 PyFn-FcBP의 양에 따른 RU 값의 증가는 PyFn-FcBP의 농도에 비례하여 증가함을 알 수 있다. 이러한 결과는 상기의 SPR 측정의 결합 센서그램의 증가 곡선은 H IgG Fc 도메인과 PyFn-FcBP 단백질간의 상호작용에 기인함을 보여준다.
실시예 3-4: SPR 측정법에 의한 항체(R IgG) 단백질 및 PyFn-FcBP 단백질간 상호작용 측정
상기 실시예 3-2의 SPR 방법이 선택적으로 PyFn-FcBP 단백질의 FcBP 부분과 항체 Fc 도메인의 결합을 측정할 수 있는지의 여부를 확인하기 위하여, CM5 센서 칩에 고정화된 항체 단백질에 PyFn-FcBP 단백질을 500, 250, 100, 50, 25, 10 nM의 농도로 흘려주면서, 결합 센서그램을 조사하였다. 그 결과, 도 7에서 나타난 바와 같이 PyFn-FcBP 단백질은 항체 Fc 도메인에 특이적으로 결합하는 센서그램을 보여주며 결합한 PyFn-FcBP의 양에 따른 RU 값의 증가는 PyFn-FcBP의 농도에 비례하여 증가함을 알 수 있다. 이러한 결과는 상기의 SPR 측정의 결합 센서그램의 증가 곡선은 R IgG Fc 도메인과 PyFn-FcBP 단백질간의 상호작용에 기인함을 보여준다.
실시예 4: 페리틴-항체결합 펩타이드 복합체를 이용한 표적 지향성 확인
실시예 4-1: 세포선정, 항체의 선정, 초기실험조건
페리틴-FcBP 를 이용하여 항체 치료제인 Herceptin을 특정 세포에 선택적으로 전달하는지를 확인하기 위하여 HER2/neu 수용체가 과발현되는 유방암세포인 SKBR3(HER2/neu+)를 선택하고, 대조군으로는 HER2/neu 수용체가 발현되지 않는 유방세포인 MCF10A를 선택하였다. Herceptin은 현재 시판되는 유방암치료제로써, HER2/neu 수용체에 결합함으로써 하류의 신호전달을 방해하게 되어 항암효과를 나타내는 단클론 항체이다. SKBR3는 10% FBS(우태아혈청), 1% penicillin/streptomycin 이 포함된 Dulbecco's Modified Eagle's Medium(DMEM, Gibco) 배지를 이용하여 배양하였다. MCF10A는 5 % horse serum, 20 ng/ml EGF, 0.5 mg/ml hydrocortisone, 100 ng/ml cholera toxin, 10 μg/ml insulin, 1% penicillin/streptomycin 이 포함된 DMEM/F12(Gibco) 배지를 이용하여 배양하였다.
실험에 사용하는 페리틴-FcBP, Herceptin, human IgG는 형광물질을 표지하였는데 페리틴-FcBP는 fluorescein-5-maleimide(Invitrogen)을, 항체인 Herceptin과 human IgG는 CY3(GE Healthcare)를 도입하였다. 형광물질을 도입하는 방법은 다음과 같다. 단백질에 대해 약 10배 이상의 몰수에 해당하는 형광물질을 인산완충액(pH 7.5 내지 8.0) 존재 하에서 실온에서 1~2시간 반응시켰다. 탈염 컬럼인 PD10(GE Healthcare)를 이용하여 반응에 참여하지 않은 과량의 형광물질은 제거하고 형광물질이 도입된 단백질만을 회수하였다. 회수한 단백질은 브래드포드 정량법을 이용하여 정량하였다.
본 실험에 앞서 SKBR3(HER2/neu+)에 대하여 Herceptin-CY3와 human IgG-CY3를 처리한 결과 Herceptin-CY3만 결합하는 것을 확인하였으며, MCF10A에 Herceptin-CY3와 human IgG-CY3를 처리한 결과 두 가지 항체 모두 결합하지 않는 것을 확인하였다(도 8). 결합여부를 확인하기 위하여 형광현미경인 DeltaVisionRT(Applied Precision)을 이용하였다.
실시예 4-2: SKBR3(HER2/neu+)
SKBR3는 10% FBS, 1% penicillin/streptomycin 이 포함된 DMEM(Gibco) 배지를 이용하여 배양하였다. Herceptin-CY3와 페리틴-FcBP-fluorescein-5-maleimide, human IgG-CY3와 페리틴-FcBP-fluorescein-5-maleimide를 DMEM 존재하에서 15분간 반응하여 페리틴에 각각의 항체가 결합하도록 하였다. SKBR3에 두 종류의 항체-페리틴을 처리하고 30분간 반응 후 PBS로 세척한 후 형광이미지를 관찰하였다(도 9). 형광이미지를 관찰한 결과 Herceptin-CY3와 페리틴-FcBP-fluorescein-5-maleimide을 처리한 샘플에서만 CY3와 fluorescein의 형광이 동시에 관찰이 되었으며 이를 통해 SKBR3 세포는 Herceptin에 의해 표적화 되었으며 또한 페리틴 구조체와 Herceptin이 결합하고 있음을 확인하였다.
실시예 4-3: MCF10A(HER2/neu-)
MCF10A는 5% horse serum, 20 ng/ml EGF, 0.5 mg/ml hydrocortisone, 100 ng/ml cholera toxin, 10 μg/ml insulin, 1% penicillin/streptomycin이 포함된 DMEM/F12(Gibco) 배지를 이용하여 배양하였다. Herceptin-CY3와 페리틴-FcBP는 fluorescein-5-maleimide, human IgG-CY3와 페리틴-FcBP는 fluorescein-5-maleimide를 DMEM 존재하에서 15분간 반응하여 페리틴에 각각의 항체가 결합하도록 하였다. MCF10A에 두 종류의 항체-페리틴을 처리하고 30분간 반응 후 PBS로 세척한 후 형광이미지를 관찰하였다(도 10). 이때 MCF10A 세포주에서는 어떠한 형광도 관찰되지 않았다.
한편, 도 11은 도 10에서 실시한 실험 결과 단백질 침전이 발생하는 문제를 해결하기 위해 페리틴-FcBP와 Herceptin의 결합조건에 변화를 주고 난 뒤 SKBR3 세포주에 처리한 결과를 보여주는 형광 이미지이다. 페리틴-FcBP-fluorescein-5-maleimide를 0.05% TWEEN 20이 포함된 DMEM 존재하에서 15분간 반응하여 페리틴에 각각의 항체가 결합하도록 하였다. SKBR3에 항체-페리틴을 처리하고 30분간 반응시킨 후 PBS로 세척하고 형광이미지를 관찰하였다. 그 결과 과도하게 발생되던 단백질 침전이 감소하였음을 관찰하였다.
실시예 5: 사람 유래 페리틴-항체결합 펩타이드 복합체 제조
사람유래의 페리틴 유전자(서열번호 5, 6, 도 12)는 21세기 프론티어 인간유전자 은행으로부터 분양받았다(클론넘버: hMU001607, hMU011497). 사람유래의 페리틴 유전자를 프라이머P1(서열번호 7; 5'-gggaattccatatgagctcccagattcgtcagaat-3') 및 P2(서열번호 8; 5'-ccgctcgagttagtcgtgcttgagagtgagcct-3')를 이용하여 증폭시킨 다음, 제한효소 NdeI, XhoI을 이용하여 벡터 pET 28(a)에 클로닝하였다. 클로닝 된 페리틴 유전자는 염기서열 분석을 통해 확인하였다.
페리틴 단백질의 157번과 158번 사이에 항체결합 펩타이드 서열을 도입하였다. 프라이머 Q1 (서열번호 9; 5'-ctccacaggctgggtggcgactgtgcatggcacctgggagaggctgggctgggcgagtat-3')과 Q2 (서열번호 10; 5'-atactcgcccagcccagcctctcccaggtgccatgcacagtcgccacccagcctgtggag-3') 를 이용하여 1회 자리지정 돌연변이유발(site-directed mutagenesis)(Invitrogen)을 실시하였다. 이어서 Q3 (서열번호 11; 5'-gactgtgcatggcacctgggagaactggtctggtgcaccgaggctgggctgggcgagtat-3')와 Q4 (서열번호 12; 5'-atactcgcccagcccagcctcggtgcaccagaccagttctcccaggtgccatgcacagtc-3')를 이용하여 2번째 자리지정 돌연변이유발을 수행함으로써 항체결합 펩타이드가 도입된 사람유래 페리틴 유전자를 제작하였다. 사람유래 페리틴-FcBP 에 해당되는 플라스미드 DNA는 대장균(Rosetta DE3, Novagen)으로 형질전환하였으며, IPTG(Isopropyl-β-D-thio-galactoside)를 1 mM이 되도록 첨가한 뒤 18℃에서 16시간 동안 배양하여 단백질의 발현을 유도하였다.
실시예 6: 사람 유래 페리틴-FcBP의 정제 및 특성 분석
사람유래 페리틴-FcBP가 발현된 대장균을 세포 파쇄액(50 mm Tris pH 7.5, 250 mM NaCl, 5% glycerol, 0.5% β-mercaptoethanol)에 현탁하였고, 초음파 발생기로 파쇄시켰다. 이를 원심분리하여 상층액을 탈론 수지(Talon resin, Clontech)를 이용한 배치(batch) 방법으로 정제하였다. 배치방법을 이용한 단백질 정제를 상세히 기술하면 하기와 같다. 10 ㎖의 컬럼완충용액(50 mM Tris pH 7.5, 250 mM NaCl, 5% glycerol, 0.05% β-mercaptoethanol)으로 탈론 수지(1 ㎖)를 2번 씻어서 활성화시킨 후, 상기에서 분리한 상층액을 가하여 4℃에서 1시간 동안 천천히 진탕하여 단백질을 탈론 수지에 흡착시킨다. 수용액을 여과 제거한 후, 탈론 수지를 컬럼완충용액(10 ㎖)으로 두 번 씻어 준 후 10 ㎖의 용출 완충용액(elution buffer: 100 mM 이미다졸)을 가한 후 다시 1 시간 천천히 진탕(rocking)한 후 여과하고 5 ㎖의 용출 완충용액을 사용하여 한 번 더 반복해주어 수득량을 늘렸다. 상기 방법으로 정제된 단백질은 브래드포드 검출(Bradford assay)법을 통해 정량하였고, 15% SDS-PAGE 젤을 통해 단백질의 크기를 추정함으로써 항체결합 펩타이드가 도입된 사람유래 페리틴의 과발현 및 정제 결과를 확인하였다(도 13).
실시예 7: 사람유래 페리틴-항체결합 펩타이드 복합체의 항체 결합력 측정
H IgG 및 사람유래 페리틴-FcBP 간의 상호 결합도를 SPR 방법으로 측정하기 위하여 BIAcore 3000 분석기 (BIACORE, Uppsala, Sweden)를 사용하였다. 바이오센서 분석에서는 EDC / NHS(N'-(3-dimethylaminopropyl) carbodiimide hydrochloride / N-hydroxysuccinimide)로 활성화한 CM5 센서 칩(BIACORE, Uppsala, Sweden)에 10 ㎕/min의 유속으로 H IgG 단백질(20 μg/㎖ in 10 mM Sodium acdetate, pH 4.5)을 7 분간 흘려주어 고정화시켰다. 센서 칩 표면에 남아있는 활성화 부분은 1.0 M 에탄올아민(ethanolamine, pH 8.0)을 첨가하여 비활성화시켰다.
사람유래 페리틴-FcBP는 각 농도별로 완충용액(1 X PBS, pH 7.4)에 희석한 후, 30 ㎕/min의 유속으로 흘러주면서 결합 센서그램과 해리 센서그램을 확인하였다(도 14). 센서 칩과의 비특이적 결합에 의해 발생하는 센서그램을 보정하기 위해서 BSA로만 완전히 비활성화된 셀을 사용하였고 사람유래 페리틴-FcBP의 센서그램에서 BSA의 센서그램을 빼줌으로써 비특이성 결합을 보정하였다. 센서 칩의 표면은 재생 완충용액(20 mM NaOH)을 흘려줌으로써 재생하였다.
실시예 8: 사람유래 페리틴-항체결합 펩타이드 복합체에 시스테인(cystein) 잔기 도입
사람유래 페리틴(서열번호 35)-FcBP의 특정 위치에 시스테인 잔기를 도입하기 위하여 다음에 해당하는 프라이머를 이용하여 자리지정 돌연변이유발을 실시하였다. 서열번호 36은 사람유래 페리틴-항체결합 펩타이드 복합체의 아미노산 서열이며 항체결합 펩타이드(CAWHLGELVWC)의 양말단에는 링커서열(CGGGGGGD 및 TGGGGGAS)을 포함한다. 나노구조체의 내부에 시스테인을 도입하기 위하여 61번 E(Glu), 68번 K(Lys), 137번 E(Glu)를 시스테인으로 치환하였으며, 나노구조체의 외부에 시스테인을 도입하기 위하여 2번 S(Ser), 19번 S(Ser), 102번 A(Ala), 113번 D(Asp)를 시스테인으로 치환하였다. 상기 치환된 자리는 항체결합 펩타이드와의 복합체가 아닌 천연형 페리틴 서열을 기준으로 한다. 사용된 프라이머의 염기서열은 다음과 같다.
E61C forward(서열번호 15): 5'-gccgaggagaagcgctgcggctacgagcgtctcctg-3', E61C reverse(서열번호 16): 5'-caggagacgctcgtagccgcagcgcttctcctcggc-3', K68C forward(서열번호 17): 5'-ggctacgagcgtctcctgtgcatgcaaaaccagcgt-3', K68C reverse(서열번호 18):　5'-acgctggttttgcatgcacaggagacgctcgtagcc-3', E137C forward(서열번호 19): 5'-actcacttcctagattgcgaagtgaagcttatcaag-3', E137C reverse(서열번호 20):　5'-cttgataagcttcacttcgcaatctaggaagtgagt-3', S2C forward(서열번호 21): 5'-ggcagccatatgagctgccagattcgtcagaat-3', S2C reverse(서열번호 22):　5'-attctgacgaatctggcagctcatatggctgcc-3', S19C forward(서열번호 23):　5'-gaggcagccgtcaactgcctggtcaatttgtacctg-3', S19C reverse(서열번호 24):　5'-caggtacaaattgaccaggcagttgacggctgcctc-3', A102C forward(서열번호 25): 5'-atgaaagctgccatgtgcctggagaaaaagctgaac-3', A102C reverse(서열번호 26): 5'-gttcagctttttctccaggcacatggcagctttcat-3', D113C forward(서열번호 27): 5'-aaccaggcccttttgtgccttcatgccctgggttct-3', D113C reverse(서열번호 28): 5'-agaacccagggcatgaaggcacaaaagggcctggtt-3'.
자리지정 돌연변이유발을 위한 PCR은 95℃에서 5분간 초기변성 후 95℃에서 30초간 변성과정(denaturation), 45℃에서 1분간 프라이머 결합(annealing), 68℃에서 12분간의 신장 과정(elongation)을 17회 내지 19회 반복하여 DNA를 증폭하고, 제한효소인 DpnI을 처리하여 주형 DNA를 제거한 뒤 대장균에 형질 전환하고 DNA 염기서열을 확인함으로써 돌연변이가 유도됨을 확인하였다. 이러한 방법을 이용하여 다양한 위치에 시스테인이 삽입된 사람유래 페리틴-FcBP 유전자를 제작하였다. 시스테인이 삽입된 페리틴-FcBP에 해당되는 플라스미드 DNA는 대장균(Rosetta DE3, Novagen)으로 형질전환하였으며, IPTG(Isopropyl-β-D-thio-galactoside)를 1 mM이 되도록 첨가한 뒤 18℃에서 16시간 혹은 37℃에서 3시간 동안 배양하여 단백질의 발현을 유도하였다. 단백질의 발현을 확인한 결과 K71C와 S5C의 경우 불용성 단백질의 형태로 발현됨을 확인하였으며, E61C, E137C, S19C, A102C, D113C의 경우 18℃에서 16시간 동안 배양하였을 때 수용성 단백질의 형태로 발현됨을 확인할 수 있었다(표 2).
표 2
Figure PCTKR2012007993-appb-T000002
실시예 9: 시스테인이 도입된 사람유래 페리틴-FcBP의 정제
상기 실시예 8에서 제조한 시스테인이 도입된 사람유래 페리틴-FcBP을 발현된 대장균을 세포 파쇄액(50 mM Tris pH 7.5, 250 mM NaCl, 5% 글리세롤, 0.5% β-머캅토에탄올)에 현탁하였고, 초음파 발생기로 파쇄시켰다. 이를 원심분리하여 상층액을 탈론 수지(Talon resin, Clontech)를 이용한 배치(batch)방법으로 정제하였다. 배치방법을 이용한 단백질 정제를 상세히 기술하면 하기와 같다. 10 ㎖의 컬럼완충용액(50 mM Tris pH 7.5, 250 mM NaCl, 5% 글리세롤, 0.05% β-머캅토에탄올)으로 탈론 수지(1 ㎖)를 2번 씻어서 활성화시킨 후, 상기 분리한 상층액을 가하여 4℃에서 1시간 동안 천천히 진탕하여 단백질을 탈론 수지에 흡착시킨다. 수용액을 여과 제거한 후, 탈론 수지를 컬럼완충용액(10 ㎖)으로 두 번 세척한 후 10 ㎖의 용출 완충용액(elution buffer: 100 mM 이미다졸)을 가하여 다시 1시간 천천히 진탕(rocking)한 후 여과하고 5 ㎖의 용출 완충용액을 사용하여 한 번 더 반복해주어 수득량을 늘렸다. 상기 방법으로 정제된 단백질은 브래드포드 검출(Bradford assay)법을 통해 정량하였고, 15% SDS-PAGE 젤을 통해 단백질의 크기를 추정함으로써 항체결합 펩타이드가 도입된 사람유래 페리틴의 과발현 및 정제 결과를 확인하였다(도 15).
실시예 10: Pyrococcus furiosus 유래 페리틴-항체결합 펩타이드 복합체에 시스테인 잔기 도입(미생물페리틴-FcBP)
페리틴(서열번호 37)-FcBP의 특정 위치에 시스테인 잔기를 도입하기 위하여 다음에 해당하는 프라이머를 이용하여 자리지정 돌연변이유발을 실시하였다. 서열번호 38은 사람유래 페리틴-항체결합 펩타이드 복합체의 아미노산 서열이며 항체결합 펩타이드(CAWHLGELVWC)의 양말단에는 링커서열(CGGGGGGD 및 TGGGGGAS)을 포함한다. 나노구조체의 내부에 시스테인을 도입하기 위하여 161번째 위치 와 174번 위치 다음에 시스테인 잔기를 하나 이상 포함하는 아미노산 서열(GGC)을 삽입하였으며, 나노구조체의 외부에 시스테인을 도입하기 위하여 1번째와 2번째 아미노산 사이에 시스테인을 삽입하였다. 상기 삽입된 자리는 항체결합 펩타이드와의 복합체가 아닌 천연형 페리틴 서열을 기준으로 한다. 사용된 프라이머의 염기서열은 다음과 같다.
164C(In) forward(서열번호 29): 5'-gataaggagttgagtgcgggcggttgcagagctccaaagctccca-3', 164C(In) reverse(서열번호 30): 5'-tgggagctttggagctctgcaaccgcccgcactcaactccttatc-3', 177C(In) forward(서열번호 31): 5'-ctcttaatgcagggaggagagggcggttgctaaggatccgaattcgagctc-3', 177C(In) reverse(서열번호 32): 5'-gagctcgaattcggatccttagcaaccgccctctcctccctgcattaagag-3', 2C(Ex) forward(서열번호 33):　5'-taagaaggagatatacatatgtgcttgagcgaaagaatgctcaag-3', 2C(Ex) reverse(서열번호 34):　5'-cttgagcattctttcgctcaagcacatatgtatatctccttctta-3'.
자리지정 돌연변이유발을 수행함으로써 시스테인이 삽입된 페리틴-FcBP 유전자를 제작하였다. 시스테인이 삽입된 페리틴-FcBP에 해당되는 플라스미드 DNA는 대장균(BL21 DE3, Novagen)으로 형질전환하였으며, IPTG(Isopropyl-β-D-thio-galactoside)를 1 mM이 되도록 첨가한 뒤 18℃에서 16시간 동안 배양하여 단백질의 발현을 유도하였다. 페리틴-FcBP의 경우 시스테인 잔기가 서로 다른 위치에 삽입된 세 종류의 돌연변이체를 제작하였으며, 이 돌연변이체들은 18℃에서 16시간 동안 배양하였을 때 수용성 단백질의 형태로 발현됨을 확인할 수 있었다(도 16).
실시예 11: 시스테인 페리틴-항체결합 펩타이드 복합체에 금속리간드 도입
박테리아 혹은 인간 유래 단백질 나노입자를 산소를 제거한 pH 7.5의 50 mM 인산완충액에 녹이고 10 mM TCEP으로 30분간 처리한 후 PD10 칼럼으로 과량의 유기시약을 제거하고 단백질을 회수하였다. 이어서 회수한 단백질 나노입자 용액에 도 17에 제시된 (S)-2-(4-(2-브로모아세트아미도)벤질)-DOTA((S)-2-(4-(2-bromoacetamido)benzyl)-DOTA), 디에틸렌트리아민펜타아세트산-말레이미도에틸아미드(diethylene triamine pentaacetic acid-maleimidoethylamide; DTPA-MEA), 혹은 디에틸렌트리아민펜타아세트산-브로모아세트아미도에틸아미드(diethylene triamine pentaacetic acid-bromoacetamidoethylamide; DTPA-BAEA) 등과 같은 금속리간드(10 당량/각 단백질모노머)를 혼합하고 상온에서 10시간 혹은 4℃에서 24시간 동안 정치하였다. PD10 칼럼으로 과량의 미반응 시약을 제거하여 금속이온 배위리간드가 부착된 단백질 나노입자를 제조하였다. 리간드의 결합은 질량분석으로 확인하였다.
실시예 12: 페리틴-항체결합 펩타이드-금속리간드 복합체에 금속이온의 도입
페리틴-항체결합 펩타이드-금속리간드 복합체에 리간드의 1.1 당량에 해당하는 금속이온을 첨가하여 이미징 혹은 치료에 그대로 사용하거나 PD10 탈염칼럼으로 정제 후 사용하였다.

Claims (31)

  1. 항체결합 펩타이드-페리틴 융합단백질 단량체 24개를 포함하는 나노입자로서,
    페리틴에 의해 4-폴드 대칭점(4-fold symmetry point)을 가진 6개의 부분구조가 형성되며, 페리틴 중 4-폴드 대칭점의 ±10 a.a.(amino acid) 범위에 항체결합 펩타이드가 융합되어 4-폴드 대칭점 부근에 4개의 항체결합 펩타이드가 위치하는 것이 특징이 나노입자.
  2. 제1항에 있어서,
    나노입자를 형성하는 페리틴들은 동종 또는 이종인 것이 특징인 나노입자.
  3. 제1항에 있어서,
    나노입자를 형성하는 페리틴들은 천연형 아미노산 서열에서 하나 이상의 아미노산 잔기가 시스테인으로 치환되거나 시스테인이 추가로 삽입된 뮤테인(mutein)인 것인 나노입자.
  4. 제3항에 있어서,
    상기 시스테인은 직접 또는 링커를 통해 약물과 결합하는 것이 특징인 나노입자.
  5. 제3항에 있어서,
    상기 뮤테인은 천연형 사람유래 페리틴 아미노산 서열의 2번째 Ser(serine), 19번째 Ser(serine), 61번째 Glu(glutamic acid), 68번째 Lys(lysine), 102번째 Ala(alanine), 113번째 Asp(aspartic acid) 및 137번째 Glu(glutamic acid)으로 구성된 군으로부터 선택된 하나 이상의 아미노산 잔기가 시스테인으로 치환된 것인 나노입자.
  6. 제3항에 있어서,
    상기 뮤테인은 천연형 Pyrococcus furiosus 페리틴 아미노산 서열의 1번째와 2번째 사이에 시스테인이, 또는 161번째와 162번째 사이 또는 174번째 이후에 GGC 아미노산 서열이 추가로 삽입된 것인 나노입자.
  7. 제5항 또는 제6항에 있어서,
    상기 뮤테인이 천연형 사람유래 페리틴 아미노산 서열의 2번째 Ser(serine), 19번째 Ser(serine), 102번째 Ala(alanine) 및 113번째 Asp(aspartic acid)으로 구성된 군으로부터 선택된 하나 이상의 아미노산 잔기가 시스테인으로 치환된 것이거나, 천연형 Pyrococcus furiosus 페리틴 아미노산 서열의 1번째와 2번째 아미노산 사이에 시스테인이 추가로 삽입되어 입자 외부표면에 노출된 약물결합 가능한 시스테인을 포함하거나,
    천연형 사람유래 페리틴 아미노산 서열의 61번째 Glu(glutamic acid), 68번째 Lys(lysine) 및 137번째 Glu(glutamic acid)으로 구성된 군으로부터 선택된 하나 이상의 아미노산 잔기가 시스테인으로 치환된 것이거나, 천연형 Pyrococcus furiosus 페리틴 아미노산 서열의 161번째와 162번째 사이 또는 174번째 이후 또는 두 자리 모두에 GGC 아미노산 서열이 추가로 삽입되어 입자 내부표면에 노출된 약물결합 가능한 시스테인을 포함하는 것이 특징인 나노입자.
  8. 제1항에 있어서,
    페리틴 중 4-폴드 대칭점의 ±10 a.a. 범위에 항체결합 펩타이드 양 말단이 각각 독립적으로 링커를 통해 또는 링커 없이 융합되어 있는 것이 특징인 나노입자.
  9. 제1항에 있어서,
    항체결합 펩타이드-페리틴 융합단백질 단량체 24개의 자가조립에 의해 형성된 것이 특징인 나노입자.
  10. 제1항에 있어서,
    나노입자의 직경이 1 내지 20 nm인 것을 특징으로 하는 나노입자.
  11. 제1항 내지 제10항 중 어느 한 항에 있어서,
    항체결합 펩타이드에 항체가 결합된 것이 특징인 나노입자.
  12. 제11항에 있어서,
    페리틴 중 하나의 4-폴드 대칭점 부근에 위치한 4개의 항체결합 펩타이드에 하나 혹은 두 개 이상의 항체가 결합된 것이 특징인 나노입자.
  13. 제11항에 있어서,
    항체는 IgG인 것이 특징인 나노입자.
  14. 페리틴의 자기조립에 의해 나노입자 형성시 페리틴 중 4-폴드 대칭점(4-fold symmetry point)의 ±10 a.a. 범위에 항체결합 펩타이드가 융합되어 있는 항체결합 펩타이드-페리틴 융합단백질.
  15. 제14항에 있어서,
    페리틴 중 4-폴드 대칭점의 ±10 a.a. 범위에 항체결합 펩타이드 양 말단이 각각 독립적으로 링커를 통해 또는 링커 없이 융합되어 있는 것이 특징인 융합단백질.
  16. 제14항에 있어서,
    항체 고정화용인 것이 특징인 융합단백질.
  17. 제14항 또는 제15항에 기재된 항체결합 펩타이드-페리틴 융합단백질을 암호화하는 핵산.
  18. 제17항의 핵산을 포함하는 재조합 발현 벡터.
  19. 제17항의 핵산 또는 상기 핵산을 포함하는 재조합 벡터로 형질전환된 형질전환체.
  20. i) 제17항의 핵산을 포함하는 재조합 발현 벡터를 제작하는 단계;
    ii) 상기 재조합 발현 벡터를 형질도입한 형질전환체를 제작하는 단계;
    iii) 단계 ii)의 형질전환체로부터 항체결합 펩타이드-페리틴 융합단백질을 발현시키는 단계; 및
    iv) 발현된 항체결합 펩타이드-페리틴 융합단백질이 자가조립에 의해 4-폴드 대칭점(4-fold symmetry point)을 가진 6개의 부분구조가 형성된 나노입자를 정제하는 단계;를 포함하는 융합 단백질 나노입자의 생산 방법.
  21. 제1항 내지 제13항 중 어느 한 항에 기재된 나노입자의 내부 또는 표면에 약물을 운반하는 것이 특징인 약물 전달체.
  22. 제21에 있어서,
    나노입자 중 항체결합 펩타이드에 항체가 결합되어 표적지향적 약물 전달이 가능한 약물 전달체.
  23. 제21항에 있어서,
    상기 약물은 치료제제 또는 진단/검출제제인 것인 약물 전달체.
  24. 제23항에 있어서,
    상기 치료제제는 항체, 항체단편, 약물, 독소, 핵산가수분해효소, 호르몬, 면역조절제, 킬레이터, 붕소화합물, 광활성(photoactive)제제, 염료 또는 방사성동위원소인 약물 전달체.
  25. 제23항에 있어서,
    상기 진단/검출제제는 방사선동위원소, 염료, 조영제, 형광단백질, 형광화합물, 또는 MRI(magnetic resonance imaging) 조영 증강제인 것인 약물 전달체.
  26. 제21항에 있어서,
    약물은 나노입자 내부에 봉입되거나, 나노입자 내부 또는 외부 표면에 직접 또는 링커를 통해 결합되는 것인 약물 전달체.
  27. 제1항 내지 제13항 중 어느 한 항에 기재된 나노입자를 포함하는 단백질 칩.
  28. 제27항에 있어서,
    나노입자 중 항체결합 펩타이드에 항체가 결합되어 있는 단백질 칩.
  29. 제27항의 단백질 칩을 준비하는 단계;
    상기 단백질 칩에 검출 대상의 항원에 대한 항체를 고정화하는 단계;
    상기 고정화된 항체를 포함하는 단백질 칩에 시료를 반응시키는 단계; 및
    항원-항체반응 여부를 측정하는 단계를 포함하는 항원 검출방법.
  30. 제27항에 기재된 단백질 칩을 포함하는 진단 키트.
  31. 제30항에 있어서,
    나노입자 중 항체결합 펩타이드에 항체가 결합되어 있는 진단 키트.
PCT/KR2012/007993 2011-10-12 2012-10-02 항체결합 펩타이드-페리틴 융합단백질 및 이의 용도 WO2013055058A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20110104339 2011-10-12
KR10-2011-0104339 2011-10-12

Publications (3)

Publication Number Publication Date
WO2013055058A2 WO2013055058A2 (ko) 2013-04-18
WO2013055058A9 true WO2013055058A9 (ko) 2013-06-13
WO2013055058A3 WO2013055058A3 (ko) 2013-08-01

Family

ID=48082633

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2012/007993 WO2013055058A2 (ko) 2011-10-12 2012-10-02 항체결합 펩타이드-페리틴 융합단백질 및 이의 용도

Country Status (2)

Country Link
KR (1) KR101477123B1 (ko)
WO (1) WO2013055058A2 (ko)

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014182136A1 (ko) 2013-05-10 2014-11-13 고려대학교 산학협력단 표적 지향성 펩타이드를 포함하는 재조합 자기조립성 단백질 및 그의 용도
KR101629362B1 (ko) * 2014-05-15 2016-06-10 한국생명공학연구원 루신 지퍼 쌍을 이용한 암 진단 및 치료용 조성물
KR20160094550A (ko) * 2015-01-30 2016-08-10 동국대학교 산학협력단 단일사슬항체조각과 페리틴을 포함하는 융합단백질 및 그의 용도
KR101811050B1 (ko) 2015-09-02 2017-12-21 경북대학교 산학협력단 항염증성 폴리펩티드와 페리틴 모노머 단편이 접합된 융합폴리펩티드 및 이를 유효성분으로 포함하는 염증성 질환 예방 및 치료용 약학적 조성물
KR101888675B1 (ko) 2015-09-02 2018-08-14 경북대학교 산학협력단 인간 유래 페리틴 모노머 단편 및 이를 이용한 융합폴리펩티드
KR101712852B1 (ko) * 2016-05-18 2017-03-07 한국생명공학연구원 루신 지퍼 쌍을 이용한 암 진단 및 치료용 조성물
CA3040440C (en) 2016-07-15 2022-12-13 Korea Institute Of Science And Technology A novel nanocage and use thereof
US11261236B2 (en) 2017-01-06 2022-03-01 Kyungpook National University Industry-Academic Cooperation Foundation Fusion peptide comprising thrombus-targeting peptide, ferritin fragment and thrombolytic peptide, and use thereof
KR102032647B1 (ko) 2018-04-03 2019-10-15 한양대학교 에리카산학협력단 미생물 검출용 구조체, 그의 제조 방법, 및 그 미생물 검출용 구조체를 이용한 미생물 검출 방법
EP3958885A4 (en) * 2019-04-25 2023-07-19 The Regents of the University of California ANTIBODY DECORATED SELF-ASSEMBLING PROTEIN NANOCAGE (SAPNA) AND PARTS ITS
WO2022092974A1 (ko) * 2020-10-30 2022-05-05 (주)셀레메디 항체 유사 단백질 및 그 용도
EP4238984A1 (en) 2020-10-30 2023-09-06 Cellemedy Co., Ltd Antibody-like protein and use thereof
KR102649246B1 (ko) * 2021-06-28 2024-03-20 한국과학기술연구원 Pd-1 부착 나노케이지 및 이의 용도
WO2023135187A1 (en) * 2022-01-12 2023-07-20 Navigo Proteins Gmbh High affinity purification of ferritin

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7097841B2 (en) * 2002-05-10 2006-08-29 New Century Pharmaceuticals, Inc. Ferritin fusion proteins for use in vaccines and other applications
US20090035389A1 (en) * 2007-02-23 2009-02-05 Specigen Inc. Targeted protein cages
KR20100001091A (ko) * 2008-06-26 2010-01-06 한국생명공학연구원 항체를 세포내로 도입하는 융합 펩타이드，및 이를 이용한세포이미징 및 약물전달
KR100953917B1 (ko) * 2009-04-30 2010-04-22 고려대학교 산학협력단 항체의 Ｆｃ 영역에 특이적 결합능을 가지는 리포펩타이드 및 그를 포함하는 항원 인지형 지질 나노입자

Also Published As

Publication number Publication date
KR101477123B1 (ko) 2014-12-29
KR20130039672A (ko) 2013-04-22
WO2013055058A2 (ko) 2013-04-18
WO2013055058A3 (ko) 2013-08-01

Similar Documents

Publication Publication Date Title
WO2013055058A2 (ko) 항체결합 펩타이드-페리틴 융합단백질 및 이의 용도
JP7076152B2 (ja) ＩｇＧ結合ペプチドによる抗体の特異的修飾
TWI837077B (zh) 藉由IgG結合肽之部位特異性RI標識抗體
KR101884654B1 (ko) 폴리펩타이드
US5420105A (en) Polymeric carriers for non-covalent drug conjugation
US20230192812A1 (en) Stabilized fibronectin based scaffold molecules
Hui et al. Facile Method for the Site‐Specific, Covalent Attachment of Full‐Length IgG onto Nanoparticles
CN108602878B (zh) C端赖氨酸缀合免疫球蛋白
WO2016122259A1 (ko) 단일사슬항체조각과 페리틴을 포함하는 융합단백질 및 그의 용도
US8846861B2 (en) Peptide clearing agents
JP5677453B2 (ja) Ｂｐｂベースのカーゴ運搬システム
WO2009136676A1 (en) Method for specific covalent coupling of antibody using a photoactivable protein g variant
JP2011032264A (ja) 標識タンパク質及びその取得方法
CN113166217A (zh) 用于癌症诊断和治疗的新型folr1特异性结合蛋白
JP5403681B2 (ja) 新規核内移行ペプチド
KR102006997B1 (ko) ＩｇＧ Ｆｃ 위치선택적 결합 펩티드 및 이를 포함하는 하이브리드 분자
Kang et al. IgG Fc-binding peptide (FcBP)-tat conjugate as a smart antibody carrier into live cells
TWI787151B (zh) 藉由ＩｇＧ結合肽之抗體之特異性裝飾
US20030113819A1 (en) Carrier peptide and method for delivery of molecules into cells
WO2022080385A1 (ja) ペプチド、およびペプチドを用いる抗体の修飾
WO2019107962A2 (ko) 항체와 생리활성물질의 접합방법
JPS6185327A (ja) 発癌遺伝子生成物に対する抗体

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12840592

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct app. not ent. europ. phase

Ref document number: 12840592

Country of ref document: EP

Kind code of ref document: A2