WO2012142500A2 - Compositions and methods for autologous germline mitochondrial energy transfer - Google Patents

Compositions and methods for autologous germline mitochondrial energy transfer Download PDF

Info

Publication number
WO2012142500A2
WO2012142500A2 PCT/US2012/033643 US2012033643W WO2012142500A2 WO 2012142500 A2 WO2012142500 A2 WO 2012142500A2 US 2012033643 W US2012033643 W US 2012033643W WO 2012142500 A2 WO2012142500 A2 WO 2012142500A2
Authority
WO
WIPO (PCT)
Prior art keywords
osc
mitochondria
composition
progeny
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2012/033643
Other languages
English (en)
French (fr)
Other versions
WO2012142500A3 (en
Inventor
Jonathan Lee TILLY
Dori C. WOODS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
Original Assignee
General Hospital Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=47010014&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2012142500(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to EP18205564.0A priority Critical patent/EP3498826A1/en
Priority to EA201391523A priority patent/EA201391523A1/ru
Priority to CA2832336A priority patent/CA2832336C/en
Priority to NZ617582A priority patent/NZ617582B2/en
Priority to SG2013075510A priority patent/SG194448A1/en
Priority to MX2013011990A priority patent/MX2013011990A/es
Priority to AU2012242591A priority patent/AU2012242591B2/en
Priority to JP2014505369A priority patent/JP5793237B2/ja
Priority to AP2013007229A priority patent/AP2013007229A0/xx
Priority to PH1/2013/502206A priority patent/PH12013502206A1/en
Priority to EP12770662.0A priority patent/EP2697365A4/en
Application filed by General Hospital Corp filed Critical General Hospital Corp
Priority to EP14164380.9A priority patent/EP2787073B1/en
Priority to BR112013026501A priority patent/BR112013026501A2/pt
Priority to CN201280018195.1A priority patent/CN103562378B/zh
Publication of WO2012142500A2 publication Critical patent/WO2012142500A2/en
Publication of WO2012142500A3 publication Critical patent/WO2012142500A3/en
Priority to IL228829A priority patent/IL228829A/en
Anticipated expiration legal-status Critical
Priority to TNP2013000454A priority patent/TN2013000454A1/fr
Priority to MA36400A priority patent/MA35105B1/fr
Priority to ZA2013/08494A priority patent/ZA201308494B/en
Priority to IL237089A priority patent/IL237089A/en
Priority to IL247447A priority patent/IL247447B/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0608Germ cells
    • C12N5/0609Oocytes, oogonia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0608Germ cells
    • C12N5/0611Primordial germ cells, e.g. embryonic germ cells [EG]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/11Epidermal growth factor [EGF]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/115Basic fibroblast growth factor (bFGF, FGF-2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/13Nerve growth factor [NGF]; Brain-derived neurotrophic factor [BDNF]; Cilliary neurotrophic factor [CNTF]; Glial-derived neurotrophic factor [GDNF]; Neurotrophins [NT]; Neuregulins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • C12N2501/23Interleukins [IL]
    • C12N2501/235Leukemia inhibitory factor [LIF]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00Coculture with; Conditioned medium produced by
    • C12N2502/13Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2517/00Cells related to new breeds of animals
    • C12N2517/10Conditioning of cells for in vitro fecondation or nuclear transfer

Definitions

  • the present invention is based, in part, upon the surprising discovery that the mammalian female germline stem cells or oogonial stem cells (OSCs), which are present in the somatic tissue of the ovary, contain mitochondria with the highest known ATP-generating capacity of all stem cell types evaluated, and containing mtDNA having a reduced amount of accumulated mutations, including, in some cases, non-detectable levels of a common mtDNA deletion known to accumulate with age in somatic cells.
  • OSCs oogonial stem cells
  • the invention provides a method of preparing an oocyte for in vitro fertilization (IVF) or artificial insemination.
  • the method comprises transferring a composition comprising OSC mitochondria, or mitochondria obtained from a progeny of an OSC, into an autologous oocyte, thereby preparing the oocyte for in vitro fertilization or artificial insemination.
  • the OSC is an isolated non-embryonic stem cell that is mitotically competent and expresses Vasa, Oct-4, Dazl, Stella and optionally a stage-specific embryonic antigen (SSEA) (e.g., SSEA-1, -2, -3, and -4).
  • SSEA stage-specific embryonic antigen
  • the OSC can be obtained from ovarian tissue, or non-ovarian tissue/sources, such as, e.g., bone marrow or blood, e.g., peripheral and umbilical cord blood.
  • the composition comprising OSC mitochondria, or mitochondria obtained from a progeny of an OSC is the cytoplasm of the cells without a nucleus.
  • the composition comprising OSC mitochondria or mitochondria obtained from the progeny of an OSC is a purified preparation.
  • the purified preparation does not contain or is at least about 85%, 90%, 95% free of OSCs, OSC progeny and/or non-functional mitochondria.
  • the composition comprises lxl 0 3 to 5xl0 4 mitochondria.
  • the OSC or progeny of an OSC produces at least 5-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 10-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 50-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 100-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the oocyte is obtained from a human female of advanced maternal age. In other embodiments, the oocyte is obtained from a human female with low ovarian reserve.
  • the composition comprises mitochondria that have been isolated by centrifugation. In other embodiments, the composition comprises mitochondria that have been isolated by mitochondrial membrane potential-dependent cell sorting.
  • the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC is the cytoplasm of the cells without a nucleus. In other embodiments, the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC is a purified preparation of mitochondria.
  • the invention provides an composition comprising isolated OSC mitochondria, or mitochondria obtained from a progeny of an OSC.
  • the composition is at least about 85%, 90%, 95% free of cells or non-functional mitochondria.
  • the composition comprises lxlO 3 to 5xl0 4 mitochondria.
  • the OSC or progeny of an OSC produces at least 5-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 10-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 50-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 100-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC is obtained from a human female of advanced maternal age. In other embodiments, the OSC or progeny of an OSC is obtained from a human female with low ovarian reserve.
  • the composition comprises mitochondria that have been isolated by centrifugation. In other embodiments, the composition comprises mitochondria that have been isolated by mitochondrial membrane potential-dependent cell sorting.
  • the invention provides a composition comprising at least one isolated mitochondrion obtained from an OSC or at least one progeny of an OSC.
  • the composition comprises lxlO 3 to 5xl0 4 mitochondria.
  • the OSC or progeny of an OSC produces at least 5-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 10-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 50-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 100-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC is obtained from a human female of advanced maternal age. In other embodiments, the OSC or progeny of an OSC is obtained from a human female with low ovarian reserve.
  • the composition comprises mitochondria that have been isolated by centrifugation. In other embodiments, the composition comprises mitochondria that have been isolated by mitochondrial membrane potential-dependent cell sorting.
  • the invention provides an oocyte prepared in accordance with any of the methods described above.
  • the invention provides an oocyte comprising exogenous, autologous OSC mitochondria or mitochondria obtained from a progeny of an OSC.
  • the invention provides a method of in vitro fertilization.
  • the method comprises the steps of: a) obtaining a composition comprising i) mitochondria obtained from an OSC, or ii) mitochondria obtained from a progeny of an OSC; b) transferring the composition into an isolated, autologous oocyte; and c) fertilizing the autologous oocyte in vitro to form a zygote.
  • the method further comprises transferring the zygote, or a preimplantation stage embryo derived from the zygote, into the uterus or oviduct of a female subject.
  • the composition comprises lxlO 3 to 5xl0 4 mitochondria.
  • the OSC or progeny of an OSC produces at least 5 -fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 10-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 50-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 100-fold more
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the oocyte is obtained from a human female of advanced maternal age. In other embodiments, the oocyte is obtained from a human female with low ovarian reserve.
  • the composition comprises mitochondria that have been isolated by centrifugation. In other embodiments, the composition comprises mitochondria that have been isolated by mitochondrial membrane potential-dependent cell sorting.
  • the at least one OSC is obtained from ovarian tissue. In other embodiments, the at least one OSC is obtained from a non-ovarian tissue.
  • the non-ovarian tissue is blood. In other embodiments, the non- ovarian tissue is bone marrow.
  • the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC is the cytoplasm of the cells without a nucleus.
  • the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC is a purified preparation of mitochondria.
  • the invention provides a method of isolating a population of functional mitochondria from at least one OSC, or at least one progeny of an OSC.
  • the method comprises the steps of incubating a composition comprising at least one OSC, or at least one progeny of an OSC, with a mitochondrial tracking probe under conditions sufficient to bind the probe to the functional mitochondria and sorting the functional mitochondria from the nonfunctional mitochondria, thereby isolating the population of functional mitochondria from at least one OSC, or at least one progeny of an OSC.
  • non-functional mitochondria are excluded from the population of functional mitochondria.
  • the mitochondrial tracking probe is a non-oxidation dependent probe. In some embodiments, the mitochondrial tracl ing probe is an accumulation dependent probe. In some embodiments, the mitochondrial traclcing probe is a reduced oxidative state probe. In some embodiments, the sorting step includes fluorescence-activated cell sorting.
  • the invention provides a method of identifying a population of functional mitochondria obtained from at least one OSC, or at least one progeny of an OSC.
  • the method comprises the steps of: a) incubating a composition comprising at least one OSC, or at least one progeny of an OSC, with a fluorescent reduced oxidative state probe and a fluorescent accumulation dependent probe under conditions sufficient to bind the fluorescent reduced oxidative state probe to functional mitochondria in the composition and bind the fluorescent accumulation dependent probe to total mitochondria in the composition; b) obtaining a composition comprising the functional mitochondria using fluorescence-activated cell sorting, wherein the composition excludes non-functional mitochondria; c) determining the amount of functional mitochondria and the amount of total mitochondria; and d) calculating the ratio of functional mitochondria to total mitochondria; and e) determining whether the ratio is greater than about 0.02, thereby identifying a population of functional mitochondria obtained from at least one OSC, or at least one progeny of an OSC.
  • the fluorescent accumulation dependent probe can fluoresce in one portion of the spectrum (e.g., green). In other embodiments, the fluorescent reduced oxidative state probe can fluoresce in a different portion of the spectrum (e.g., red).
  • the invention provides a composition comprising functional mitochondria obtained according to a method comprising the steps of: a) incubating a composition comprising at least one OSC, or at least one progeny of an OSC, with a fluorescent reduced oxidative state probe and a fluorescent accumulation dependent probe under conditions sufficient to bind the fluorescent reduced oxidative state probe to functional mitochondria in the composition and bind the fluorescent accumulation dependent probe to total mitochondria in the composition; and b) obtaining a composition comprising the functional mitochondria using fluorescence-activated cell sorting, wherein the composition excludes non-functional mitochondria.
  • kits comprising a composition comprising isolated OSC mitochondria or mitochondria obtained from a progeny of an OSC and instructions for use.
  • the composition is at least about 85%, 90%, 95% free of cells or non-functional mitochondria.
  • kits comprising at least one isolated mitochondrion obtained from an OSC or at least one progeny of an OSC and instructions for use.
  • Another aspect of the invention provides a method for increasing the ATP-generating capacity of an oocyte.
  • the method comprises the steps of: a) obtaining a composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC that is autologous to the oocyte; and b) injecting the composition of mitochondria into the oocyte.
  • the composition comprises lxlO 3 to 5xl0 4 mitochondria.
  • the OSC or progeny of an OSC produces at least 5-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 10-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 50-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the OSC or progeny of an OSC produces at least 100-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  • the ovarian somatic cell or mesenchymal stem cell is autologous.
  • the oocyte is obtained from a human female of advanced maternal age. In other embodiments, the oocyte is obtained from a human female with low ovarian reserve.
  • the composition comprises mitochondria that have been isolated by centrifugation. In other embodiments, the composition comprises mitochondria that have been isolated by mitochondrial membrane potential-dependent cell sorting.
  • the at least one OSC is obtained from ovarian tissue. In other embodiments, the at least one OSC is obtained from a non-ovarian tissue.
  • the non-ovarian tissue is blood. In other embodiments, the non- ovarian tissue is bone marrow.
  • the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC is the cytoplasm of the cells without a nucleus. ⁇ other embodiments, the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC is a purified preparation of mitochondria.
  • the invention provides an oocyte prepared by a method comprising the steps of: a) obtaining a composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC that is autologous to the oocyte; and b) injecting the composition of mitochondria into the oocyte.
  • Yet another aspect of the invention provides a composition of mitochondria obtained from at least one OSC or at least one progeny of an OSC, wherein the composition comprises a population of mitochondria in which greater than about 75%, 85%, 90%, or about 99% of the mitochondria are high ATP-generating capacity mitochondria.
  • compositions comprising a population of mitochondria in which less than about 5% to about 25% of the mtDNA comprises a deletion mutation within nucleotides 8470-13447 of the mitochondrial genome, and methods pertaining to such compositions.
  • FIG 1 depicts validation of a fluorescence-activated cell sorting (FACS)-based protocol for OSC isolation.
  • FACS fluorescence-activated cell sorting
  • Figure la immunofluorescence analysis of VASA expression (with DAPI counterstain) is shown in adult mouse ovaries using antibodies against the NH 2 or COOH terminus of VASA (scale bars, 50 ⁇ ).
  • Figure lb immunomagnetic sorting of dispersed mouse ovaries or isolated oocytes is shown using antibodies against the NH 2 or COOH terminus of VASA.
  • Fraction 1 contains cells plus beads prior to separation
  • Fraction 2 is a wash or flow-through fraction (non-immunoreactive)
  • Fraction 3 is a bead fraction (VA8A- positive cells).
  • FIG lc FACS analysis of live or permeabilized cells from dispersed mouse ovaries using antibodies against the NH 2 or COOH terminus of VASA is shown. Viable VASA- positive cells are only detected with the COOH antibody (dashed box) whereas permeabilization enables isolation of VASA-positive cells using the NH 2 antibody (dashed box).
  • permeabilization of viable VASA-positive cells (dashed box) obtained with the COOH antibody enables re-isolation of the same cells by FACS using the NH 2 antibody (dashed box).
  • Figure le a schematic representation of the FACS protocols employed using the VASA-COOH antibody for isolation of viable OSCs is shown.
  • Figure If depicts gene expression analysis of germline markers [Blimp 1 (also referred to as PR domain containing 1 with ZNF domain or Prdml), Stella, Fragilis (also referred to as interferon induced transmembrane protein 3 or Ifitm3), Tert (telomerase reverse transcriptase), Vasa, Dazl (deleted in azoospermia like)] and oocyte markers [Nobox (newborn ovary homeobox), Zp3 (zona pellucida glycoprotein 3), Gdf9 (growth differentiation factor 9)] in each cell fraction produced during the ovarian dispersion process to obtain cells for FACS-based isolation of OSCs using the VASA-COOH antibody (+ve, VASA-positive viable cell fraction after FACS; -ve, VASA-negative viable cell fraction after FACS; No RT, PCR of RNA sample without reverse transcription; jS-actin, sample loading control).
  • VASA-COOH antibody (+ve, VASA-positive viable cell fraction after F
  • Figure 2 depicts OSC fractions isolated from adult mouse ovaries by immunomagnetic bead sorting that contain contaminating oocytes.
  • Gene expression analysis of germline markers (Blimpl, Stella, Fragilis, Tert, Vasa, Dazl) and oocyte-specific markers (Nobox, Zp3, Gdf9) is shown in young adult mouse ovaries (positive control) or the final cell fraction obtained following VASA-COOH antibody-based immunomagnetic bead sorting of dispersed young adult mouse ovaries (No RT, PCR of sorted cell RNA sample without reverse transcription; ⁇ - actin, sample loading control).
  • Figure 3 depicts isolation of VASA-positive cells from adult mouse and human ovaries using FACS.
  • Figure 3a and b the representative histological appearance of adult ovarian tissue used for human (a) and mouse (b) OSC isolation is shown. Scale bars, 100 ⁇ .
  • Figures 3 c and d the morphology of viable cells isolated by FACS based on cell-surface expression of VASA is shown. Scale bars, 10 ⁇ .
  • Figure 3e provides the gene expression profile of starting ovarian material and freshly-isolated OSCs, showing assessment of 3 different patients as examples for human tissue analysis (No RT: PCR of RNA sample without reverse transcription; /3-actin, sample loading control).
  • Figure 4 depicts functional eggs obtained from mouse OSCs after intraovarian transplantation.
  • Figures 4a and 4b examples of growing follicles containing GFP-negative and GFP-positive (hematoxylin counterstain) oocytes are shown in ovaries of wild-type mice injected with GFP-expressing OSCs 5-6 months earlier.
  • FIG 4c examples of ovulated GFP -negative eggs (in cumulus-oocyte complexes), and resultant embryos [2-cell, 4-cell, compact morula (CM) and early blastocyst (EB) stage embryos are shown as examples] generated by IVF are shown, following induced ovulation of wild-type female mice that received intraovarian transplantation of GFP-expressing OSCs 5-6 months earlier.
  • Figures 4d and 4e examples of GFP-positive eggs (in cumulus-oocyte complexes) obtained from the oviducts are shown following induced ovulation of wild-type female mice that received intraovarian transplantation of GFP-expressing OSCs 5-6 months earlier.
  • Figure 5 depicts germ cell colony formation by mouse and human OSCs in vitro.
  • Figure 6 depicts evaluation of mouse and human ovary-derived VASA-positive cells in defined cultures.
  • Figures 6a through 6d show assessment of OSC proliferation by dual detection of VASA expression and BrdU incorporation in mouse (6a, 6b) and human (6c, 6d) OSCs maintained in MEF-free cultures.
  • Figure 6e shows the typical growth curve for MEF-free cultures of mouse OSCs after passage and seeding 2.5 X 10 4 cells per well in 24-well culture plates.
  • Figure 6f shows FACS analysis using the COOH antibody to detect cell-surface expression of VASA in mouse OSCs after months of propagation (example shown, passage 45).
  • Figure 6g indicates the gene expression profile of starting ovarian material and cultured mouse and human OSCs after 4 or more months of propagation in vitro (No RT, PGR of RNA sample without reverse transcription; /3-actin, sample loading control).
  • Two different human OSC lines (OSCl and OSC2) established from two different patients are shown as examples.
  • Figure 6h and 6i show representative immunofluorescence analysis of BLIMP 1, STELLA and FRAGILIS expression in mouse (h) and human (i) OSCs in MEF-free cultures. Cells were counterstained with DAPI and rhodamine-phalloidin to visualize nuclear DNA and cytoplasmic F-actin, respectively.
  • Figure 7 depicts spontaneous oogenesis from cultured mouse and human OSCs.
  • Figures 7a through 7c provide examples of immature oocytes formed by mouse OSCs in culture, as assessed by morphology (7a), expression of oocyte marker proteins VASA and KIT (7b; note cytoplasmic localization of VASA), and the presence of mRNAs encoding the oocyte marker genes Vasa, Kit, Msy2 (also referred to as Y box protein 2 or Ybx2), Nobox, Lhx8, Gdf9, Z l, Zp2 and Zp3 (7c; No RT: PCR of RNA sample without reverse transcription; /3-actin, sample loading control). Scale bars, 25 ⁇ .
  • the presence of mRNAs encoding oocyte marker genes (Vasa, Kit, Msy2, Nobox, Lhx8, Gdf9, Zpl, Zp2, Zp3) in human OSC- derived oocytes is shown in panel c along with results for mouse OSC-derived oocytes.
  • Figure 8 depicts the detection of oocyte-specific markers in adult human ovaries.
  • VASA Immunofluorescence analysis of VASA (8a), KIT (8b), MSY2 (8c) and LHX8 (8d,) expression in oocytes in adult human ovarian cortical tissue is shown (see also Figure lOh). Sections were counterstained with DAPI for visualization of nuclei. Scale bars, 25 ⁇ .
  • Figure 9 depicts ploidy analysis of human fibroblasts and mouse OSCs in culture.
  • Figure 9a and 9b show representative FACS-based assessment of ploidy status in cultures of actively- dividing human fetal lcidney fibroblasts (9a) and in mouse OSCs collected 48 hours after passage (9b).
  • Haploid (In) cells were only detected in the germline cultures, consistent with results from analysis of human OSCs maintained in vitro (see Figure 7i), whereas all cultures contained diploid (2n) and tetraploid (4n) populations of cells.
  • Figure 10 depicts generation of oocytes from human OSCs in human ovary tissue.
  • Direct (live-cell) GFP fluorescence analysis of human ovarian cortical tissue following dispersion, re- aggregation with GFP-hOSCs (10a) and in vitro culture for 24-72 hours (10b, 10c) is shown. Note the formation of large single GFP-positive cells surrounded by smaller GFP-negative cells in compact structures resembling follicles ( Figures 10b and 10c; scale bars, 50 ⁇ ).
  • GFP was not detected in grafts prior to GFP-hOSC injection, whereas MSY2 and LHX8 were detected in all oocytes. Sections were counterstained with DAPI for visualization of nuclei. Scale bars, 25 ⁇ .
  • Figure 11 depicts morphometry-based assessment of oocyte formation in human ovarian xenografts following GFP-hOSC transplantation.
  • the total number of primordial and primary follicles in 3 randomly selected human ovarian cortical tissue samples (labeled 1, 2 and 3) are shown, 7 days after injecting GFP-hOSCs and xenografting into NOD/SCED mice, which contain GFP-negative (host-derived) or GFP-positive (OSC-derived) oocytes (see Figures lOd through 1 Og for examples) .
  • Figure 12 depicts cryopreservation and thawing of human ovarian cortical tissue and freshly-isolated human OSCs.
  • Figure 12a and 12b show the histological appearance of adult human ovarian cortical tissue before and after vitrification, highlighting the maintenance of tissue integrity and the large numbers of oocytes (black arrowheads) that survive the freeze-thaw procedure.
  • Figure 12c the percent cell loss following freeze-thaw of freshly-isolated human OSCs is shown (results from two different patients).
  • FIG. 13 depicts an overview of an Autologous Germline Mitochondrial Energy Transfer (AUGMENT) procedure.
  • OSCs used as a source of mitochondria for the transfer, and the egg to be fertilized which will receive the OSC mitochondria, are obtained from the same subject.
  • Figure 14 depicts mitochondrial staining with MitoTracker Green FM (Invitrogen M7514, Life Technologies Corp., Carlsbad, CA) in cultured human ovarian somatic cells and cultured human OSCs obtained from the same patient.
  • MitoTracker Green FM Invitrogen M7514, Life Technologies Corp., Carlsbad, CA
  • Figure 15 depicts PCR analysis of the 4977-bp deletion in mtDNA from cultured OSCs and patient matched ovarian somatic cells.
  • Figure 16 depicts the results of an ATP assay.
  • Figure 17 depicts FACS-based germ cell purification or isolation from bone marrow preparations of adult female mice during estrus of the female reproductive cycle using cell surface expression of Vasa to isolate the cells.
  • Figure 18 depicts FACS-based germ cell purification or isolation from peripheral blood preparations of adult female mice during estrus of the female reproductive cycle using cell surface expression of Vasa to isolate the cells.
  • FIG 19 depicts mitochondria following staining with mitotracker M7514 and cell lysis.
  • Human OSCs were incubated with M7514, and then lysed to release the stained mitochondria using osmotic shock.
  • the entire population (mitochondria from lysed cells and residual unlysed stained cells) was analyzed by FACS.
  • the left panel shows mitochondria from lysed cells, which are easily distinguishable from mitochondria contained in residual unlysed cells based on size (forward scatter; FSC-A).
  • Fluorescence intensity (FITC-A) revealed two distinct populations of mitochondria from lysed cells, one having high intensity (Mito MT high), and one having low intensity (Mito MT Low). Functional mitochondria are known to have a greater uptake and retention of the stain, and thus fluoresce at a higher intensity (Invitrogen technical staff, Life Technologies Corp., Carlsbad, CA).
  • Figure 20 depicts the kinetics of ATP production capacity by mitochondria isolated from different human cell types.
  • Figure 21 depicts ATP production capacity over 10 minutes by mitochondria isolated from different human cell types.
  • Figure 22 depicts mtDNA deletion analysis in human mesenchymal stem cells and human ovarian soma.
  • OSCs also known as female germline stem cells
  • OSCs are derived from postnatal sources and express markers including Vasa, Oct-4, Dazl, Stella and optionally an SSEA.
  • OSCs are mitotically competent (i.e., capable of mitosis) and do not express oocyte markers including growth/differentiation factor-9 ("GDF-9"), and zona pellucida glycoproteins (e.g., zona pellucida glycoprotein-3, "ZP3”), or markers of meiotic recombination such as synaptonemal complex protein-3 ("SYCP3" or "SCP3").
  • OSCs can be obtained from the postnatal ovary. OSCs are known in the art and are described in U.S.
  • OSCs are additionally described by Johnson et al., Nature 428:145-150; Johnson et al., Cell 2005 122:303-315; Wang et al., Cell Cycle 2010 9:339-349; Niikura et al., Aging 2010 2:999-1003; Tilly et al., Biol Reprod 2009 80:2-12, Tilly et al., Mol Hum Reprod 2009 15:393-398; Zou et al., Nat Cell Biol 2009 11:631-636; Pacchiarotti et al., Differentiation 2010 79:159-170), the contents of which are incorporated herein by reference.
  • the OSC of the invention is a human OSC.
  • the "progeny of an OSC” refers to all daughter cells derived from OSCs of the invention, including progenitor cells and differentiated cells that maintain or achieve oogenic potential (i.e., the ability to form an oocyte) and functional mitochondria.
  • the OSC progeny of the invention is a human OSC progeny.
  • микл ⁇ онент refers to mitochondria that produce ATP and can be used interchangeably with the term “respiring mitochondria.”
  • OSCs may additionally be obtained from the bone marrow, peripheral blood or umbilical cord blood.
  • Bone marrow derived OSCs of the invention can also circulate throughout the body and most preferably can be localized in bone marrow, peripheral blood and ovary.
  • Bone marrow derived OSCs express markers including Oct 4, Vasa, Dazl, Stella, Fragilis, and optionally Nobox, Kit and Sca-1.
  • Bone marrow derived OSCs are mitotically competent (i.e., capable of mitosis) and do not express GDF-9, zona pellucida proteins (e.g., ZP3) or SCP3.
  • GDF-9 e.g., ZP3
  • SCP3 zona pellucida proteins
  • Oct-4 also referred to as POU domain class 5 transcription factor 1 or Pou5fl, is a gene expressed in female germline stem cells and their progenitor cells.
  • the Oct-4 gene encodes a transcription factor that is involved in the establishment of the mammalian germline and plays a significant role in early germ cell specification (reviewed in Scholer, Trends Genet. 1991 7(10):323-329).
  • Oct-4 is down-regulated during the differentiation of the epiblast, eventually becoming confined to the germ cell lineage.
  • Oct-4 expression is regulated separately from epiblast expression.
  • Expression of Oct-4 is a phenotypic marker of totipotency (Yeom et al., Development 1996 122:881-888).
  • Stella also commonly referred to as developmental pluripotency associated 3 or Dppa3, is a gene expressed in female germline stem cells and their progenitor cells. Stella is a novel gene specifically expressed in primordial germ cells and their descendants, including oocytes (Bortvin et al., BMC Developmental Biology 20044(2): 1-5). Stella encodes a protein with a SAP-like domain and a splicing factor motif-like structure. Embryos deficient in Stella expression are compromised in preimplantation development and rarely reach the blastocyst stage. Thus, Stella is a maternal factor implicated in early embryogenesis.
  • Dazl is a gene expressed in female germline stem cells and their progenitor cells.
  • the autosomal gene Dazl is a member of a family of genes that contain a consensus RNA binding domain and are expressed in germ cells. Loss of expression of an intact Dazl protein in mice is associated with failure of germ cells to complete meiotic prophase. Specifically, in female mice null for Dazl, loss of germ cells occurs during fetal life at a time coincident with progression of germ cells through meiotic prophase, hi male mice null for Dazl, germ cells were unable to progress beyond the leptotene stage of meiotic prophase I. Thus, in the absence of Dazl, progression through meiotic prophase is interrupted (Saunders et al., Reproduction 2003 126:589-597).
  • Vasa also referred to as DEAD box polypeptide 4 or Ddx4, is a gene expressed in female germline stem cells and their progenitor cells. Vasa is a component of the germplasm that encodes a DEAD-family ATP-dependent RNA helicase (Liang et al., Development 1994
  • Vasa is required for pole cell formation and is exclusively restricted to the germ cell lineage throughout development.
  • Vasa is a molecular marker for the germ cell lineage in most animal species (Toshiaki et al., Cell Structure and Function 2001 26:131-136).
  • Stage-Specific Embryonic Antigens are optionally expressed in female germline stem cells and expressed in female germline stem cell progenitors of the invention.
  • Stage-Specific Embryonic Antigen-1 (SSEA-1) is a cell surface embryonic antigen whose functions are associated with cell adhesion, migration and differentiation. During hypoblast formation, SSEA- 1 positive cells can be identified in the blastocoel and hypoblast and later in the germinal crescent. SSEA-1 functions in the early germ cell and neural cell development. (D'Costa et al., IntJ. Dev. Biol. 1999 43(4):349-356; Henderson et al., Stem Cells 2002 20:329-337). In specific embodiments, expression of SSEAs in female germline stem cells may arise as the cells differentiate.
  • SSEAs useful in the invention include SSEA-1 , -2, -3, and -4.
  • the term "autologous” as used herein refers to biological compositions obtained from the same subject.
  • the biological composition includes OSCs, OSC-derived compositions and oocytes (i.e., mature oocytes). Accordingly, in conducting methods of the invention, the female germ cell cytoplasm or mitochondria used for transfer and the recipient oocyte into which the aforementioned compositions are transferred are obtained from the same subject.
  • isolated refers to an OSC, mitochondrion or composition derived from an OSC (e.g., cytoplasm, mitochondrial preparation), which has been physically separated or removed from its natural biological environment.
  • An isolated OSC, mitochondrion or composition need not be purified.
  • exogenous refers to transferred cellular material (e.g., mitochondria) that is removed from one cell and transferred into another cell. For example, OSC derived mitochondria that have been transferred into an oocyte, even if both are derived from the same subject, would be exogenous.
  • a “subject” is any live-bearing member of the class mammalia, including humans, domestic and farm animals, and zoo, sports or pet animals, such as mouse, rabbit, pig, sheep, goat, cattle and higher primates.
  • the term "advanced maternal age” as it relates to humans refers to a woman who is 34 years of age or older.
  • the term “oocyte-related infertility” as it relates to humans refers to an inability to conceive after one year of unprotected intercourse which is not caused by an anatomical abnormality (e.g., blocked oviduct) or pathological condition (e.g., uterine fibroids, severe endometriosis, Type ⁇ diabetes, polycystic ovarian disease).
  • an anatomical abnormality e.g., blocked oviduct
  • pathological condition e.g., uterine fibroids, severe endometriosis, Type ⁇ diabetes, polycystic ovarian disease.
  • the term "low ovarian reserve” as it relates to humans refers to a woman who exhibits a circulating Follicle Stimulating Hormone (FSH) level greater than 15 miu/ml in a "day 3 FSH test," as described in Scott et al., Fertility and Sterility, 1989 51:651-4, or a circulating Anti-Mullerian Hormone (AMH) level less than 0.6 ng/ml, or an antral follicle count less than 7 as measured by ultrasound.
  • FSH Follicle Stimulating Hormone
  • reduced or “reduce” or “decrease” as used herein generally means a decrease of at least 5%, for example a decrease by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (i.e. substantially absent or below levels of detection), or any decrease between 5-100% as compared to a reference level, as that term is defined herein, and as determined by a method that achieves statistical significance (p ⁇ 0.05).
  • increase generally means an increase of at least 5%, for example an increase by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%), or at least about 90% or up to and including a 100% increase (i.e. substantially above levels of detection), or any increase between 5-100% as compared to a reference level, as that term is defined herein, and as determined by a method that achieves statistical significance (p ⁇ 0.05).
  • an increase in ATP generation or production refers to an amount of ATP production that is at least about 1-fold more than (for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1000, 10,000-fold or more) the amount of ATP production in a reference level, as that term is defined herein.
  • ATP production can be measured by standard methods known in the art.
  • high ATP-generating capacity mitochondria refers to mitochondria having a high mitochondrial membrane potential, as determined by a probe which can distinguish between high and low (or between high and medium/low) membrane potential.
  • One method of identifying mitochondria with high mitochondrial membrane potential is the use of the fluorescent probe 5,5',6,6'-tetrachloro-l,l',3,3'-tetraethylbenzimidazolyl carbocyanine iodide (JC-1, Invitrogen T3168, Life Technologies Corp., Carlsbad, CA), which fluoresces red-orange (590 nm) in high quality mitochondria but fluoresces green (510-520 nm) in medium and/or low quality mitochondria.
  • the term "standard” or “reference” refers to a measured biological parameter including but not limited to defects such as aneuploidy, mutation, chromosomal misalignment, meiotic spindle abnormalities, and/or mitochondrial dysfunction (aggregation, impaired ATP production), or the reduction or elimination of such defects, in a known sample against which another sample is compared; alternatively, a standard can simply be a reference number that represents an amount of the measured biological parameter that defines a baseline for comparison. The reference number can be derived from either a sample taken from an individual, or a plurality of individuals or cells obtained therefrom (e.g., oocytes, OSCs).
  • defects such as aneuploidy, mutation, chromosomal misalignment, meiotic spindle abnormalities, and/or mitochondrial dysfunction (aggregation, impaired ATP production), or the reduction or elimination of such defects, in a known sample against which another sample is compared; alternatively, a standard can simply be a reference number that represents an amount of the
  • the "standard” does not need to be a sample that is tested, but can be an accepted reference number or value.
  • a series of standards can be developed that take into account an individual's status, e.g., with respect to age, gender, weight, height, ethnic background etc.
  • a standard level can be obtained for example from a known sample from a different individual (e.g., not the individual being tested).
  • a known sample can also be obtained by pooling samples from a plurality of individuals (or cells obtained therefrom) to produce a standard over an averaged population.
  • a standard can be synthesized such that a series of standards are used to quantify the biological parameter in an individual's sample.
  • a sample from the individual to be tested can be obtained at an earlier time point (presumably prior to the onset of treatment) and serve as a standard or reference compared to a sample taken from the same individual after the onset of treatment, hi such instances, the standard can provide a measure of the efficacy of treatment.
  • a "standard” or “reference” is an ovarian somatic cell (e.g., an aged-matched ovarian somatic cell obtained from a female subject having a functional reproductive system) or an aged-matched mesenchymal stem cell.
  • Ranges provided herein are understood to be shorthand for all of the values within the range.
  • a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.
  • ovarian cortical tissue can be obtained using a minor laparoscopic procedure lmown in the art to collect a small (e.g., 3x3x1 mm) ovarian cortical biopsy, which is then processed for OSC isolation. See Gook et al., Human Reproduction, 2004 20(l):72-78.
  • OSCs can also be obtained from non- ovarian sources, such as bone marrow or peripheral blood. Bone marrow and peripheral blood derived OSCs can be isolated by standard means lmown in the art for the separation of stem cells from, for example, the marrow or blood (e.g., cell sorting).
  • the isolation protocol includes generation of a kit+/lin- fraction that is depleted of hematopoietic cells.
  • Additional selection means based on the characteristic profile of gene expression in OSCs (e.g., Vasa, Oct- 4, Dazl, Stella, Fragilis) can be employed to further purify or isolate the desired population of cells and to reduce or eliminate other cells and material from the biological sample from which they were obtained (e.g. bone marrow, peripheral blood).
  • OSCs e.g., Vasa, Oct- 4, Dazl, Stella, Fragilis
  • the methods described in Example 1, Figure lb have been applied to a mononuclear fraction of blood cells and bone marrow cells to obtain purified or isolated OSCs from non-ovarian sources.
  • OSCs can be isolated and cultured as described above. In one method, when OSC cultures reach 80% confluency, 2 ml of mitochondrial lysis buffer (0.3 M sucrose, 1 mM EDTA, 5 mM MOPS, 5 mM KH2P04, 0.1% BSA) is added to each plate, and the cells are removed using a cell scraper.
  • the cell suspension is transferred into a small glass tissue douncer and homogenized until smooth (approximately 10 up-and-down strokes), and the lysate is centrifuged at 600 g for 30 minutes at 4°C. The supernatant is removed and spun at 10,000 g for 12 minutes at 4°C, and the resulting crude mitochondrial pellet is resuspended in 0.2 ml of 0.25 M sucrose. This sample is then layered over a 25-60% Percoll density gradient diluted with 0.25 M sucrose and centrifuged at 40,000 g for 20 minutes at 17°C. The interface band is extracted from the gradient and washed in 2 volumes of 0.25 M sucrose before a final centrifugation at 14,000 g for 10 min at 4°C to yield a mitochondrial pellet.
  • the mitochondrial pellet can also be prepared as described Frezza et al. Nature Protocols 2007 2:287-295, the contents of which are incorporated herein by reference.
  • the total OSC-derived mitochondrial population in a tissue, cell, lysed cell, or fraction thereof can be isolated, characterized and/or enumerated using a FACS-based method with a fluorescent probe that specifically binds to mitochondria in a mitochondrial membrane potential (MMP)-independent manner.
  • MMP mitochondrial membrane potential
  • Fluorescent probes that specifically bind to mitochondria in a MMP-independent manner include, but are not limited to, accumulation dependent probes (e.g., JC-1 (red spectrum; Invitrogen T3168, Life Technologies Corp., Carlsbad, CA), MitoTracker Deep Red FM (Invitrogen M22426, Life Technologies Corp., Carlsbad, CA) and JC-1 (green spectrum; Invitrogen T3168, Life Technologies Corp., Carlsbad, CA).
  • accumulation dependent probes e.g., JC-1 (red spectrum; Invitrogen T3168, Life Technologies Corp., Carlsbad, CA)
  • MitoTracker Deep Red FM Invitrogen M22426, Life Technologies Corp., Carlsbad, CA
  • JC-1 green spectrum; Invitrogen T3168, Life Technologies Corp., Carlsbad, CA
  • Functional (e.g., respiring) mitochondria can be sorted and collected, preferably with exclusion of residual unlysed cells and non-functional mitochondria, based on size and fluorescence intensity using mitochondrial tracking probes that indicate mitochondrial mass including, but not limited to, non-oxidation dependent probes (e.g., MitoTracker Green FM (Invitrogen M7514, Life Technologies Corp., Carlsbad, CA). Details of an exemplary protocol for conducting FACS with a non-oxidation dependent probe are provided below in Example 9.
  • the FACS-based method can also be employed to selectively yield a substantially pure population of functional (e.g., respiring) mitochondria using a mitochondrial membrane fluorescent probe that specifically binds to mitochondria in a MMP-dependent manner.
  • Fluorescent probes that specifically bind to mitochondria in a MMP-dependent manner include, but are not limited to, reduced oxidative state mitotracker probes (e.g., MitoTracker Red CM- H2XRos (Invitrogen M7513, Life Technologies Corp., Carlsbad, CA) and MitoTracker Orange CM-H2TMRos (Invitrogen M7511, Life Technologies Corp., Carlsbad, CA).
  • reduced oxidative state mitotracker probes e.g., MitoTracker Red CM- H2XRos (Invitrogen M7513, Life Technologies Corp., Carlsbad, CA) and MitoTracker Orange CM-H2TMRos (Invitrogen M7511, Life Technologies Corp., Carlsbad, CA).
  • dual- labeling using MMP-dependent and MMP-independent probes can be conducted to quantitate the ratio of functional to total mitochondria in a tissue, cell, lysed cell or fraction derived therefrom.
  • the ratio is greater than about 0.02, 0.025, 0.033, 0.04, 0.05, 0.1, or about 0.2.
  • spectral color is the major determining factor to designate functional mitochondria, and forward scatter can be used to distinguish the fluorescent mitochondria released from lysed cells from those still contained in residual unlysed cells.
  • Mitochondrial pellets can also be prepared as described by Taylor et al., Nat. Biotechnol. 2003 21(3): 239-40; Hanson et al., Electrophoresis. 2001 22(5): 950-9; and Hanson et al., J. Biol. Chem. 2001 276(19): 16296-301.
  • the total OSC- derived mitochondrial population in a tissue, cell, lysed cell, or fraction thereof can be isolated, characterized and/or enumerated using a differential centrifugation method such as that described herein at Example 10 or using a sucrose gradient separation procedure such as that described herein at Example 11.
  • mitochondrial function or mtDNA integrity can be conducted according to methods known in the art (Duran et al., Fertility and Sterility 2011 96(2):384-388; Aral et al., Genetics and Molecular Biology 2010 33: 1-4; Chan et al., Molecular Human Reproduction 2005 l l(12):843-846; Chen et al., BMC Medical Genetics 2011 12:8 and Example 8).
  • Functional parameters e.g., MMP dependent/active or MMP-independenty active plus inactive
  • mitochondria from less preferred OSC sources including samples of limited size
  • Mitochondrial compositions of the invention can generate, for example, about 1 pmol ATP per fg mtDNA to about 6 pmol ATP per fg mtDNA (e.g., about 1, 2, 3, 4, 5, or 6 pmol ATP per fg mtDNA). In specific embodiments, between about 1.0 pmol to 1.4 pmol ATP per fg mtDNA is generated within about 10 minutes to about 15 minutes.
  • the percentage of mutations in a population of mitochondria can be assessed by first determining the number of mitochondria present in a biological sample and next, determining the copy number of mitochondrial DNA present in the sample. Standard mutation analysis can be employed and compared to the number of mitochondria and copy number of mitochondrial DNA to calculate the percentage of mutations in the population of mitochondria.
  • compositions and methods of the invention can provide a population of mitochondria in which less than about 5% to about 25% (e.g., about 5%, 10%, 15%, 20% to about 25%) of the mitochondrial DNA comprises a deletion mutation within nucleotides 8470-13447 of the mitochondrial genome.
  • the material to be injected (e.g., mitochondrial suspension) is transferred to a microinjection needle according to methods known in the art.
  • Microinjection needles and holding pipettes can be made using a Sutter puller (Sutter Instruments, Novato, CA, USA) and a De Fonbrune Microforge (EB Sciences, East Granby, CT, USA).
  • the microinjection needles have inner diameters of 5 ⁇ with blunt tips.
  • the material to be injected is aspirated into the needle by negative suction.
  • lxlO 3 - to about 5xl0 4 mitochondria from OSCs or their progeny can be injected (e.g., about 1, 2, 3, 4, 5, 6, 7, 8 to 9 x 10 3 ; about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9 to about 5 x 10 4 mitochondria).
  • the mitochondrial suspension in sucrose (e.g., 5-7 pi containing approximately lxlO 3 - 5xl0 4 mitochondria from OSCs or their progeny) can be injected into oocytes using a Piezo micromanipulator. Oocytes that survive the microinjection procedure are transferred for culture and optionally, assessment or cryopreservation prior to in vitro fertilization or intrauterine insemination. Methods of oocyte cryopreservation are well known in the art.
  • OSCs are exposed to hHTF medium containing cytochalosin B (CCB; Sigma Chemical Co., St Louis, MO, USA) for 10 min at 37°C. Partitioning of human ⁇ oocytes involves variable cytochalasin B concentration depending on their sensitivity (-2.5 mg/ml).
  • Ooplasts of various sizes are separated from OSCs by withdrawing a portion of the ooplasm enclosed in the plasma membrane. Alignment and electrofusion in a mannitol solution is performed after insertion of the OSC derived ooplast into the perivitelline space of the recipient egg from which the polar body was removed. This can be done with a wide-bored polished microtool ⁇ 3( ⁇ 0 ⁇ in diameter. The ooplast is sucked into the microtool and released once the tool is placed deeply into the perivitelline space. Oocytes that survive the electrofusion procedure are transferred for culture and optionally, assessment or
  • ICSI intracytoplasmic sperm injection
  • the zonae of the recipient eggs are opened mechanically over the polar body area using a microspear.
  • the polar body is removed after re-positioning the oocyte on the holding pipette in such a way that the zona can be dissected using the closed microspear.
  • the same position is used to insert the ooplast -90° left of the area, which had contained the polar body.
  • the zona is closed tight using the same tool.
  • Electrofused cells are washed and incubated in mHTF for 40-90 min prior to ICSI.
  • Spermatozoa are immobilized in 10% polyvinylpyrrolidone (PVP) for ICSI.
  • PVP polyvinylpyrrolidone
  • the procedure is performed in hHTF while the short side of the aperture is at approximately 3 o'clock.
  • the ICSI tool is moved through the artificial gap in order to avoid extrusion of ooplasm upon indentation of the zona during standard ICSI.
  • Methods of in vitro fertilization are well known in the art. Couples are generally first evaluated to diagnose their particular infertility problem(s).
  • Procedures often begin with the administration of a drug to down-regulate the hypothalamic/pituitary system (GnRH agonist). This process decreases serum concentrations of the gonadotropins, and developing ovarian follicles degenerate, thereby providing a set of new follicles at earlier stages of development. This permits more precise control of the maturation of these new follicles by administration of exogenous gonadotropins in the absence of influences by the hypothalamic pituitary axis. The progress of maturation and the number of growing follicles (usually four to ten stimulated per ovary) are monitored by daily observations using ultrasound and serum estradiol determinations. When the follicles attain preovulatory size (18-21 mm) and estradiol concentrations continue to rise linearly, the ovulatory response is initiated by exogenous administration of human chorionic gonadotropins (hCG).
  • hCG human chorionic gonadotropins
  • oocytes can be evaluated morphologically and transferred to a petri dish containing culture media and heat-inactivated serum.
  • a semen sample is provided by the male partner and processed using a "swim up" procedure, whereby the most active, motile sperm will be obtained for insemination.
  • GIFT gamete intrafallopian transfer
  • oocyte-cumulus complexes surrounded by sperm are placed directly into the oviducts by laparoscopy. This procedure best simulates the normal sequences of events and permits fertilization to occur within the oviducts.
  • GIFT has the highest success rate with 22% of the 3,750 patients undergoing ova retrieval in 1990 having a live delivery.
  • An alternative procedure ZIFT zygote intrafallopian transfer
  • Extra zygotes can be cryopreserved at this time for future transfer or for donation to couples without female gametes.
  • Most patients having more serious infertility problems, however, will require an additional one to two days incubation in culture so that preimplantation embryos in the early cleavage states can be selected for transfer to the uterus or oviduct.
  • This rVF-UT (in vitro fertilization uterine transfer) procedure entails the transcervical transfer of several 2-6 cell (day 2) or 8-16 (day 3) preimplantation embryos to the fundus of the uterus (4-5 preimplantation embryos provides optimal success).
  • patients may elect to have the oocyte comprising exogenous, autologous
  • IUI Intrauterine Insemination
  • IUI is a well known process that involves preparing and delivering a highly concentrated amount of active motile sperm directly through the cervix into the uterus.
  • sperm is separated from seminal fluid.
  • One method of sperm separation is known as "Density Gradient Separation", hi this technique, motile sperm are separated from dead sperm and other cells through the use of viscous solution.
  • the sperm concentrate is placed through the cervix into the uterus by using a thin, flexible catheter and fertilization of the reimplanted oocyte follows.
  • VASA antibody used by Zou et al., Nat Cell Biol 2009 11 :631-636 to isolate mouse OSCs by immunomagnetic sorting is a rabbit polyclonal against the last 25 amino acids of the COOH-terrninus of human VASA (DDX4) (abl3840; Abeam, Cambridge, MA). This region shares 96% overall homology with the corresponding region of mouse VASA (MVH).
  • DDX4 COOH-terrninus of human VASA
  • abl3840 Abeam, Cambridge, MA
  • MSH mouse VASA
  • a goat polyclonal antibody against the first 145 amino acids of the NH 2 - terminus of human VASA AF2030; R&D Systems, Minneapolis, MN was used, which shares 91 % overall homology with the corresponding region of mouse VASA.
  • Digestions were carried out in the presence of 1 ⁇ g/ml DNase-I (Sigma-Aldrich, St. Louis, MO) to minimize stickiness within the cell preparations, and trypsin was neutralized by addition of 10% fetal bovine serum (FBS; Hyclone, ThermoFisher Scientific, Inc.,Waltham, MA). Ovarian dispersates were filtered through a 70- ⁇ nylon mesh and blocked in a solution composed of 1% fatty-acid free bovine serum albumin (BSA; Sigma-Aldrich, St.
  • ovarian tissue (mouse: 4 ovaries pooled; human: 10 X 10 X 1 mm thick, cortex only) was dissociated, blocked and reacted with primary antibody (abl3840 for VASA-COOH or AF2030 for VASA-NH 2 ) as described above. After washing with HBSS, cells were incubated with a 1 :500 dilution of goat anti-rabbit IgG conjugated to Alexa Fluor 488
  • VASA-COOH positive viable cells were then either left intact or fixed and permeabilized prior to incubation with VASA-NH 2 antibody (AF2030), followed by incubation with donkey anti-goat IgG conjugated to Alexa Fluor 488 and FACS analysis.
  • VASA-positive cells were obtained only when the COOH antibody was used ( Figure lc). However, if the ovarian cells were permeabilized prior to FACS, a VASA-positive cell population was obtained using the NH 2 antibody ( Figure lc). Furthermore, if the viable VASA-positive cells isolated by FACS using the COOH antibody were permeabilized and re-sorted, the same cell population was recognized by the VASA-NH 2 antibody ( Figure Id).
  • fractions of cells at each step of the protocol were assessed by gene expression analysis using a combination of markers for germ cells (Blimp llPrdml, StellalDppa.3, Fragilisllfitm3, Tert, Vasa, Dazl) and oocytes (Nobox, Zp3, Gdf9).
  • markers for germ cells Blimp llPrdml, StellalDppa.3, Fragilisllfitm3, Tert, Vasa, Dazl
  • oocytes Nobox, Zp3, Gdf9
  • This percent yield is the incidence of these cells in the final pool of viable single cells sorted by FACS, which represents a fraction of the total number of cells present in ovaries prior to processing.
  • OSCs per ovary was estimated to be 0.014% ⁇ 0.002% [0.00926 X (1.5% ⁇ 0.2%)]. With respect to OSC yield, this number varied across replicates but between 250 to slightly over 1,000 viable VASA-positive cells per adult ovary were consistently obtained after FACS of dispersates initially prepared from a pool of 4 ovaries.
  • Figure 3a, 3b revealed a similar size and morphology (Figure 3c, 3d), and a matched gene expression profile rich in markers for early germ cells (Saitou et al., Nature 2002 418:293-300; Ohinata et al., Nature 2005 436:207-213; Dolci et al., Cell Sci. 2002 115:1643-1649) (Blimpl, Stella, Fragilis and Tert; Figure 3e). These results agree with the morphology and gene expression profile of mouse OSCs reported in the scientific literature (Zou et al., Nat Cell Biol 2009 11:631-636, Pacchiarotti et al., Differentiation 2010 79:159-170).
  • VASA-positive cells obtained from adult ovaries
  • mouse OSCs were tested using an in vivo teratoma formation assay. This was important since a recent study has reported the isolation of Ocd/ ⁇ -positive stem cells from adult mouse ovaries that possess the teratoma-forming capacity of embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) (Gong et al., Fertil. Steril. 2010 93:2594-2601). Ovaries were collected from a total of 100 young adult female mice, dissociated and subjected to FACS for isolation of VASA-COOH positive viable cells, as described above.
  • ESCs embryonic stem cells
  • iPSCs induced pluripotent stem cells
  • mice Freshly isolated mouse OSCs were injected subcutaneously near the rear haunch of NOD/SCBD female mice (lxlO 5 cells injected per mouse).
  • mouse embryonic stem cells mESC v6.5
  • mice were injected into age-matched female mice in parallel (lxl 0 s cells injected per recipient mouse). Mice were monitored weekly for up to 6 months for tumor formation.
  • mice transplanted with mouse ESCs used as a positive control developed teratomas within 3 weeks; however, no teratomas were observed in mice transplanted in parallel with VASA-positive cells isolated from adult mouse ovaries, even at 24 weeks post- transplant ( Figures 3f-k).
  • OSCs express numerous stem cell and primitive germ cell markers (Zou et al., Nat Cell Biol 2009 11 :631-636, Pacchiarotti et al., Differentiation 2010 79:159-170; see also Figure If and Figure 3e), these cells are clearly distinct from other types of pluripotent stem cells described to date.
  • Example 3 Generation of Oocytes from FACS-purified mouse OSCs
  • sperm were obtained by gently squeezing the tissue with tweezers, capacitated for 1 hour at 37° C, and then mixed with cumulus-oocyte complexes (1-2 x 10 6 sperm/ml in HTF medium supplemented with BSA) for 4-5 hours. Inseminated oocytes were then washed of sperm and transferred to fresh medium. At 4-5 hours post-insemination, oocytes (fertilized and unfertilized) were transferred to 50 ⁇ drops of KSOM-AA medium (Irvine Scientific, Santa Ana, CA), and the drops were covered with mineral oil to support further preimplantation embryonic development.
  • KSOM-AA medium Irvine Scientific, Santa Ana, CA
  • cells were cultured in MEMa (Invitrogen, Life Technologies Corp., Carlsbad, CA) supplemented with 10% FBS (Hyclone, ThermoFisher Scientific, Inc., Waltham, MA), 1 mM sodium pyruvate, 1 mM non-essential amino acids, lX-concentrated penicillin- streptomycin-glutamine (Invitrogen, Life Technologies Corp., Carlsbad, CA), 0.1 mM ⁇ - mercaptoethanol (Sigma, St.
  • FBS Hyclone, ThermoFisher Scientific, Inc., Waltham, MA
  • 1 mM sodium pyruvate 1 mM non-essential amino acids
  • lX-concentrated penicillin- streptomycin-glutamine Invitrogen, Life Technologies Corp., Carlsbad, CA
  • 0.1 mM ⁇ - mercaptoethanol Sigma, St.
  • LIF leukemia inhibitory factor
  • rhEGF human epidermal growth factor
  • bFGF basic fibroblast growth factor
  • GDNF glial cell-derived neurotropic factor
  • Freshly-isolated OSCs could be established as clonal lines, and the colony formation efficiency for human OSCs not seeded onto MEFs ranged from 0.18% to 0.40%. Accurate assessment of colony formation efficiency could not be performed using MEFs as initial feeders, the latter of which greatly facilitates establishment of mouse and human OSCs in vitro. After 10-12 weeks (mouse) or 4-8 weeks (human) in culture, actively-dividing germ cell colonies became readily apparent ( Figure 5). Once established and proliferating, the cells could be reestablished as germ cell -only cultures in the absence of MEFs without loss of proliferative potential.
  • the remaining cells not detected by FACS using the VASA- COOH antibody were large (35-50 ⁇ in diameter) spherical cells spontaneously produced by mouse and human OSCs during culture, which exhibited cytoplasmic expression of VASA and are described in detail in Example 5.
  • Table 1 PC primers used to analyze gene expression in mouse cell and tissue samples.
  • oocytes were incubated for 2 hours at 20° C with a 1 : 100 dilution (in PBS with 0.5% BSA) of one of the following primary antibodies: a goat polyclonal against c-KIT (scl494, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), a rabbit polyclonal against VASA (ab 13840, Abeam, Cambridge, MA) or a rabbit polyclonal against LHX8 (ab41519, Abeam, Cambridge, MA).
  • TNK buffer 0.1 M Tris-HCl, 0.55 M NaCl, 0.1 mM KCL, 0.5% BSA, and 0.1% Triton-XlOO in phosphate-buffered saline
  • VASA-COOH or LHX8 detection 1% normal goat serum
  • VASA-NH 2 or c-KIT detection 1% normal donkey serum
  • Sections were then incubated with a 1 :100 dilution of primary antibody (in TNK buffer with 1% normal serum) overnight at 4° C, washed in PBS, and incubated for 30 minutes at 20° C with a 1:500 dilution of goat anti-rabbit IgG conjugated to Alexa Fluor 568 (VASA-COOH detection in human ovary), goat anti-rabbit IgG conjugated to Alexa Fluor 488 (detection of VASA-COOH in mouse ovary or LHX8) or donlcey anti-goat IgG conjugated to Alexa Fluor 488 (c-KIT or VASA-NH 2 detection).
  • VASA-COOH detection in human ovary goat anti-rabbit IgG conjugated to Alexa Fluor 568
  • Alexa Fluor 488 detection of VASA-COOH in mouse ovary or LHX8
  • donlcey anti-goat IgG conjugated to Alexa Fluor 488 c-KIT or VASA
  • MSY2 is a mammalian homologue of Xenopus FRGY2, a germ cell-specific nucleic acid-binding Y-box protein that is essential for meiotic progression and gametogenesis in both sexes (Gu et al., Biol. Reprod. 1998 59:1266-1274; Yang et al., Proc. Natl. Acad. Sci. USA 2005 102:5755-5760).
  • Example 6 Human OSCs Generate Oocytes in Human Ovarian Cortical Tissue In Vivo
  • VASA-positive cells isolated from adult human ovaries were stably transduced with a GFP expression vector (GFP-hOSCs) to facilitate cell tracking.
  • GFP-hOSCs GFP expression vector
  • human OSCs were transduced using a retrovirus to obtain cells with stable expression of GFP (GFP-hOSCs).
  • pBabe-Gfp vector DNA (Addgene plasmid repository #10668) was transfected as per the manufacturer's protocol (Lipofectamine, Invitrogen, Life Technologies Corp., Carlsbad, CA) into the Platinum-A retroviral packaging cell line (Cell Biolabs, Inc., San Diego, CA). Viral supernatant was collected 48 hours after transfection. Transduction of human OSCs was performed using fresh viral supernatant facilitated by the presence of polybrene (5 ju.g/ml; Sigma-Aldrich, St. Louis, MO). After 48 hours, the virus was removed and replaced with fresh OSC culture medium.
  • polybrene 5 ju.g/ml; Sigma-Aldrich, St. Louis, MO
  • the cell mix was pelleted by centrifugation (9,300 x g for 1 minute at 20° C) to create the tissue aggregate, which was placed onto a Millicell 0.4 ⁇ culture plate insert (EMD Millipore, Inc., Billerica, MA) contained in a 6-well culture dish with 1 ml of OSC culture medium. Aggregates were incubated at 37° C in 5% C0 2 -95% air, and live-cell GFP imaging was performed 24, 48 and 72 hours later.
  • EMD Millipore, Inc., Billerica, MA contained in a 6-well culture dish with 1 ml of OSC culture medium. Aggregates were incubated at 37° C in 5% C0 2 -95% air, and live-cell GFP imaging was performed 24, 48 and 72 hours later.
  • Ovarian cortical tissue pieces (2 X 2 X 1 mm) were individually injected with approximately 1.3 X 10 3 GFP-hOSCs using a 10- ⁇ 1 NanoFil syringe with a 35-gauge beveled needle (World Precision Instruments, Sarasota, FL).
  • Recipient NOD/SCID female mice were anesthetized and a small incision was made along the dorsal flank for subcutaneous insertion of the human ovarian tissue, essentially as described (Weissman et al., Biol.
  • Sections were then washed, incubated with a 1 :500 dilution of goat anti- mouse biotinylated secondary antibody for 30 minutes at 20° C, washed and reacted with Vectastain ABC reagents (Lab Vision, ThermoFisher Scientific, Inc., Waltham, MA) for 30 minutes at 20° C prior to detection of GFP-positive cells using diaminobenzidine (DAKO Glostrup, Denmark). Sections were lightly counterstained with haematoxylin to visualize cell and tissue architecture. Negative controls (complete immunohistochemical staining protocol on xenografted tissues that received vehicle injections) were always run in parallel and did not show a positive signal.
  • GFP-positive oocytes were never detected in human ovarian cortical tissue prior to GFP-hOSC injection ( Figure lOe) or in xenografts that received mock injections (vehicle without GFP-hOSCs) prior to transplantation into NOD/SCID mice ( Figure lOg).
  • Dual immunofluorescence-based detection of GFP along with either the diplotene stage oocyte-specific marker MSY2 (Gu et al., Biol. Reprod. 1998 59:1266-1274; Yang et al, Proc. Natl. Acad. Sci. USA 2005 102:5755-5760) or the oocyte-specific transcription factor LHX8 (Pangas et al., Proc.
  • Figure 13 depicts an overview of the use of OSCs as an autologous source of female germ cells for derivation of oogenic cytoplasm or mitochondrial fractions that can then be transferred into an oocyte obtained from the same subject prior to or during in vitro fertilization (IVF).
  • the resultant boost in mitochondrial DNA copy number and ATP-generating capacity in the egg after AUGMENT ensures that the oocyte has ample reserves of ATP for energy-driven events required for successful fertilization and embryonic development.
  • the additional mitochondria provided to the oocyte by AUGMENT are derived from the natural precursor cell used by the body to produce oocytes.
  • An exemplary clinical protocol for AUGMENT is as follows. Prior to the start of standard IVF, the subject will undergo a laparoscopy during menstrual cycle days 1-7 to collect up to three pieces (approximately 3x3x1 mm each) of ovarian epithelium (ovarian cortical biopsy) from one ovary. During this procedure, 2-3 incisions will be made within the abdomen and a device will be inserted to remove the tissue from an ovary using sterile procedures. The tissue collected will be placed in sterile solution and transported on ice to the GTP compliant laboratory where it will be cryopreserved until the time of AUGMENT/ICSI. The tissue will remain frozen until the time of enzymatic dissociation. This will serve as the source of autologous OSCs from which mitochondria will be purified or isolated.
  • OSCs will be isolated and mitochondria will be harvested from the OSCs.
  • the tissue After thawing the ovarian cortical biopsied tissue, the tissue will be minced and placed in solution, containing recombinant collagenase and recombinant DNasel and homogenized to a single cell suspension.
  • the suspension will be passed through a cell strainer to prepare a solution of single cells.
  • the single cell suspension will be incubated with an anti-VASA antibody. Labeled cells will then be isolated by fluorescence-activated cell sorting (FACS). Standard slow cooling cryopreservation procedures for freezing aliquots of OSCs will be used.
  • FACS fluorescence-activated cell sorting
  • Subjects will undergo a standard IVF protocol including baseline evaluation, GnRH antagonist down-regulation and gonadotropin stimulation. Oocyte retrieval will take place within 34-38 hours after hCG administration and oocytes will be assessed for quality and maturation state. Mature oocytes will be inseminated by ICSI.
  • OSC vial for that subject will be thawed using standard methods. OSCs will be processed to yield a mitochondrial pellet (Frezza et al. Nature Protocols 2007 2:287-295 or Perez et al, Cell Death and Differentiation 2007 3:524-33. Epub 2006 Oct 13) or as described below in Example 9, where a FACS-based method is employed to isolate the total mitochondrial population in a tissue and optionally, further isolate the actively respiring mitochondrial population or quantitate the ratio of active to total mitochondria in a tissue. Evaluation and activity of the mitochondrial preparation will be assessed and recorded. Exemplary assays of mitochondrial function are described in Example 8.
  • the mitochondrial pellet will be re-suspended in media to a standardized concentration of mitochondrial activity which improves oocyte quality.
  • This media containing the mitochondria will be aspirated into a microinjection needle that contains the spermatozoan to be delivered. Both the mitochondria and spermatozoan will be delivered together into the oocyte by ICS! Alternatively, the mitochondria or preparation thereof will be frozen prior to use.
  • grade 1 or grade 2 SART grading system (50) embryos may be transferred under ultrasound guidance after 3 or 5 days of culturing based on the assessment of embryo development. If a pregnancy is confirmed via beta hCG testing, then the subject will have subsequent observations at approximately 6 and 20-weeks gestational age.
  • Example 8 Assessment of Mitochondrial Parameters in Human OSCs versus Human Ovarian Stromal Cells.
  • Mitochondrial staining was conducted in cultured human ovarian somatic cells and cultured human OSCs obtained from the same patient. Cells were incubated with the non- oxidation dependent MitoTracker Green FM (Invitrogen, Life Technologies Corp., Carlsbad, CA; M7514) mitochondrial tracking probe, which indicates mitochondrial mass, at 37° C for 45 minutes and washed twice with fresh culture medium prior to live cell fluorescent imaging. Both cell types were processed in parallel. In Figure 14, distribution patterns indicate perinuclear localization in the human OSCs, consistent with other human stem cell types.
  • MitoTracker Green FM Invitrogen, Life Technologies Corp., Carlsbad, CA; M7514
  • the small product reaches the exponential and plateau phases more rapidly, thereby utilizing the available reagents in the PCR mix and leaving little or none for the less efficient 5-kb product amplification.
  • the PCR analysis shown in Figure 15 indicates that the human OSCs do not harbor an accumulation of the mutation, whereas patient matched ovarian somatic cells do.
  • a second set of PCR primers targeting a sequence specifically within the deleted region was used to assess mitochondrial integrity in ovarian somatic cells.
  • the amplification of a 191 bp product indicates that this region is intact within at least some of the mitochondria in these cells, and that the overall population of somatic cell mitochondria is heterogeneous with respect to the deletion mutation, whereas the human OSCs are essentially free of the mutation.
  • Primer sequences (5' to 3') for mitochondrial DNA analysis include Amplicon 1 for mitochondrial DNA analysis
  • TTACACTATTCCTCATCACCCAAC forward
  • TGTGAGGAAAGGTATTCCTGCT reverse
  • Amplicon 2 for 191 bp (internal, deleted sequence) having the following sequences: CCTACCCCTCACAATCATGG (forward) and ATCGGGTGATGATAGCCAAG (reverse).
  • Figure 16 depicts the results of an ATP assay (ATP Bioluminescence Assay Kit HS ⁇ ,
  • the left panel shows the standard curve following dilution of ATP (molar ratio vs. chemiluminescence). As shown, the assay is sensitive in detecting levels of ATP.
  • the right panel shows the amount of ATP from mitochondria isolated from cultured human OSCs. Approximately 100,000, 10,000, 1,000, and 100 cells were lysed and used for analysis, with values and detectability falling in the niM to fM range.
  • FACS-based methods can be employed to isolate the total mitochondrial population in a tissue.
  • FACS-based methods for mitochondrial isolation can employ dual-labeling using two different fluorescent dyes (mitochondrial membrane potential (MMP)-dependent and MMP-independent) to isolate only the functional (e.g., actively respiring) mitochondrial population or quantitate the ratio of functional to total mitochondria in a tissue, cell, lysed cell or fraction derived thereof.
  • MMP mitochondrial membrane potential
  • MitoTracker Green FM (Invitrogen, Life Technologies Corp., Carlsbad, CA; M7514) mitochondrial tracldng probe, which indicates mitochondrial mass, was prepared and utilized as described below.
  • MitoTracker stock solution (l-5mg/ml dissolved in anhydrous dimethylsulfoxide (DMSO)) was diluted in serum free growth medium tojeach a working concentration of between 25-500nM.
  • DMSO dimethylsulfoxide
  • Freshly isolated or thawed OSCs were pelleted by centrifugation at 300 x g for 5 minutes. The supernatant was aspirated and the cell pellet was resuspended in 200 ⁇ of the diluted MitoTracker stock solution.
  • Cells were incubated at 37° C for 45 minutes, washed in pre-warmed (37° C) serum free growth medium and pelleted by centrifugation at 300 x g for 5 minutes (alternatively, cells can be lysed prior to incubation with a probe of interest). Supernatant was aspirated and cells were resuspended in 100 ⁇ mitochondrial lysis buffer and transferred to a FACS sort tube for lysis by mechanical permeabilization using rapid osmotic shock. Following lysis, cells were equilibrated on ice for 15-30 minutes, incubated in 200 ⁇ (minimum volume) ice cold PBS and vortexed.
  • CM-H2XRos CM-H2XRos
  • M7513 MitoTracker Orange CM-H2TMRos
  • JC-1 red spectrum; Invitrogen, Life Technologies Corp., Carlsbad, CA; T3168), MitoTracker Deep Red FM (Invitrogen, Life Technologies Corp., Carlsbad, CA; M22426) and JC-1 (green spectrum; Invitrogen, Life Technologies Corp., Carlsbad, CA; T3168).
  • differential centrifugation procedures can be employed to isolate and/or fractionate mitochondria present in a tissue.
  • the key steps when isolating mitochondria from any tissue or cell are: (i) rupturing of cells by mechanical and/or chemical means, (ii) differential centrifugation at low speed to remove debris and extremely large cellular organelles (SPIN 1), and (iii) centrifugation at a higher speed to isolate and collect mitochondria (SPIN 2).
  • the tissue is weighed and washed twice with 1.5 ml of a commercially available Wash Buffer (MitoSciences, Abeam, pic, Cambridge, UK). The tissue is minced and placed in a pre- chilled Dounce homogenizer. Up to 2.0 ml of a commercially available Isolation Buffer
  • the cells are ruptured using the Dounce homogenizer (10-40 strokes), and the homogenate is transferred to Eppendorf tubes. Each tube is filled to 2.0 ml with Isolation Buffer. The homogenate is centrifuged at l,000g for 10 minutes at 4°C. The supernatant is reserved and transferred into new tubes, each of which is filled to 2.0 ml with Isolation Buffer. The tubes are centrifuged at 12,000g for 15 minutes at 4°C. The pellet is reserved. If desired, the supernatant is analyzed for quality.
  • the pellet is washed twice by resuspending in 1.0 ml of Isolation Buffer supplemented with 10 ⁇ of a commercially available protease inhibitor cocktail (MitoSciences, Abeam, pic, Cambridge, UK).
  • the tubes are centrifuged at 12,000 g for 15 minutes at 4°C. After washing, the pellets are combined and resuspended in 500 ⁇ of Isolation Buffer supplemented with protease inhibitor cocktail. If desired, aliquots are stored at -80°C until use.
  • mitochondria integrity is tested by Western blot screening for cytochrome c, porin, or cyclophilin D in the isolated mitochondria versus in the supernatant fraction using commercially available antibodies, such as antibodies MSA06, MSA03, and MSA04 (MitoSciences, Abeam, pic, Cambridge, UK).
  • mitochondrial samples are probed by Western blot to detect components of the mitochondrial complex, for example, using the commercially available OXPHOS Complexes Detection cocktail
  • the protocol employs the following reagents, which are commercially available: n- dodecyl-
  • PBS Phosphate buffered saline
  • Sucrose solutions 15, 20, 25, 27.5, 30 and 35 %, double distilled water
  • a protease inhibitor cocktail MitoSciences, Abeam, pic, Cambridge, UK
  • 13 x 51 mm polyallomer centrifuge tubes Beckman 326819; Beckman-Coulter, Inc., Brea, CA.
  • the sucrose gradient separation procedure is a protein subfractionation method optimized for mitochondria. This method resolves a sample into at least 10 fractions. It is possible to separate solubilized whole cells into fractions of much lower complexity but when analyzing already isolated mitochondria the fractions are even more simplified.
  • the sucrose gradient separation technique is designed for an initial sample volume of up to 0.5 ml at 5 mg/ml protein. Therefore 2.5 mg or less of total protein should be used. For larger amounts, multiple gradients can be prepared or larger scale
  • the sample is solubilized in a non-ionic detergent. It has been determined that at this protein concentration mitochondria are completely solubilized by 20 mM n-dodecyl-/3-D- maltopyranoside (1% w/v lauryl maltoside).
  • the key to this solubilization process is that the membranes are disrupted while the previously membrane embedded multisubunit OXPHOS complexes remain intact, a step necessary for the density based sucrose separation procedure described herein.
  • One important exception is the pyruvate dehydrogenase enzyme (PDH). In order to isolate PDH at a protein concentration of 5 mg/ml mitochondria, the required detergent concentration is only 10 mM (0.5 %) lauryl maltoside.
  • the PDH enzyme should also be centrifuged at lower speeds, a centrifugal force of 16 000 g is maximum for the PDH complex.
  • a discontinuous sucrose density gradient is prepared by layering successive decreasing sucrose densities solutions upon one another. The preparation and centrifugation of a discontinuous gradient containing sucrose solutions from 15-35 % is described in detail below. This gradient gives good separation of the mitochondrial OXPHOS complexes (masses ranging from 200 kDa to 1000 kDa). However this setup can be modified for the separation of a particular complex or for the separation of larger amounts of material.
  • the gradient is prepared by layering progressively less dense sucrose solutions upon one another; therefore the first solution applied is the 35 % sucrose solution.
  • a steady application of the solutions yields the most reproducible gradient.
  • a Beckman polyallomer tube is held upright in a tube stand.
  • a Rainin Pipetman 200 ⁇ pipette tip is placed on the end of a Rainin Pipetman 1000 ⁇ pipette tip. Both snugly fitting tips are held steady by a clamp stand and the end of the 200 ⁇ pipette tip is allowed to make contact with the inside wall of the tube.
  • Sucrose solutions are then placed inside the 1000 ⁇ pipette tip and fed into the tube slowly and steadily, starting with the 35% solution (0.25 ml).
  • the 30 % solution (0.5 ml) is loaded into the tube on top of the 35 % solution. This procedure is continued with the 27.5% (0.75 ml), 25 % (1.0 ml), 20 % (1.0 ml) and 15 % (1.0 ml) solutions, respectively. Enough space is left at the top of the tube to add the 0.5 ml sample of solubilized mitochondria.
  • sucrose gradient is poured discrete layers of sucrose are visible. Having applied the sample to the top of the gradient the tube is loaded into the rotor very carefully, and centrifugation begins. All centrifugation procedures require a balanced rotor therefore another tube containing precisely the same mass is generated. In practice this means 2 gradients must be prepared although the second gradient need not contain an experimental sample but could contain 0.5 ml water in place of the 0.5 ml protein sample.
  • the polyallomer tubes should be centrifuged in a swinging bucket SW 50.1 type rotor
  • fraction collection the tube is held steady and upright using a clamp stand. A tiny hole is introduced into the very bottom of the tube using a fine needle. The hole is just big enough to allow the sucrose solution to drip out at approximately 1 drop per second. Fractions of equal volume are collected in Eppendorf tubes below the pierced hole. A total of 10 x 0.5 ml fractions are appropriate, however collecting more fractions which are thus smaller in volume is also possible (e.g., 20 x 0.25 ml fractions). The fractions are stored at - 80°C until analysis. Collected fractions are analyzed to determine mitochondrial integrity using any of the methods described herein (e.g., in Example 9, 10) or known in the art.
  • OSCs are essentially the female equivalent of male spermatogonial stem cells (spermatogonia), however, it has now been determined that OSCs have prolific mitochondrial activity.
  • mitochondrial production of ATP (pmol) was measured at 10, 15, 20 and 30 minutes, and then standardized against total mtDNA content (fg) in each sample tested (ATP Bioluminescence Assay Kit HS ⁇ , Roche Applied Science, Mannheim, Germany).
  • adult human ovary-derived oogonial stem cells obtained from female patients between 22-33 (28.5 ⁇ 4.0) years of age with Gender Identity Disorder for sex reassignment at Saitama Medical Center, generated much greater levels of ATP than human mesenchymal stem cells from bone marrow (hMSCs, obtained from PromoCell GmbH, Heidelberg, Germany), adult human ovarian somatic cells (subject matched to the OSCs used), human embryonic stem cells (ESCs), and human induced pluripotent stem cells (iPSCs) derived from IMR90 fetal lung fibroblasts.
  • OSCs human ovary-derived oogonial stem cells
  • Mitochondrial production of ATP was standardized against total mtDNA content (fg) in each sample tested.
  • OSCs adult human ovary-derived oogonial stem cells
  • MSCs mesenchymal stem cells
  • ESCs human embryonic stem cells
  • iPSCs human induced pluripotent stem cells
  • Figure 21 depicts 1.03E-09, 1.46E-10, 1.76E-11, 4.56E-12, 9.10E- 11 pmol ATP generated in 10 minutes for hOSC, hMSC, Soma, hESC, and hiPSC, respectively. Standard errors (in the same order) are 1.15E-10, 4.56E-11, 2.28E-12, 1.72E-13 and 7.99E-12.
  • Deletion analysis revealed the presence of the common 4977-bp deletion in hMSCs (Figure 22). Human ovarian soma, which is known to have the mutation, is included as a positive control along with a no sample control (ve). The intact portion of the product was not detected in either sample. By comparison, the common 4977-bp deletion is not detectable in human OSCs ( Figure 15).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Developmental Biology & Embryology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Reproductive Health (AREA)
  • Veterinary Medicine (AREA)
  • Pregnancy & Childbirth (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Endocrinology (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Gynecology & Obstetrics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicinal Preparation (AREA)
PCT/US2012/033643 2011-04-14 2012-04-13 Compositions and methods for autologous germline mitochondrial energy transfer Ceased WO2012142500A2 (en)

Priority Applications (20)

Application Number Priority Date Filing Date Title
BR112013026501A BR112013026501A2 (pt) 2011-04-14 2012-04-13 “métodos para preparar um oócito, de fertilização in vitro, e para aumentar a capacidade de geração de atp de um oócito, oócito, e, composição”
EP14164380.9A EP2787073B1 (en) 2011-04-14 2012-04-13 Compositions and methods for autologous germline mitochondrial energy transfer
CA2832336A CA2832336C (en) 2011-04-14 2012-04-13 Compositions and methods for autologous germline mitochondrial energy transfer
NZ617582A NZ617582B2 (en) 2011-04-14 2012-04-13 Compositions and methods for autologous germline mitochondrial energy transfer
SG2013075510A SG194448A1 (en) 2011-04-14 2012-04-13 Compositions and methods for autologous germline mitochondrial energy transfer
MX2013011990A MX2013011990A (es) 2011-04-14 2012-04-13 Composiciones y metodos para transferencia de energia mitocondrial de linea germinal autologa.
AU2012242591A AU2012242591B2 (en) 2011-04-14 2012-04-13 Compositions and methods for autologous germline mitochondrial energy transfer
EA201391523A EA201391523A1 (ru) 2011-04-14 2012-04-13 Композиции и способы для переноса энергии митохондрий аутологичных герминативных клеток
AP2013007229A AP2013007229A0 (en) 2011-04-14 2012-04-13 Compositions and methods for autologous germline mitochondrial energy transfer
PH1/2013/502206A PH12013502206A1 (en) 2011-04-14 2012-04-13 Compositions and methods for autologous germline mitochondrial energy transfer
EP12770662.0A EP2697365A4 (en) 2011-04-14 2012-04-13 COMPOSITIONS AND METHODS FOR AUTOLOGOUS ENERGY TRANSMISSION IN MITOCHONDRIAL GLAND LINES
EP18205564.0A EP3498826A1 (en) 2011-04-14 2012-04-13 Compositions and methods for autologous germline mitochondrial energy transfer
CN201280018195.1A CN103562378B (zh) 2011-04-14 2012-04-13 用于自体种系线粒体能量转移的组合物和方法
JP2014505369A JP5793237B2 (ja) 2011-04-14 2012-04-13 オートロガス生殖細胞系ミトコンドリアエネルギー移動のための組成物及び方法
IL228829A IL228829A (en) 2011-04-14 2013-10-10 Method for making an egg for in vitro fertilization and a method for in vitro fertilization
TNP2013000454A TN2013000454A1 (en) 2012-02-17 2013-10-30 Compositions and methods for autologous germline mitochondrial energy transfer
MA36400A MA35105B1 (fr) 2011-04-14 2013-11-07 Compositions et méthodes de transfert d'énergie autologue des mitochondries dans les cellules germinales
ZA2013/08494A ZA201308494B (en) 2011-04-14 2013-11-12 Compositions and methods for autologous germline mitochondrial energy transfer
IL237089A IL237089A (en) 2011-04-14 2015-02-04 Composition comprising functional mitochondria isolated from an oogonial stem cell
IL247447A IL247447B (en) 2011-04-14 2016-08-24 An oocyte comprising exogenous, autologous functional mitochondria obtained from an oogonial stem cell (osc) or the progeny of an osc

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201161475561P 2011-04-14 2011-04-14
US61/475,561 2011-04-14
US201261600505P 2012-02-17 2012-02-17
US61/600,505 2012-02-17

Publications (2)

Publication Number Publication Date
WO2012142500A2 true WO2012142500A2 (en) 2012-10-18
WO2012142500A3 WO2012142500A3 (en) 2012-12-13

Family

ID=47010014

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2012/033643 Ceased WO2012142500A2 (en) 2011-04-14 2012-04-13 Compositions and methods for autologous germline mitochondrial energy transfer

Country Status (24)

Country Link
US (5) US8647869B2 (https=)
EP (3) EP2697365A4 (https=)
JP (3) JP5793237B2 (https=)
CN (2) CN106350479A (https=)
AP (1) AP2013007229A0 (https=)
AU (1) AU2012242591B2 (https=)
BR (1) BR112013026501A2 (https=)
CA (2) CA2832336C (https=)
CL (1) CL2013002989A1 (https=)
CO (1) CO6862102A2 (https=)
CR (1) CR20130592A (https=)
DO (1) DOP2013000240A (https=)
EA (1) EA201391523A1 (https=)
GT (1) GT201300248A (https=)
IL (3) IL228829A (https=)
MA (1) MA35105B1 (https=)
MX (1) MX2013011990A (https=)
NI (1) NI201300108A (https=)
NZ (1) NZ706806A (https=)
PE (1) PE20141517A1 (https=)
PH (1) PH12013502206A1 (https=)
SG (2) SG194448A1 (https=)
WO (1) WO2012142500A2 (https=)
ZA (2) ZA201308494B (https=)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103146644A (zh) * 2013-02-27 2013-06-12 青岛农业大学 一种小鼠毛囊干细胞体外向原始生殖细胞分化的技术方法
US8642329B2 (en) 2011-04-14 2014-02-04 The General Hospital Corporation Compositions and methods for autologous germline mitochondrial energy transfer
US8652840B2 (en) 2004-05-17 2014-02-18 The General Hospital Corporation Method for obtaining female germline stem cells and uses thereof
US9267111B2 (en) 2004-05-17 2016-02-23 The General Hospital Corporation Methods of treating female subjects in need of in vitro fertilization
US9403913B2 (en) 2014-09-16 2016-08-02 Ovascience, Inc. Anti-VASA antibodies, and methods of production and use thereof
WO2017197425A1 (en) * 2016-05-18 2017-11-23 Hudson Institute of Medical Research A method of treatment
US9845482B2 (en) 2011-06-29 2017-12-19 The General Hospital Corporation Compositions and methods for enhancing bioenergetic status in female germ cells
WO2019060297A1 (en) * 2017-09-19 2019-03-28 Unity Biotechnology, Inc. MITOCHONDRIAL REJUVENATION AS A TREATMENT FOR AGE-RELATED AND NEURODEGENERATIVE CONDITIONS
US20230011622A1 (en) * 2020-02-20 2023-01-12 Northeastern University Methods and compositions for use of mitochondrial therapies to improve female reproductive potential

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103969232A (zh) * 2014-04-03 2014-08-06 浙江大学 一种三色荧光标记筛选抗阿霉素肾毒性活性物质的方法
CN107109404A (zh) * 2014-12-08 2017-08-29 Ova科学股份有限公司 线粒体收集和浓缩以及其用途
WO2017065839A1 (en) * 2015-10-16 2017-04-20 Coopersurgical, Inc. Quantification of mitochondrial dna and methods for determining the quality of an embryo
US11103537B2 (en) 2016-06-23 2021-08-31 Tithon Biotech Inc. Cells expressing parathyroid hormone 1 receptor and uses thereof
JP7637323B2 (ja) * 2016-06-23 2025-02-28 ティソン バイオテック,インコーポレイテッド 副甲状腺ホルモン1型受容体を発現する細胞およびその使用
CN106190963A (zh) * 2016-07-13 2016-12-07 浙江大学 一种采用线粒体移植促进损伤神经元存活的方法
CN108004200A (zh) * 2017-12-01 2018-05-08 佳学基因医学技术(北京)有限公司 一种线粒体转移液及其制备方法
CN111621555A (zh) * 2019-06-13 2020-09-04 中国科学院广州生物医药与健康研究院 生物标志物及其应用
CN116456892A (zh) * 2020-09-11 2023-07-18 布里格姆妇女医院 确定生殖细胞结构中的位置
CN114134106B (zh) * 2021-11-26 2024-01-26 北京大学人民医院 一种尿源间充质干细胞线粒体及其移植方法与应用
CN116024296A (zh) * 2022-11-25 2023-04-28 中国科学院深圳先进技术研究院 一种基于有机荧光探针评估活生殖细胞及其早期胚胎线粒体状态的应用方法

Citations (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3854470A (en) 1973-11-23 1974-12-17 L Augspurger Reproduction processes for cellular bodies
US4062942A (en) 1975-02-17 1977-12-13 Serono Laboratories, Inc. Induction of ovulation with partially desialylated human chorionic gonadotropin
US4193392A (en) 1977-09-23 1980-03-18 Barnett Gordon R Method for removing ova from animals
US4326505A (en) 1980-01-07 1982-04-27 Occidental Petroleum Corporation Surgical procedure for embryo transplants on animals
US4339434A (en) 1981-08-17 1982-07-13 Gametrics Limited Method of increasing the incidence of female offspring
US4589402A (en) 1984-07-26 1986-05-20 Serono Laboratories, Inc. Method of in vitro fertilization
US4642094A (en) 1984-05-29 1987-02-10 North Jr Walter L Non-surgical embryo transfer device
US4654025A (en) 1984-05-04 1987-03-31 Robert Cassou Artificial insemination apparatus
US4701161A (en) 1985-04-24 1987-10-20 Lenck Lucien Charles Method and apparatus for insemination in vivo and in vitro
US4725579A (en) 1985-02-21 1988-02-16 Serono Laboratories, Inc. Method of in vitro fertilization by a unique combination of gonadotropins
US4790814A (en) 1986-04-09 1988-12-13 Fischl Franz H Artificial fertilization catheter
US4832681A (en) 1986-12-10 1989-05-23 Lenck Lucien C Method and apparatus for artificial fertilization
US4845077A (en) 1984-04-03 1989-07-04 Serono Laboratories, Inc. Method of inducing ovulation
US4846785A (en) 1987-01-22 1989-07-11 Robert Cassou Instrument for artificial insemination, embryo transfer or sampling follicular liquids in mammals
US4865589A (en) 1987-04-22 1989-09-12 Ludwig Simmet Instrument for the transfer of materials such as sperm and embryos
US4902286A (en) 1985-11-08 1990-02-20 Claude Ranoux Container for fertilization of human ovocytes in the absence of CO2 -enriched air
US5084004A (en) 1987-04-30 1992-01-28 Claude Ranoux Process for intra-uterine fertilization in mammals and device for implementation thereof
US5147315A (en) 1990-04-06 1992-09-15 C. R. Bard, Inc. Access catheter and system for use in the female reproductive system
US5160312A (en) 1990-02-09 1992-11-03 W. R. Grace & Co.-Conn. Cryopreservation process for direct transfer of embryos
US5296375A (en) 1992-05-01 1994-03-22 Trustees Of The University Of Pennsylvania Mesoscale sperm handling devices
US5360389A (en) 1993-05-25 1994-11-01 Chenette Philip E Methods for endometrial implantation of embryos
US5512476A (en) 1991-05-14 1996-04-30 Mount Sinai School Of Medicine Of The City University Of New York Method for in vitro fertilization of oocytes using microchambers
US5532155A (en) 1991-07-01 1996-07-02 Ranoux; Claude Spontaneous cycle fertilization method
US5538948A (en) 1987-01-30 1996-07-23 Novo Nordisk A/S Method for treating infertility comprising administering GnRH analog, gonadotrophins, and growth hormone
US5541081A (en) 1994-03-22 1996-07-30 President And Fellows Of Harvard College Process for assessing oocyte and embryo quality
US5563059A (en) 1993-02-23 1996-10-08 Genentech, Inc. Use of human inhibin and human activin to increase the number of mature primate oocytes
US5627066A (en) 1991-05-14 1997-05-06 Mount Sinai School Of Medicine Of The City University Of New York Method and apparatus for in vitro fertilization
US5635366A (en) 1993-03-23 1997-06-03 Royal Free Hospital School Of Medicine Predictive assay for the outcome of IVF
US5744366A (en) 1992-05-01 1998-04-28 Trustees Of The University Of Pennsylvania Mesoscale devices and methods for analysis of motile cells
US5760024A (en) 1992-12-30 1998-06-02 Applied Research Systems Ars Holding N.V. Method of using aspirin to implant an embryo
US5827174A (en) 1995-09-26 1998-10-27 Reuss, Jr.; William Alexander Biological speciman containment and incubation pouch
US5882928A (en) 1997-03-11 1999-03-16 Oocytechs Research Corporation In vitro maturation and fertilization of mammalian oocytes
US5961444A (en) 1997-10-17 1999-10-05 Medworks Corporation In vitro fertilization procedure using direct vision
US6011015A (en) 1994-05-27 2000-01-04 Queen Mary & Westfield College Angiotensin II for improving fertilization
US6010448A (en) 1997-10-17 2000-01-04 Medworks Corp Embryo transfer arrangement
US6040340A (en) 1996-05-07 2000-03-21 Schering Aktiengesellschaft Implantation rates after in vitro fertilization, treatment of infertility and early pregnancy loss with a nitric oxide donor alone or in combination with progesterone, and a method for contraception with nitric oxide inhibitors
US6110741A (en) 1996-05-29 2000-08-29 Wisconsin Alumni Research Foundation Gonadotrophin releasor hormone-containing composition for embryo culture and method for in vitro fertilization
US6130086A (en) 1995-09-04 2000-10-10 Fuso Pharmaceutical Industries, Ltd. Composition for an in vitro fertilization medium
US6196965B1 (en) 1998-05-21 2001-03-06 Cryofacets, Inc. Compositions methods and devices for embryo implantation for in vitro fertilization
US6281013B1 (en) 1999-02-24 2001-08-28 Novo Nordisk A/S Treatment of Infertility
US6352997B1 (en) 1997-03-17 2002-03-05 Merck & Co., Inc. Method of improving in-vitro fertilization
US6544166B1 (en) 1999-11-25 2003-04-08 Groendahl Christian Treatment of human infertility
US6585982B1 (en) 1999-02-24 2003-07-01 Nna/S Treatment of infertility
US6610543B2 (en) 2000-07-24 2003-08-26 Laboratoire C.C.D. Cellular culture medium, particularly for in vitro fertilization, or for the culture of follicles, male germ cells or embryos
US20060010509A1 (en) 2004-05-17 2006-01-12 Joshua Johnson Methods and compositions for producing germ cells from bone marrow derived germline stem cells
US20060010508A1 (en) 2004-05-17 2006-01-12 Tilly Jonathan L Compositions comprising female germline stem cells and methods of use thereof

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU1123301A (en) * 1999-10-27 2001-05-08 General Hospital Corporation, The Methods and compositions for enhancing developmental potential of oocytes and zygotes
US6875854B1 (en) 1999-11-18 2005-04-05 The Brigham And Women's Hospital, Inc. Compositions and methods for the improved diagnosis and treatment of germ cell tumors
EP1233978A4 (en) 1999-11-18 2003-07-23 Brigham & Womens Hospital COMPOSITIONS AND METHODS FOR IMPROVED DIAGNOSIS AND TREATMENT OF GERM CELL TUMORS
CN1673361A (zh) * 2000-04-14 2005-09-28 先进细胞技术公司 含有异源核和线粒体的多能细胞
US20030134422A1 (en) * 2002-01-16 2003-07-17 Sayre Chauncey Bigelow Stem cell maturation for all tissue lines
WO2005007687A1 (en) 2003-07-09 2005-01-27 Dana-Farber Cancer Institute, Inc Compositions and methods for modulating ovarian follicular initiation
US20050130302A1 (en) 2003-09-29 2005-06-16 Reprocell Inc. Method and composition for regulating expansion of stem cells
WO2007008377A1 (en) * 2005-07-06 2007-01-18 University Of Tennessee Research Foundation Oocytes derived from ovarian culture initially containing no oocytes
US8062222B2 (en) 2007-06-13 2011-11-22 Litron Laboratories, Ltd. Method for measuring in vivo hematotoxicity with an emphasis on radiation exposure assessment
US20090111764A1 (en) 2007-10-25 2009-04-30 Searete Llc, A Limited Liability Corporation Of The State Of Delaware Mitochondrial selection
EP2421958A4 (en) * 2009-04-24 2013-09-04 Univ Oregon Health & Science PROCEDURE FOR MITOCHONDRIAL DNA REPLACEMENT IN OOCYTES
CN106350479A (zh) 2011-04-14 2017-01-25 通用医疗公司 用于自体种系线粒体能量转移的组合物和方法
EA201490050A1 (ru) * 2011-06-29 2014-07-30 Зе Дженерэл Хоспитэл Корпорейшн Композиции и способы повышения биоэнергетического состояния женских зародышевых клеток
US9247180B2 (en) * 2012-12-27 2016-01-26 Panasonic Intellectual Property Corporation Of America Video display method using visible light communication image including stripe patterns having different pitches

Patent Citations (49)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3854470A (en) 1973-11-23 1974-12-17 L Augspurger Reproduction processes for cellular bodies
US4062942A (en) 1975-02-17 1977-12-13 Serono Laboratories, Inc. Induction of ovulation with partially desialylated human chorionic gonadotropin
US4193392A (en) 1977-09-23 1980-03-18 Barnett Gordon R Method for removing ova from animals
US4326505A (en) 1980-01-07 1982-04-27 Occidental Petroleum Corporation Surgical procedure for embryo transplants on animals
US4339434A (en) 1981-08-17 1982-07-13 Gametrics Limited Method of increasing the incidence of female offspring
US4845077A (en) 1984-04-03 1989-07-04 Serono Laboratories, Inc. Method of inducing ovulation
US4654025A (en) 1984-05-04 1987-03-31 Robert Cassou Artificial insemination apparatus
US4642094A (en) 1984-05-29 1987-02-10 North Jr Walter L Non-surgical embryo transfer device
US4589402A (en) 1984-07-26 1986-05-20 Serono Laboratories, Inc. Method of in vitro fertilization
US4725579A (en) 1985-02-21 1988-02-16 Serono Laboratories, Inc. Method of in vitro fertilization by a unique combination of gonadotropins
US4701161A (en) 1985-04-24 1987-10-20 Lenck Lucien Charles Method and apparatus for insemination in vivo and in vitro
US4902286A (en) 1985-11-08 1990-02-20 Claude Ranoux Container for fertilization of human ovocytes in the absence of CO2 -enriched air
US4790814A (en) 1986-04-09 1988-12-13 Fischl Franz H Artificial fertilization catheter
US4832681A (en) 1986-12-10 1989-05-23 Lenck Lucien C Method and apparatus for artificial fertilization
US4846785A (en) 1987-01-22 1989-07-11 Robert Cassou Instrument for artificial insemination, embryo transfer or sampling follicular liquids in mammals
US5538948A (en) 1987-01-30 1996-07-23 Novo Nordisk A/S Method for treating infertility comprising administering GnRH analog, gonadotrophins, and growth hormone
US4865589A (en) 1987-04-22 1989-09-12 Ludwig Simmet Instrument for the transfer of materials such as sperm and embryos
US5084004A (en) 1987-04-30 1992-01-28 Claude Ranoux Process for intra-uterine fertilization in mammals and device for implementation thereof
US5160312A (en) 1990-02-09 1992-11-03 W. R. Grace & Co.-Conn. Cryopreservation process for direct transfer of embryos
US5147315A (en) 1990-04-06 1992-09-15 C. R. Bard, Inc. Access catheter and system for use in the female reproductive system
US5627066A (en) 1991-05-14 1997-05-06 Mount Sinai School Of Medicine Of The City University Of New York Method and apparatus for in vitro fertilization
US5512476A (en) 1991-05-14 1996-04-30 Mount Sinai School Of Medicine Of The City University Of New York Method for in vitro fertilization of oocytes using microchambers
US5691194A (en) 1991-05-14 1997-11-25 Mount Sinai School Of Medicine Of The City University Of New York Method and apparatus for in vitro fertilization
US5532155A (en) 1991-07-01 1996-07-02 Ranoux; Claude Spontaneous cycle fertilization method
US5296375A (en) 1992-05-01 1994-03-22 Trustees Of The University Of Pennsylvania Mesoscale sperm handling devices
US5744366A (en) 1992-05-01 1998-04-28 Trustees Of The University Of Pennsylvania Mesoscale devices and methods for analysis of motile cells
US5760024A (en) 1992-12-30 1998-06-02 Applied Research Systems Ars Holding N.V. Method of using aspirin to implant an embryo
US5563059A (en) 1993-02-23 1996-10-08 Genentech, Inc. Use of human inhibin and human activin to increase the number of mature primate oocytes
US5635366A (en) 1993-03-23 1997-06-03 Royal Free Hospital School Of Medicine Predictive assay for the outcome of IVF
US5360389A (en) 1993-05-25 1994-11-01 Chenette Philip E Methods for endometrial implantation of embryos
US5541081A (en) 1994-03-22 1996-07-30 President And Fellows Of Harvard College Process for assessing oocyte and embryo quality
US6011015A (en) 1994-05-27 2000-01-04 Queen Mary & Westfield College Angiotensin II for improving fertilization
US6130086A (en) 1995-09-04 2000-10-10 Fuso Pharmaceutical Industries, Ltd. Composition for an in vitro fertilization medium
US5827174A (en) 1995-09-26 1998-10-27 Reuss, Jr.; William Alexander Biological speciman containment and incubation pouch
US6040340A (en) 1996-05-07 2000-03-21 Schering Aktiengesellschaft Implantation rates after in vitro fertilization, treatment of infertility and early pregnancy loss with a nitric oxide donor alone or in combination with progesterone, and a method for contraception with nitric oxide inhibitors
US6110741A (en) 1996-05-29 2000-08-29 Wisconsin Alumni Research Foundation Gonadotrophin releasor hormone-containing composition for embryo culture and method for in vitro fertilization
US5882928A (en) 1997-03-11 1999-03-16 Oocytechs Research Corporation In vitro maturation and fertilization of mammalian oocytes
US6352997B1 (en) 1997-03-17 2002-03-05 Merck & Co., Inc. Method of improving in-vitro fertilization
US5961444A (en) 1997-10-17 1999-10-05 Medworks Corporation In vitro fertilization procedure using direct vision
US6010448A (en) 1997-10-17 2000-01-04 Medworks Corp Embryo transfer arrangement
US6196965B1 (en) 1998-05-21 2001-03-06 Cryofacets, Inc. Compositions methods and devices for embryo implantation for in vitro fertilization
US6281013B1 (en) 1999-02-24 2001-08-28 Novo Nordisk A/S Treatment of Infertility
US6585982B1 (en) 1999-02-24 2003-07-01 Nna/S Treatment of infertility
US6544166B1 (en) 1999-11-25 2003-04-08 Groendahl Christian Treatment of human infertility
US6610543B2 (en) 2000-07-24 2003-08-26 Laboratoire C.C.D. Cellular culture medium, particularly for in vitro fertilization, or for the culture of follicles, male germ cells or embryos
US20060010509A1 (en) 2004-05-17 2006-01-12 Joshua Johnson Methods and compositions for producing germ cells from bone marrow derived germline stem cells
US20060010508A1 (en) 2004-05-17 2006-01-12 Tilly Jonathan L Compositions comprising female germline stem cells and methods of use thereof
US20060015961A1 (en) 2004-05-17 2006-01-19 Tilly Jonathan L Methods and compositions for producing germ cells from peripheral blood derived germline stem cells
US7955846B2 (en) 2004-05-17 2011-06-07 The General Hospital Corporation Compositions comprising female germline stem cells and methods of use thereof

Non-Patent Citations (82)

* Cited by examiner, † Cited by third party
Title
ACTON ET AL., BIOL REPROD, vol. 77, 2007, pages 569 - 76
ARAL ET AL., GENETICS AND MOLECULAR BIOLOGY, vol. 33, 2010, pages 1 - 4
BARRITT ET AL., HUM REP ROD, vol. 16, 2001, pages 513 - 6
BARTMANN ET AL., J ASSIST REPROD GENET, vol. 21, 2004, pages 79 - 83
BATTAGLIA ET AL., HUM REPROD, vol. 11, 1996, pages 2217 - 2222
BORTVIN ET AL., BMC DEVELOPMENTAL BIOLOGY, vol. 4, no. 2, 2004, pages 1 - 5
CHAN ET AL., MOLECULAR HUMAN REPRODUCTION, vol. 11, no. 12, 2005, pages 843 - 846
CHEN ET AL., BMC MEDICAL GENETICS, vol. 12, 2011, pages 8
COHEN ET AL., MOL HUM REPROD, vol. 4, 1998, pages 269 - 80
COSSARIZA ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 197, 1993, pages 40 - 45
D'COSTA ET AL., INT J. DEV. BIOL., vol. 43, no. 4, 1999, pages 349 - 356
DOLCI ET AL., CELL SCI., vol. 115, 2002, pages 1643 - 1649
DURAN ET AL., FERTILITY AND STERILITY, vol. 96, no. 2, 2011, pages 384 - 388
ELVIN ET AL., MOL. ENDOCRINOL., vol. 13, 1999, pages 1035 - 1048
FABBRI ET AL., MOLECULAR AND CELLULAR ENDOCRINOLOGY, vol. 169, 2000, pages 39 - 42
FREZZA ET AL., NATURE PROTOCOLS, vol. 2, 2007, pages 287 - 295
GARNER ET AL., BIO. REPROD., vol. 57, 1997, pages 1401 - 1406
GAVIS ET AL., DEVELOPRNENT, vol. 110, 1996, pages 521 - 528
GONG ET AL., FERTIL. STERIL., vol. 93, 2010, pages 2594 - 2601
GOOK ET AL., HUMAN REPRODUCTION, vol. 20, no. 1, 2004, pages 72 - 78
GU ET AL., BIOL. REPROD., vol. 59, 1998, pages 1266 - 1274
HANSON ET AL., ELECTROPHORESIS, vol. 22, no. 5, 2001, pages 950 - 9
HANSON ET AL., J. BIOL. CHEM., vol. 276, no. 19, 2001, pages 16296 - 301
HARVEY ET AL., CURR TOP DEV BIOL, vol. 77, 2007, pages 229 - 49
HASSOLD ET AL., HUM GENET, vol. 70, 1985, pages 11 - 17
HENDERSON ET AL., NATURE, vol. 218, 1968, pages 22 - 28
HENDERSON ET AL., STEM CELLS, vol. 20, 2002, pages 329 - 337
HUNT ET AL., TRENDS GENET, vol. 24, 2008, pages 86 - 93
JOHNSON ET AL., CELL, vol. 122, 2005, pages 303 - 315
JOHNSON ET AL., NATURE, vol. 428, pages 145 - 150
KAGAWA ET AL., FEBS J., vol. 277, 2010, pages 590 - 598
KAGAWA ET AL., REPROD. BIOMED., 2009
LASKO ET AL., NATURE, vol. 335, 1988, pages 611 - 167
LEE ET AL., 1 CLIN. ONCOL., vol. 25, 2007, pages 3198 - 3204
LEE ET AL., J. CLIN. ONCOL., vol. 25, 2007, pages 3198 - 3204
LIANG ET AL., DEVELOPMENT, vol. 120, 1994, pages 1201 - 1211
MANDELBAUM, HUMAN REPRODUCTION, vol. 15, 2000, pages 43 - 47
MATIKAINEN ET AL., NATURE GENET., vol. 28, 2001, pages 355 - 360
MATTHEWS, NCHSDATA BRIEF, vol. 21, 2009, pages 1 - 8
MUGGLETON-HARRIS ET AL., NATURE, vol. 299, 1982, pages 460 - 2
NIIKURA ET AL., AGING, vol. 2, 2010, pages 999 - 1003
OHINATA ET AL., NATURE, vol. 436, 2005, pages 207 - 213
ONLINE, vol. 18, pages 568 - 577
PACCHIAROTTI ET AL., DIFFERENTIATION, vol. 79, 2010, pages 159 - 170
PAGE ET AL., ANNU. REV. CELL DEV. BIOL., vol. 20, 2004, pages 525 - 558
PANGAS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 103, 2006, pages 8090 - 8095
PEREZ ET AL., CELL DEATH AND DIFFERENTIATION, vol. 3, 13 October 2006 (2006-10-13), pages 524 - 33
PEREZ ET AL., NATURE, vol. 403, 2000, pages 500 - 1
PORCU ET AL., MOLECULAR AND CELLULAR ENDOCRINOLOGY, vol. 169, 2000, pages 33 - 37
RAJKOVIC ET AL., SCIENCE, vol. 305, 2004, pages 1157 - 1159
RAMALHO-SANTOS ET AL., HUM REPROD UPDATE, 2009, pages 553 - 72
RAMALHO-SANTOS ET AL., HUM REPROD UPDATE, no. 5, 2009, pages 553 - 72
REERS ET AL., BIOCHEMISTRY, vol. 30, 1991, pages 4480 - 4486
SAITOU ET AL., NATURE, vol. 418, 2002, pages 293 - 300
SAUNDERS ET AL., REPRODUCTION, vol. 126, 2003, pages 589 - 597
SCHOLER, TRENDS GENET., vol. 7, no. 10, 1991, pages 323 - 329
SCOTT ET AL., FERTILITY AND STERILITY, vol. 1, 1989, pages 651 - 4
See also references of EP2697365A4
SELESNIEMI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 108, 2011, pages 12319 - 12324
SMILEY ET AL., PROC NATL ACAD SCI USA, vol. 88, 1991, pages 3671 - 3675
SUTOVSKY ET AL., BIOL REPROD, vol. 63, 2000, pages 5820590
SUZUMORI ET AL., MECH. DEV., vol. 111, 2002, pages 137 - 141
TARIN ET AL., MOL REPROD DEV, vol. 61, 2002, pages 385 - 397
TARIN ET AL., THERIOGENOLOGY, vol. 57, 2002, pages 1539 - 1550
TAYLOR ET AL., NAT. BIOTECHNOL., vol. 21, no. 3, 2003, pages 239 - 40
TILLY ET AL., BIOL REPROD, vol. 80, 2009, pages 2 - 12
TILLY ET AL., MOL HUM REPROD, vol. 15, 2009, pages 393 - 398
TOSHIAKI ET AL., CELL STRUCTURE AND FUNCTION, vol. 26, 2001, pages 131 - 136
VENTURA, VITAL HEALTH STAT, vol. 47, 1989, pages 1 - 27
WAI ET AL., BIOLOGY OF REPRODUCTION, vol. 83, 2010, pages 52 - 62
WANG ET AL., CELL CYCLE, vol. 9, 2010, pages 339 - 349
WEISSMAN ET AL., BIOL. REPROD., vol. 60, 1999, pages 1462 - 1467
WEST ET AL., STEM CELLS DEV., vol. 20, 2011, pages 1079 - 1088
WILDING ET AL., ZYGOTE, vol. 13, 2005, pages 317 - 23
YANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 102, 2005, pages 5755 - 5760
YEOM ET AL., DEVELOPMENT, vol. 122, 1996, pages 881 - 888
YUAN ET AL., SCIENCE, vol. 296, 2002, pages 1115 - 1118
ZHENG ET AL., SEMIN. REPROD. MED., vol. 25, 2007, pages 243 - 251
ZOU ET AL., NAT CELL BIOL, 2009, pages 11631 - 636
ZOU ET AL., NAT CELL BIOL, vol. 11, 2009, pages 631 - 636
ZOU ET AL., NATURE CELL BIOLOGY, vol. 5, 12 April 2009 (2009-04-12), pages 631 - 6
ZOU ET AL., STEM CELLS DEV., 2011

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9962411B2 (en) 2004-05-17 2018-05-08 The General Hospital Corporation Isolated populations of female germline stem cells and cell preparations and compositions thereof
US8652840B2 (en) 2004-05-17 2014-02-18 The General Hospital Corporation Method for obtaining female germline stem cells and uses thereof
US9267111B2 (en) 2004-05-17 2016-02-23 The General Hospital Corporation Methods of treating female subjects in need of in vitro fertilization
US8642329B2 (en) 2011-04-14 2014-02-04 The General Hospital Corporation Compositions and methods for autologous germline mitochondrial energy transfer
US8647869B2 (en) 2011-04-14 2014-02-11 The General Hospital Corporation Compositions and methods for autologous germline mitochondrial energy transfer
US9150830B2 (en) 2011-04-14 2015-10-06 The General Hospital Corporation Compositions for autologous ovarian oogonial stem cell mitochondrial energy transfer
US9845482B2 (en) 2011-06-29 2017-12-19 The General Hospital Corporation Compositions and methods for enhancing bioenergetic status in female germ cells
CN103146644A (zh) * 2013-02-27 2013-06-12 青岛农业大学 一种小鼠毛囊干细胞体外向原始生殖细胞分化的技术方法
US9567404B2 (en) 2014-09-16 2017-02-14 Ovascience, Inc. Anti-vasa antibodies, and methods of production and use thereof
US9403913B2 (en) 2014-09-16 2016-08-02 Ovascience, Inc. Anti-VASA antibodies, and methods of production and use thereof
WO2017197425A1 (en) * 2016-05-18 2017-11-23 Hudson Institute of Medical Research A method of treatment
WO2019060297A1 (en) * 2017-09-19 2019-03-28 Unity Biotechnology, Inc. MITOCHONDRIAL REJUVENATION AS A TREATMENT FOR AGE-RELATED AND NEURODEGENERATIVE CONDITIONS
US20230011622A1 (en) * 2020-02-20 2023-01-12 Northeastern University Methods and compositions for use of mitochondrial therapies to improve female reproductive potential

Also Published As

Publication number Publication date
US8647869B2 (en) 2014-02-11
IL228829A (en) 2015-02-26
CR20130592A (es) 2014-03-05
US20120315651A1 (en) 2012-12-13
MA35105B1 (fr) 2014-05-02
CA2832336A1 (en) 2012-10-18
JP2018007659A (ja) 2018-01-18
EP2787073A1 (en) 2014-10-08
NI201300108A (es) 2014-08-26
JP2014514928A (ja) 2014-06-26
US9150830B2 (en) 2015-10-06
CA2868239C (en) 2018-07-31
EP2787073B1 (en) 2019-03-20
CN106350479A (zh) 2017-01-25
US20130060079A1 (en) 2013-03-07
NZ706806A (en) 2016-12-23
GT201300248A (es) 2015-09-01
MX2013011990A (es) 2013-11-20
AP2013007229A0 (en) 2013-11-30
ZA201308494B (en) 2016-02-24
AU2012242591A1 (en) 2013-10-17
EP2697365A4 (en) 2014-07-23
EP3498826A1 (en) 2019-06-19
PH12013502206A1 (en) 2017-10-25
US20130052727A1 (en) 2013-02-28
US8642329B2 (en) 2014-02-04
BR112013026501A2 (pt) 2016-11-29
EA201391523A1 (ru) 2014-03-31
CO6862102A2 (es) 2014-02-10
IL247447B (en) 2018-10-31
NZ617582A (en) 2015-06-26
HK1202890A1 (en) 2015-10-09
US20150353887A1 (en) 2015-12-10
US20190300850A1 (en) 2019-10-03
ZA201502630B (en) 2016-01-27
DOP2013000240A (es) 2014-06-30
SG194448A1 (en) 2013-12-30
CA2868239A1 (en) 2012-10-18
EP2697365A2 (en) 2014-02-19
CN103562378B (zh) 2016-09-07
CL2013002989A1 (es) 2014-05-02
SG10201406171QA (en) 2014-10-30
CA2832336C (en) 2016-08-09
IL228829A0 (en) 2013-12-31
WO2012142500A3 (en) 2012-12-13
IL237089A (en) 2017-05-29
JP5793237B2 (ja) 2015-10-14
JP2016019532A (ja) 2016-02-04
JP6170103B2 (ja) 2017-07-26
CN103562378A (zh) 2014-02-05
PE20141517A1 (es) 2014-10-25
AU2012242591B2 (en) 2014-10-23

Similar Documents

Publication Publication Date Title
AU2012242591B2 (en) Compositions and methods for autologous germline mitochondrial energy transfer
AU2010314989B2 (en) Ex host maturation of germline stem cells
AU2017201404B2 (en) Compositions And Methods For Autologous Germline Mitochondrial Energy Transfer
HK1202890B (en) Compositions and methods for autologous germline mitochondrial energy transfer
OA16632A (en) Compositions and methods for autologous germline mitochondrial energy transfer.
HK1233676A1 (en) Compositions and methods for autologous germline mitochondrial energy transfer
NZ617582B2 (en) Compositions and methods for autologous germline mitochondrial energy transfer
AU2014200322A1 (en) Ex host maturation of germline stem cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12770662

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2832336

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2014505369

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2013002989

Country of ref document: CL

Ref document number: 002292-2013

Country of ref document: PE

Ref document number: MX/A/2013/011990

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2012242591

Country of ref document: AU

Date of ref document: 20120413

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012770662

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 201391523

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: CR2013-000592

Country of ref document: CR

WWE Wipo information: entry into national phase

Ref document number: 13268347

Country of ref document: CO

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013026501

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 237089

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 247447

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 112013026501

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20131014