OA16632A - Compositions and methods for autologous germline mitochondrial energy transfer. - Google Patents

Compositions and methods for autologous germline mitochondrial energy transfer. Download PDF

Info

Publication number
OA16632A
OA16632A OA1201300433 OA16632A OA 16632 A OA16632 A OA 16632A OA 1201300433 OA1201300433 OA 1201300433 OA 16632 A OA16632 A OA 16632A
Authority
OA
OAPI
Prior art keywords
osc
mitochondria
composition
progeny
cell
Prior art date
Application number
OA1201300433
Inventor
Jonathan Lee Tilly
Dori C. Woods
Original Assignee
The General Hospital Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The General Hospital Corporation filed Critical The General Hospital Corporation
Publication of OA16632A publication Critical patent/OA16632A/en

Links

Abstract

Oogonial stem cell (OSC)-derived compositions, such as nuclear free cytoplasm or isolated mitochondria, and uses of OSC-derived compositions in autologous fertility-enhancing procedures are described.

Description

COMPOSITIONS AND METHODS FOR AUTOLOGOUS GERMLINE
MITOCHONDRIAL ENERGY TRANSFER
RELATED APPLICATIONS
This application daims benefit under 35 U.S.C. § l I9(e) of U.S. provisional application Ser. No. 61/475,561, filed April 14, 2011 and U.S. provisional application Ser. No. 61/600,505, fîled February 17,2012, the entire disclosures of which are incorporated herein by reference.
STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH
This work was supported in part by National Institutes on Aging Grant No. NIH R37AG012279 and National Institutes on Health National Research Service Award (F32-AG034809). The govemment has certain rights to the invention.
BACKGROUND OF THE INVENTION
During the past few décades, because of cultural and social changes, women in the developed world hâve signifîcantly delayed chiIdbirth. For example, first birth rates for women 35-44 years of âge in the United States hâve increased by more than 8-fold over the past 40 years (Ventura Vital Health Stat 47:1-27,1989 Matthews NCHS Data Brief2009 21:1-8). It is well known that pregnancy rates in women at 35 or more years of âge are signifîcantly lower, both naturally and with assisted reproduction. The décliné in live birth rate reflects a décliné in response to ovarian stimulation, reduced embryo quality and pregnancy rates, and an increased incidence of miscarriages and fêtai aneuploidy. In addition, aging-associated chromosomal and meiotic spindle abnormalities in eggs are considered the major factors responsible for the increased incidence of infertility, fêtai loss (miscarriage) and conceptions resulting in birth defects - most notably trisomy 21 or Down syndrome - în women at advanced reproductive âges (Henderson et al., Nature 1968 218:22-28, Hassold et al., Hum Genet 1985 70:11-17, Battaglia et al., Hum Reprod 1996 11:2217-2222, Hunt et al., Trends Genet 2008 24:86-93).
At présent there is no known intervention to improve the pregnancy outcome of older female patients. In animal studies, chronic administration of pharmacologie doses of anti-oxidants during the juvénile period and throughout adult reproductive life has been reported to improve oocyte quality in aging female mice (Tarin et al., Mol ReprodDev 2002 61:385-397). However, this approach has signifîcant long-term négative effects on ovarian and uterine function, leading to higher fêtai death and résorptions as well as decreased litter frequency and size in treated animais (Tarin et al., Theriogenology 2002 57:1539-1550). Thus, ciinical translation of chronic anti-oxidant therapy for maintaining or improving oocyte quality in aging females is impractîcal.
Aging and age-related pathologies are frequently associated with loss of mitochondrial function, due to decreased mitochondrial numbers (biogenesis), diminished mitochondrial activity (production of ATP, which is the main source of energy for cells) and/or accumulation of mitochondrial DNA (mtDNA) mutations and délétions. As oocytes âge and oocyte mitochondrial energy production decreases, many of the critical processes of oocyte maturation, required to produce a competent egg, especially nuclear spindle activity and chromosomal ségrégation, become impaired (Bartmann et a\.,JAssist Reprod Genet 2004 21:79-83, Wilding et al., Zygote 2005 13:317-23).
Heterologous transfer of cytoplasmic extracts from young donor oocytes (viz. obtained from different women) into the oocytes of older women with a history of reproductive failure, a procedure known as ooplasmic transplantation or ooplasmic transfer, demonstrated improved embryo development and delivery of live offspring. Unfortunately, however, the children bom following this procedure exhibit mitochondrial heteroplasmy or the presence of mîtochondria from two different sources (Cohen et al., Mol Hum Reprod 1998 4:269-80, Barritt et al., Hum Reprod 2001 16:513-6, Muggleton-Harris et al., Nature 1982 299:460-2, Harvey et al., Curr Top Dev Biol 2007 77:229-49. This is consistent with the fact that maternally-derived mîtochondria présent in the egg are used to “seed” the embryo with mîtochondria, as patemallyderived mîtochondria from the sperm are destroyed shortly after fertilization (Sutovsky et al., Biol Reprod 2000 63:5820590). Although the procedure involves transfer of cytoplasm and not purified or isolated mîtochondria from the donor eggs, the presence of donor mîtochondria in the transferred cytoplasm, confïrmed by the passage of “foreign” mîtochondria into the offspring, is believed to be the reason why heterologous ooplasmic transfer provides a fertility benefit. Irrespective, the health impact of induced mitochondrial heteroplasmy in these children is as yet unknown; however, it has been demonstrated that a mouse model of mitochondrial heteroplasmy produces a phenotype consistent with metabolic syndrome (Acton et al., Biol Reprod2007 77: 569-76). Arguably, the most significant issue with heterologous ooplasmic transfer is tied to the fact that mîtochondria also contain genetic material that is distinct from nuclear genes contributed by the biological mother and biological father.
Accordingly, the children conceived following this procedure hâve three genetic parents (biological mother, biological father, egg donor), and thus represent an example of genetic manipulation of the human germline for the génération of embryos. Ooplasmic transplantation procedures that resuit in mitochondrial heteroplasmy are therefore now regulated and largely prohibited by the FDA. For details, see CBER 2002 Meeting Documents, Biological Response Modifiers Advisory Committee minutes from May 9,2002, which are publicly available from the FDA and “Letter to Sponsors / Researehers - Human Cells Used in Therapy Involving the Transfer of Genetic Material By Means Other Than the Union of Gamete Nuclei”, which is also
K publicly available from the FDA http://www.fda.gov/BiologicsBloodVaccines/SafetyAvailability/ucml05852.htm.
Although the use of autologous mitochondria from somatic cells would avoid mitochondrial heteroplasmy, the mitochondria of somatic cells also suffer from age-related loss of mitochondrial fonction, due to decreased mitochondrial numbers (biogenesis), diminished mitochondrial activity (production of ATP, which is the main source of energy for cells) and/or accumulation of mitochondrial mtDNA mutations and délétions. Therefore, for women of advanced maternai âge, no significant benefit would hâve been expected from transferring mitochondria derived from autologous somatic cells into oocytes. Moreover, a variety of stem cells are known to possess low mitochondrial activity (Ramalho-Santos et al., Hum Reprod Update. 2009 (5):553-72) and, therefore, adult stem cells were not thought to be viable sources of high activity mitochondria.
SUMMARY OF THE INVENTION
The présent invention is based, in part, upon the surprising discovery that the mammalian female germline stem cells or oogonial stem cells (OSCs), which are présent in the somatic tissue of the ovary, contain mitochondria with the highest known ATP-generating capacity of all stem cell types evaluated, and containing mtDNA having a reduced amount of accumulated mutations, including, in some cases, non-detectable levels of a common mtDNA délétion known to accumulate with âge in somatic cells.
In one aspect, the invention provides a method of preparing an oocyte for in vitro fertilization (IVF) or artificial insémination. The method comprises transferring a composition comprising OSC mitochondria, or mitochondria obtained from a progeny of an OSC, into an autologous oocyte, thereby preparing the oocyte for in vitro fertilization or artificial insémination.
In some embodiments, the OSC is an isolated non-embiyonic stem cell that is mitotically competent and expresses Vasa, Oct-4, Dazl, Stella and optionally a stage-specific embryonic antigen (SSEA) (e.g., SSEA-1, -2, -3, and -4). The OSC can be obtained from ovarian tissue, or non-ovarian tissue/sources, such as, e.g., bone marrow or blood, e.g., peripheral and umbilical cord blood.
In other embodiments, the composition comprising OSC mitochondria, or mitochondria obtained from a progeny of an OSC, is the cytoplasm of the cells without a nucléus.
In yet other embodiments, the composition comprising OSC mitochondria or mitochondria obtained from the progeny of an OSC is a purified préparation. In certain embodiments, the purified préparation does not contain or îs at least about 85%, 90%, 95% free of OSCs, OSC progeny and/or non-fonctional mitochondria.
K
In some embodiments, the composition comprises IxlO3 to 5xl04 mitochondria.
fn other embodiments, the OSC or progeny of an OSC produces at least 5-fold more
ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In yet other embodiments, the OSC or progeny of an OSC produces at least I0-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In still other embodiments, the OSC or progeny of an OSC produces at least 50-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain, embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In other embodiments, the OSC or progeny of an OSC produces at least 100-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In some embodiments, the oocyte is obtained from a human female of advanced maternai âge. In other embodiments, the oocyte is obtained from a human female with low ovarian reserve.
In some embodiments, the composition comprises mitochondria that hâve been isolated by centrifugation. In other embodiments, the composition comprises mitochondria that hâve been isolated by mitochondrial membrane potential-dependent cell sorting.
In some embodiments, the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC, is the cytoplasm of the cells without a nucléus, fn other embodiments, the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC is a purified préparation of mitochondria.
In another aspect, the invention provides an composition comprising isolated OSC mitochondria, or mitochondria obtained from a progeny of an OSC.
In some embodiments, the composition is at least about 85%, 90%, 95% free of cells or non-functional mitochondria.
In some embodiments, the composition comprises IxlO3 to 5xl04 mitochondria.
In other embodiments, the OSC or progeny of an OSC produces at least 5-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In some embodiments, the OSC or progeny of an OSC produces at least iO-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
A
In other embodiments, the OSC or progeny of an OSC produces at least 50-fold more
ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In some embodiments, the OSC or progeny of an OSC produces at least 100-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In some embodiments, the OSC or progeny of an OSC is obtained from a human female of advanced maternai âge. In other embodiments, the OSC or progeny of an OSC is obtained from a human female with low ovarian reserve.
In some embodiments, the composition comprises mitochondria that hâve been isolated by centrifugation. In other embodiments, the composition comprises mitochondria that hâve been isolated by mitochondrial membrane potential-dependent cell sorting.
In yet another aspect, the invention provides a composition comprising at least one isolated mitochondrion obtained from an OSC or at least one progeny of an OSC.
In some embodiments, the composition comprises lxlO3 to 5x104 mitochondria.
In other embodiments, the OSC or progeny of an OSC produces at least 5-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In some embodiments, the OSC or progeny of an OSC produces at least 10-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In other embodiments, the OSC or progeny of an OSC produces at least 50-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In some embodiments, the OSC or progeny of an OSC produces at least 100-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In some embodiments, the OSC or progeny of an OSC is obtained from a human female of advanced maternai âge. In other embodiments, the OSC or progeny of an OSC is obtained from a human female with low ovarian reserve.
In some embodiments, the composition comprises mitochondria that hâve been isolated by centrifugation. In other embodiments, the composition comprises mitochondria that hâve been isolated by mitochondrial membrane potential-dependent cell sorting.
In another aspect, the invention provides an oocyte prepared in accordance with any of the methods described above.
<
In yet another aspect, the invention provides an oocyte comprising exogenous, autologous OSC mitochondria or mitochondria obtained from a progeny of an OSC.
In yet another aspect, the invention provides a method of in vitro fertilization. The method comprises the steps of: a) obtaining a composition comprising i) mitochondria obtained from an OSC, or ii) mitochondria obtained from a progeny of an OSC; b) transferring the composition into an isolated, autologous oocyte; and c) fertîlizing the autologous oocyte in vitro to form a zygote. In an embodiment, the method further comprises transferring the zygote, or a preimplantation stage embryo derived from the zygote, into the utérus or oviduct of a female subject.
In some embodiments, the composition comprises lxlO3 to 5xl04 mitochondria.
In other embodiments, the OSC or progeny of an OSC produces at least 5-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In yet other embodiments, the OSC or progeny of an OSC produces at least I0-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In stiil other embodiments, the OSC or progeny of an OSC produces at least 50-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain, embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In other embodiments, the OSC or progeny of an OSC produces at least 100-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In some embodiments, the oocyte is obtained from a human female of advanced maternai âge. In other embodiments, the oocyte is obtained from a human female with low ovarian reserve.
In some embodiments, the composition comprises mitochondria that hâve been isolated by centrifugation. In other embodiments, the composition comprises mitochondria that hâve been isolated by mitochondrial membrane potential-dependent cell sorting.
In some embodiments, the at least one OSC is obtained from ovarian tissue. In other embodiments, the at least one OSC is obtained from a non-ovarian tissue.
In some embodiments, the non-ovarian tissue is blood. In other embodiments, the nonovarian tissue is bone marrow.
In some embodiments, the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC, is the cytoplasm of the cells without a nucléus. In other embodiments, the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC is a purified préparation of mitochondria.
In yet another aspect, the invention provides a method of isolating a population of functional mitochondria from at least one OSC, or at least one progeny of an OSC. The method comprises the steps of incubating a composition comprising at least one OSC, or at least one progeny of an OSC, with a mitochondrial tracking probe under conditions sufficient to bind the probe to the functional mitochondria and sorting the fiinctîonal mitochondria from the nonfunctional mitochondria, thereby isolating the population of functional mitochondria from at least one OSC, or at least one progeny of an OSC. In some embodiments, non-functional mitochondria are excluded from the population of functional mitochondria.
In some embodiments, the mitochondrial tracking probe is a non-oxidation dépendent probe. In some embodiments, the mitochondrial tracking probe is an accumulation dépendent probe. In some embodiments, the mitochondrial tracking probe is a reduced oxidative state probe. In some embodiments, the sorting step includes fluorescence-activated cell sorting.
In yet another aspect, the invention provides a method of identifying a population of functional mitochondria obtained from at least one OSC, or at least one progeny of an OSC. The method comprises the steps of: a) incubating a composition comprising at least one OSC, or at least one progeny of an OSC, with a fluorescent reduced oxidative state probe and a fluorescent accumulation dépendent probe under conditions sufficient to bind the fluorescent reduced oxidative state probe to functional mitochondria in the composition and bind the fluorescent accumulation dépendent probe to total mitochondria in the composition; b) obtaining a composition comprising the functional mitochondria using fluorescence-activated cell sorting, wherein the composition excludes non-functional mitochondria; c) determining the amount of functional mitochondria and the amount of total mitochondria; and d) calculating the ratio of functional mitochondria to total mitochondria; and e) determining whether the ratio is greater than about 0.02, thereby identifying a population of functional mitochondria obtained from at least one OSC, or at least one progeny of an OSC.
In some embodiments, the fluorescent accumulation dépendent probe can fluoresce in one portion of the spectrum (e.g., green). In other embodiments, the fluorescent reduced oxidative state probe can fluoresce in a different portion of the spectrum (e.g., red).
In another aspect, the invention provides a composition comprising functional mitochondria obtained according to a method comprising the steps of: a) incubating a composition comprising at least one OSC, or at least one progeny of an OSC, with a fluorescent reduced oxidative state probe and a fluorescent accumulation dépendent probe under conditions sufficient to bind the fluorescent reduced oxidative state probe to functional mitochondria in the composition and bind the fluorescent accumulation dépendent probe to total mitochondria in the composition; and b) obtaining a composition comprising the functional mitochondria using
O<
fluorescence-activated cell sorting, wherein the composition excludes non-functional mitochondria.
Another aspect of the invention provides a kit comprising a composition comprising isolated OSC mitochondria or mitochondria obtained from a progeny of an OSC and instructions for use. In one embodiment, the composition îs at least about 85%, 90%, 95% free of cells or non-functional mitochondria.
Yet another aspect of the invention provides a kit comprising at least one isolated mitochondrion obtained from an OSC or at least one progeny of an OSC and instructions for use.
Another aspect of the invention provides a method for increasing the ATP-generating capacity of an oocyte. The method comprises the steps of: a) obtaining a composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC that is autologous to the oocyte; and b) injecting the composition of mitochondria into the oocyte.
In some embodiments, the composition comprises lxlO3 to 5xl04 mitochondria.
In other embodiments, the OSC or progeny of an OSC produces at least 5-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In yet other embodiments, the OSC or progeny of an OSC produces at least l O-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In still other embodiments, the OSC or progeny of an OSC produces at least 50-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain, embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In other embodiments, the OSC or progeny of an OSC produces at least 100-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell. In certain embodiments, the ovarian somatic cell or mesenchymal stem cell is autologous.
In some embodiments, the oocyte is obtained from a human female of advanced maternai âge. In other embodiments, the oocyte is obtained from a human female with low ovarian reserve.
In some embodiments, the composition comprises mitochondria that have been isolated by centrifugation. In other embodiments, the composition comprises mitochondria that have been isolated by mitochondrial membrane potential-dependent cell sorting.
In some embodiments, the at least one OSC is obtained from ovarian tissue. In other embodiments, the at least one OSC is obtained from a non-ovarian tissue.
In some embodiments, the non-ovarian tissue is blood. In other embodiments, the nonovarian tissue is bone marrow.
In some embodiments, the composition comprising mitochondrie obtained from at least one OSC or at least one progeny of an OSC, is the cytoplasm of the cells without a nucléus. In other embodiments, the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC is a purified préparation of mitochondria.
In another aspect, the invention provides an oocyte prepared by a method comprising the steps of: a) obtaining a composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC that is autologous to the oocyte; and b) injecting the composition of mitochondria into the oocyte.
Yet another aspect ofthe invention provides a composition of mitochondria obtained from at least one OSC or at least one progeny of an OSC, wherein the composition comprises a population of mitochondria in which greater than about 75%, 85%, 90%, or about 99% of the mitochondria are high ATP-generating capacity mitochondria.
In still another aspect, the invention provides compositions comprising a population of mitochondria in which less than about 5% to about 25% of the mtDNA comprises a délétion mutation within nucléotides 8470-13447 of the mitochondrial genome, and methods pertaining to such compositions.
Other features and advantages of the invention will be apparent from the detailed description, and from the claims. Thus, other aspects of the invention are described in the following disclosure and are within the ambit of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
The following Detailed Description, given by way of example, but not intended to limit the invention to spécifie embodiments described, may be understood in conjunction with the accompanying figures, incorporated herein by reference.
Figure 1 depicts validation of a fluorescence-activated cell sorting (FACS)-based protocol for OSC isolation. In Figure la, immunofluorescence analysis of VASA expression (with DAPI counterstain) is shown in adult mouse ovaries using antibodies against the NH2 or COOH terminus of VASA (scale bars, 50 gm). In Figure lb, immunomagnetic sorting of dispersed mouse ovaries or isolated oocytes is shown using antibodies against the NH2 or COOH terminus of VASA. Fraction 1 contains cells plus beads prior to séparation, Fraction 2 is a wash or flow-through fraction (non-immunoreactive) and Fraction 3 is a bead fraction (VASApositive cells). In Figure le, FACS analysis of live orpermeabilized cells from dispersed mouse ovaries using antibodies against the NH2 or COOH terminus of VASA is shown. Viable VASApositive cells are oniy detected with the COOH antibody (dashed box) whereas permeabilization enables isolation of VASA-positive cells using the NH2 antibody (dashed box). In Figure ld, permeabilization of viable VASA-positive cells (dashed box) obtained with the COOH antibody
K enables re-isolation of the same cells by FACS using the NH2 antibody (dashed box). In Figure le, a schematic représentation of the FACS protocols employed using the VASA-COOH antibody for isolation of viable OSCs is shown. Figure lf depicts gene expression analysis of germline markers [Blimpl (also referred to as PR domain containing l with ZNF domain or Prdml), Stella, Fragilis (also referred to as interferon induced transmembrane protein 3 or Ifitm3), Tert (telomerase reverse transcriptase), Vasa, Dazl (deleted in azoospermie like)] and oocyte markers [Nobox (newbom ovaiy homeobox), Zp3 (zona pellucida giycoprotein 3), Gdf9 (growth différentiation factor 9)] in each cell fraction produced during the ovarian dispersion process to obtain cells for FACS-based isolation of OSCs using the VASA-COOH antibody (+ve, VASA-positive viable cell fraction after FACS; -ve, VASA-negative viable cell fraction after FACS; No RT, PCR of RNA sample without reverse transcription; β-actin, sample loading control).
Figure 2 depicts OSC fractions isolated from adult mouse ovaries by immunomagnetic bead sortîng that contain contaminating oocytes. Gene expression analysis of germline markers (Blimpl, Stella, Fragilis, Tert, Vasa, Dazl) and oocyte-specific markers (Nobox, Zp3, Gdi9) is shown in young adult mouse ovaries (positive control) or the final cell fraction obtained following VASA-COOH antibody-based immunomagnetic bead sorting of dispersed young adult mouse ovaries (No RT, PCR of sorted cell RNA sample without reverse transcription; βactin, sample loading control).
Figure 3 depicts isolation of VASA-positive cells from adult mouse and human ovaries using FACS. In Figure 3a and b, the représentative histological appearance of adult ovarian tissue used for human (a) and mouse (b) OSC isolation is shown. Scale bars, 100 pm. In Figures 3c and d, the morphology of viable cells isolated by FACS based on cell-surface expression of VASA is shown. Scale bars, 10 pm. Figure 3e provides the gene expression profile of starting ovarian material and freshly-isolated OSCs, showing assessment of 3 different patients as examples for human tissue analysis (No RT: PCR of RNA sample without reverse transcription; β-actin, sample loading control). In Figure 3f through Figure 3k, a teratoma formation assay showing an absence of tumors in mice 24 weeks after receiving injections of mouse OSCs (3f) compared with development of tumors in mice 3 weeks after injection of mouse embryonic stem cells (ESCs) is shown (Figure 3g through Figure 3j; panels 3h through 3j show examples of cells from ail three germ layers, with neural rosette highlighted in panel 3h, inset), along with a summary of the experimental outcomes (3k).
Figure 4 depicts functional eggs obtained from mouse OSCs after intraovarian transplantation. In Figures 4a and 4b, examples of growing follicles containing GFP-negative and GFP-positive (hematoxylin counterstain) oocytes are shown in ovaries of wild-type mice injected with GFP-expressîng OSCs 5-6 months earlier. In Figure 4c, examples of ovulated
GFP-negative eggs (in cumulus-oocyte complexes), and résultant embryos [2-cell, 4-cell, compact monda (CM) and early blastocyst (EB) stage embryos are shown as examples] generated by IVF are shown, following induced ovulation of wild-type female mice that received intraovarian transplantation of GFP-expressing OSCs 5-6 months earlier. In Figures 4d and 4e, 5 examples of GFP-positive eggs (in cumulus-oocyte complexes) obtained from the oviducts are shown following induced ovulation of wild-type female mice that received intraovarian transplantation of GFP-expressing OSCs 5-6 months earlier. These eggs were in vitro fertilized using wild-type sperm, resulting in 2-cell embryos that progressed through preïmplantation development [examples of GFP-positive embryos at the 2-cell, 4-cell, 8-cell, compacted morula 10 (CM), expanded morula (EM), blastocyst (B) and hatching blastocyst (HB) stage are shown] to form hatching blastocysts 5-6 days after fertilization.
Figure 5 depicts gémi cell colony formation by mouse and human OSCs in vitro.
Immunofluorescence-based analysis of VASA expression is shown in Figures 5b and 5d; (with DAPI counterstain) in typical germ cell colonies formed by mouse (5a, 5b) and human (5c, 5d) 15 OSCs after establishment on mouse embryonic fïbroblasts (MEFs) in vitro (typical colonies are highlighted by white dashed lines).
Figure 6 depicts évaluation of mouse and human ovary-derived VASA-positive cells in defined cultures. Figures 6a through 6d show assessment of OSC prolifération by dual détection of VASA expression and BrdU incorporation in mouse (6a, 6b) and human (6c, 6d) OSCs 20 maintained in MEF-free cultures. Figure 6e shows the typical growth curve for MEF-free cultures of mouse OSCs after passage and seeding 2.5 X 104 cells per well in 24-well culture plates. Figure 6f shows FACS analysis using the COOH antibody to detect cell-surface expression of VASA in mouse OSCs after months of propagation (example shown, passage 45). Figure 6g indicates the gene expression profile of starting ovarian material and cultured mouse 25 and human OSCs after 4 or more months of propagation in vitro (No RT, PCR of RNA sample without reverse transcription; β-actin, sample loading control). Two different human OSC lines (OSCl and OSC2) cstablished from two different patients are shown as examples. Figure 6h and 6i show représentative immunofluorescence analysis of BLIMPl, STELLA and FRAGILIS expression in mouse (h) and human (i) OSCs in MEF-free cultures. Cells were counterstained 30 with DAPI and rhodamine-phalloidin to visualize nuclear DNA and cytoplasmic F-actin, respectively.
Figure 7 depicts spontaneous oogenesis from cultured mouse and human OSCs. Figures 7a through 7c provide examples of immature oocytes formed by mouse OSCs in culture, as assessed by morphology (7a), expression of oocyte marker proteins VASA and KIT (7b; note 35 cytoplasmic localisation of VASA), and the presence of mRNAs encoding the oocyte marker genes Vasa, Kit, Msy2 (also referred to as Y box protein 2 or Ybx2), Nobox, Lhx8, Gdf9, Zpl,
Zp2 and Zp3 (7c; No RT: PCR of RNA sample without reverse transcription; β-actin, sample loading control). Scale bars, 25 gm. Figure 7d indicates the number of immature oocytes formed by mouse OSCs 24,48 and 72 hours after passage and seeding 2.5 X ÎO4 cells per well in 24well culture plates (culture supematants were collected at each time point for détermination, and thus the values represent numbers generated over each 24 hour block, not cumulative numbers; mean ± SEM, n = 3 independent cultures). Figures 7e through 7g show in vitro oogenesis from human OSCs, with examples of immature oocytes formed by human OSCs in culture (7f, morphology; 7g, expression of oocyte marker proteins VASA, KIT, MSY2 and LHX8) and numbers formed following passage and seeding of 2.5 X l O4 cells per well in 24-well culture plates (7e; mean ± SEM, n = 3 independent cultures) shown. The presence of mRNAs encoding oocyte marker genes (Vasa, Kit, Msy2, Nobox, Lhx8, Gdf9, Zpl, Zp2, Zp3) in human OSCderived oocytes is shown in panel c along with results for mouse OSC-derived oocytes. Scale bars, 25 gm. In Figure 7h, immunofluorescence-based détection of the meiotic recombination markers, DMCl (dosage suppressor of mckl homolog) and SYCP3 (synaptonemal complex protein 3) (DAPI counterstain), is shown in nuclei of cultured human OSCs; human ovarian stromal cells served as a négative control. In Figure 7i, FACS-based ploidy analysis of cultured human OSCs ts shown 72 hours after passage. Results from ploidy analysis of cultured human fibroblasts (négative control) and cultured mouse OSCs are presented in Figure 9.
Figure 8 depicts the détection of oocyte-specific markers in adult human ovaries. Immunofluorescence analysis of VASA (8a), KIT (8b), MSY2 (8c) and LHX8 (8d,) expression in oocytes in adult human ovarian cortical tissue is shown (see also Figure l Oh). Sections were counterstained with DAPI for visualization of nuclei. Scale bars, 25 gm.
Figure 9 depicts ploidy analysis of human fibroblasts and mouse OSCs in culture. Figure 9a and 9b show représentative FACS-based assessment of ploidy status in cultures of activelydividing human fêtai kidney fibroblasts (9a) and in mouse OSCs collected 48 hours after passage (9b). Haploid (ln) cells were only detected in the germline cultures, consistent with results from analysis of human OSCs maintained in vitro (see Figure 7i), whereas ail cultures contained diploid (2n) and tetraploid (4n) populations of cells.
Figure I0 depicts génération of oocytes from human OSCs in human ovary tissue. Direct (live-cell) GFP fluorescence analysis of human ovarian cortical tissue following dispersion, reaggregation with GFP-hOSCs (10a) and in vitro culture for 24-72 hours (10b, 10c) is shown. Note the formation of large single GFP-positive cells surrounded by smaller GFP-negative cells in compact structures resembling follicles (Figures 10b and 10c; scale bars, 50 gm). Examples of immature follicles containing GFP-positive oocytes (highlighted by black arrowheads, against a hematoxylin counterstain) in adult human ovarian cortical tissue injected with GFP-hOSCs and xenografted into NOD/SCID female mice are shown (Figure lOd, 1 week post-transplant; Figure lOf, 2 weeks post-transplant). Note comparable follicles with GFP-negative oocytes in the same grafts. As négative controls, ail immature follicles in human ovarian cortical tissue prior to GFPhOSC injection and xenografting (10e) or that receîved vehicle injection (no GFP-hOSCs) prior to xenografting (10g) contained GFP-negative oocytes after processing for GFP détection in parallel with the samples shown above. Figure lOh shows dual immunofluorescence analysis of GFP expression and either the diplotene stage oocyte-specific marker MSY2 or the oocyte transcription factor LHX8 in xenografts rcceiving GFP-hOSC injections. Note that GFP was not detected in grafts prior to GFP-hOSC injection, whereas MSY2 and LHX8 were detected in ali oocytes. Sections were counterstained with DAPI for visualization of nuclei. Scale bars, 25 pm.
Figure 11 depicts morphometry-based assessment of oocyte formation in human ovarian xenografts following GFP-hOSC transplantation. The total number of primordial and primary follicles in 3 randomly selected human ovarian cortical tissue samples (labeled 1,2 and 3) are shown, 7 days after injecting GFP-hOSCs and xenografting into NOD/SC1D mice, which contain GFP-negative (host-derived) or GFP-positive (OSC-derived) oocytes (see Figures lOd through 10g for examples).
Figure 12 depicts cryopreservation and thawing of human ovarian cortical tissue and freshly-isolated human OSCs. Figure 12a and 12b show the histological appearance of adult human ovarian cortical tissue before and after vitrification, highlighting the maintenance of tissue integrity and the large numbers of oocytes (black arrowheads) that survive the freeze-thaw procedure. In Figure 12c, the percent cell loss following freeze-thaw of freshly-isolated human OSCs is shown (results from two different patients).
Figure 13 depicts an overview of an Autologous Germline Mitochondrial Energy Transfer (AUGMENT) procedure. Note that OSCs used as a source of mitochondria for the transfer, and the egg to be fertilized which will receive the OSC mitochondria, are obtained from the same subject.
Figure 14 depicts mitochondrial staining with MitoTracker Green FM (Invitrogen M7514, Life Technologies Corp., Carlsbad, CA) in cultured human ovarian somatic cells and cultured human OSCs obtained from the same patient.
Figure 15 depicts PCR analysis ofthe 4977-bp délétion in mtDNA from cultured OSCs and patient matched ovarian somatic cells.
Figure 16 depicts the results of an ATP assay.
Figure 17 depicts FACS-based germ cell purification or isolation from bone marrow préparations of adult female mice during estrus of the female reproductive cycle using cell surface expression of Vasa to isolate the cells.
Figure 18 depicts FACS-based germ cell purification or isolation from peripheral blood préparations of adult female mice during estrus of the female reproductive cycle using cell surface expression of Vasa to isolate the cells.
Figure 19 depicts mitochondria following staining with mitotracker M7514 and cell lysis. Human OSCs were incubated with M7514, and then lysed to release the stained mitochondria using osmotic shock. The entire population (mitochondria from lysed cells and résiduel unlysed stained cells) was analyzed by FACS. The left panel shows mitochondria from lysed cells, which are easily distinguishable from mitochondria contained in residual unlysed cells based on size (forward scatter, FSC-A). Fluorescence intensity (FITC-A) revealed two distinct populations of mitochondria from lysed cells, one having high intensity (Mito MT high), and one having low intensity (Mito MT Low). Functional mitochondria are known to hâve a greatcr uptake and rétention of the stain, and thus fluoresce at a higher intensity (Invitrogen technical staff, Lîfe Technologies Corp., Carlsbad, CA).
Figure 20 depicts the kinetics of ATP production capacity by mitochondria isolated from different human cell types.
Figure 21 depicts ATP production capacity over 10 minutes by mitochondria isolated from different human cell types.
Figure 22 depicts mtDNA délétion analysis in human mesenchymal stem cells and human ovarian soma.
DETAILED DESCRIPTION OF THE INVENTION
Définitions
Unless otherwise defined, ail technical and scientifïc terms used herein hâve the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the présent application, including définitions wiil control.
“Oogonial stem cells” (OSCs), also known as female germline stem cells, are derived from postnatal sources and express markers including Vasa, Oct-4, Dazl, Stella and optionally an SSEA. OSCs are mitotically competent (i.e., capable of mitosis) and do not express oocyte markers including growth/differentiation factor-9 (GDF-9), and zona pellucida glycoproteins (e.g., zona pellucida glycoprotein-3, ZP3), or markers of meiotic recombination such as synaptonemal complex protein-3 (SYCP3 or SCP3). OSCs can be obtained from the postnatal ovaiy. OSCs are known in the art and are described in U.S. Patent No. 7,955,846, the entire contents of which are incorporated herein by référencé. OSCs are additionally described by Johnson étal., Nature 428:145-150; Johnson et al., Cell 2005 122:303-315; Wang et al., Cell Cycle 2010 9:339-349; Niikura et al., Aging20\0 2:999-1003; Tilly et al., BiolReprod 20Q9 80:2-12, Tilly et al., Mol Hum Reprod 2009 15:393-398; Zou et al., Nat Cell Biol2009
11:631-636; Pacchiarotti et al., Différentiation 2010 79:159-170), the contents of which are incorporated herein by reference. Preferably, the OSC of the invention is a human OSC.
As used herein, the “progeny of an OSC” refers to ail daughter cells derived from OSCs of the invention, including progenitor cells and differentiated cells that maintain or achieve oogenic potential (i.e., the ability to form an oocyte) and functional mitochondria. Preferably, the OSC progeny of the invention is a human OSC progeny.
As used herein, the term “functional mitochondria” refers to mitochondria that produce ATP and can be used interchangeably with the term “respiring mitochondria.”
OSCs may additionally be obtained from the bone marrow, peripheral blood or umbilical cord blood. Bone marrow derived OSCs of the invention can also circulate throughout the body and most preferably can be localized in bone marrow, peripheral blood and ovaty. Bone marrow derived OSCs express markers including Oct 4, Vasa, Dazl, Stella, Fragilis, and optionally Nobox, Kit and Sca-1. Bone marrow derived OSCs are mîtotically competent (i.e., capable of mitosis) and do not express GDF-9, zona pellucida proteins (e.g., ZP3) or SCP3. For additional details on bone marrow-derived OSCs, see, U.S. Patent Pub. No. 20060010509, the entire contents of which are incorporated herein by reference for their description of OSCs in the bone marrow. For additional details on peripheral blood and umbilical cord blood derived OSCs, see, U.S. Patent Pub. No. 20060015961, the entire contents of which are incorporated herein by reference for their description of OSCs in the peripheral blood.
Oct-4, also referred to as POU domain class 5 transcription factor 1 or Pou5fl, is a gene expressed in female germline stem cells and their progenitor cells. The Oct-4 gene encodes a transcription factor that is învolved in the establishment of the mammalian germline and plays a signifïcant rôle in early germ cell spécification (reviewed in Scholer, Trends Genet. 1991 7(10):323-329). In the developing mammalian embryo, Oct-4 is down-regulated during the différentiation of the epiblast, eventually becoming confined to the germ cell lineage. In the germline, Oct-4 expression is regulated separately from epiblast expression. Expression of Oct-4 is a phenotypic marker of totipotency (Yeom et al., Development 1996 122:881-888).
Stella, also commonly referred to as developmental pluripotency associated 3 or Dppa3, is a gene expressed in female germline stem cells and their progenitor cells. Stella is a novel gene specificaily expressed in primordial germ cells and their descendants, including oocytes (Bortvin et al., BMC Developmental Biology 2004 4(2): 1-5). Stella encodes a protein with a SAP-like domain and a splicing factor motif-like structure. Embryos déficient in Stella expression are compromised in preimplantation development and rarely reach the blastocyst stage. Thus, Stella is a maternai factor implicated in early embryogenesis.
Dazl is a gene expressed in female germline stem cells and their progenitor cells. The autosomal gene Dazl is a member of a family of genes that contain a consensus RNA binding domain and are expressed in germ cells. Loss of expression of an intact Dazl protein in mice is associated with failure of germ cells to complété meiotic prophase. Specifically, in female mice null for Dazl, loss of germ cells occurs during fêtai life at a time coïncident with progression of germ cells through meiotic prophase. In male mice null for Dazl, germ cells were unable to progress beyond the leptotene stage of meiotic prophase I. Thus, in the absence of Dazl, progression through meiotic prophase is interrupted (Saunders et al., Reproduction 2003 126:589-597).
Vasa, also referred to as DEAD box polypeptide 4 or Ddx4, is a gene expressed in female germline stem cells and their progenitor cells. Vasa is a component of the germplasm that encodes a DEAD-family ATP-dependent RNA helicase (Liang et al., Development 1994 120:1201-1211; Lasko étal.,Nature 1988 335:611-167). The molecular fonction of Vasa is directed to binding target mRNAs involved in germ cell establishment (e.g., Oskar and Nanos), oogenests, (e.g., Gruken), and translation onset (Gavis et al., Development 1996 110:521-528). Vasa is required for pôle cell formation and is exclusîvely restricted to the germ cell lineage throughout development. Thus, Vasa is a molecular marker for the germ cell lineage in most animal species (Toshiaki et al., Cell Structure and Fonction 2001 26:131-136).
Stage-Specifîc Embryonic Antigens are optionally expressed in female germline stem cells and expressed in female germline stem cell progenitors ofthe invention. Stage-Specifîc Embryonic Antigen-1 (SSEA-1) is a cell surface embryonic antigen whose fonctions are associated with cell adhesion, migration and différentiation. During hypoblast formation, SSEA1 positive cells can be identified in the blastocoel and hypoblast and later in the germinal crescent. SSEA-1 fonctions in the early germ cell and neural cell development (D'Costa et al., Int J. Dev. Biol. 1999 43(4):349-356; Henderson et al., Stem Cells 2002 20:329-337). In spécifie embodiments, expression of SSEAs in female germline stem cells may arise as the cells differentiate. SSEAs usefol in the invention include SSEA-1, -2, -3, and -4.
The term “autologous” as used herein refers to biological compositions obtained from the same subject. In one embodiment the biological composition includes OSCs, OSC-derived compositions and oocytes (i.e., mature oocytes). Accordingly, in conducting methods of the invention, the female germ cell cytoplasm or mitochondria used for transfer and the récipient oocyte into which the aforementîoned compositions are transferred are obtained from the same subject.
The term isolated as used herein refers to an OSC, mitochondrion or composition derived from an OSC (e.g., cytoplasm, mitochondrial préparation), which has been physically separated or removed from its naturel biological environment. An isolated OSC, mitochondrion or composition need not be purified.
The term exogenous as used herein refers to transferred cellular material (e.g., mitochondria) that is removed from one cell and transferred into another cell. For example,
OSC derived mitochondria that have been transferred into an oocyte, even if both are derived from the same subject, would be exogenous.
A subject is any live-bearing member of the class mammalia, including humans, domestic and farm animais, and zoo, sports or pet animais, such as mouse, rabbit, pig, sheep, goat, cattle and higher primates.
As used herein, the term “advanced maternai âge” as it relates to humans refers to a woman who is 34 years of âge or older. As used herein, the term “oocyte-related infertility” as it relates to humans refers to an inability to conceive after one year of unprotected intercourse which is not caused by an anatomical abnormality (e.g., blocked oviduct) or pathological condition (e.g., uterine fibroids, severe endometriosis, Type II diabètes, polycystic ovarian disease).
As used herein, the term “low ovarian reserve” as it relates to humans refers to a woman who exhibits a circulating Follicle Stimulating Hormone (FSH) level greater than 15 miu/ml in a “day 3 FSH test,” as described in Scott et al., Ferlility and Sterility, 1989 51:651-4, or a circulating Anti-Mullerian Hormone (AMH) level less than 0.6 ng/ml, or an entrai follicle count less than 7 as measured by ultrasound.
In this disclosure, “comprises,” “comprising,” “containing” and “having” and the like can have the meaning ascribed to them in U.S. Patent law and can mean “includes,” “including” and the like; “consisting essentially of' or “consists essentielly” likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.
The term “reduced” or “reduce” or “decrease” as used herein generally means a decrease of at least 5%, for example a decrease by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (i.e. substantially absent or below levels of détection), or any decrease between 5-100% as compared to a référencé level, as that term is defined herein, and as determined by a method that achieves statistical significance (p <0.05).
The term “increase” as used herein generally means an increase of at least 5%, for example an increase by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase (i.e. substantially above levels of détection), or any increase between 5-100% as compared to a référencé level, as that
A term is defined herein, and as determined by a method that achieves statisticai significance (p <0.05).
As used herein “an increase in ATP génération or production” refers to an amount of ATP production that is at least about 1-fold more than (for example 1, 2, 3,4, 5, 6, 7, 8,9, 10, 20, 30,40, 50, 60, 70, 80,90, 100, 1000, 10,000-fold or more) the amount of ATP production in a reference level, as that term is defined herein. ATP production can be measured by standard methods known in the art.
As used herein, “high ATP-generating capacity mitochondria refers to mitochondria having a high mitochondrial membrane potentiel, as determined by a probe which can disttnguish between high and low (or between high and medium/low) membrane potential. One method of identifying mitochondria with high mitochondrial membrane potential is the use of the fluorescent probe 5,5',6,6'-tetrachloro-l,r,3,3'-tetraethylbenzimidazolyl carbocyanine iodide (JC-1, Invitrogen T3168, Life Technologies Corp., Carlsbad, CA), which fluoresces red-orange (590 nm) in high quality mitochondria but fluoresces green (510-520 nm) in medium and/or low quality mitochondria. (See, e.g., Gamer et al., Bio. Reprod. 1997 57:1401-1406; Reers et al., Biochemistry 1991 30:4480-4486; Cossariza et al, Biochem Biophys Res Commun 1993 197:4045; Smiley et al„ Proc Natl AcadSci USA 1991 88:3671-3675).
As used herein, the term “standard” or reference” refers to a measured biological parameter including but not lîmited to defects such as aneuploidy, mutation, chromosomal misalignment, meiotic spindle abnormalities, and/or mitochondrial dysfonction (aggregatîon, impaired ATP production), or the réduction or élimination of such defects, in a known sample against which another sample is compared; alternat! vely, a standard can simply be a reference number that represents an amount of the measured biological parameter that defines a baseline for comparison. The reference number can be derived from either a sample taken from an individual, or a plurality of individuels or cells obtained therefrom (e.g., oocytes, OSCs). That is, the “standard” does not need to be a sample that is tested, but can be an accepted reference number or value. A sériés of standards can be developed that take into account an individual’s status, e.g., with respect to âge, gender, weight, height, ethnie background etc. A standard level can be obtained for example from a known sample from a different individual (e.g., not the individual being tested). A known sample can also be obtained by pooling samples from a plurality of individuals (or cells obtained therefrom) to produce a standard over an averaged population. Additionally, a standard can be synthesized such that a sériés of standards are used to quantify the biological parameter in an individual’s sample. A sample from the individual to be tested can be obtained at an earlier time point (presumably prior to the onset of treatment) and serve as a standard or reference compared to a sample taken from the same individual after the onset of treatment. In such instances, the standard can provide a measure of the efficacy of treatment. In spécifie embodiments, a “standard” or référencé” is an ovarian somatic cell (e.g., an aged-matched ovarian somatic cell obtained from a female subject having a functional reproductive system) or an aged-matched mesenchymal stem cell.
Ranges provided herein are understood to be shorthand for ail of the values within the range. For example, a range of l to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting I, 2, 3,4,5,6, 7,8, 9, 10,11, 12, 13, 14, 15, 16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38, 39,40,41, 42, 43,44,45,46,47,48,49, or 50.
Other définitions appear in context throughout this disclosure.
Compositions and Methods of the Invention
Isolation of OSCs
Adult ovarian cortical tissue can be obtained using a ininor laparoscopie procedure known in the art to collect a small (e.g., 3x3x1 mm) ovarian cortical biopsy, which is then processed for OSC isolation. See Gook et al., Human Reproduction, 2004 20( 1 ):72-78.
Isolation of human OSCs from adult ovarian cortical tissue can be performed as described in Example 1, Figure 1 or as previously described in the art, or using comparable techniques. See, for example, paragraph 0116 of U.S. Patent Pub. No. 20060010508, and Zou et al., Nature Cell Biology 2009 5:631 -6. Epub 2009 Apr 12. OSCs can also be obtained from nonovarian sources, such as bone marrow or peripheral blood. Bone marrow and peripheral blood derived OSCs can be isolated by standard means known in the art for the séparation of stem cells from, for example, the marrow or blood (e.g., cell sorting). Optionally, the isolation protocol includes génération of a kit+/lin- fraction that is depleted of hematopoietic cells. Additional sélection means based on the characteristic profile of gene expression in OSCs (e.g., Vasa, Oct4, Dazl, Stella, Fragilis) can be employed to further purify or isolate the desired population of cells and to reduce or eliminate other cells and material from the biological sample from which they were obtained (e.g. bone marrow, peripheral blood). For example, the methods described in Example 1, Figure lb hâve been applied to a mononuclear fraction of blood cells and bone marrow cells to obtain purified or isolated OSCs from non-ovarian sources. Briefly, cells were incubated with a rabbit anti-VASA antibody (abl3840; Abcam, Cambridge, MA) for 20 minutes, washed, and incubated with goat antî-rabbit IgG conjugated to allophcocyanin (APC) for 20 minutes, and washed again. Labeled cells in the eluate were isolated by fiuorescenceactivated cell sorting (FACS) using a BD Biosciences FACSAria II cytometer (Harvard Stem Cell Institute, Boston, MA), gated against négative (unstained and no primary antibody) controls. Propidium iodide was added to the cell suspension just prior to sorting for dead cell exclusion. Results obtained using cell surface expression of Vasa to isolate OSCs from non19 ovarian sources are provided in Figures 17 and 18, where the FACS-based germ cell purification of bone marrow and peripheral blood préparations from adult female mice during estrus of the female reproductive cycle is shown.
Préparation of OSC Derived Compositions and Methods of Transfer
Methods for the préparation and transfer of mitochondria are known in the art and can be carried out as previously described in the art, or using comparable techniques. See, for example, Perez et al., Cell Death andDifférentiation 2007 3:524-33. Epub 2006 Oct 13, and Perez et al., Nature 2000,403:500-1, the contents each of which are incorporated herein by reference. Briefly, OSCs can be isolated and cultured as described above. In one method, when OSC cultures reach 80% confluency, 2 ml of mitochondrial lysis buffer (0.3 M sucrose, 1 mM EDTA, 5 mM MOPS, 5 mM KH2PO4,0.1% BSA) is added to each plate, and the cells are removed using a cell scraper. The cell suspension is transferred into a small glass tissue douncer and homogenized until smooth (approximately 10 up-and-down strokcs), and the lysate is centrifuged at 600 g for 30 minutes at 4°C. The supematant is removed and spun at 10,000 g for 12 minutes at 4°C, and the resulting crude mitochondrial pellet is resuspended in 0.2 ml of 0.25 M sucrose. This sample is then layered over a 25-60% Percoll density gradient diluted with 0.25 M sucrose and centrifuged at 40,000 g for 20 minutes at 17°C. The interface band is extracted from the gradient and washed in 2 volumes of 0.25 M sucrose before a final centrifugation at 14,000 g for 10 min at 4°C to yield a mitochondrial pellet.
The mitochondrial pellet can also be prepared as described Frezza et al. Nature Protocols 2007 2:287-295, the contents of which are incorporated herein by reference. In spécifie embodiments of the invention, the total OSC-derived mitochondrial population in a tissue, cell, lysed cell, or fraction thereof can be isolated, characterized and/or enumerated using a FACS-based method with a fluorescent probe that specifically binds to mitochondria in a mitochondrial membrane potentiel (MMP)-independent manner. Fluorescent probes that specifically bind to mitochondria in a MMP-independent manner include, but are not limited to, accumulation dépendent probes (e.g., JC-1 (red spectrum; Invitrogen T3168, Life Technologies Corp., Carlsbad, CA), MitoTracker Deep Red FM (Invitrogen M22426, Life Technologies Corp., Carlsbad, CA) and JC-1 (green spectrum; Invitrogen T3168, Life Technologies Corp., Carlsbad, CA). Functional (e.g., respiring) mitochondria can be sorted and collected, preferably with exclusion of residual unlysed cells and non-functional mitochondria, based on size and fluorescence intensity using mitochondrial tracking probes that indicate mitochondrial mass including, but not limited to, non-oxidation dépendent probes (e.g., MitoTracker Green FM (Invitrogen M7514, Life Technologies Corp., Carlsbad, CA). Details ofan exemplary protocol for conducting FACS with a non-oxidation dépendent probe are provided below in Example 9.
Optionally, the FACS-based method can also be employed to selectively yield a substantially pure population of functional (e.g., respiring) mitochondria using a mitochondrial membrane fluorescent probe that specifically binds to mitochondria in a MMP-dependent manner. Fluorescent probes that specifically bind to mitochondria in a MMP-dependent manner include, but are not limited to, reduced oxidative state mitotracker probes (e.g., MitoTracker Red CMH2XRos (Invitrogen M7513, Life Technologies Corp., Carlsbad, CA) and MitoTracker Orange CM-H2TMRos (Invitrogen M7511, Life Technologies Corp., Carlsbad, CA). Furthermore, duallabeling using MMP-dependent and MMP-independent probes can be conducted to quantitate the ratio of functional to total mitochondria in a tissue, cell, lysed cell or fraction derived therefrom. In spécifie embodiments, the ratio is greater than about 0.02,0.025, 0.033, 0.04, 0.05, 0.1, or about 0.2. When using probes for differential screening based on MMP, spectral color is the major determining factor to designate functional mitochondria, and forward scatter can be used to distinguish the fluorescent mitochondria released from lysed cells from those still contained in residual unlysed cells.
Mitochondrial pellets can also be prepared as described by Taylor et al., Nat. Biotechnol. 2003 21(3): 239-40; Hanson et al., Electrophoresis. 2001 22(5): 950-9; and Hanson et al., J. Biol. Chem. 2001 276(19): 16296-301. In spécifie embodiments of the invention, the total OSCderived mitochondrial population in a tissue, cell, lysed cell, or fraction thereof can be isolated, characterized and/or enumerated using a differential centrifugation method such as that described herein at Example 10 or using a sucrose gradient séparation procedure such as that described herein at Example 11.
Following isolation, assessment of mitochondrial fonction or mtDNA integrity (e.g., mutations and délétions) can be conducted according to methods known in the art (Duran et al., Fertility and Sterility 2011 96(2):384-388; Aral et al., Genetics andMolecular Biology 2010 33:1-4; Chan et al., Molecular Human Reproduction 2005 11(12):843-846; Chen et al., BMC Medical Genetics 2011 12:8 and Example 8). Populations of mitochondria sorted according to functional parameters (e.g., MMP dependent/active or MMP-independent/active plus inactive) or mitochondria from less preferred OSC sources, including samples of limited size, can be now be obtained according to the methods of the invention. Mitochondrial compositions of the invention can generate, for example, about 1 pmol ATP per fg mtDNA to about 6 pmol ATP per fg mtDNA (e.g., about 1,2,3,4, 5, or 6 pmol ATP per fg mtDNA). In spécifie embodiments, between about 1.0 pmol to 1.4 pmol ATP per fg mtDNA is generated within about 10 minutes to about 15 minutes.
The percentage of mutations in a population of mitochondria can be assessed by first determining the number of mitochondria présent in a bioiogical sample and next, determining the copy number of mitochondrial DNA présent in the sample. Standard mutation analysis can /X be employed and compared to the number of mïtochondria and copy number of mitochondrial DNA to calculate the percentage of mutations in the population of mïtochondria. For example, compositions and methods of the invention can provide a population of mitochondria in which less than about 5% to about 25% (e.g., about 5%, 10%, 15%, 20% to about 25%) of the mitochondrial DNA comprises a délétion mutation within nucléotides 8470-13447 ofthe mitochondrial genome.
The material to be injected (e.g., mitochondrial suspension) is transferred to a microinjection needle according to methods known in the art. Microinjection needles and holding pipettes can be made using a Sutter puller (Sutter Instruments, Novato, CA, USA) and a De Fonbrune Microforge (EB Sciences, East Granby, CT, USA). The microinjection needles hâve inner diameters of 5 pm with blunt tips. The material to be injected is aspirated into the needle by négative suction. Between about lxl03 - to about 5x104 mitochondria from OSCs or their progeny can be injected (e.g., about 1, 2,3,4, 5, 6, 7, 8 to 9 x 103; about 1,1.1, 1.2, 1.3, 1.4, 1.5,1.6, 1.7, 1.8, 1.9, 2,2.1,2.2, 2.3,2.4,2.5, 2.6,2.7,2.8, 2.9,3,3.1,3.2,3.3,3.4, 3.5,3.6, 3.7, 3.8, 3.9,4,4.1,4.2,4.3, 4.4, 4.5, 4.6,4.7,4.8, 4.9 to about 5 x 104 mitochondria). The mitochondrial suspension in sucrose (e.g., 5-7 pl containing approximately lxl03 - 5x104 mitochondria from OSCs or their progeny) can be injected into oocytes using a Piezo micromanipulator. Oocytes that survive the microinjection procedure are transferred for culture and optionally, assessment or cryopreservation prior to in vitro fertilization or intrauterine insémination. Methods of oocyte cryopreservation are well known in the art. For details, see for example, Porcu et al., Molecular and Cellular Endocrinology 2000 169:33-37; Mandelbaum, Human Reproduction 2000 15:43-47; and Fabbri et al., Molecular and Cellular Endocrinology 2000 169:39-42, the contents of which are incorporated herein by reference.
Methods for the préparation and transfer of nuclear-free cytoplasmic fractions are known in the art and can be carried out as previously described. See, for example, Cohen et al., Mol Hum Reprod 1998 4:269-80, the contents of which are incorporated herein by reference. Briefly, in one method, approximately 4 hours after egg retrieval, récipient eggs are exposed to 0.1% hyaluronidase, and mature eggs are selected for injection. AU corona cells are removed with fine bore pipettes. Ooplasmic transfer can be performed by electrofusion of OSC ooplasts with intact Mil oocytes. After exposure to 0.1% hyaluronidase, zonae are opened mechanically using a microspear. OSCs are exposed to hHTF medium containing cytochalosin B (CCB; Sigma Chemical Co., St Louis, MO, USA) for 10 min at 37°C. Partitioning of human Mil oocytes involves variable cytochalasin B concentration depending on their sensitivity (—2.5 mg/ml). Ooplasts of various sizes are separated from OSCs by withdrawing a portion of the ooplasm enclosed in the plasma membrane. Alignment and electrofusion in a mannitol solution is performed after insertion of the OSC derived ooplast into the perivitelline space of the récipient egg from which the polar body was removed. This can be done with a wide-bored polished microtool -30-40 pm in diameter. The ooplast is sucked into the microtool and released once the tool îs placed deeply into the perivitellîne space. Oocytes that survive the electrofusion procedure are transferred for culture and optionally, assessment or cryopreservation prior to in vitro fertilization or intrauterine insémination.
Alternatively, conventional întracytoplasmic sperm injection (ICSI) methods can be employed in connection with the transfer of nuclear-ffee cytoplasmic fractions or isolated mitochondria. See, for example, Cohen et al., Mol Hum Reprod 1998 4:269-80, the contents of which are incorporated herein by reference. As one example, the zonae of the récipient eggs are opened mechanicaliy over the polar body area using a microspear. The polar body is removed after re-positioning the oocyte on the holding pipette in such a way that the zona can be dissected using the closed microspear. The same position is used to însert the ooplast -90° left of the area, which had contained the polar body. The zona is closed tight using the same tool. Eiectrofiised cells are washed and incubated in mHTF for 40-90 min prior to ICSI. Spermatozoa are immobilized in 10% polyvinylpyrrolidone (PVP) for ICSI. The procedure is performed in hHTF while the short side of the aperture is at approximately 3 o’clock. The ICSI tool is moved through the artificîal gap in order to avoid extrusion of ooplasm upon indentation of the zona during standard ICSI. Methods of in vitro fertilization are well known in the art. Couples are generally first evaluated to diagnose their partîcular infertility problem(s). These may range from unexplained infertility of both partners to severe problems of the female (e.g., endometriosis resulting in nonpatent oviducts with irregular menstrual cycles or polycystic ovarian disease) or the male (e.g., low sperm count with morphological abnormalities, or an inability to ejaculate normally as with spinal cord lésions, rétrogradé éjaculation, or reversed vasectomy). The results of these évaluations also détermine the spécifie procedure to be performed for each couple.
Procedures often begin with the administration of a drug to down-regulate the hypothalamic/pituitary system (GnRH agonist). This process decreases sérum concentrations of the gonadotropins, and developing ovarian follicles degenerate, thereby providing a set of new follicles at earlier stages of development. This permits more précisé control of the maturation of these new follicles by administration of exogenous gonadotropins in the absence of influences by the hypothalamic pituitary axis. The progress of maturation and the number of growing follicles (usually four to ten stimulated per ovary) are monitored by daily observations using ultrasound and sérum estradiol déterminations. When the follicles attain preovulatory size (l 8-21 mm) and estradiol concentrations continue to rise linearly, the ovulatory response is initiated by exogenous administration of human chorionic gonadotropins (hCG).
Following the transplantation procedure, individual oocytes can be evaluated morphologically and transferred to a pétri dish containing culture media and heat-inactivated sérum. A semen sample is provided by the male partner and processed using a swim up procedure, whereby the most active, motile sperm will be obtained for insémination. If the female's oviducts are présent, a procedure called GIFT (gamète intrafallopian transfer) can be performed at this time. By this approach, oocyte-cumulus complexes surrounded by sperm are placed directly into the oviducts by laparoscopy. This procedure best simulâtes the normal sequences of events and permits fertilisation to occur within the oviducts. Not surprisingly, GIFT has the highest success rate with 22% of the 3,750 patients undergoing ova retrieval in 1990 having a live delivery. An alternative procedure ZIFT (zygote intrafallopian transfer) permits the sélection of in vitro fertilized zygotes to be transferred to oviducts the day following ova retrieval. Extra zygotes can be cryopreserved at this time for future transfer or for donation to couples without female gametes. Most patients having more serious infertility problems, however, will require an additional one to two days incubation in culture so that preimplantation embryos in the early cleavage states can be selected for transfer to the utérus or oviduct. This IVF-UT (in vitro fertîlization uterine transfer) procedure entails the transcervical transfer of several 2-6 cell (day 2) or 8-16 (day 3) preimplantation embryos to the fundus ofthe utérus (4-5 preimplantation embryos provides optimal success).
Procedures for in vitro fertîlization are also described in U.S. Pat. Nos., 6,610,543
4,326,505,4,193,392,4,062,942, and 3,854,470, the contents of which are specifically incorporated by reference for their description of these procedures.
Altematively, patients may elect to hâve the oocyte comprising exogenous, autologous OSC mitochondria reimplanted and fertilized in vivo using Intrauterine Insémination (IUI). IUI is a well known process that involves preparing and delivering a highly concentrated amount of active motile sperm directly through the cervîx into the utérus. There are several techniques available for preparing the sperm for IUI. First, sperm is separated from séminal fluid. One method of sperm séparation is known as “Density Gradient Séparation”. In this technique, motile sperm are separated from dead sperm and other cells through the use of viscous solution. After préparation, the sperm concentrate is placed through the cervix into the utérus by using a thin, flexible cathéter and fertîlization of the reimplanted oocyte follows.
The présent invention is additionally described by way of the following illustrative, nonlimiting Examples that provide a better understanding of the présent invention and of its many advantages.
EXAMPLES
Herein, validated protocols are employed to demonstrate that OSCs can be reliably isolated from tissues of healthy young women and propagated in vitro for use in subséquent clinical procedures. The following examples are put forth for illustrative purposes only and are not intended to limit the scope of what the inventors regard as their invention.
Example 1: FACS-based Protocol forOSC Isolation
The VASA antibody used by Zou et al., Nat Cell Biol 2009 11:631-636 to îsolate mouse OSCs by immunomagnetic sorting is a rabbit polyclonal agaînst the last 25 amino acids of the COOH-terminus of human VASA (DDX4) (ab!3840; Abcam, Cambridge, MA). This région shares 96% overall homology with the corresponding région of mouse VASA (MVH). For comparative studies, a goat polyclonal antibody against the first 145 amino acids of the NH2terminus of human VASA (AF2030; R&D Systems, Minneapolis, MN) was used, which shares 91% overall homology with the corresponding région of mouse VASA.
Immunofluorescence analysis of young adult (2-month-oId) mouse ovaries using either antibody showed an identical pattern of VASA expression that was restricted, as expected, to oocytes (Figure la). Each antibody was then used for immunomagnetic sorting of dispersed young adult mouse ovary tissue (Zou et al., Nat Cell Biol 2009 11:631-636). For each préparation of cells, ovaries from 4 mice were pooled and dîssociated by mincing followed by a two-step enzymatic digestion involving a 15-minute incubation with 800 U/ml collagénase [type ÎV; prepared in Hank’s balanced sait solution minus calcium and magnésium (HBSS)] followed by a 10-minute incubation with 0.05% trypsin-EDTA. Digestions were carried out in the presence of I μ g/ mi DNase-I (Sigma-Aldrich, St. Louis, MO) to minimize stickiness within the cell préparations, and trypsin was neutralized by addition of 10% fêtai bovine sérum (FBS; Hyclone, ThermoFisher Scientific, Inc.,Waltham, MA). Ovarian dispersâtes were filtered through a 70-pm nylon mesh and blocked in a solution composed of 1% fatty-acid free bovine sérum albumin (BSA; Sigma-Aldrich, St. Louis, MO) with either 1% normal goat sérum (EMD Millipore, Billerica, MA; for subséquent reactions using ab!3840 against VASA-COOH) or 1% normal donkey sérum (Sigma-Aldrich, St. Louis, MO; for subséquent reactions using AF2030 against VASA-NH2) in HBSS for 20 minutes on îce. Cells were then reacted for 20 minutes on ice with a 1:10 dilution of VASA antibody that recognizcs either the COOH terminus (abl3840) or NH2 terminus (AF2030). Afterwards, cells were washed 2 times in HBSS and incubated for 20 minutes on ice with a 1:10 dilution of either goat anti-rabbit IgG-conjugated microbeads (Miltenyi, Gladbach, Germany; ab!3840 détection) or biotin-conjugated donkey anti-goat IgG (Santa Cruz Biotechnology, Santa Cruz, CA; AF2030 détection) followed by incubation with streptavidin-conjugated microbeads (Miltenyi; Gladbach, Germany). After one additional wash in HBSS, the cell préparations were loaded onto MACS columns and separated according to manufacturées spécifications (Miltenyi, Gladbach, Germany). For experiments to visualize potential antibody-bead interaction with individual oocytes, adult female mice were superovulated by injection of prégnant mare sérum gonadotropin (PMSG, 10 IU; Sigma-Aldrich, St. Louis, MO) followed by human chorionic gonadotropin (hCG, 10 IU; Sigma-Aldrich, St. Louis, MO) 46-48 hours later. Oocytes were collected from oviducts 15-16 hours after hCG injection, denuded of cumulus cells using hyaluronidase (Irvine Scientific, Santa Ana, CA) and washed with human tubal fluid (HTF; Irvine Scientific, Santa Ana, CA) supplemented with BSA. Dispersed ovarian cells or îsolated oocytes were blocked and incubated with primary antibodies against VASA as described above. After washing in HBSS, cells were reacted with species-appropriate secondary antibodies conjugated to 2.5-μιη Dynabeads (Invitrogen, Life Technologies Corp., Carlsbad, CA). Suspensions were placed into 1.5 ml Eppendorf tubes for séparation using a Dynal MPC*-S Magnetic Particle Concentrator (Dynal Life Technologies Corp., Carlsbad, CA).
No cells were obtained in the bead fraction when the VASA-NH2 antibody was used; however, 5-8 pm cells bound to the magnetic beads were observed when the VASA-COOH antibody was used (Figure Ib). Analysis of these cells revealed a germline gene expression pattern consistent with that reported for OSCs isolated previously by Zou et al., Nat Cell Biol 2009 11:631-636 using immunomagnetic sorting (Figure 2). Although isolated oocytes assessed in parallel using the VASA-COOH antibody were always detected in the non-immunoreactive wash fraction (Figure lb), additional marker analysis of the VASA-positive cell fraction obtained by immunomagnetic sorting revealed several oocyte-specific mRNAs including Nobox, Zp3 and Gdf9 (Figure 2). These findings indicate that while oocytes do not exhibit cell surface expression of VASA when analyzed as individual entities (Figure lb), oocytes are nonetheless a contaminating cell type following immunomagnetic sorting of OSCs from dispersed ovary tissue. This outcome most likely reflects either a non-speciftc physical carry-over of oocytes during the bead centrifugation steps or reactivity of cytoplasmic VASA in plasma membranecompromised (damaged) oocytes with the COOH antibody. Either case would be alleviated by use of FACS.
The reactivity of each antibody with dispersed mouse ovarian cells was next assessed by FACS. For each experiment, ovarian tissue (mouse: 4 ovaries pooled; human: 10 X 10 X I mm thick, cortex only) was dissociated, blocked and reacted with primary antibody (abl3840 for VASA-COOH or AF2030 for VASA-NH2) as described above. After washing with HBSS, cells were incubated with a 1:500 dilution of goat anti-rabbit IgG conjugated to Alexa Fluor 488 (Invitrogen, Life Technologies Corp., Carlsbad, CA; ab!3840 détection) or donkey anti-goat IgG conjugated to Alexa Fluor 488 (Invitrogen, Life Technologies Corp., Carlsbad, CA; AF2030 détection) for 20 minutes on îce, and washed with HBSS. Labeled cells were then filtered again (35-μιη pore diameter) and sorted by FACS using a FACSAria II cytometer (BD Biosciences, Becton Dickinson and Company, Franklin Lakes, NJ; Harvard Stem Cell lnstitute), gated against négative (unstained and no primary antibody) controls. Propidium iodide was added to the cell suspension just prior to sorting for dead cell exclusion. Freshly-isolated VASA-positive viable cells were collected for gene expression profiling, assessment of teratoma formation capacity or in vitro culture. For some experiments, cells were fixed in 2% neutrel-buffered paraformaldéhyde (PFA) and permeabilized with 0.1% Triton-XlOO prior to reaction with primary antibody against the NH2 terminus of VASA (AF2030) and détection by FACS after reaction with donkey anti-goat IgG conjugated to Alexa Fluor 488. For re-sort experiments, viable cells were reacted with VASA-COOH antibody (ab13840) and sorted by FACS after reaction with a goat anti-rabbit IgG conjugated to allophcocyanin (APC) (Jackson Immunoresearch Laboratories, Inc., West Grave PA). Résultant APC-positive (VASA-COOH positive) viable cells were then either left intact or fixed and permeabilized prior to incubation with VASA-NH2 antibody (AF2030), followed by incubation with donkey anti-goat IgG conjugated to Alexa Fluor 488 and FACS analysis.
In agreement with the magnetic bead sorting results, viable VASA-positive cells were obtained only when the COOH antibody was used (Figure le). However, if the ovarîan cells were permeabilized prior to FACS, a VASA-positive cell population was obtained using the NH2 antibody (Figure le). Furthermore, if the viable VASA-posîtîve cells isolated by FACS using the COOH antibody were permeabilized and re-sorted, the same cell population was recognized by the VASA-NH2 antibody (Figure Id). As a final means to confirm validity of this OSC isolation method, fractions of cells at each step of the protocol were assessed by gene expression analysis using a combination of markers for germ cells (BltmpHPrdml, Stella!Dppa3, Fragilis!Ifitm3t Tert, Vasa, DazI) and oocytes (Nobox, Zp3, GdJ9). To obtain cells for FACS, ovarîan tissue was minced and enzymatically digested using collagénase and trypsin, passed through a 70-μπι filter to remove large tissue clumps, and then passed through a 35-pm filter to obtain a final fraction of cells. Every fraction of cells through each step of the protocol, with the exception of the VASA-positive viable cell fraction obtained by FACS, expressed ail germline and oocyte markers (Figure If). While the FACS-sorted VASA-positive cell fraction expressed ail germline markers, no oocyte markers were detected (Figure lf). Thus, unlike the oocyte contamination observed when OSCs are isolated by immunomagnetic sorting using the VASA-COOH antibody (see Figure 2), use of this.same antibody with FACS provides a superior strategy to obtain adult ovary-derived OSC fractions free of oocytes.
Exemple 2: Isolation of OSCs From Human Ovaries
With written informed consent, ovaries were surgically removed from 6 female patients between 22—33 (28.5 ± 4.0) years of âge with Gender Identity Disorder for sex reassignment at Saitama Medical Center. The outer cortical layer was carefully removed, vitrifîcd and cryopreserved (Kagawa et al., Reprod. Biomed. 2009 Online 18:568-577; Figure 12). Briefly, l mm-thick cortical fragments were eut into 100-mm2 (10 X 10 mm) pièces, incubated in an équilibration solution containing 7.5% ethylene glycol (EG) and 7.5% dimethylsulfoxide (DMSO) at 26° C for 25 minutes, and then incubated in a vitrification solution containing 20% EG, 20% DMSO and 0.5 M sucrose at 26° C for 15 minutes prior to submersion into liquid nitrogen. For experimental analysis, cryopreserved ovarian tissue was thawed using the Cryotissue Thawing Kit (Kitazato Biopharma, Fuji City, Shizuoka, Japan) and processed immediately for histology, xenografting or OSC isolation. Using the COOH antibody, viable VASA-positive cells between 5-8 pm in diameter were also consistently isolated by FACS from human ovarian cortical tissue biopsies of ail patients between 22-33 years of âge, with a percent yield (1.7% ± 0.6% VASA-positive versus total viable cells sorted; mean ± SEM, n = 6) that was comparable to the yield of OSCs from young adult mouse ovaries processed in parallel ( 1.5% ± 0.2% VASA-positive versus total viable cells sorted; mean ± SEM, n = 15). This percent yield is the incidence of these cells in the final pool of viable single cells sorted by FACS, which représente a fraction of the total number of cells présent in ovaries prior to processing. To estimate the incidence of OSCs per ovary, the genomic DNA content per ovary of 1.5-2 monthold mice was determined (1,774.44 ± 426.15 pg; mean ± SEM, n = 10) and divided into genomic DNA content per fraction of viable cells sorted per ovary (16.41 ± 4.01 pg; mean ± SEM, n = 10). Assuming genomic DNA content per cell is équivalent, how much of the total ovarian cell pool is represented by the total viable sorted cell fraction obtained after processing was determined. Using this correction factor, the incidence of OSCs per ovary was estimated to be 0.014% ± 0.002% [0.00926 X (1.5% ± 0.2%)]. With respect to OSC yield, this number varîed across replicates but between 250 to slightly over 1,000 viable VASA-positive cells per adult ovary were consistently obtained after FACS of dispersâtes initially prepared from a pool of 4 ovaries.
Analysis of freshly-isolated VASA-positive cells from both mouse and human ovaries (Figure 3a, 3b) revealed a similar size and morphology (Figure 3c, 3d), and a matched gene expression profile rich in markers for early germ cells (Saitou et al., Nature 2002 418:293—300; Ohinata et al., Nature 2005 436:207—213; Dolci et al., Cell Sci. 2002 115:1643-1649) (Blimpl, Stella, Fragilis and Tert\ Figure 3e). These résulte agréé with the morphology and gene expression profile of mouse OSCs reported in the scientific literature (Zou et al., Nat Cell Biol
2009 11:631-636, Pacchiarotti et al., Différentiation 2010 79:159-170).
To further define characteristic features of VASA-positive cells obtained from adult ovaries, mouse OSCs were tested using an in vivo teratoma formation assay. This was important since a recent study has reported the isolation of Oc/3/V-positivc stem cells from adult mouse ovaries that possess the teratoma-forming capacity of embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) (Gong et al., Fertil. Steril. 2010 93:2594-2601). Ovaries were collected from a total of 100 young adult female mice, dissociated and subjected to FACS for isolation of VASA-COOH positive viable cells, as described above. Freshly isolated mouse OSCs were injected subcutaneously near the rear haunch of NOD/SCID female mice (1xl0s cells injected per mouse). As a contreI, mouse embryonic stem cells (mESC v6.5) were injected into age-matched female mice in parai Ici (1x105 cells injected per récipient mouse). Mice were monitored weekly for up to 6 months for tumor formation.
As expected, 100% of the mice transplanted with mouse ESCs used as a positive control developed teratomas within 3 weeks; however, no teratomas were observed in mice transplanted in parallel with VASA-positive cells isolated from adult mouse ovaries, even at 24 weeks posttransplant (Figures 3f-k). Thus, while OSCs express numerous stem cell and primitive germ cell markers(Zou et al., Nat Cell Biol 2009 11:631-636, Pacchiarotti et al., Différentiation 2010 79:159-170; see also Figure 1 f and Figure 3e), these cells are clearly distinct from other types of pluripotent stem cells described to date.
Example 3: Génération of Oocytes from FACS-purified mouse OSCs
The ability of FACS-purified mouse OSCs, engineered to express GFP through retroviral transduction (after their establishment as actively-dividing germ cell-only cultures in vitro) to generate oocytes following transplantation into ovaries of adult female mice was assessed. To ensure the outcomes obtained were reflective of stable intégration of the transplanted cells into the ovaries and also were not complicated by pre-transplantation induced damage to the gonads, 1x104 GFP-expressing mouse OSCs were injected into ovaries of nonchemotherapy conditioned wild-type récipients at 2 months of âge and animais were maintained for 5-6 months prior to analysis. Between 7-8 months of âge, transplanted animais were induced to ovulate with exogenous gonadotropins (a single intraperitoneal injection of PMSG (10 IU) followed by hCG (10 IU) 46-48 hours later), after which their ovaries and any oocytes released into the oviducts were collected. Ovulated cumulus-oocyte complexes were transferred into HTF supplemented with 0.4% BSA, and assessed by direct fluorescence microscopy for GFP expression. Developing follicles containing GFP-positive oocytes were readily détectable, along with follicles containing GFP-negative oocytes, in ovaries of females that received GFPexpressing mouse OSCs initially purified by FACS (Figure 4a).
After oviductal flushing, complexes containing expanded cumulus cells surrounding centrally-located oocytes both lacking and expressing GFP were observed. Mixing of these complexes with sperm from wild-type males resulted in fertilization and development of preimplantation embryos. For in vitro fertilization (IVF), the cauda epididymides and vas deferens were removed from adult wild-type C57BL/6 male mice and placed into HTF medium supplemented with BSA. Sperm were obtained by gently squeezing the tissue with tweezers, capacitated for l hourat 37’ C, and then mîxed with cumulus-oocyte complexes (l-2 x ÎO6 sperm/ml in HTF medium supplemented with BSA) for 4-5 hours. Inseminated oocytes were then washed of sperm and transferred to fresh medium. At 4-5 hours post-insemination, oocytes (fertilized and unfertilized) were transferred to 50 μΙ drops of KSOM-AA medium (Irvine Scientific, Santa Ana, CA), and the drops were covered with minerai oil to support further preimplantation embryonic development. Light and fluorescence microscopie examînation was performed every 24 hours for a total of 144 hours to monitor embryo development to the hatching blastocyst stage (Selesniemi et al., Proc. Natl. Acad. Sci. USA 2011 108:12319-12324). Ovarian tissue harvested at the time of ovulated oocyte collection from the oviducts was fixed and processed for immunohistochemical détection of GFP expression using a mouse monoclonal antibody against GFP (sc9996; Santa Cruz Bîotechnology, Santa Cruz, CA) along with the MOM™ kit (Vector Laboratories, Burlingamc, CA), as detailed previously (Lee et al,, J. Clin. Oncol. 2007 25:3198-3204). Ovaries from non-transplanted wild-type female mice and from TgOG2 transgenic female mice served as négative and positive controls, respectively, for GFP détection.
Preimplantation embryos derived from fertilized GFP-positive eggs retained GFP expression through the hatching blastocyst stage (Figure 4b-d). From the 5 adult wild-type female mice transplanted with GFP-expressing OSCs 5-6 months earlier, a total of 31 cumulusoocyte complexes were retrieved from the oviducts, 23 of which successfully fertilized to produce embryos. The presence of cumulus cells around each oocyte made it impossible to accurately détermine the numbers of GFP-negative versus GFP-positive oocytes ovulated, However, évaluation of the 23 embryos produced following in vitro fertilization (IVF) revealed that 8 were GFP-positive, with ail 5 mice tested releasing at least one egg at ovulation that fertilized to produce a GFP-positive embryo. These fîndings indicate that OSCs isolated or purified by VASA-COOH antibody-based FACS, like their previously reported counterparts isolated by immunomagnetic sorting(Zou et al., Nat Cell Biol 2009 11:631-636), generate functional oocytes in vivo. However, our data also show that chemotherapy conditioning prior to transplantation is not, as previously reported (Zou et al., Nat Cell Biol 2009 11 ;631-636), required for OSCs to engraft and generate functional oocytes in adult ovary tissue.
Exemple 4: In vitro Characterization of Candidate Human OSCs
Using parameters described previously for in vitro propagation of mouse OSCs (Zou et al., Nat Cell Biol 2009 11:631-636), adult mouse and human ovary-derived VASA-positive cells were placed into defined cultures with mitotically-inactive mouse embryonic fibroblasts (MEFs) as feeders. Briefly, cells were cultured in MEMa (Invitrogen, Life Technologies Corp., Carlsbad, CA) supplemented with 10% FBS (Hyclone, ThermoFisher Scientific, Inc., Waltham, MA), l mM sodium pyruvate, l mM non-essential amino acids, l X-concentrated penicillinstreptomycin-glutamine (Invitrogen, Life Technologies Corp., Carlsbad, CA), 0.1 mM βmercaptoethanol (Sigma, St. Louis, MO), I X-concentrated N-2 supplément (R&D Systems, Minneapolis, MN), leukemia inhibitory factor (LIF; 103 units/ml; EMD Millîpore, inc., Billerica, MA), 10 ng/ml recombinant human epidermal growth factor (rhEGF; Invitrogen, Life Technologies Corp., Carlsbad, CA), 1 ng/ml basic fibroblast growth factor (bFGF; Invitrogen, Life Technologies Corp., Carlsbad, CA), and 40 ng/ml glial cell-derived neurotropic factor (GDNF; R&D Systems, Minneapolis, MN), Cultures were reffeshed by the addition of 40-80 μΐ of new medium every other day, and cells were re-plated on fresh MEFS every two weeks. To assess prolifération, MEF-free OSC cultures were treated with 10 μΜ BrdU (Sigma-Aldrich, St. Louis, MO) for 48 hours prior to fixation in 2% PFA for dual immunofluorescence-based détection of BrdU incorporation (mitotically-active cells) and VASA expression (germ cells), as described (Zou et al., Nat Cell Biol 2009 11:631-636). No signal was detected if primary antibodies were omitted or replaced with an équivalent dilution of normal rabbit sérum (not shown).
Freshly-isolated OSCs could be established as clonal lines, and the colony formation efficïency for human OSCs not seeded onto MEFs ranged from 0.18% to 0.40%. Accurate assessment of colony formation efficïency could not be performed using MEFs as initial feeders, the latter of which greatly facilitâtes establishment of mouse and human OSCs in vitro. After 10-12 weeks (mouse) or 4-8 weeks (human) in culture, actively-dividing germ cell colonies became readily apparent (Figure 5). Once established and proliferating, the cells could be reestablished as germ cell-only cultures in the absence of MEFs without loss of proliférative potential. Dual analysis of VASA expression and bromodeoxyuridine (BrdU) incorporation in MEF-free cultures revealed large numbers of double-positive cells (Figure 6a-d), confirming that adult mouse and human ovary-derived VASA-positive cells were actively dividing. At this stage, mouse cells required passage at confluence every 4-5 days with cultures split 1:6-l :8 (estimated doubling time of 14 hours; Figure 6e). The rate of mouse OSC prolifération was approximately 2-3 fold higher than that of human germ cells maintained in parallel, the latter of which required passage at confluence every 7 days with cultures split 1:3-1:4. Cell surface expression of VASA remaîned détectable on the surface of more than 95% of the cells after (Z months of propagation (Figure 6f). The remaining cells not detcctcd by FACS using the VASACOOH antibody were large (35-50 pm in diameter) spherical cells spontaneously produced by mouse and human OSCs during culture, which exhibited cytoplasmic expression of VASA and are described in detail in Example 5.
Gene expression analysis of the cultured cells confirmed maintenance of early germline markers (Figure 6g). Several oocyte-specific markers were also detected in these cultures. Levels of mRNA were assessed by RT-PCR using a SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen, Life Technologies Corp., Carlsbad, CA) and Platinum Taq polymerase (Invitrogen, Life Technologies Corp., Carlsbad, CA). Ail products were sequenced to confirm identity.
Sequences of forward and reverse primers used, along with GenBank accession numbers of the corresponding genes, are provided in Table l (mouse) and Table 2 (human).
Table 1. PCR primers used to analyse eene expression in mouse cell and tissue samples.
Gene Accession No. Primer sequences(5’ to 3’; F, forward; R, reverse) 1 Size (bp)
Blimpl NM 007548 F CGGAAAGCAACCCAAAGCAATAC 483
R CCTCGGAACCATAGGAAACATTC
Stella NM 139218 F CCCAATGAAGGACCCTGAAAC 354
R AATGGCTCACTGTCCCGTTCA
Fragilis NM 025378 F GTTATCACCATTGTTAGTGTCATC 151
R AATGAGTGTTACACCTGCGTG
Tert NM 009354 F TGCCAATATGATCAGGCACTCG 305
R ACTGCGTATAGCACCTGTCACC
Vasa NM 001145885 F GGAAACCAGCAGCAAGTGAT 213
R TGGAGTCCTCATCCTCTGG
Dazl NM 010021 F GTGTGTCGAAGGGCTATGGAT 328
R ACAGGCAGCTGATATCCAGTG
Msy2 NM 016875 F CCTCCCCACTTTCCCATAAT 235
R AATGGGTGGGGAAGAAAAAC
Sycp3 NM 011517 F AGCAGAGAGCTTGGTCGGG 100
R TCCGGTGAGCTGTCGCTGTC
mcl NM 010059.2 F CTCACGCTTCCACAACAAGA 81
R TCTCGGGGCTGTCATAAATC
Nobox NM 130869 F CCCTTCAGTCACAGTTTCCGT 379
R GTCTCTACTCTAGTGCCTTCG
Lhx8 NM 010713 F CGTCAGTCCCAACCATTCTT 157
R TTGTTGGTGAGCATCCATGT
Gdfi NM 008110 F TGCCTCCTTCCCTCATCTTG 709
R CACTTCCCCCGCTCACACAG
Zpl NM 009580 F GTCCGACTCCTGCAGAGAAC 208
R TGATGGTGAAGCGCTGATAG
Zp2 NM 011775 F AAGGTCTTGAGCAGGAACGA 152
R GGGTGGAAAGTAGTGCGGTA
Zp3 NM 011776 F CCGAGCTGTGCAATTCCCAGA 183
R AACCCTCTGAGCCAAGGGTGA
β-actin NM 007393 F GATGACGATATCGCTGCGCTG 440
R GTACGACCAGAGGCATACAGG
Table 2. PCR primera used to analyste gene expression in human ccll and tisane sam pies.
Gene Accession riumbcr Primer sequences (5* to 3’; F, forward; R, reverse) Size (bp)
Blimpl NM 001198 F: AAACATGACCGGCTACAAGACCCT 332
R: GGCACACCTTGCATTGGTATGGTT
Stella NM 199286 F: AGCAGTCCTCAGGGAAATCGAAGA 276
R: TATGGCTGAAGTGGCTTGGTGTCT
Fragilis NM 021034 F: ATGTCGTCTGGTCCCTGTTC 205
R: GGGATGACGATGAGCAGAAT
Tert NM 198253 F: AGACGGTGTGCACCAACATCTACA 271
R: TGTCGAGTCAGCTTGAGCAGGAAT
Vasa NM 024415 F: TTGTTGCTGTTGGACAAGTGGGTG 283
R: GCAACAAGAACTGGGCACTTTCCA
Dazl NM 001190811 F: TCGAACTGGTGTGTCCAAAGGCTA 260
R: TAGGATTCATCGTGGTTGTGGGCT
Msy2 NM 015982 F: ACCCTACCCAGTACCCTGCT 248
R: GCAAGAAAAGCAACCAGGAG
Sycp3 NM 001177949 F: TATGGTGTCCTCCGGAAAAA 238
R: AACTCCAACTCCTTCCAGCA
Nobox NM 001080413 F: ATAAACGCCGAGAGATTGCCCAGA 375
R: AAGTCTGGTCAGAAGTCAGCAGCA
Lhx8 NM 001001933 F: CAAGCACAATTTGCTCAGGA 230
R: GGCACGTAGGCAGAATAAGC
Gdf9 NM .005260 F: TCACCTCTACAACACTGTTCGGCT 344
R: AAGGTTGAAGGAGGCTGGTCACAT
Zpl NM 207341 F: CGCCATGTTCTCTGTCTCAA 219
R: CGTTTGTTCACATCCCAGTG
Zp2 NM 003460 F: TCTTCTTCGCCCTTGTGACT 217
R: CTCAGGGTGAGCTTTTCTGG
Zp3 NM 001110354 F: AGCAGGACCCAGATGAACTCAACA 274
R: AAGCCCACTGCTCTACTTCATGGT
β-actin NM 001101 F: CATGTACGTTGCTATCCAGGC 250
R: CTCCTTAATGTCACGCACGAT
To extend the mRNA analyses of Blimpl, Stella and Fragilis, immunofluorescence analysis of these three classic primitive germline markers was performed (Saitou et al., Nature
2002 418:293-300; Ohinata et al.. Nature 2005 436:207-213). For analysis of cultured OSCs, cells were washed with IX-concentrated phosphate-buffered saline (PBS), fixed in 2% PFA for 45 minutes at 20* C, washed 3 times with PBS-T (PBS containing 0.01% Triton-Xl 00) and incubated for 1 hour at 20* C in blocking buffer (PBS containing 2% normal goat sérum and 2% BSA). The cells were then incubated for 1 hour at 20' C with a 1:100 dilution of one of the following primaiy antibodies: a biotinylated mouse monoclonal against BLIMP1 (ab81961, Abcam, Cambridge, MA), a rabbit polyclonal against STELLA (abl 9878; Abcam, Cambridge, MA) or a rabbit polyclonal against FRAGILIS (mouse: abl 5592, human: ab74699; Abcam, Cambridge, MA). Cells were washed and incubated for 30 minutes at 20* C with a 1:500 dilution cX of streptavidin-conjugated Alexa Fluor 488 (Invitrogen, Life Technologies Corp., Carlsbad, CA; BLIMPl détection) or goat anti-rabbit IgG conjugated to Alexa Fluor 488 (STELLA and FRAG1LIS détection) in the presence of rhodamine-phalloidin (Invitrogen, Life Technologies Corp., Carlsbad, CA). Cells were washed, incubated with 4',6-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma-Aldrich, St. Louis, MO) and washed 3 additional times before imaging. No signal was detected if primary antibody was omitted or replaced with normal sérum (not shown).
For assessment of oocytes generated in vitro by mouse and human OSCs, individual oocytes were collected from culture supematants, washed, fixed with 2% PFA containing 0.5% BSA for 45 minutes at 37’ C, washed and blocked for I hour at 20’ C in PBS containing 0.5% BSA and either 5% normal goat sérum (VASA or LHX8 détection) or l% normal donkey sérum (c-K.1T détection). After blocking, oocytes were incubated for 2 hours at 20’ C with a 1: 100 dilution (in PBS with 0.5% BSA) of one of the following primary antîbodies: a goat polyclonal against c-KIT (sel494, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), a rabbit polyclonal against VASA (abl3840, Abcam, Cambridge, MA) or a rabbit polyclonal against LHX8 (ab41519, Abcam, Cambridge, MA). Cells were then washed and incubated with a l :250 dilution of goat anti-rabbit IgG conjugated to Alexa Fluor 568 (Invitrogen, Life Technologies Corp., Carlsbad, CA; VASA détection) or Alexa Fluor 488 (LHX8 détection), or a l :250 dilution of donkey anti-goat IgG conjugated to Alexa Fluor 488 (c-KIT détection). Cells were washed, incubated with DAPI and washed 3 additional times before imaging. No signal was detected if primary antibody was omitted or replaced with normal sérum.
For these latter experiments, détection of oocyte-specific expression of VASA, c-KIT and, for human ovaries, LHX8 in ovarian tissue sections served as a positive control. Mouse and human ovarian tissue was fixed in 4% PFA, parafïm-embedded and sectioned (6-pm) prior to high température antigen retrieval using 0.01 M sodium citrate buffer (pH 6.0). After cooling, sections were washed and blocked for l hour at 20’ C using TNK buffer (0.1 M Tris-HCl, 0.55 M NaCI, 0.1 mM KCL, 0.5% BSA, and 0.1% Triton-Xl00 in phosphate-buffered saline) containing either l% normal goat sérum (VASA-COOH or LHX8 détection) or l% normal donkey sérum (VASA-NH2 or c-KIT détection). Sections were then incubated with a 1:100 dilution of primary antibody (in TNK buffer with 1% normal sérum) ovemight at 4* C, washed in PBS, and incubated for 30 minutes at 20 C with a 1:500 dilution of goat anti-rabbit IgG conjugated to Alexa Fluor 568 (VASA-COOH détection in human ovaiy), goat anti-rabbit IgG conjugated to Alexa Fluor 488 (détection of VASA-COOH in mouse ovary or LHX8) or donkey anti-goat IgG conjugated to Alexa Fluor 488 (c-KIT or VASA-NH2 détection). After washing with PBS, sections were cover-slipped using Vectashield containing DAPI (Vector Labs). No signal was detected if primary antibody was omitted or replaced with normal sérum.
Ail three proteins were easily and unîformly detected in mouse (Figure 6h) and human (Figure 6i) OSCs maintained in vitro. Notably, détection of FRAGILIS in these cells agréés with a recent study reporting that this protein can also be used to îsolate OSCs from mouse ovaries by immunomagnetic bead sorting(Zou et al., Stem Cells Dev. 2011 doi: I0.l089/scd.20l l .0091). Example 5: In vitro Oogenic Capacity of Candidate Human OSCs
Consistent with results from others(Pacchiarotti et al., Différentiation 2010 79:159-170), mouse OSCs cultured in vitro spontaneously generated large (35-50 pm in diameter) spherical cells that by morphology (Figure 7a) and gene expression analysis (Figure 7b, c) resembled oocytes. Peak levels of m vitro oogenesis from mouse OSCs were observed within 24-48 hours after each passage (Figure 7d), followed by a progressive décliné to nearly non-detectable levels each time OSCs regained confluence. Parallel analysis of VASA-positive cells isolated from adult human ovaries and maintained in vitro revealed that these cells, like mouse OSCs, also spontaneously generated oocytes as deduced from both morphological (Figure 7f) and gene expression (Figure 7c, g) analyses. The kinetîcs of in vitro oogenesis from human OSCs differed slightly from mouse OSCs in that peak levels of oocyte formation were observed at 72 hours after each passage (Figure 7e). In addition to détection of many wîdely accepted oocyte markers (Posa, c-Kit, Nobox, Lhx8, Gdf9, Zpl, Zp2, Zp3; (Suzumori et al., Mech, Dev. 2002 111:137-141; Rajkovic et al., Science 2004 305:1157-1159; Pangas et al., Proc, Natl. Acad. Sci. USA 2006 1 03:8090-8095; Elvin et al., Mol. Endocrinol. 1999 13:1035-1048; Zheng et al., Semin. Reprod. Med. 2007 25:243-251), mouse and human OSC-derived oocytes also expressed the diplotene oocyte stage-specific marker Msy2 (Figure 7c). MSY2 is a mammalian homologue ofXenopus FRGY2, a germ cell-specific nucleic acid-binding Y-box protein that is essential for meiotic progression and gametogenesis in both sexes (Gu et al., Biol. Reprod. 1998 59:1266—1274; Yang et al., Proc. Natl. Acad. Sci. USA 2005 102:5755-5760). Through empirical testing of commercially-available antibodies using adult human ovarian cortical tissue as a positive control, four such antibodies against oocyte markers were identified that specifically reacted with immature oocytes présent in adult human ovaries (VASA, c-K.IT, MSY2, LHX8; Figure 8); ail four of these proteins were also detected in oocytes generated by human OSCs in vitro (Figure 7g).
The presence of mRNA encoding the meiotic marker MSY2 in oocytes newly formed from human OSCs in vitro prompted us to next explore the prospects of meiotic entry in these cultures. Immunofluorescence analysis of attached (non-oocyte germline) cells 72 hours after passage identified cells with punctate nuclear localization ofthe meiosis-specific DNA recombinase, DMC1, and the meiotic recombination protein, synaptonemal complex protein 3 (SYCP3) (Figure 7h). Both proteins are spécifie to germ cells and are necessary for meiotic recombination (Page et a\.,Annu. Rev. Cell Dev. Biol. 2004 20:525-558; Yuan et al., Science
2002 296:1115-1118; Kagawa et al., FEBSJ. 2010 277:590-598).
Chromosomal DNA content analysis of human OSC cultures 72 hours after passage was determined. Cultured mouse (48 hours after passage) or human (72 hours after passage) OSCs were collected by trypsinization, washed and resuspended in ice-cold PBS, and counted with a hemocytometer. After fixation in ice-cold 70% éthanol for 1 hour, cells were washed in ice-cold PBS and incubated with 0.2 mg/ml RNase-A for 1 hour at 37’ C. Propïdium iodide was then added (10 gg/ml final), and ploidy status was determined using the BD Biosciences FACSAria II cytometer. As a control somatic cell line, these experiments were repeated using human fêtai kidney fibroblasts (HEK 293, Invitrogen, Life Technologies Corp., Carlsbad, CA). This analysis revealed the presence of an expected diploid (2n) cell population; however, peaks corresponding to 4n and ln populations of cells were detected, the latter being indicative of germ cells that had reached haploid status (West et al., Stem Cells Dev. 2011 20:1079-1088) (Figure 7i). In activelydividing cultures of fêtai human kidney fibroblasts analyzed as controls in parallel, only 2n and 4n populations of cells (Figure 9a) were detected. Comparable outcomes were observed following FACS-based chromosomal analysis of mouse OSC cultures (Figure 9b).
Example 6: Human OSCs Generate Oocytes in Human Ovarian Cortical Tissue In Vivo
To confirm and extend the in vitro observations of putative oogenesis from candidate human OSCs, in two final experiments VASA-positive cells isolated from adult human ovaries were stably transduccd with a GFP expression vector (GFP-hOSCs) to facilitate cell tracking. For cell tracking experiments, human OSCs were transduced using a retrovirus to obtain cells with stable expression of GFP (GFP-hOSCs). Briefly, 1 gg ofpBabe-Gjp vector DNA (Addgene plasmid repository #10668) was transfected as per the manufacturées protocol (Lipofectamine, Invitrogen, Life Technologies Corp., Carlsbad, CA) into the Platinum-A retroviral packaging cell line (Cell Biolabs, Inc., San Diego, CA). Viral supematant was collected 48 hours after transfection. Transduction of human OSCs was performed using fresh viral supematant facilitated by the presence of polybrene (5 gg/ml; Sigma-Aldrich, St. Louis, MO). After 48 hours, the virus was removed and replaced with fresh OSC culture medium. Human OSCs with expression of GFP were purified or isolated by FACS following an initial 1 week of expansion, and the purified or isolated cells were expanded for additional 2 weeks before a second round of FACS purification or sorting to obtain GFP-hOSCs for human ovarian tissue re-aggregation or xenografting experiments.
In the first experiment, approximately 1 X 105 GFP-hOSCs were then re-aggregated with dispersed adult human ovarian cortical tissue. Human ovarian cortex was dissociated and washed as described above, and incubated with 35 gg/ml phytohemaglutannin (PHA; Sigma, St. Louis, MO) plus 1x10* GFP-hOSCs for 10 minutes at 37' C. The cell mix was pelleted by centrifugation (9,300 xg for I minute at 20' C) to create the tissue aggregate, which was placed onto a Millicell 0.4 pm culture plate insert (EMD Millipore, Inc., Billerica, MA) contaîned in a
6-well culture dish with l ml of OSC culture medium. Aggregates were incubated at 37* C in 5%
CO2-95% air, and live-cell GFP imaging was performed 24,48 and 72 hours later.
Numerous GFP-positive cells were observed, as expected, throughout the re-aggregated tissue (Figure 10a). The aggregates were then placed in culture and assessed 24-72 hours later by direct (live cell) GFP fluorescence. Within 24 hours, several very large (>50-pm) single cells were also observed in the aggregates, many of which were enclosed by smaller GFP-negative cells in tightly compact structures resembling follicles; these structures remained détectable through 72 hours (Figure 10b, c). These findings indicated that GFP-expressing human OSCs spontaneously generated oocytes that became enclosed by somatic (pregranulosa/granulosa) cells présent in the adult human ovarian dispersâtes.
Next, GFP-hOSCs were injected into adult human ovarian cortical tissue biopsies, which were then xenografted into NOD/SCID female mice (n = 40 grafts total). Ovarian cortical tissue pièces (2 X 2 X l mm) were individually injected with approximately I.3 X 103 GFP-hOSCs using a l O-μΙ NanoFil syringe with a 35-gauge beveled needle (World Précision Instruments, Sarasota, FL). Récipient NOD/SCID female mice were anesthetized and a small incision was made along the dorsal flank for subcutaneous insertion of the human ovarian tissue, essentially as described (Weissman et al., Biol. Reprod. 1999 60:1462-1467; Matikainen et al., Nature Genet, 2001 28:355-360). Xenografts were removed after 7 or 14 days post transplantation, fixed in 4% PFA, paraffin-embedded and serially sectioned (6-pm) for immunohistochemical analysis using a mouse monoclonal antibody against GFP (sc9996; Santa Cruz Biotechnology, Santa Cruz, CA) (Lee et al., J. Clin. Oncol. 2007 25:3198-3204). Briefly, high température antigen retrie val was first performed using 0.01 M sodium citrate bufïer (pH 6.0). After cooling, sections were incubated for 10 minutes with 3% hydrogen peroxide in methanol to block endogenous peroxidase activity, washed and incubated in streptavidin-biotin pre-block solution as per the manufacturées protocol (Vector Laboratories, Burlingame, CA). Sections were then blocked for 1 hour at 20* C using TNK bufïer containing 1% normal goat sérum and incubated overnight at 4° C with a 1:100 dilution of GFP antibody prepared in TNK bufïer containing 1% normal goat sérum. Sections were then washed, incubated with a 1:500 dilution of goat antîmouse biotinylated secondary antibody for 30 minutes at 20* C, washed and reacted with Vectastain ABC reagents (Lab Vision, ThermoFisher Scientîfic, Inc., Waltham, MA) for 30 minutes at 20° C prior to détection of GFP-positive cells using diaminobenzidine (DAKO Glostrup, Denmark). Sections were lightly counterstaïned with haematoxylin to visualize cell and tissue architecture. Négative controls (complété immunohistochemical staining protocol on xenografted tissues that received vehicle injections) were always run in parallel and did not show a positive signal. To confîrm and extend these observations, dual immunofluorescence-based détection of GFP and either MSY2 (diplotene stage oocyte-specific marker) or LHX8 (early stage oocyte transcription factor) in xenografted human ovarian tissues was performed with
DAPI counterstaining, as detailed previously in the description of îmmunoanalysis.
Grafts were collected 7 or 14 days later for assessment of GFP expression. Ail human ovary grafts contained easily discemible primordial and primary follicles with centrally-located GFP-negative oocytes. Interdispersed among and often adjacent to these follicles, which were presumably présent in the tissue prior to GFP-hOSC injection, were other immature follicles containing GFP-positive oocytes (Figure lOd, f). Serial section histomorphometric analysis of 3 randomly selected human ovarian tissue biopsies injected with GFP-hOSCs revealed the presence of 15-21 GFP-positive oocytes per graft 7 days after xenografting into mice (Figure 11). As controls, GFP-positive oocytes were never detected in human ovarian cortical tissue prior to GFP-hOSC injection (Figure 10e) or in xenografts that received mock injections (vehicle without GFP-hOSCs) prior to transplantation intoNOD/SCID mice (Figure 10g). Dual immunofluorescence-based détection of GFP along with either the diplotene stage oocytespecific marker MSY2 (Gu et al., Biol. Reprod. 1998 59:1266-1274; Yang et al., Proc. Natl. Acad. Sci. USA 2005 102:5755-5760) or the oocyte-specific transcription factor LHX8 (Pangas et al., Proc. Natl. Acad. Sci. USA 2006 103:8090-8095) identified many dual-positive cells distributed throughout xenografts injected with GFP-hOSCs (Figure lOh). As expected, no GFPpositive oocytes were detected in ovarian tissue prior to GFP-hOSC injection or in xenografts that did not receive GFP-hOSC injections (not shown; see Figure 10e, g); however, these oocytes were consistently positive for LHX8 and MSY2 (Figure 1 Oh; Figure 8).
Example 7: Use of OSCs in Autologous Germline Mitochondrial Energy Transfer (“AUGMENT”)
Figure 13 depicts an overview of the use of OSCs as an autologous source of female germ cells for dérivation of oogenic cytoplasm or mitochondrial fractions that can then be transferred into an oocyte obtained from the same subject prior to or during in vitro fertîlization (TVF). The résultant boost in mitochondrial DNA copy number and ATP-generating capacity in the egg after AUGMENT ensures that the oocyte has ample reserves of ATP for energy-driven events required for successful fertîlization and embryonic development. The additional mitochondria provided to the oocyte by AUGMENT are derived from the naturel precursor cell used by the body to produce oocytes. Furthermore, the additional mitochondria will not produce adverse effects in the oocyte, based on data showing that healthy embryogenesis proceeds even when the minimal threshold number of mitochondria needed for embryo development is exceeded by nearly four-fold (see Wai et al., Biology of Reproduction 2010 83:52-62, Figure 6).
K
The bénéficiai effects of heterologous ooplasmic transfer reported earlierby Cohen et al., Mo!
Hum Reprod I998 4:269-80, a procedure which is not suitable for human use because it results în germline genetic manipulation and mitochondrial heteroplasmy in embryos/offspring, indicate that oocytes are benefited by additîonal mitochondria.
An exemplary clinical protocol for AUGMENT is as follows. Prior to the start of standard IVF, the subject will undergo a laparoscopy during menstrual cycle days l-7 to collect up to three pièces (approximately 3x3x1 mm each) of ovarian epithelium (ovarîan cortical bîopsy) from one ovary, During this procedure, 2-3 incisions will be made within the abdomen and a device will be inserted to remove the tissue from an ovary using stérile procedures. The tissue collected will be placed in stérile solution and transported on ice to the GTP compilant laboratory where it will be cryopreserved until the time of AUGMENT/ICSI. The tissue will remain frozen until the time of enzymatic dissociation. This will serve as the source of autologous OSCs ffom which mitochondria will be purified or isolated.
Next, OSCs will be isolated and mitochondria will be harvested from the OSCs. After thawing the ovarian cortical biopsied tissue, the tissue will be minced and placed in solution, containing recombinant collagénase and recombinant DNasel and homogenized to a single cell suspension. The suspension will be passed through a cell strainer to préparé a solution of single cells. The single cell suspension will be incubated with an anti-VASA antibody. Labeled cells will then be isolated by fluorescence-activated cell sorting (FACS). Standard slow cooling cryopreservation procedures for ffeezing aliquots of OSCs will be used.
Subjects will undergo a standard IVF protocol including baseline évaluation, GnRH antagonist down-regulation and gonadotropin stimulation. Oocyte retrieval will take place within 34-38 hours after hCG administration and oocytes will be assessed for quality and maturation state. Mature oocytes will be inseminated by ICSI.
On the day of oocyte retrieval, the frozen OSC vial for that subject will be thawed using standard methods. OSCs will be processed to yield a mitochondrial pellet (Frezza et al. Nature Protocols 2007 2:287-295 or Perez et al., Cell Death andDifférentiation 2007 3:524-33. Epub 2006 Oct 13) or as described beiow in Example 9, where a FACS-based method is employed to isolate the total mitochondrial population in a tissue and optionally, further isolate the actively respiring mitochondrial population or quantitate the ratio of active to total mitochondria in a tissue. Evaluation and activity ofthe mitochondrial préparation will be assessed and recorded. Exemplary assays of mitochondrial function are described in Example 8. The mitochondrial pellet will be re-suspended in media to a standardized concentration of mitochondrial activity which improves oocyte quality. This media containing the mitochondria will be aspirated into a microinjection needle that contains the spermatozoan to be delivered. Both the mitochondria and spermatozoan will be delivered together into the oocyte by ICSI. Alternatively, the mitochondria or préparation thereof will be frozen prior to use.
Following fertilization and embryo culture, typically a maximum of three, grade l or grade 2 (SART grading system (50)) embryos may be transferred under ultrasound guidance after 3 or 5 days of culturing based on the assessment of embryo development. If a pregnancy is confirmed via beta hCG testing, then the subject will hâve subséquent observations at approximately 6 and 20-weeks gestational âge.
Example 8: Assessment of Mitochondrial Parameters in Human OSCs versus Human Ovarian Stromal Cells.
Mitochondrial staining was conducted in cultured human ovarian somatic cells and cultured human OSCs obtained from the same patient. Cells were incubated with the nonoxidation dépendent MitoTracker Green FM (Invitrogen, Life Technologies Corp., Carlsbad, CA; M7514) mitochondrial tracking probe, which indicates mitochondrial mass, at 37’ C for 45 minutes and washed twice with fresh culture medium prior to live cell fluorescent imaging. Both cell types were processed in parallel. In Figure 14, distribution patterns indicate perinuclear localization in the human OSCs, consistent with other human stem cell types.
Accumulation of a common délétion mutation (délétion of nucléotides 8470-13447 of the mitochondrion genome) occurs in mtDNA of cells as an organism âges. PCR primers were designed to span this délétion. If the délétion mutation is absent, indicating the mtDNA genome is intact, the PCR amplicon will be 5080 bp. If the délétion is présent, a 103 bp fragment will be amplifted. In instances of heterogeneity among the mitochondria within individual cells or the cell population, both products do not amplify. This occurs because because the délétion (as ïndicated by the small band) amplifies much more efficiently than the large 5-kb product. The small product reaches the exponentiel and plateau phases more rapidly, thereby utilizing the available reagents in the PCR mix and leaving little or none for the less efficient 5-kb product amplification. The PCR analysis shown in Figure 15 indicates that the human OSCs do not harbor an accumulation of the mutation, whereas patient matched ovarian somatic cells do.
To confirm that the mitochondrial population within the somatic cells is heterogeneous with respect to the mutation (some mitochondria will harbor the délétion and some will not), a second set of PCR primers targeting a sequence specifically within the deleted région was used to assess mitochondrial integrity in ovarian somatic cells. The amplification of a 191 bp product indicates that this région is intact within at least some of the mitochondria in these cells, and that the overall population of somatic cell mitochondria is heterogeneous with respect to the délétion mutation, whereas the human OSCs are essentially free of the mutation.
Primer sequences (5’ to 3’) for mitochondrial DNA analysis include Amplicon 1 for 5080 bp (intact) or 103 bp (délétion mutant) having the following sequences:
(Z
TTACACTATTCCTCATCACCCAAC (forward) and TGTGAGGAAAGGTATTCCTGCT (reverse) and Amplicon 2 for I9l bp (internai, deleted sequence) having the following sequences: CCTACCCCTCACAATCATGG (forward) and ATCGGGTGATGATAGCCAAG (reverse).
Figure 16 depicts the results of an ATP assay (ATP Bioluminescence Assay Kit HS H, Roche Applied Science, Mannheim, Germany). The left panel shows the standard curve following dilution of ATP (molar ratio vs. chemiluminescence). As shown, the assay is sensitive in detecting levels of ATP, The right panel shows the amount of ATP from mitochondria isolated from cultured human OSCs. Approximately 100,000, 10,000, 1,000, and 100 cells were lysed and used for analysis, with values and detectability falling in the mM to fM range. Samples containing as few as 100 OSCs produced as much as 6.00E-08 M ATP (about 600pmol ATP/cell). Compared to ovarian somatic egg cells, OSCs produce greater than or équivalent amounts of ATP/cell with approximately 100 fold less mitochondria.
Example 9: FACS-based Isolation of Mitochondria
As described in this Example, FACS-based methods can be employed to isolate the total mitochondrial population in a tissue. In addition, FACS-based methods for mitochondrial isolation can employ dual-labeling using two different fluorescent dyes (mitochondria! membrane potentiel (MMP)-dependent and MMP-independent) to isolate only the functional (e.g., actively respiring) mitochondrial population or quantitate the ratio of functional to total mitochondria in a tissue, cell, lysed cell or fraction derived thereof.
The non-oxidation dépendent MitoTracker Green FM (Invitrogen, Life Technologies Corp., Carlsbad, CA; M7514) mitochondrial tracking probe, which indicates mitochondrial mass, was prepared and utilized as described below. MitoTracker stock solution (l-5mg/ml dissolved in anhydrous dimethylsulfoxide (DMSO)) was diluted in sérum ffee growth medium to_reach a working concentration of between 25-500nM. Freshly isolated or thawed OSCs were pelleted by centrifugation at 300 x g for 5 minutes. The supernatant was aspirated and the cell pellet was resuspended in 200 μΐ of the diluted MitoTracker stock solution.
Cells were incubated at 37 C for 45 minutes, washed in pre-warmed (37* C) sérum free growth medium and pelleted by centrifugation at 300 x g for 5 minutes (alternatively, cells can be lysed prior to incubation with a probe of interest). Supernatant was aspirated and cells were resuspended in 100 μΙ mitochondrial lysis buffer and transferred to a FACS sort tube for lysis by mechanical permeabilization using rapid osmotic shock. Following lysis, cells were equilibrated on ice for 15-30 minutes, incubated in 200 μΙ (minimum volume) ice cold PBS and vortexed. As shown in Figure 19, three distinct populations were observed: residual M7514 positive cells (Cells MT +), high fluorescent mitochondria (functional, Mito MT high), and low expressing tZ mitochondria (non-functional, Mito MT Low). The ratio of functional to non-functional mitochondria post lysîs was approximately l:l (1552 mitochondria, 743 were gated as functional and 716 were gated as non-functional, with the remainder not gated; the gates for each population of mitochondria are highlighted in Figure 19).
Therefore, functional mitochondria can be sorted and collected, with residual unlysed cells and non-functional mitochondria excluded based on size and fluorescence intensity. Duallabeling using multiple probes or a JC-l probe (red spectrum; Invitrogen, Life Technologies Corp., Carlsbad, CA; T3168) can help to further distinguish functional from non-functional mitochondria. Probes for use in dual labeling include, but are not limited to, reduced oxidative state mitotracker probes (e.g., MitoTracker Red CM-H2XRos (Invitrogen, Life Technologies Corp., Carlsbad, CA; M7513), MitoTracker Orange CM-H2TMRos (Invitrogen, Life Technologies Corp., Carlsbad, CA; M75l l) and accumulation dépendent probes: JC-l (red spectrum; Invitrogen, Life Technologies Corp., Carlsbad, CA; T3168), MitoTracker Deep Red FM (Invitrogen, Life Technologies Corp., Carlsbad, CA; M22426) and JC-l (green spectrum; Invitrogen, Life Technologies Corp., Carlsbad, CA; T3168).
Example 10: Mitochondrial Isolation Using Différentiel Centrifugation
As described in this Example, differential centrifugation procedures can be employed to isolate and/or fractionate mitochondria présent in a tissue. The key steps when isolating mitochondria from any tissue or cell are: (i) rupturing of cells by mechanical and/or chemical means, (ii) differential centrifugation at low speed to remove débris and extremely large cellular organelles (SPIN 1), and (iii) centrifugation at a higher speed to isolate and collect mitochondria (SPIN 2).
The tissue is weighed and washed twice with 1.5 ml of a commercially available Wash Buffer (MitoSciences, Abcam, pic, Cambridge, UK). The tissue is minced and placed in a prechilled Dounce homogenizer. Up to 2.0 ml of a commercially available Isolation Buffer (MitoSciences, Abcam, pic, Cambridge, UK) is added. The cells are ruptured using the Dounce homogenizer ( 10-40 strokes), and the homogenate is transferred to Eppendorf tubes. Each tube is filled to 2.0 ml with Isolation Buffer. The homogenate is centrifuged at 1,000g for 10 minutes at 4’C. The supematant is reserved and transferred into new tubes, each of which is filled to 2.0 ml with Isolation Buffer. The tubes are centrifuged at 12,000g for 15 minutes at 4*C. The pellet is reserved. If desired, the supematant is analyzed for quality. The pellet is washed twice by resuspending in 1.0 ml of Isolation Buffer supplemented with 10 μΙ of a commercially available protease inhibitor cocktail (MitoSciences, Abcam, pic, Cambridge, UK). The tubes are centrifuged at 12,000 g for 15 minutes at 4*C. After washing, the peliets are combined and resuspended in 500 μΙ of Isolation Buffer supplemented with protease inhibitor cocktail. If desired, alîquots are stored at -80C until use.
In one approach, mîtochondria întegrity is tested by Western blot screening for cytochrome c, porin, or cyclophilin D in the isolated mîtochondria versus in the supernatant fraction using commercially available antibodies, such as antibodies MSA06, MSA03, and MSA04 (MitoSciences, Abcam, pic, Cambridge, UK). In another approach, mitochondrial samples are probed by Western blot to detect components of the mitochondrial complex, for example, using the commercially available OXPHOS Complexes Détection cocktail (MitoSciences, Abcam, pic, Cambridge, UK ).
Example 11: Mitochondrial Isolation Using Sucrose Gradient Séparation
The protocol employs the following reagents, which are commercially available: ndodecyl-p-D-maltopyranoside (Lauryl maitoside; MS910; MitoSciences, Abcam, pic, Cambridge, UK), Phosphate buffered saline (PBS), Sucrose solutions 15, 20,25,27.5, 30 and 35 %, double distilled water, a protease inhibitor cocktail (MitoSciences, Abcam, pic, Cambridge, UK ), and 13x51 mm polyallomer centrifuge tubes (Beckman 326819; Beckman-Coulter, Inc., Brea, CA).
The sucrose gradient séparation procedure is a protein subfractionation method optimized for mîtochondria. This method résolves a sample into at Ieast 10 fractions. It is possible to separate solubilized whole cells into fractions of much lower complexity but when analyzing already isolated mîtochondria the fractions are even more simplified. The sucrose gradient séparation technique is designed for an initial sample volume of up to 0,5 ml at 5 mg/ml protein. Therefore 2.5 mg or less of total protein should be used. For larger amounts, multiple gradients can be prepared or larger scale gradients are made.
The sample is solubilized in a non-ionic detergent. It has been determined that at this protein concentration mîtochondria are completely solubilized by 20 mM n-dodecyl-p-Dmaltopyranoside (1% w/v lauryl maitoside). The key to this solubilization process is that the membranes are disrupted while the prevîously membrane embedded multisubunit OXPHOS complexes remain intact, a step necessary for the density based sucrose séparation procedure described herein, One important exception is the pyruvate dehydrogenase enzyme (PDH). In order to isolate PDH at a protein concentration of 5 mg/ml mîtochondria, the required detergent concentration is only 10 mM (0.5 %) lauiyl maitoside. The PDH enzyme should also be centrifuged at lower speeds, a centrifugal force of 16 000 g is maximum for the PDH complex.
To a mitochondrial membrane suspension at 5 mg/ml protein in PBS, lauryl maitoside is added to a final concentration of 1 %. This is mixed well and incubated on ice for 30 minutes. The mixture is then centrifuged at 72,000 g for 30 minutes. A Beckman Optima benchtop ultracentrifugc (Beckman-Coulter, Inc., Brea, CA) is recommended for small sample volumes. However, at a minimum a benchtop microfuge, on maximum speed (e.g., about 16 000 g) should suffice. After centrifugation, the supematant is collected and the pellet discarded. A protease inhibitor cocktail is added to the sample, which is maintained on ice until centrifugation is performed. In samples very rich in mitochondria the cytochromes in complexes III and IV may give the supematant a brown color, which is useful when checking the effectiveness of the following séparation.
A discontinuous sucrose density gradient is prepared by layering successive decreasing sucrose densities solutions upon one another. The préparation and centrifugation of a discontinuous gradient containing sucrose solutions from 15-35 % is described in detail below. This gradient gives good séparation of the mitochondrial OXPHOS complexes (masses ranging from 200 kDa to 1000 kDa). However this setup can be modified for the séparation of a partîcular complex or for the séparation of larger amounts of material.
The gradient is prepared by layering progressively less dense sucrose solutions upon one another; therefore the first solution applied is the 35 % sucrose solution. A steady application of the solutions yields the most reproducible gradient. To aid in this application, a Beckman polyallomer tube is held upright in a tube stand. Next a Rainin Pipetman 200 μΙ pipette tip is placed on the end of a Rainin Pipetman 1000 μΐ pipette tip. Both snugly fitting tips are held steady by a clamp stand and the end of the 200 μΙ pipette tip is allowed to make contact with the inside wall of the tube. Sucrose solutions are then placed inside the I000 μΐ pipette tip and fed into the tube slowly and steadily, starting with the 35% solution (0.25 ml).
Once the 35% solution has drained into the tube, the 30 % solution (0.5 ml) is loaded into the tube on top of the 35 % solution. This procedure is continued with the 27.5% (0.75 ml), 25 % ( l .0 ml), 20 % (l .0 ml) and 15 % (l .0 ml) solutions, respectively. Enough space is left at the top of the tube to add the 0.5 ml sample of solubilized mitochondria.
Once the sucrose gradient is poured discrète layers of sucrose are visible. Having applied the sample to the top of the gradient the tube is loaded into the rotor very carefully, and centrifugation begins. Ail centrifugation procedures require a balanced rotor therefore another tube containing precisely the same mass is generated. In practice this means 2 gradients must be prepared although the second gradient need not contain an experimental sample but could contain 0.5 ml water in place of the 0.5 ml protein sample.
The polyallomer tubes should be centrifuged in a swinging bucket SW 50.1 type rotor (Beckman-Coulter, Inc., Brea, CA) at 37,500 rpm (Relative Centrifugal Force avg. 132,000 x g) for 16 hours 30 minutes at 4'C with an accélération profile of 7 and décélération profile of 7. Immediately after the run the tube should be removed from the rotor, taking great care not to disturb thc layers of sucrose. When separating a sample rich in mitochondria, discrète colored protein layers may be observed. Most often these are Complex 111 (500 kDa — brown color) approximately 10 mm from the bottom of the tube and Complex IV (200 kDa - green color) 25 mm from the bottom of the tube. In some circumstances additional bands can be observed. These are the other OXPHOS complexes.
For fraction collection, the tube is held steady and upright using a clamp stand. A tiny hole is introduced into the very bottom of the tube using a fine needle. The hole is just big enough to allow the sucrose solution to drip out at approximately l drop per second. Fractions of equal volume are collected in Eppendorf tubes below the pierced hole. A total of 10 x 0.5 ml fractions are appropriate, however collecting more fractions which are thus smaller in volume is also possible (e.g., 20 x 0.25 ml fractions). The fractions are stored at - 80*C until analysis. Collected fractions are analyzed to détermine mitochondrial integrity using any of the methods described herein (e.g., in Example 9, 10) or known in the art.
Example 12: OSCs Exhibit Increased Mitochondrial Activity
It has been reported that low mitochondrial activity is a feature of “stemness”, as it has been observed in spermatogonia, early embryo, inner cell mass cells and embryonic stem cells. See Ramalho-Santos et al., Hum Reprod Update. 2009 (5):553-72. OSCs are essentially the female équivalent of male spermatogonial stem cells (spermatogonia), however, it has now been determined that OSCs hâve proltfic mitochondrial activity.
Following OSC lysis, mitochondrial production of ATP (pmol) was measured at 10, 15, 20 and 30 minutes, and then standardized against total mtDNA content (fg) in each sample tested (ATP Bioluminescence Assay Kit HS II, Roche Applied Science, Mannheim, Germany). As shown in Figure 20, adult human ovary-derived oogonial stem cells (OSCs), obtained from female patients between 22-33 (28.5 ± 4.0) years of âge with Gender Identity Disorder for sex reassignment at Saitama Medical Center, generated much greater levels of ATP than human mesenchymal stem cells from bone marrow (hMSCs, obtained from PromoCell GmbH, Heidelberg, Germany), adult human ovarian somatic cells (subject matched to the OSCs used), human embryonic stem cells (ESCs), and human induced pluripotent stem cells (iPSCs) derived from IMR90 fêtai lung fibroblasts.
Mitochondrial production of ATP (pmol) was standardized against total mtDNA content (fg) in each sample tested. As shown in Figure 21, mitochondria isolated from adult human ovary-derived oogonial stem cells (OSCs) produced greater than 6-fold more ATP in 10 minutes than human mesenchymal stem cells (MSCs) from bone marrow and over 10-fold more ATP in minutes than adult human ovarian somatic cells (subject matched to the OSCs used), human embryonic stem cells (ESCs), and human induced pluripotent stem cells (iPSCs) derived from IMR90 fêtai lung fibroblasts. Figure 21 depicts 1.03E-09, 1.46E-10, 1.76E-11,4.56E-12, 9.10E- pmol ATP generated in 10 minutes for hOSC, hMSC, Soma, hESC, and hiPSC, respectively. Standard errors (in the same order) are 1.15E-10,4.56E-11,2.28E-12, 1.72E-13 and 7.99E-12.
<
Délétion analysis revealed the presence of the common 4977-bp délétion in hMSCs (Figure 22). Human ovarian soma, which is known to hâve the mutation, is included as a positive control along with a no sample control (ve). The intact portion of the product was not detected in either sample. By comparison, the common 4977-bp délétion is not détectable in human OSCs (Figure 15).
Other Embodiments
From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adapt it to various usages and conditions. Such embodiments are also within the scope of the following daims.
The récitation of a listing of éléments in any définition of a variable herein includes définitions of that variable as any single element or combination (or subcombination) of listed éléments. The récitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.
This application contains subject matter that may be related to U.S. provisional application Ser. No. 61/502,840, filed June 29, 2011 and U.S. provisional application Ser. No. 61/600,529, filed February 17, 2012, the entire disclosures of which are incorporated herein by référencé. Ail patents and publications mentioned in this spécification are herein incorporated by référencé to the same extent as if each îndependent patent and publication was specîfically and individually indicated to be incorporated by référencé.
IFtIXGAl (EflVICEÎ

Claims (57)

  1. What is claimed is:
    1. A method of preparing an oocyte for in vitro fertilization (IVF) or artificial insémination, the method comprising transferring a composition comprising i) oogonial stem cell (OSC) mitochondria, or H) mitochondria obtained from a progeny of an OSC, into an autologous oocyte, thereby preparing said oocyte for IVF or artificial insémination.
  2. 2. The method of claim 1, wherein the OSC is an isolated non-embryonic stem cell that is mitotically competent and expresses Vasa, Oct-4, Dazl, Stella and optionally a stage-specific embryonic antigen.
  3. 3. The method of claim I, wherein the OSC îs obtained from ovarian tissue.
  4. 4. The method of claim 1, wherein the OSC is obtained from non-ovarian tissue.
  5. 5. The method of claim 4, wherein the non-ovarian tissue is blood.
  6. 6. The method of claim 4, wherein the non-ovarian tissue is bone marrow.
  7. 7. The method of claim 1, wherein the composition comprising an OSC mitochondria, or mitochondria obtained from a progeny of an OSC, is the cytoplasm of said cells without a nucléus.
  8. 8. The method of claim 1, wherein the composition comprising i) OSC mitochondria, or ii) mitochondria obtained from a progeny of an OSC, is a purified préparation of mitochondria.
  9. 9. A composition comprising isolated OSC mitochondria or mitochondria obtained from a progeny of an OSC.
  10. 10. The composition of claim 9, wherein the composition is at least about 85%, 90%, 95% free of cells or non-functional mitochondria.
  11. 11. A composition comprising at least one isolated mitochondrion obtained from an OSC or at least one progeny of an OSC.
  12. 12. An oocyte prepared according to the method of claim 1.
    (Z47
  13. 13. An oocyte comprising exogenous, autologous OSC mitochondria or mîtochondria obtained from the progeny of an OSC.
  14. 14. A method of in vitro fertilization, said method comprising the steps of:
    a) obtaining a composition comprising i) mitochondria from an OSC, or ii) mitochondria obtained from a progeny of an OSC;
    b) transferring the composition into an isolated, autologous oocyte; and
    c) fertilizing the autologous oocyte in vitro to form a zygote.
  15. 15. The method of claim 14, further comprising transferring the zygote, or a preimplantation stage embryo derived from said zygote, into the utérus or oviduct of a female subject.
  16. 16. A method of isolating a population of functional mitochondria from at least one OSC, or at least one progeny of an OSC, said method comprising the steps of încubating a composition comprising at least one OSC, or at least one progeny of an OSC, with a fluorescent mitochondrial tracking probe selected from the group consisting of a non-oxidation dépendent probe, accumulation dépendent probe and reduced oxidative state probe under conditions suffirent to bind the probe to the functional mitochondria and sorting the functional mitochondria using fluorescence-activated cell sorting, thereby isolating the population of functional mitochondria from at least one OSC, or at least one progeny of an OSC.
  17. 17. The method of claim 16, wherein non-functional mitochondria are excluded from the population of functional mitochondria.
  18. 18. A method of identîfyîng a population of functional mitochondria obtained from at least one OSC, or at least one progeny of an OSC, said method comprising the steps of:
    a) incubating a composition comprising at least one OSC, or at least one progeny of an OSC, with a fluorescent reduced oxidative state probe and a fluorescent accumulation dépendent probe under conditions sufficient to bind the fluorescent reduced oxidative state probe to functional mitochondria in the composition and bind the fluorescent accumulation dépendent probe to total mitochondria in the composition;
    b) obtaining a composition comprising the functional mitochondria using fluorescence-activated cell sorting, wherein said composition excludes non-functional mitochondria;
    c) determinîng the amount of functional mitochondria and the amount of total mitochondria; and txC
    d) calculating the ratio of functional mitochondria to total mitochondria; and
    e) determining whether the ratio is greater than about 0.02, thereby identifying a population of functional mitochondria obtained from at least one OSC, or at least one progeny of an OSC.
  19. 19. The method of claim 18, wherein the fluorescent accumulation dépendent probe fluoresces in the green spectrum.
  20. 20. The method of claim 18, wherein the fluorescent reduced oxidative state probe fluoresces in the red spectrum.
  21. 21. A composition comprising the functional mitochondria obtained according to steps a) and b) of claim 18.
  22. 22. A kit comprising the composition of any one of daims 9 to 11 and instructions for use.
  23. 23. A method for increasing the ATP-generating capacity of an oocyte, said method comprising the steps of:
    a) obtainîng a composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC that is autologous to the oocyte; and
    b) injecting the composition of mitochondria into the oocyte.
  24. 24. The method of claim l, 14 or 23, wherein the composition comprises IxlO3 to 5xl04 mitochondria.
  25. 25. The method of claim 1, 14 or 23, wherein the OSC or progeny of an OSC produces at least 5-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  26. 26. The method of claim 25, wherein the ovarian somatic cell or mesenchymal stem cell is autologous.
  27. 27. The method of claim 1, 14 or 23, wherein the OSC or progeny of an OSC produces at least 10-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  28. 28. The method of claim 27, wherein the ovarian somatic cell or mesenchymal stem cell is autologous.
    Z.
  29. 29. The method of claim l, 14, or 23, wherein the OSC or progeny of an OSC produces at least 50-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  30. 30. The method of claim 29, wherein the ovarian somatic cell or mesenchymal stem cell is autologous.
  31. 31. The method ofclaim I, 14, or 23, wherein the OSC or progeny of an OSC produces at least 100-foid more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  32. 32. The method of claim 31, wherein the ovarian somatic cell or mesenchymal stem cell is autologous.
  33. 33. The method of claim l, 14 or 23, wherein the oocyte is obtained from a human female of advanced maternai âge.
  34. 34. The method of claim l, 14 or 23, wherein the oocyte is obtained from a human female with low ovarian reserve.
  35. 35. The method of claim l, 14 or 23, wherein the composition comprises mitochondria that hâve been isolated by centrifugation.
  36. 36. The method of claim l, 14 or 23, wherein the composition comprises mitochondria that hâve been isolated by mitochondrial membrane potential-dependent cell sorting.
  37. 37. The method of claim 23, wherein the at least one OSC is obtained from ovarian tissue.
  38. 38. The method of claim 23, wherein the at least one OSC is obtained from a non-ovarian tissue.
  39. 39. The method of claim 38, wherein the non-ovarian tissue is blood.
  40. 40. The method of claim 38, wherein the non-ovarian tissue is bone marrow.
  41. 41. The method of claim 23, wherein the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC, is the cytoplasm of said cells without a nucléus.
  42. 42. The method of claim 23, wherein the composition comprising mitochondria obtained from at least one OSC or at least one progeny of an OSC is a purified préparation of mitochondria.
  43. 43. The composition of claim 9 or 11, wherein the composition comprises lxlO3 to 5xl04 mitochondria.
  44. 44. The composition of claim 9 or 11, wherein the OSC or progeny of an OSC produces at least 5-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  45. 45. The composition of claim 44, wherein the ovarian somatic cell or mesenchymal stem cell is autologous.
  46. 46. Thecomposition ofclaim 9or 11, wherein the OSC or progeny ofanOSC producesat least lO-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  47. 47. The composition of claim 46, wherein the ovarian somatic cell or mesenchymal stem cell is autologous.
  48. 48. The composition of claim 9 or 11, wherein the OSC or progeny of an OSC produces at least 50-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  49. 49. The composition of claim 48, wherein the ovarian somatic cell or mesenchymal stem cell is autologous.
  50. 50. The composition of claim 9 or 11, wherein the OSC or progeny of an OSC produces at least 100-fold more ATP per fg mtDNA than an ovarian somatic cell or mesenchymal stem cell.
  51. 51. The composition of claim 50, wherein the ovarian somatic cell or mesenchymal stem cell is autologous.
  52. 52. The composition of claim 9 or 11 wherein the OSC or progeny of an OSC is obtained from a human female of advanced maternai âge.
  53. 53. The composition of claim 9 or 11 wherein the OSC or progeny of an OSC is obtained from a human female with low ovarian reserve.
  54. 54. The composition of claim 9 or 11, wherein the composition comprises mitochondria that 5 hâve been isolated by centrifugation.
  55. 55. The composition of claim 9 or 11, wherein the composition comprises mitochondria that hâve been isolated by mitochondrial membrane potential-dependent cell sorting.
    10
  56. 56. An oocyte prepared according to the method of claim 23.
  57. 57. A composition of mitochondria obtained from at least one OSC or at least one progeny of an OSC, wherein the composition comprises a population of mitochondria in which greater than about 75%, 85%, 90%, or about 99% of the mitochondria are high ATP-generating capacity mitochondria.
OA1201300433 2011-04-14 2012-04-13 Compositions and methods for autologous germline mitochondrial energy transfer. OA16632A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US61/475,561 2011-04-14
US61/600,505 2012-02-17

Publications (1)

Publication Number Publication Date
OA16632A true OA16632A (en) 2015-12-01

Family

ID=

Similar Documents

Publication Publication Date Title
EP2787073B1 (en) Compositions and methods for autologous germline mitochondrial energy transfer
AU2010314989B2 (en) Ex host maturation of germline stem cells
AU2017251852A1 (en) Compositions and Methods for Enhancing Bioenergetic Status in Female Germ Cells
AU2017201404B2 (en) Compositions And Methods For Autologous Germline Mitochondrial Energy Transfer
HK1202890B (en) Compositions and methods for autologous germline mitochondrial energy transfer
HK1233676A1 (en) Compositions and methods for autologous germline mitochondrial energy transfer
NZ617582B2 (en) Compositions and methods for autologous germline mitochondrial energy transfer
AU2014200322A1 (en) Ex host maturation of germline stem cells