WO2012083189A2 - Methods, compositions, systems, apparatuses and kits for nucleic acid amplification - Google Patents

Methods, compositions, systems, apparatuses and kits for nucleic acid amplification Download PDF

Info

Publication number
WO2012083189A2
WO2012083189A2 PCT/US2011/065535 US2011065535W WO2012083189A2 WO 2012083189 A2 WO2012083189 A2 WO 2012083189A2 US 2011065535 W US2011065535 W US 2011065535W WO 2012083189 A2 WO2012083189 A2 WO 2012083189A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
primer
template
immobilized
strand
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/065535
Other languages
English (en)
French (fr)
Other versions
WO2012083189A3 (en
Inventor
Bin Li
Kai Qin Lao
Jennifer O'neil
Jennifer Kunkel
Kellie Haley
Rachel Kasinskas
Zhaochun Ma
Pius Brzoska
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Life Technologies Corp
Original Assignee
Life Technologies Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Life Technologies Corp filed Critical Life Technologies Corp
Priority to CN202410224895.0A priority Critical patent/CN118086471A/zh
Priority to JP2013544833A priority patent/JP5907990B2/ja
Priority to EP19154117.6A priority patent/EP3564392B1/en
Priority to EP16196078.6A priority patent/EP3147374B1/en
Priority to CN201180067596.1A priority patent/CN103370425B/zh
Priority to CN201910119594.0A priority patent/CN110079588B/zh
Priority to EP11808489.6A priority patent/EP2652148B1/en
Publication of WO2012083189A2 publication Critical patent/WO2012083189A2/en
Publication of WO2012083189A3 publication Critical patent/WO2012083189A3/en
Priority to PCT/US2012/066869 priority patent/WO2013082164A1/en
Priority to US14/360,892 priority patent/US9315861B2/en
Priority to US13/828,049 priority patent/US9309566B2/en
Priority to US13/842,296 priority patent/US9309557B2/en
Anticipated expiration legal-status Critical
Priority to US13/923,232 priority patent/US9371557B2/en
Priority to US14/023,361 priority patent/US9334531B2/en
Priority to US14/085,718 priority patent/US20140148345A1/en
Priority to US14/085,727 priority patent/US9309558B2/en
Priority to US14/789,922 priority patent/US10113195B2/en
Priority to US15/071,086 priority patent/US9765388B2/en
Priority to US15/091,717 priority patent/US10329544B2/en
Priority to US15/695,244 priority patent/US10093969B2/en
Priority to US16/168,810 priority patent/US10858695B2/en
Priority to US16/442,341 priority patent/US11001815B2/en
Priority to US17/302,192 priority patent/US11725195B2/en
Priority to US18/221,099 priority patent/US20240067939A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/44Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase
    • C12Q1/46Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving esterase involving cholinesterase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6846Common amplification features
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6874Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00Reactions of nucleic acids characterised by
    • C12Q2531/10Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/119Strand displacement amplification [SDA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/50Detection characterised by immobilisation to a surface
    • C12Q2565/537Detection characterised by immobilisation to a surface characterised by the capture oligonucleotide acting as a primer

Definitions

  • Nucleic acid amplification is very useful in molecular biology and has wide applicability in practically every aspect of biology, therapeutics, diagnostics, forensics and research.
  • multiple amplicons are generated from a starting template using one or more primers, where the amplicons are homologous or complementary to the template from which they were generated.
  • Multiplexed amplification can also streamline processes and reduce overheads.
  • a single set of primers can be mixed with different templates, or a single template can be contacted with multiple different primers, or multiple different templates can be contacted with multiple different primers. This application relates to methods and reagents for nucleic acid amplification and/or analysis.
  • Amplification can make use of immobilized and/or soluble primers.
  • Amplicons generated from methods provided herein are suitable substrates for further analysis, e.g., sequence determination.
  • Figure 1 Schematic showing an embodiment of template walking.
  • the immobilized primer comprises an adenosine-rich sequence designated as (A) n , e.g., (A) 3 o
  • the primer binding site for the immobilized primer on the template comprises a complementary T-rich sequence, e.g., (T) 30 .
  • Figure 2 Overview of amplification on beads by template walking and deposition of beads onto a planar array for sequencing
  • Figure 3 Alternative embodiments using semiconductor-based detection of sequencing by synthesis.
  • Template walking can be used to generate a population of clonal amplicons on a bead or on the base or bottom of a reaction chamber.
  • the immobilized primer comprises an adenosine-rich sequence designated as (A) n , e.g., (A) 30
  • the primer binding site for the immobilized primer on the template comprises a complementary T-rich sequence, e.g., (T) 30 .
  • Figure 4 Alternative embodiments of immobilization sites in the form of primer lawns onplanar substrates. Arrays of separated immobilization sites can be used or else a single continuous lawn of primers can be considered to be a random array of immobilization sites. Optionally, the location of one or more immobilization sites in the continuous lawn of primers can be undetermined as yet, where the location is determined at the time of attachment of the initial template before walking or is determined by the space occupied by the amplified cluster.
  • the immobilized primer comprises an adenosine-rich sequence designated as (A) n , e.g., (A) 30
  • the primer binding site for the immobilized primer on the template comprises a complementary T-rich sequence, e.g., (T) 30 .
  • Figure 5 Influence of temperature on the template walking reaction. A graphical plot of the delta Ct before and after the template walking amplification was calculated and plotted against reaction temperature.
  • Figure 6 Table of the Ct values of the 96 duplex TaqMan qPCR reactions.
  • Figure 7 100,000-fold.amplification by template walking on beads. Delta Ct before and after the template walking reaction and fold of amplification before and after the template walking reaction was calculated and plotted against reaction time.
  • Figure 8 Schematic depiction of an exemplary strand-flipping and walking strategy.
  • any active verb is intended to indicate that the corresponding action occurs at a specific, significant or substantial level (e.g., more than random, or more than an appropriate control).
  • a specific, significant or substantial level e.g., more than random, or more than an appropriate control.
  • hybridizing indicates that a significant or substantial level of specific hybridization takes place.
  • hybridizing is optionally sufficient to achieve a desired fold of amplification - e.g., at least 10 3 or 10 4 or 10 5 or 10 6 amplicons from a single template.
  • specific hybridization is more than would happen between two nucleic acids that share no significant amount of sequence homology.
  • specific hybridization comprises binding of a nucleic acid to a target nucleotide sequence in the absence of substantial binding to other nucleotide sequences present in the hybridization mixture under defined stringency conditions.
  • the sample is derived from tissues or fluids taken from living or dead organisms (e.g., humans) for the purposes of diagnostics or forensics).
  • the same comprises a genomic library or an exome library.
  • Two sequences can be considered to be complementary if one sequence hybridizes substantially and specifically under the conditions of choice to the other sequence.
  • Two sequences can be considered to be homologous if the reverse complement of one sequence can hybridize substantially and specifically under the conditions of choice to the other sequence.
  • Substantial hybridization for example is where more than 5%, optionally 10%, 30%, 50% or 80% of one of the nucleic acids is hybridized to the other nucleic acid.
  • Hybridization between two single-stranded nucleic acids often but not necessarily involves the formation of a double stranded structure that is stable under conditions of choice.
  • the conditions of choice are for example conditions in which hybridization is intended, e.g., during an annealing step of an amplification cycle.
  • Two single-stranded polynucleotides are optionally considered to be hybridized if they are bonded to each other by two or more sequentially adjacent base pairings.
  • a substantial proportion of nucleotides in one strand of the double stranded structure undergo Watson-Crick base-pairing with a nucleoside on the other strand.
  • Hybridization also includes the pairing of nucleoside analogs, such as deoxyinosine, nucleosides with 2- aminopurine bases, and the like, that may be employed to reduce the degeneracy of the probes, whether or not such pairing involves formation of hydrogen bonds.
  • a nucleic acid can be considered immobilized if it is attached to a support in a manner that is substantially stable, at least during conditions of choice (e.g., during the amplification reaction).
  • the attachment can be by any mechanism, including but not limited to non-covalent bonding, ionic interactions, covalent linkage. If a first nucleic acid is hybridized to a second nucleic acid immobilized on a support, then the first nucleic acid can also be considered to be immobilized to the support during amplification, if amplification conditions are such that substantial amounts of the first and second nucleic acids are associated or connected with each other at any or all times during amplification.
  • first and second nucleic acids can be associated together by hybridization involving Watson-Crick base pairing or hydrogen bonding.
  • the amplification conditions of choice allow at least 50%, 80%), 90%), 95%o or 99% of the first nucleic acid to remain hybridized with the second nucleic acid, or vice versa.
  • a nucleic acid can be considered unimmobilized or non-immobilized if it is not directly or indirectly attached to or associated with a support.
  • a medium can be considered fiowable under conditions of choice if the medium is under those conditions at least temporarily a fluid medium that does not substantially or completely restrain or impede transfer or movement of an unimmobilized molecule.
  • the unimmobilized molecule is not itself immobilized to a solid support or surface or associated with another immobilized molecule.
  • the unimmobilized molecule is a solute (e.g., a nucleic acid) through the fiowable medium.
  • Exemplary transfer or movement in the medium can be by means of diffusion, convection, turbulence, agitation, Brownian motion, advection, current flows, or other molecular movements within the liquid) from any first point in the continuous phase to any other point in fluid communication or in the same continuous phase.
  • a fiowable medium a significant amount of an unimmobilized nucleic acid is transferred from one immobilization site to another immobilization site that is within the same continuous phase of the fiowable medium, or in fluid communication with the first
  • the rate of transfer or movement of the nucleic acid in the medium is comparable to the rate of transfer or movement of the nucleic acid in water.
  • the conditions of choice are conditions that the medium is subjected to during amplification.
  • the conditions of choice may or may not allow the fiowable medium to remain substantially motionless.
  • the conditions may or may not subject the fiowable medium to active mixing, agitation or shaking.
  • the medium is optionally fiowable at least temporarily during amplification.
  • the medium is fiowable under at least one preamplification and/or amplification condition of choice.
  • a fiowable medium does not substantially prevent intermingling of different unimmobilized nucleic acids or transfer of an unimmobilized nucleic acid between different zones of a continuous phase of the fiowable medium.
  • the movement or transfer of nucleic acids for example can be caused by means of diffusion or convection.
  • a medium is optionally considered nonflowable if unimmobilized nucleic acids upon amplification fail to spread or move between different immobilization sites or over the entire continuous phase.
  • a fiowable medium does not substantially confine unimmobilized nucleic acids (e.g., the templates or amplicons) within limited zones of the reaction volume or at fixed locations during the period of amplification.
  • a fiowable medium can be rendered non- fiowable by various meansor by varying its conditions.
  • a medium is fiowable if it is liquid or is not semisolid.
  • a medium can be considered fiowable if its fluidity is
  • a support comprises one or more immobilization sites.
  • a nucleic acid e.g., a template or an amplicon
  • An immobilization site optionally comprises a specific portion or area of a support, or a position or location on a support.
  • An immobilization site can have or optionally can lack any specific or predetermined location, position, dimension, size, area or structure on the support, or any other distinguishing parameter or charateristic.
  • one or more of such parameters are determined for an immobilization site at the time of association of the template with the support, and/or during or at the completion of amplification.
  • one or template-attachment moieties are attached to the support, which optionally are or are not arranged on the support at pre-determined or defined positions or angles or distances from the center of a defined point.
  • an arrangement of template molecules over one or more immobilization sites on a support is or is not achieved through an intentional design or placement of individual attachment moieties.
  • "randomly-patterned" or “random” array of attachment moieties can be achieved by dropping, spraying, plating or spreading a solution, emulsion, aerosol, vapor or dry preparation comprising a pool of nucleic acid molecules onto a support and allowing the nucleic acid molecules to settle onto the support, with or without any intervention that would direct them to specific or predetermined immobilization sites thereon.
  • a support or immobilization site optionally comprises one or more oligonucleotides (e.g., amplification primers) attached to a support.
  • oligonucleotides e.g., amplification primers
  • the attachment of the oligonucleotide to the support or immobilization site is stable during subsequent amplification or other assays (e.g., more than 10%, 30%>, 50%>, 70%> or 90%> of oligonucleotides remain attached after being subjected to the amplification conditions of choice).
  • all primers on at least one support or immobilization site comprise the same sequence.
  • the support or immobilization site can optionally comprise other nucleic acids which do not hybridize to one strand of the template of interest or its complement.
  • the support or immobilization site optionally does not comprise any other nucleic acid which hybridizes to one strand of the template of interest or its complement (i.e., the immobilization site optionally lacks any other primers).
  • a support or immobilization site comprises a plurality of primers having at least two different sequences.
  • the support or immobilization site comprises a species of immobilized primers that is complementary to a first portion of a single-stranded template, and does not comprise an immobilized primer that is homologous to a second non-overlapping portion of the template (or can hybridize to the template-complement).
  • the two portions are non-overlapping if they do not contain any subportions that hybridize to each other or to a complement of the other portion.
  • Two or more different types of primer e.g., different in sequence
  • the primers are substantially homogeneously dispersed over the support or immobilization site.
  • two different immobilization sites are spatially separated subcomponents (e.g., portions or areas) of a single support and/or are on different (e.g., structurally disconnected) supports.
  • at least one immobilization site includes the entire surface of the support or the entire volume of a support.
  • the immobilized primers are optionally uniformly distributed over the one or more supports or immobilization sites.
  • the two different immobilization sites are located in a predetermined arrangement in or on a shared support (e.g. in a grid pattern).
  • the metes, bounds or positioning of one or more immobilization sites is not known or predetermined before immobilization of the template to the support.
  • the support comprises multiple immobilized primers, and the primer to which a starting template hybridizes (e.g., before any amplification occurs) can be considered to be included within (e.g., a central point of) the immobilization site for that template.
  • the positioning of an immobilization site is determined during or after hybridization of the primer to the template.
  • the metes and bounds of an immobilization site can also be determined during or after extension and/or amplification.
  • a population of nucleic acids is considered clonal if a substantial portion of its members have substantially identical (or substantially complementary) sequence. It will be understood that members of a population need not be 100% identical or complementary, e.g., a certain number of "errors" may occur during the course of synthesis. In an embodiment, at least 50% of the members of a population are substantially identical (or complementary) to each other or to a reference nucleic acid molecule (i.e., a molecule of defined sequence used as a basis for a sequence comparison).
  • At least 60%>, at least 70%>, at least 80%>, at least 90%>, at least 95%, at least 99%, or more of the members of a population are substantially identical (or complementary) to the reference nucleic acid molecule.
  • Two molecules can be considered substantially identical if the percent identity between the two molecules is at least 75%, 80%>, 85%, 90%, 95%, 98%, 99%, 99.9% or greater, when optimally aligned.
  • Two molecules can be considered substantially complementary if the percent complementarity between the two molecules is at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.9% or greater, when optimally aligned.
  • references to templates, initializing oligonucleotides, extension probes, primers, etc. can refer to populations or pools of nucleic acid molecules that are substantially identical within a relevant portion, rather than single molecules.
  • a "template” can refer to a plurality of substantially identical template molecules; a “probe” can refer to a plurality of substantially identical probe molecules, etc.
  • probes that are degenerate at one or more positions
  • sequence of the probe molecules that comprise a particular probe will differ at the degenerate positions, i.e., the sequences of the probe molecules that constitute a particular probe may be substantially identical only at the nondegenerate position(s).
  • These terms within this application are intended to provide support for either a population or a molecule. Where it is intended to refer to a single nucleic acid molecule (i.e., one molecule), the terms "template molecule”, “probe molecule”, “primer molecule”, etc., may be used instead. In certain instances the plural nature of a population of substantially identical nucleic acid molecules will be explicitly indicated.
  • Tempolate "oligonucleotide”, “probe”, “primer”, “template”, “nucleic acid” and the like are intended to be interchangeable terms herein. These terms refer to polynucleotides, not necessarily limited to any length or function. The same nucleic acid can be regarded as a “template”, “probe” or “primer” depending on the context, and can switch between these roles with time.
  • a “polynucleotide,” also called a “nucleic acid,” is a linear polymer of two or more nucleotides joined by covalent internucleosidic linkages, or variant or functional fragments thereof.
  • the internucleoside linkage is typically a phosphodiester bond.
  • other examples optionally comprise other internucleoside linkages, such as phosphorothiolate linkages and may or may not comprise a phosphate group.
  • Polynucleotides include double- and single-stranded DNA, as well as double- and single- stranded R A, DNA:R A hybrids, peptide-nucleic acids (PNAs) and hybrids between PNAs and DNA or RNA, and also include known types of modifications.
  • Polynucleotides can optionally be attached to one or more non-nucleotide moieties such as labels and other small molecules, large molecules such proteins, lipids, sugars, and solid or semi-solid supports, for example through either the 5 ' or 3' end.
  • Labels include any moiety that is detectable using a detection method of choice, and thus renders the attached nucleotide or polynucleotide similarly detectable using a detection method of choice.
  • the label emits electromagnetic radiation that is optically detectable or visible.
  • the nucleotide or polynucleotide is not attached to a label, and the presence of the nucleotide or polynucleotide is directly detected.
  • nucleotide refers to a nucleotide, nucleoside or analog thereof.
  • the nucleotide is an N- or C-glycoside of a purine or pyrimidine base, (e.g., deoxyribonucleoside containing 2-deoxy-D-ribose or ribonucleoside containing D-ribose).
  • a purine or pyrimidine base e.g., deoxyribonucleoside containing 2-deoxy-D-ribose or ribonucleoside containing D-ribose.
  • examples of other analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral- methyl phosphonates, 2-O-methyl ribonucleotides.
  • nucleic acid by any one of these terms should not be taken as implying that the nucleic acid has any particular activity, function or properties.
  • the word “template” does not indicate that the "template” is being copied by a polymerase or that the template is not capable of acting as a "primer” or a "probe”.
  • nucleic acid reagents involved in amplification such as a template, probe, primer, etc.
  • this other portion does not serve any template, probe, or primer function.
  • a nucleic acid that substantially hybridizes to an optionally-immobilized primer e.g., on an immobilization site
  • Any one or more nucleic acid reagents that are involved in template walking (template, immobilized strands, immobilized or unimmobilized primer, etc.) may be generated before or during amplification from other nucleic acids.
  • the nucleic acid reagent is optionally generated from (and need not be identical to) an input nucleic acid by making one or more modifications to the nucleic acid that was initially introduced into the template walking medium.
  • An input nucleic acid can for example be subjected to restriction digestion, ligation, one or more amplification cycles, denaturation, mutation, etc, to generate a nucleic acid that serves as the template, primer, etc, during amplification or further amplification.
  • a double-stranded input nucleic acid can be denatured to generate a first single-stranded nucleic acid which optionally is used to generate a second complementary strand. If so desired, the first single-stranded nucleic acid can be considered the "template" for our purposes herein.
  • the second complementary strand generated from the first single-stranded nucleic acid can be considered the "template" for our purposes herein.
  • a template is derived from an input nucleic acid and is not necessarily identical to the input nucleic acid.
  • the template can comprise additional sequence not present an input nucleic acid .
  • the template can be an amplicon generated from an input nucleic acid using one or more primers with a 5' overhang that is not complementary to the input nucleic acid.
  • amplifying refers to production of copies of a nucleic acid molecule, for example via repeated rounds of primed enzymatic synthesis.
  • amplifying takes place with an immobilized template nucleic acid molecule and/or one or more primers that are immobilized.
  • An amplicon is for example a single-stranded or double-stranded nucleic acid that is generated by an amplification procedure from a starting template nucleic acid.
  • the amplicon comprises a nucleic acid strand, of which at least a portion is substantially identical or substantially complementary to at least a portion of the starting template.
  • an amplicon comprises a nucleic acid strand that is substantially identical to at least a portion of one strand and is substantially complementary to at least a portion of either strand.
  • the amplicon can be single-stranded or double-stranded irrespective of whether the initial template is single-stranded or double-stranded.
  • support includes any solid or semisolid article on which reagents such as nucleic acids can be immobilized. Nucleic acids may be immobilized on the solid support by any method including but not limited to physical adsorption, by ionic or covalent bond formation, or combinations thereof.
  • a solid support may include a polymeric, a glass, or a metallic material. Examples of solid supports include a membrane, a planar surface, a microtiter plate, a bead, a filter, a test strip, a slide, a cover slip, and a test tube, means any solid phase material upon which a oligomer is synthesized, attached, ligated or otherwise immobilized.
  • a support can optionally comprise a "resin", “phase”, "surface” and "support”.
  • a support may be composed of organic polymers such as polystyrene, polyethylene, polypropylene,
  • a support may also be inorganic, such as glass, silica, controlled-pore-glass (CPG), or reverse-phase silica.
  • CPG controlled-pore-glass
  • the configuration of a support may be in the form of beads, spheres, particles, granules, a gel, or a surface. Surfaces may be planar, substantially planar, or non- planar. Supports may be porous or non-porous, and may have swelling or non-swelling characteristics.
  • a support can be shaped to comprise one or more wells, depressions or other containers, vessels, features or locations.
  • a plurality of supports may be configured in an array at various locations.
  • a support is optionally addressable (e.g., for robotic delivery of reagents), or by detection means including scanning by laser illumination and confocal or deflective light gathering.
  • An amplification support e.g., a bead
  • can be placed within or on another support e.g., within a well of a second support.
  • the solid support is a "microparticle,” “bead” “microbead”, etc., (optionally but not necessarily spherical in shape) having a smallest cross-sectional length (e.g., diameter) of 50 microns or less, preferably 10 microns or less, 3 microns or less, approximately 1 micron or less, approximately 0.5 microns or less, e.g., approximately 0.1, 0.2, 0.3, or 0.4 microns, or smaller (e.g., under 1 nanometer, about 1-10 nanometer, about 10-100 nanometers, or about 100-500 nanometers).
  • Microparticles may be made of a variety of inorganic or organic materials including, but not limited to, glass (e.g., controlled pore glass), silica, zirconia, cross-linked polystyrene, polyacrylate, polymehtymethacrylate, titanium dioxide, latex, polystyrene, etc.
  • Magnetization can facilitate collection and concentration of the microparticle-attached reagents (e.g., polynucleotides or ligases) after amplification, and can also facilitate additional steps (e.g., washes, reagent removal, etc.).
  • reagents e.g., polynucleotides or ligases
  • a population of microparticles having different shapes sizes and/or colors can be used.
  • the microparticles can optionally be encoded, e.g., with quantum dots such that each microparticle can be individually or uniquely identified.
  • the disclosure relates generally to methods, compositions, systems, apparatuses and kits for clonally amplifying one or more nucleic acid templates to form clonally amplified populations of nucleic acid templates.
  • Any amplification method described herein optionally comprises repeated cycles of nucleic acid amplification.
  • a cycle of amplification optionally comprises (a) hybridization of primer to a template strand, (b) primer extension to form a first extended strand, (c) partial or incomplete denaturation of the extended strand from the template strand.
  • the primer that hybridizes to the template strand (designated "forward" primer for convenience) is optionally immobilized on or to a support.
  • the support is for example solid or semi-solid.
  • the denatured portion of the template strand from step (c) is free to hybridize with a different forward primer in the next amplification cycle.
  • primer extension in a subsequent amplification cycle involves displacement of the first extended strand from the template strand.
  • a second "reverse" primer can for example be included which hybridizes to the 3' end of the first extended strand.
  • the reverse primer is optionally not immobilized.
  • the templates are amplified using primers immobilized on/to one or more solid or semi-solid supports.
  • the support comprises immobilized primers that are complementary to a first portion of a template strand.
  • the support does not significantly comprise an immobilized primer that is homologous to a second non-overlapping portion of the same template strand. The two portions are non-overlapping if they do not contain any subportions that hybridize to each other or to a complement thereof.
  • the support optionally does not significantly comprise an immobilized primer that can hybridize to the complement of the template strand).
  • a plurality of nucleic acid templates are amplified simultaneously in a single continuous liquid phase in the presence of one or more supports, where each support comprises one or more immobilization sites.
  • each template is amplified to generate a clonal population of amplicons, where individual clonal populations are immobilized within or on a different support or immobilization site from other amplified populations.
  • the amplified populations remain substantially clonal after amplification.
  • a template is for example amplified to generate clonal populations which comprise template- homologous strands (called “template strands” or “reverse strands” herein) and/or template-complementary strands (called “primer strands” or “forward strands” herein).
  • template strands or “reverse strands” herein
  • primer strands or “forward strands” herein.
  • clonality is maintained in the resulting amplified nucleic acid populations by maintaining association between template strands and its primer strands, thereby effectively associating or "tethering" associated clonal progeny together and reducing the probability of cross-contamination between different clonal populations.
  • one or more amplified nucleic acids in the clonal population is attached to a support.
  • a clonal population of substantially identical nucleic acids can optionally have a spatially localized or discrete macroscopic appearance.
  • a clonal population can resemble a distinct spot or colony (e.g., when distributed in a support, optionally on the outer surface of the support).
  • the disclosure relates generally to novel methods of generating a localized clonal population of clonal amplicons, optionally immobilized in/to/on one or more supports.
  • the support can for example be solid or semisolid (such as a gel or hydrogel).
  • the amplified clonal population is optionally attached to the support's external surface or can also be within the internal surfaces of a support (e.g., where the support has a porous or matrix structure).
  • amplification is achieved by multiple cycles of primer extension along a template strand of interest (also called a "reverse" strand).
  • a primer that hybridizes to the template strand of interest is termed a “forward” primer, and is optionally extended in template-dependent fashion to form a "forward" strand that is complementary to the template strand of interest.
  • the forward strand is itself hybridized by a second primer termed the "reverse" primer, which is extended to form a new template strand (also called a reverse strand).
  • the new template strand also called a reverse strand
  • at least a portion of the new template strand is homologous to the original template (“reverse") strand of interest.
  • one or more primers can be immobilized in/on/to one or more supports.
  • one primer is immobilized by attachment to a support.
  • a second primer can be present and is optionally not immobilized or attached to a support.
  • Different templates can for example be amplified onto different supports or immobilization sites simultaneously in a single continuous liquid phase to form clonal nucleic acid populations.
  • a liquid phase can be considered continuous if any portion of the liquid phase is in fluid contact or communication with any other portion of the liquid body.
  • a liquid phase can be considered continuous if no portion is entirely subdivided or compartmentalized or otherwise entirely physically separated from the rest of the liquid body.
  • the liquid phase is flowable.
  • the continuous liquid phase is not within a gel or matrix.
  • the continuous liquid phase is within a gel or matrix.
  • the continuous liquid phase occupies pores, spaces or other interstices of a solid or semisolid support.
  • one or more primers are optionally immobilized on a support.
  • the support is the gel or matrix itself.
  • the support is not the gel or matrix itself.
  • one primer is immobilized on a solid support contained within a gel and is not immobilized to gel molecules.
  • the support is for example in the form of a planar surface or one or more microparticles.
  • the planar surface or plurality of microparticles comprises forward primers having substantially identical sequence.
  • the support does not contain significant amounts of a second different primer.
  • a second non-immobilized primer is in solution within the gel.
  • the second non-immobilized primer for example binds to a template strand (i.e., reverse strand), whereas the immobilized primer binds to a forward strand.
  • a forward primer binds to a forward-primer binding sequence ("forward PBS") on a reverse strand
  • a reverse primer binds to a reverse PBS on the forward strand
  • An embodiment includes a method of primer extension, comprising: (a) a primer- hybridization step, (b) an extension step, and (c) a walking step.
  • the primer- hybridization step comprises hybridizing a first primer molecule ("first forward primer”) to a complementary forward-primer-binding sequence ("forward PBS") on a nucleic acid strand ("reverse strand").
  • the extension step comprises generating an extended first forward strand that is a full-length complement of the reverse strand and is hybridized thereto.
  • the extended first forward strand is for example generated by extending the first forward primer molecule in template-dependent fashion using the reverse strand as template.
  • the walking step comprises hybridizing a second primer ("second forward primer”) to the forward PBS where the reverse strand is also hybridized to the first forward strand.
  • the walking step comprises denaturing at least a portion of the forward PBS from the forward strand ("free portion"), where another portion of the reverse strand remains hybridized to the forward strand.
  • the primer extension method is an amplification method, in which any one or more steps of primer-hybridization, extension and/or walking are repeated at least once.
  • the method can comprise amplifying the forward strand by one or more amplification cycles.
  • An amplification cycle optionally comprises extension and walking.
  • An exemplary amplification cycle comprises or consists essentially of extension followed by walking.
  • the second forward primer of a first amplification cycle acts as the first forward primer of a subsequent amplification cycle.
  • the second forward primer of a walking step in a first amplification cycle acts as the first forward primer of an extension step of a subsequent amplification cycle.
  • the method of primer extension or amplification further comprises extending or amplifying the reverse strand by (a) hybridizing a first reverse primer molecule to a complementary reverse-primer-binding sequence ("reverse PBS") on an extended forward strand; (b) generating an extended first reverse strand that is a full-length complement of the forward strand and hybridized thereto, by extending the first reverse primer molecule in template-dependent fashion using the forward strand as template; and (c) hybridizing a second primer (“second reverse primer”) to the reverse PBS where the forward strand is also hybridized to the first reverse strand.
  • reverse PBS complementary reverse-primer-binding sequence
  • steps (b)-(c) are optionally performed, wherein the second reverse primer of step (c) is the first reverse primer of repeated step (b); and wherein a substantial proportion of forward strands are hybridized to reverse strands at all times during or between said one or more repetitions.
  • the substantial proportion is optionally at least 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99%.
  • the reverse strand and/or forward strand is not exposed to totally-denaturing conditions that would result in complete separation of a significant fraction (e.g., more than 10%>, 20%>, 30%>, 40%> or 50%>) of a large plurality of strands from their extended and/or full-length complements.
  • a significant fraction e.g., more than 10%>, 20%>, 30%>, 40%> or 50%>
  • a substantial proportion of forward and/or reverse strands are optionally hybridized to extended and/or full-length complements at all times during or between one or more amplification cycles (e.g., 1, 5, 10, 20, or all amplification cycles performed).
  • the substantial proportion of strands is optionally at least 60%>, 65%, 70%, 75%, 80%), 85%), 90%), 95% or 99% of strands. In an embodiment this is achieved by maintaining the amplification reaction at a temperature higher than the T m of unextended primers, but lower than the T m of the primer-complementary strands.
  • amplification conditions are kept within a temperature that is higher than the T m of unextended forward primers, but lower than the T m of extended or full-length reverse strands. Also for example, amplification conditions are kept within a temperature that is higher than the T m of unextended reverse primers, but lower than the T m of extended or full-length forward strands.
  • one or more forward primers, and/or one or more reverse primers are breathable, e.g., have a low T m .
  • at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% of nucleotide bases of a breathable primer are adenine, thymine or uracil or are complementary to adenine, thymine or uracil.
  • the T m of a nucleic acid strand is for example the temperature at which at least a desired fraction of a clonal population of duplexes are rendered completely single-stranded under the chosen reagent conditions, where an individual duplex comprises the nucleic acid strand in question hybridized to its full-length complement.
  • the desired fraction is 50%.
  • the desired fraction is optionally at least 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99%.
  • the T m (N) is theoretically predicted using known methods, e.g., as discussed herein.
  • the T m is empirically measured by known methods, (e.g., Spink,
  • the T m for a desired fraction can be depicted as T m (N) where N denotes the desired fraction in percentage terms.
  • the T m (50) of the forward and/or reverse primer (at which 50% of all primer molecules are completely dissociated from their complementary PBSs) is not more than 50 °C, 55 °C, 60° C, 65 °C, 70 °C, 75 °C or 80 °C.
  • the T m (50) of the extended or full-length forward and/or reverse strands is not less than 80 °C, 75 °C, 70 °C, 65 °C, 60° C or 55 °C.
  • the T m (80) of the forward and/or reverse primer is not more than 50 °C, 55 °C, 60° C, 65 °C, 70 °C, 75 °C or 80 °C.
  • the T m (80) of the extended or full-length forward and/or reverse strands is not less than 80 °C, 75 °C, 70 °C, 65 °C, 60° C or 55 °C.
  • the T m (90) of the forward and/or reverse primer is not more than 50 °C, 55 °C, 60° C, 65 °C, 70 °C, 75 °C or 80 °C.
  • the T m (90) of the extended or full-length forward and/or reverse strands is not less than 80 °C, 75 °C, 70 °C, 65 °C, 60° C or 55 °C.
  • the T m (95) of the forward and/or reverse primer is not more than 50 °C, 55 °C, 60° C, 65 °C, 70 °C, 75 °C or 80 °C.
  • the T m (95) of the extended or full-length forward and/or reverse strands is not less than 80 °C, 75 °C, 70 °C, 65 °C, 60° C or 55 °C.
  • the T m (99) of the extended or full-length forward and/or reverse strands is not less than 80 °C, 75 °C, 70 °C, 65 °C, 60° C or 55 °C.
  • the T m (95) of the forward and/or reverse primer is not more than 50 °C, 55 °C, 60° C, 65 °C, 70 °C, 75 °C or 80 °C.
  • the T m (99) of the extended or full-length forward and/or reverse strands is not less than 80 °C, 75 °C, 70 °C, 65 °C, 60° C or 55 °C.
  • one or more amplification cycles are performed at temperature that is higher than the T m (70) of an unextended primer and lower than the T m (20) of the complementary full-length strand.
  • the temperature is higher than the T m (80) of an unextended primer and lower than the T m (20) or T m (15) or T m (10) or T m (5) or T m (l) of the complementary full-length strand.
  • the temperature is higher than the T m (90) of an unextended primer and lower than the T m (20) or T m (15) or T m (10) or T m (5) or T m (l) of the complementary full-length strand. Also for example the temperature is higher than the T m (95) of an unextended primer and lower than the T m (20) or T m (15) or T m (10) or T m (5) or T m (l) of the complementary full-length strand. Also for example the temperature is higher than the T m (98) of an unextended primer and lower than the T m (20) or T m (15) or T m (10) or T m (5) or T m (l) of the complementary full-length strand.
  • the temperature is higher than the T m (99) of an unextended primer and lower than the T m (20) or T m (15) or T m (10) or T m (5) or T m (l) of the complementary full-length strand.
  • the one or more amplification cycles are performed at temperature that is at least 5, 10, 15, 20, 25, 30, 35, or 45 °C higher than the T m (50) of an unextended primer.
  • the temperature is at least 5, 10, 15, 20, 25, 30, 35, or 45 °C lower than the T m (50) of a full-length primer-complementary strand.
  • the unextended primer is a forward primer and the complementary full-length strand is a reverse strand, or vice versa.
  • template-dependent extension of a forward primer using a reverse strand as template in the extension step results in displacement of another forward strand that was already hybridized to the reverse strand.
  • template-dependent extension of a reverse primer using a forward strand as template in the extension step results in displacement of another reverse strand that was already hybridized to the forward strand.
  • the method further comprises completely separating the extended forward strands from reverse strands after performing primer extension or a desired number of amplification cycles, and optionally removing separated forward strands from the presence of separated immobilized reverse strands, or vice versa.
  • one or more nucleic acid reagents are not in contact with a recombinase and/or reverse transcriptase and/or helicase and/or nicking enzyme and/or any other enzyme that is not a polymerase during any one or more steps.
  • a recombinase and/or reverse transcriptase and/or helicase and/or nicking enzyme and/or any other enzyme that is not a polymerase during any one or more steps are not in contact with one or more such enzymes at any time.
  • Denaturation is optionally achieved non-enzymatically, e.g., by raising the temperature.
  • amplification is performed under substantially isothermal conditions, as described herein.
  • any one or more nucleic acids e.g., primers are attached (e.g., covalently attached) to a support.
  • the first and/or second forward primers are immobilized to a single (same) support.
  • first and second forward primers are closely immobilized to the same support, whereby amplification generates an immobilized clonal population of extended forward strands.
  • the distance between the first and second forward primers is not more than twice the length of the primer or the PBS.
  • a plurality of template nucleic acids are individually hybridized to spatially-separated immobilization sites, whereby amplification generates spatially-separated clonal populations corresponding to individual template nucleic acids.
  • first forward primer is hybridized to a forward PBS on a "reverse" template strand.
  • the first forward primer is immobilized on a support.
  • the first forward primer can be extended along the reverse strand to form (an extended) first forward strand.
  • the extension is optionally template-dependent, using the reverse strand as a template.
  • the first forward strand and the reverse strand are optionally hybridized to each other in a duplex.
  • the PBS of the first reverse strand and the forward- primer portion of the first forward strand are separated from one another (e.g., via denaturation or melting), but the first reverse strand and the first forward strand remain associated with (e.g., hybridized to) each other over another portion.
  • the separated portion of the reverse strand including at least part of the forward-PBS can then be annealed (e.g., by hybridization) to a second, different forward primer.
  • the second forward primer is immobilized on a support.
  • the second forward primer can for example be immobilized on the same support as the first forward primer, and is optionally situated sufficiently close to the first primer so that the a portion of the reverse strand can hybridize to the first forward strand while another portion of the reverse strand is hybridized to the second forward primer simultaneously.
  • the second forward primer can then be extended in turn to form an extended second forward strand.
  • the second forward primer is extended along the reverse strand in a template-dependent fashion. Extension of the second forward primer optionally displaces the first forward strand from the reverse strand.
  • the primer binding sequence of the reverse strand can be separated from the primer portion of the second forward strand, where another portion of the reverse strand remains associated (e.g., by hybridization) with the second forward strand.
  • the process can optionally be repeated for a desired number of amplification cycles to provide a population of amplified, immobilized nucleic acid molecules.
  • the population can be substantially clonal in nature.
  • the amplified nucleic acid molecules of the amplified clonal population can include a plurality of nucleic acids that are substantially identical and/or substantially complementary to each other.
  • the extended forward strands comprise a reverse-primer-binding sequence ("reverse PBS"), to which a reverse primer hybridizes.
  • reverse PBS reverse-primer-binding sequence
  • the reverse PBS on the forward strand optionally comprises or is near the 3' end of the forward strands.
  • amplification involves dissociating least part of the reverse PBS from any hybridized or associated sequence, such as sequence on a reverse strand.
  • the reverse PBS on the forward strand is optionally contacted with a reverse primer which hybridizes to it.
  • the reverse primer is then extended using the forward strand as template to form an extended reverse strand.
  • the newly-generated reverse strand acts as template for forward primer extension.
  • the reverse strand can also participate as template, primer, or probe in another reaction, including any method described herein.
  • the amplified nucleic acid populations can be used for many different purposes, including sequencing, screening, diagnosis, in situ nucleic acid synthesis, monitoring gene expression, nucleic acid fingerprinting, etc.
  • any one or more primer extension and/or amplification methods herein generate one or more immobilized nucleic-acid extension products.
  • a solid support comprises primers that all identical or substantially identical.
  • the solid support can comprise other nucleic acids.
  • these other nucleic acids do not hybridize to a template strand of interest or its complement.
  • the solid support optionally does not comprise any other nucleic acid which hybridizes to the template strand of interest or its complement.
  • the disclosure relates generally to methods, compositions, systems, apparatuses and kits for clonally amplifying a nucleic acid template onto a support in an amplification reaction solution.
  • the nucleic acid template is contacted with a support in a solution comprising a continuous liquid phase.
  • the support can include a population of primers, including at least a first primer and a second primer.
  • the population of primers can be immobilized on the support, for example by covalent attachment to the support.
  • the nucleic acid template includes a primer binding sequence adjacent to a target sequence.
  • the primer binding sequence can by complementary to a sequence of the first primer and optionally a sequence of the second primer.
  • the target sequence can be
  • the primer binding sequence of the nucleic acid template is hybridized to the first primer.
  • the first primer can be extended along the template using a polymerase, thereby forming an extended first primer.
  • At least a portion of the primer binding sequence of the template can be separated (e.g., denatured or melted) from the extended first primer.
  • the separating is optionally performed while maintaining hybridization between a portion of the template and the extended first primer.
  • the separated portion of the primer binding sequence can be subsequently hybridized to the second primer.
  • hybridization is performed while maintaining hybridization between the other portion of the template and the extended first primer.
  • the second primer can be extended along the template using a polymerase, thereby forming a support including an extended first primer and an extended second primer.
  • the extended portion of the extended first primer and/or the extended second primer can include sequence complementary to the target sequence.
  • the disclosure relates generally to methods for clonally amplifying a nucleic acid template onto a support in an amplification reaction solution, comprising: contacting a nucleic acid template with a support in a liquid solution, wherein the support includes a population of immobilized primers including at least a first primer and a second primer, and wherein the nucleic acid template includes a primer binding sequence adjacent to a target sequence, where the primer binding sequence is complementary to a sequence of the first primer and a sequence of the second primer, and the target sequence is noncomplementary to the primers in the population; hybridizing the primer binding sequence of the nucleic acid template to the first primer; extending the first primer along the template using a polymerase, thereby forming an extended first primer; denaturing at least a portion of the primer binding sequence of the template from the extended first primer while maintaining hybridization between another portion of the template and the extended first primer; hybridizing the denatured portion of the primer binding sequence to the second primer while maintaining hybridization between
  • the population of primers can be comprised of substantially identical primers that differ in sequence by no more than one, two, three, four or five nucleotides.
  • the primer population is comprised of different primers, at least some of which include a sequence that is complementary to the primer binding sequence of the template.
  • the primers of population are noncomplementary to the sequence of the 5 ' terminal half of the template.
  • the primers of the population are noncomplementary to the sequence of the 3' terminal half of any of the extended primers of the support.
  • the primers of the population are noncomplementary to any sequence of the template other than the primer binding sequence.
  • the disclosure relates generally to methods for clonally amplifying a population of nucleic acid templates onto a population of supports in an
  • amplification reaction solution comprising: clonally amplifying a first template onto a first nucleic acid template onto a first support according to any of the methods disclosed herein, and clonally amplifying a second nucleic acid template onto a second support according to the same method, wherein both supports are included within a single continuous liquid phase during the amplifying.
  • references to templates, initializing oligonucleotides, extension probes, primers, etc. can in some embodiments refer to populations or pools of nucleic acid molecules that are substantially identical within a relevant region rather than single molecules.
  • a "template” can in some embodiments refer to a plurality of substantially identical templates;
  • a "probe” can in some embodiments refer to a plurality of substantially identical probe molecules, etc.
  • probes that are degenerate at one or more positions it will be appreciated that the sequence of the probe molecules that comprise a particular probe will differ at the degenerate positions, i.e., the sequences of the probe molecules that constitute a particular probe may be substantially identical only at the nondegenerate position(s).
  • the singular form can be used to refer not only to single molecules but also to populations of substantially identical molecules. In certain instances the singular nature of a nucleic acid molecule, or the plural nature of a population of substantially identical nucleic acid molecules, will be explicitly indicated.
  • members of a population need not be 100% identical.
  • all members of a clonally amplified population of nucleic acid sequence need not be identical since a certain number of "errors" may occur during the course of synthesis; similarly, not all primers within a population of primers may be identical to each other.
  • at least 50% of the members of a population are identical to a reference nucleic acid molecule (i.e., a molecule of defined sequence used as a basis for a sequence comparison).
  • at least 50%> of the members of a population are at least 70%>, 75%, 85%, 90%, or more preferably at least 95% identical to a reference nucleic acid molecule.
  • At least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or more of the members of a population are at least 85%, 90%, or more preferably at least 95% identical, or yet more preferably at least 99% identical to the reference nucleic acid molecule.
  • the percent identity of at least 95% or more preferably at least 99% of the members of the population to a reference nucleic acid molecule is at least 98%>, 99%, 99.9% or greater.
  • Percent identity may be computed by comparing two optimally aligned sequences, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions, and multiplying the result by 100 to yield the percentage of sequence identity.
  • a nucleic acid molecule such as a template, probe, primer, etc., may be a portion of a larger nucleic acid molecule that also contains a portion that does not serve a template, probe, or primer function. In that case individual members of a population need not be substantially identical with respect to that portion.
  • a nucleic acid optionally comprises one or more nucleotides.
  • a nucleotide comprises any one or more of a nucleobase (nitrogenous base), a five-carbon sugar (either ribose or 2'-deoxyribose), and a phosphate group.
  • a nucleotide comprises all three components or derivatives thereof.
  • the nucleobases is a purine or a pyrimidine base.
  • Exemplary purine bases include adenine and guanine, while exemplary pyrimidines are thymine, uracil and cytosine
  • complementary nucleotides can form base pairs with each other, such as the A-T/U and G-C base pairs formed through specific Watson-Crick type hydrogen bonding between the nucleobases of nucleotides and/or polynucleotides positions antiparallel to each other; other types of base pairing can also occur.
  • the complementarity of other artificial base pairs can be based on other types of hydrogen bonding and/or hydrophobicity of bases and/or shape complementarity between bases.
  • nucleic acid sequences refers to nucleic acid sequences that can undergo cumulative base pairing with each other at two or more individual corresponding positions in antiparallel orientation, as in a hybridized duplex. Optionally there can be “complete” or “total”
  • two nucleic acid sequences can be complementary when at least 50% of the nucleotide residues of one nucleic acid sequence are complementary to nucleotide residues in the other nucleic acid sequence.
  • complementary nucleic acid sequence need not always be contiguous with each other, and can be interrupted by one or more noncomplementary residues within the complementary nucleic acid sequence. In some embodiments, at least 50%, but less than 100%, of the residues of one of the two complementary nucleic acid sequences are complementary to residues in the other nucleic acid sequence. In some embodiments, at least 70%>, 80%>, 90%>, 95% or 99% of the residues of one nucleic acid sequence are complementary to residues in the other nucleic acid sequence. Sequences are said to be "substantially complementary" when at least 85% of the residues of one nucleic acid sequence are complementary to residues in the other nucleic acid sequence.
  • complementary when used in reference to two or more nucleic acid molecules, can include any nucleic acid molecules where each molecule comprises a sequence that is complementary to a sequence in the other nucleic acid molecules.
  • the complementary nucleic acid molecules need not be complementary across their entire length, and each molecule can include one or more regions that is noncomplementary to the other molecules.
  • a template and a primer molecule can be referred to as “complementary” even when they are of different lengths; in some embodiments, the template can be longer than the primer and include sequence that is noncomplementary to any sequence of the primer, or vice versa.
  • noncomplementary and its variants typically refers to nucleic acid molecules or sequences in which less than 50% of the residues of one nucleic acid molecule or sequence are
  • nucleic acid molecule or sequence complementary to residues in the other nucleic acid molecule or sequence.
  • a "mismatch” is present at any position in the nucleic acid molecule molecules or sequences where the two opposed nucleotides are not complementary.
  • two nucleotide sequences or portions thereof are considered to match each other if the sequences or portions are identical or complementary to each other.
  • hybridization refers to the process of base pairing between any two nucleic acid molecules including complementary nucleotides at one or more positions.
  • base pairing can occur according to established paradigms, for example the Watson-Crick paradigm wherein A-T/U and G-C base pairs are formed through specific
  • hybridization can occur according to non- Watson Crick paradigms as well; for example, artificial base pairs can be formed through other types of hydrogen bonding and/or hydrophobicity of bases and/or shape complementarity between bases.
  • the hybridized nucleic acid molecules need not be hybridized across their entire length, and each molecule can include one or more regions not hybridized to the other molecule.
  • a template and a primer molecule can be described as hybridized to each other even when a substantial region of the template, primer or both remain non-hybridized to each other.
  • a region of hybridization can include one or more contiguous nucleotides that are not base paired with each other.
  • nucleic acid molecules (or sequences within nucleic acid molecules) that are base paired with each other in this manner are referred to as "hybridized”.
  • a single nucleic acid molecule may undergo self-hybridization (e.g., hairpin formation) with itself.
  • hybridizing nucleic acid molecules includes contacting nucleic acid molecules with each other under conditions where one or more nucleotide residues within each nucleic acid molecule base pairs with one or more nucleotides of another nucleic acid molecule.
  • the contacting can be performed using any suitable conditions, depending on the desired application.
  • two nucleic acid molecules are contacted in a buffered solution comprising salts and/or detergents, e.g., SDS, for a desired length of time and for a desired period.
  • the hybridization can be performed using low stringency, medium stringency or high stringency hybridization conditions.
  • the stringency of hybridization can be adjusted by varying various hybridization parameters, including for example temperature, salt concentration, SDS concentration, at the like. Methods of hybridization and of controlling the stringency of hybridization are well known in the field.
  • a method is provided of generating a localized clonal population of immobilized clonal amplicons of a single-stranded template sequence, comprising: (a) attaching the single-stranded template sequence ("template 1") to an immobilization site ("ISl"), wherein ISl comprises multiple copies of an immobilized primer ("ISl primer”) which can hybridize substantially to template 1, and template 1 is attached to ISl by hybridization to an ISl primer, and (b) amplifying template 1 using ISl primer and a non-immobilized primer ("SP1 primer”) in solution, wherein amplified strands that are complementary to the single-stranded template 1 cannot hybridize substantially when single-stranded to primers on IS 1 , wherein amplification generates a localized clonal population of immobilized clonal amplicons around the point of initial hybridization of template 1 to ISl .
  • template 1 a first template sequence
  • template 2 a second template sequence
  • template 2 comprising amplifying the first and second template sequence to generate a population of clonal amplicons of template 1 substantially attached to first immobilization site (“ISl”) and not to a second immobilization site (“IS2”), or a population of clonal amplicons of template 2 substantially attached to IS2 and not to ISl, wherein: (a) both templates and all amplicons are contained within the same continuous liquid phase, where the continuous liquid phase is in contact with a first and second immobilization site (respectively, "ISl "and “IS2”), and where ISl and IS2 are spatially separated, (b) template 1 when in single-stranded form comprises a first subsequence (“Tl-FOR”) at one end, and a second subsequence (“Tl-REV”) at its opposite end, (c) template 2 when in single-stranded form comprises a first subsequence (“T2-FOR”) at one end, and a second subsequence (“T2-REV”) at
  • template 1 a first template sequence
  • template 2 a second template sequence
  • template 2 comprising amplifying the first and second template sequence, wherein: (a) both templates are in single-stranded form and are both contained within the same continuous liquid phase, where a first and second immobilization site (respectively, "ISl "and “IS2”) are in contact with said continuous liquid phase, and where ISl and IS2 are spatially separated, (b) template 1 comprises a first subsequence (“Tl-FOR”) at its 3' end, and a second subsequence (“Tl-REV”) that is non-overlapping with Tl-FOR and at its 5' end, (c) template 2 comprises a first subsequence (“T2-FOR”) at its 3' end, and a second subsequence (“T2-REV”) that is non- overlapping with T2-FOR and at its 5' end, (d) ISl comprises an immobilized primer (“ISl primer”) that can hybridize to both Tl-FOR and T2-FOR, (e) IS2 comprises an immobilized primer ("ISl primer
  • amplification results in a population of clonal amplicons of template 1 substantially attached to ISl and not to IS2, and/or a population of clonal amplicons of template 2 substantially attached to IS2 and not to ISl .
  • the continuous medium is flowable.
  • intermixing of non-immobilized nucleic acid molecules is substantially unretarded in the continuous liquid phase during at least a portion of the amplification process, e.g., during any one or more steps or cycles described herein.
  • intermixing is substantially unretarded for a period of time during amplification.
  • intermixing is substantially unretarded during the entire duration of amplification.
  • any nucleic acid that has dissociated from one immobilization site is capable of substantially hybridizing to both immobilization sites and any movement (e.g., movement by diffusion, convection) of said dissociated nucleic acid to another immobilization site is not substantially retarded in the continuous liquid phase.
  • the continuous liquid phase is in simultaneous contact with IS1 and IS2.
  • a first portion of a template that is bound by an immobilized primer does not overlap with a second portion of the template whose complement is bound by a non-immobilized primer.
  • At least one template to be amplified is generated from an input nucleic acid after the nucleic acid is placed in contact with at least one immobilization site.
  • any method described herein comprising the steps of: (a) contacting a support comprising immobilized primers with a single-stranded nucleic acid template, wherein: hybridizing a first immobilized primer to a primer-binding sequence (PBS) on the template (b) extending the hybridized first primer in template-dependent extension to form an extended strand that is complementary to the template and at least partially hybridized to the template; (c) partially denaturing the template from the extended complementary strand such that at least a portion of the PBS is in single-stranded form ("free portion"); (d) hybridizing the free portion to a non-extended, immobilized second primer (e) extending the second primer in template- dependent extension to form an extended strand that is complementary to the template (f) optionally, separating the annealed extended immobilized nucleic acid strands from one another.
  • PBS primer-binding sequence
  • nucleic acid duplexes are formed comprising a starting template and/or amplified strands; which duplexes are not subjected during amplification to conditions that would cause complete denaturation of a substantial number of duplexes.
  • the single-stranded templates are produced by taking a plurality of input double-stranded or single-stranded nucleic acid sequences to be amplified (which sequence may be known or unknown) and appending or creating a first universal adaptor sequence and a second universal adaptor sequence onto the ends of at least one input nucleic acid; wherein said first universal adaptor sequence hybridizes to IS1 primer and/or IS2 primer, and the reverse complement of said second universal adaptor sequence hybridizes to at least one non-immobilized primer.
  • the adaptors can be double- stranded or single-stranded.
  • first and second nucleic acid adaptor sequences are provided at first and second ends of said single-stranded template sequence.
  • a tag is also added to one or more nucleic acid sequences (e.g., a template or a primer or an amplicons), said tag enabling identification of a nucleic acid containing the tag.
  • nucleic acid sequences e.g., a template or a primer or an amplicons
  • an immobilization site or support has the same sequence.
  • an immobilization site or support comprises a plurality of primers having at least two different sequences.
  • two or more different types of primer e.g., different in sequence
  • the primers of at least one immobilization site or support are substantially homogeneously dispersed over the immobilization site or support.
  • two different immobilization sites are spatially separated subcomponents of a single support and/or are on different unconnected supports.
  • the support forms a three-dimensional matrix and the two different immobilization sites are two different three-dimensional portions of the support that are not completely overlapping.
  • the two different immobilization sites are two different areas on the surface of a support that are not completely overlapping.
  • the two different immobilization sites are on different supports.
  • At least one support can be a bead, e.g., a microbead or nanobead.
  • a bead e.g., a microbead or nanobead.
  • the bead is a" scaffolded nucleic acid polymer particle" or SNAPP, described in U.S. Publ. App. No. 2010-0304982, incorporated by reference.
  • At least one immobilization site includes the entire surface of the support or the entire volume of the support.
  • the two different immobilization sites are located in a predetermined arrangement (e.g. in a grid pattern).
  • one or more immobilization sites are not predetermined (e.g., the support comprises immobilized primers at non-predetermined locations), and the primer to which a starting template hybridizes (e.g., before any amplification occurs) can be considered to be the immobilization site for that template.
  • heating is used to partially separate annealed nucleic acid strands.
  • primer extension is achieved by hybridizing the primer to a template, and contacting with a polymerase and nucleotides. The contacting and hybridizing can be achieved simultaneously or sequentially.
  • one or more nucleotides are detectably labeled.
  • the method further includes the step of treating one or more extended immobilized nucleic acid strands so as to release a nucleic acid molecule or a part thereof.
  • the treating for example can optionally consist of nucleic acid cleavage, e.g., with a restriction endonuclease or with a ribozyme.
  • one or more of said primers has a restriction endonuclease recognition site or a ribozyme recognition site or has part of such a site, which part becomes complete when primer extension occurs.
  • the method is used to amplify a plurality of different nucleic acid sequences, e.g., sequentially or simultaneously.
  • the plurality is for example more than 10 3 , 10 5 , 10 7 , 10 9 , 10 11 , 10 14 , or 10 20 target nucleic acids.
  • Any method herein can be used to provide amplified nucleic acid molecules for diagnosis or for screening or for genotyping, or to provide amplified nucleic acid molecules to be used as a support for other components, or to generate additional nucleic acid molecules in free (e.g., non-immobilized rather than immobilized) form.
  • any method can be used to monitor gene expression, or to identify nucleic acid molecules with gene products that are rarely expressed, identifying heterozygous individuals, nucleic acid fingerprinting.
  • said different nucleic acid sequences are each provided with a first and second nucleic acid "adaptor" sequence as described anywhere herein, said first and second "adaptor" sequences being the same for the each of the different nucleic acid sequences.
  • said different nucleic acid sequences are each provided with a different tag so that the different sequences can be distinguished from one another.
  • amplification is achieved using RPA, i.e., recombinase- polymerase amplification ⁇ see, e.g., WO2003072805, incorporated by reference herein).
  • RPA optionally is carried out without substantial variations in temperature or reagent conditions.
  • partial denaturation and/or amplification can be achieved using a recombinase and/or single-stranded binding protein.
  • Suitable recombinases include RecA and its prokaryotic or eukaryotic homologues, or functional fragments or variants thereof, optionally in combination with single- strand binding proteins (SSBs).
  • the recombinase agent optionally coats single-stranded DNA (ssDNA) such as an amplification primer to form a nucleoprotein filament strand which invades a double-stranded region of homology on a template. This optionally creates a short hybrid and a displaced strand bubble known as a D-loop.
  • the free 3 '-end of the filament strand in the D-loop is extended by DNA polymerases to synthesize a new complementary strand.
  • the complementary strand displaces the originally-paired partner strand of the template as it elongates.
  • one or more of a pair of amplification primers are contacted with one or more recombinase agents before be contacted with a template which is optionally double-stranded.
  • amplification of a template comprises contacting a recombinase agent with one or more of at least one pair of amplification primers, thereby forming one or more "forward" and/or "reverse” RPA primers.
  • recombinase agent that has not associated with the one or more primers is optionally removed.
  • one or more forward RPA primers are then contacted with a template strand, which optionally has a region of complementarity to at least one RPA primer.
  • the template strand can be hybridized to a Contacting of a RPA primer with a complementary template optionally results hybridization between said primer and the template.
  • the the 3' end of the primer is extended along the template with one or more polymerases (e.g., in the presence of dNTPs) to generate a double stranded nucleic acid and a displaced template strand.
  • the amplification reaction can comprise repeated cycles of such contacting and extending until a desired degree of amplification is achievable.
  • the displaced strand of nucleic acid is amplified by a concurrent RPA reaction.
  • the displaced strand of nucleic acid is amplified by contacting it in turn with one or more complementary primers; and (b) extending the
  • the one or more primers comprise a "forward" primer and a "reverse” primer . Placing both primers and the template in contact optionally results in a first double stranded structure at a first portion of said first strand and a double stranded structure at a second portion of said second strand.
  • the 3' end of the forward and/or reverse primer is extended with one or more polymerases to generate a first and second double stranded nucleic acid and a first and second displaced strand of nucleic acid .
  • the second displaced strand is at least partially complementary to each other and can hybridize to form a daughter double stranded nucleic acid which can serve as double stranded template nucleic acid in a subsequent amplification cycles.
  • said first and said second displaced strands is at least partially complementary to said first or said second primer and can hybridize to said first or said second primer.
  • the support optionally comprises immobilized primers of more than one sequence.
  • the first primer can then be extended and the template and the primer can be separated partially or completely from one another.
  • the extended primer can then be annealed to a second immobilised primer that has different sequence from the first, and the second primer can be extended.
  • Both extended primers can then be separated (e.g., fully or partially denatured from one another) and can be used in turn as templates for extension of additional immobilized primers.
  • the process can be repeated to provide amplified, immobilised nucleic acid molecules. In an embodiment, this amplification results in immobilized primer extension products of two different sequences that are complementary to each other, where all primer extension products are immobilized at the 5' end to the support.
  • amplified nucleic acids generated from any method herein can be used for many different purposes, including sequencing, screening, diagnosis, in situ nucleic acid synthesis, monitoring gene expression, nucleic acid fingerprinting, etc.
  • the template concentration is adjusted such that immobilized templates are generally spaced as a sufficient distance from each other that the clonal clusters generated from individual templates have little or substantially no overlap with each other, or do not contaminate one another during or after amplification or replication.
  • any of the amplification methods herein involve a step of adjusting the concentration of template nucleic acid before it is contacted with a solid support so that individual template molecules hybridize to primers immobilized on the solid support at a density of at least 10000, 100000, 400000, 500000, 1,000,000 or 10 7 molecules per mm 2 .
  • individual template molecules are amplified in-situ on the support, giving rise to clonal populations that are spatially-centered anound the point of hybridization of the initial template.
  • two or more primers are extended to form two or more corresponding extended strands.
  • the two or more primers that are extended comprise or consist essentially of substantially identical sequence, and the extended portions of corresponding extended strand are at least partly non-identical and/or complementary to each other.
  • a starting template is amplified, e.g., by template walking, to generate a plurality of primer-extended strands (which for convenience will be designated as "forward" strands).
  • the forward strands are complementary to the starting template.
  • the forward strands are immobilized on the support.
  • the forward strands comprise substantially identical sequence, e.g., the forward strands are substantially identical to each other.
  • the forward strands are formed by extension of one or more primers immobilized on a support ("forward" primers).
  • the forward primers and/or the forward strands are optionally attached to the support at or near their 5' ends.
  • one or more of the primer-extended forward strands comprises a 3' sequence (called a self-hybridizing sequence) that is absent in the unextended primer and can hybridize under the conditions of choice to a 5' sequence (this process will be termed "self- hybridization").
  • the 5' sequence is optionally part of the unextended forward primer.
  • the forward extension product forms a "stem-loop" structure upon such hybridization.
  • the unextended forward primer comprises a "cleavable" nucleotide at or near its 3' terminus that is susceptible to cleavage.
  • the cleavable nucleotide is linked to at least one other nucleotide by a "scissile" internucleoside linkage that can be cleaved under conditions that will not substantially cleave phosphodiester bonds.
  • the forward-primer extension product i.e., the forward strand
  • the forward strand is optionally allowed to self-hybridize.
  • the forward strand is cleaved at a scissile linkage of a cleavable nucleotide (for example a nucleotide which forms a scissile linkage with a neighboring nucleotide).
  • the cleavage results in two fragments of the primer-extension product (i.e., the extended forward strand).
  • a first fragment comprises at least a portion of the original unextended forward primer.
  • the first fragment does not comprise any extended sequence.
  • the first fragment is immobilized (e.g., because the unextended forward primer was already immobilized).
  • a second fragment comprises extended sequence.
  • the second fragment comprises any 3' portion of the unextended primer beyond the cleavable nucleotide or does not comprise any portion of the unextended primer.
  • the second fragment is hybridized to the first portion through its self-hybridizing sequence.
  • the cleavable nucleotide is one that is removed by one or more enzymes.
  • the enzyme can for instance be a glycosylase.
  • the glycosylase optionally has N- glycosylase activity which releases the cleavable nucleotide from double stranded DNA.
  • the removal of the cleavable nucleotide generates an abasic, apurinic or apyrimidinic site.
  • the abasic site can optionally be further modified, for example by another enzymatic activity.
  • the abasic site is modified by a lyase to generate a base gap.
  • the lyase for example cleaves 3 ' and/or 5 ' to the abasic site. Cleavage optionally occurs at both the 5' and 3' end by the lyase, resulting in removing the abasic site and leaving a base gap.
  • Exemplary cleavable nucleotides such as 5 -hydroxy-uracil, 7, 8-dihydro-8-oxoguanine (8-oxoguanine), 8- oxoadenine, fapy-guanine, methy-fapy-guanine, fapy-adenine, aflatoxin Bl-fapy-guanine, 5- hydroxy-cytosine can be recognized and removed by various glycosylases to form an apurinic site.
  • One suitable enzyme is formamidopyrimidine [fapy]-DNA glycosylase, also known as 8- oxoguanine DNA glycosylase or FPG.
  • FPG acts both as a N-glycosylase and an AP-lyase.
  • the N-glycosylase activity optionally releases damaged purines from double stranded DNA, generating an apurinic (AP site), where the phosphodiester backbone is optionally intact.
  • the AP-lyase activity cleaves both 3 ' and 5 ' to the AP site thereby removing the AP site and leaving a one-base gap.
  • the cleavable nucleotide is 8-oxoadenine, which is coverted to a one-base gap by FPG with both glycosylase and lyase activities.
  • the cleavable nucleotide is uridine.
  • the uridine is cleaved by "USER" reagent, which includes Uracil DNA glycosylase (UDG) and the DNA glycosylase-lyase Endonuclease VIII, where UDG catalyses the excision of a uracil base, forming an abasic (apyrimidinic) site while leaving the phosphodiester backbone intact, and where the lyase activity of Endonuclease VIII breaks the phosphodiester backbone at the 3 ' and 5 ' sides of the abasic site so that base-free deoxyribose is released.; after which kinase is optionally used to convert the phosphate group on the 3 ' end of cleaved product to an -OH group).
  • At least one cleaved fragment is optionally contacted with a polymerase.
  • the first immobilized fragment can be extended by the polymerase.
  • the second hybridized fragment can act as template for extension of the first fragment.
  • a "flipped" double-stranded extension product is formed. This flipped product can optionally be subjected to template walking in any manner described herein. When both flipped and unflipped are subjected to template walking, a cluster of two different extension products is formed, where both extension products have an identical portion (corresponding to the unextended primers) and portion complementary to each other, corresponding to the extended portions of the extension products.
  • a sequence of interest such as a self-hybridizing sequence or a new primer-binding site
  • a sequence of interest can be optionally be added at the 3' ends of extended forward strands by contacting the extended forward strands with a single-stranded "splice" adaptor sequence in the presence of extension reagents (e.g., a polymerase and dNTPs).
  • This splice sequence optionally comprises a 3' portion that is substantially complementary to a 3' end portion of the extended forward strand, and a 5' portion that is substantially complementary to the sequence of interest to be added.
  • the forward strand is subjected to template-dependent polymerase extension using the splice adaptor as template.
  • template-dependent polymerase extension results in the addition of the sequence of interest to the 3' end of the extended forward strand.
  • any method of primer extension and/or amplification described herein can include any one or more of the following steps: a) extension of immobilized forward primers by template walking to generate a plurality of extended forward strands which are optionally identical;
  • a splice adaptor optionally hybridizing a splice adaptor to a 3' end of the extended forward strands and subjecting the forward strands to template-dependent extension using the splice adaptor as a template, thereby adding a further 3' sequence to the further-extended forward strands, wherein a portion of the added 3' sequence is complementary to a portion of the unextendedforward primer and hybridizes thereto to form a stem-loop structure
  • step (e) selectively extending or amplifying the flipped strands which comprise the new primer- binding sequenceby contacting with the new primer and extending or amplifying by any method, e.g., as described herein.
  • the new primer will not bind to unflipped strands or to flipped strands that were not further extended in step (e).
  • Figure 8 shows a schematic depiction of an exemplary strand- flipping and walking strategy.
  • A Template walking
  • B Strand flipping to generate flipped strands
  • C addition of new primer-binding sequence Pg' on final flipped strands.
  • a nucleic acid is associated with (e.g., hybridized to) an appropriate primer, which is optionally immobilized.
  • the hybridized nucleic acid may for convenience be designated as the
  • template strand or reverse strand. This word “template” is not intended to imply any particular functional, structural or sequence relationship with an input nucleic acid that was originally introduced into solution or with a final nucleic acid product that is generated by the amplification process.
  • a forward primer can hybridize to a first portion of the reverse strand.
  • Another "reverse" primer is optionally present, which is substantially identical to a second non-overlapping portion of the reverse strand. The two portions are for example non- overlapping if they do not contain any subportions that are identical or complementary to each other.
  • the template strand is optionally single-stranded over at least a portion that is complementary to the forward primer, which portion is designated the forward "primer-binding sequence" or forward PBS.
  • the forward primer is optionally extended using the reverse strand as template to form an extended forward strand, resulting in a duplex between the hybridized template (reverse strand) and the forward strand. At least part of the primer portion of the forward strand can be separated from the hybridized reverse strand.
  • the forward strand comprises a reverse PBS portion that can hybridize to a "reverse” primer and this reverse primer can in turn be extended to form an extended reverse strand. Both the forward and reverse strand can then be separated from each other and the process can be repeated to provide a clonal population of amplified, immobilized nucleic acid molecules.
  • any one or more steps of separating forward and reverse strands from each other involves partial separation, e.g., separation that dissociates a portion of the forward strand from a portion of the reverse strand, but does not abolish all association between the two strands.
  • a portion of a forward strand is dissociated from a reverse strand, while another portion of the same forward strand remains associated (e.g., by hybridization) with a reverse strand.
  • the forward PBS on the reverse strand is dissociated from the first forward strand.
  • separation is "partial" because the forward strand and reverse strand remain associated with eachother overall. For example, another portion of the reverse strand remains hybridized to the forward strand.
  • the denatured portion of the reverse strand re -hybridizes with a second forward primer.
  • a portion of the reverse strand is hybridized to the first forward strand, while another portion of the same reverse strand is hybridized to the second forward primer.
  • the second forward primer is then extended along the reverse strand (using the reverse strand as template) to generate a second forward strand.
  • one or more forward primers are immobilized on a support which lacks any immobilized reverse primers, or vice versa.
  • the first and second forward primers are immobilized close together or adjacent to each other.
  • the resulting clonal population of nucleic acids comprises forward strands that are immobilized close to or adjacent to each other.
  • at least 10 6 , 10 8 , 10 10 , 10 12 , or 10 14 primers are immobilized on a cm 2 or a cm 3 of an individual support or immobilization site.
  • all forward primers are identical in sequence, or have an identical 3' portion.
  • both the forward and/or reverse primer are optionally immobilized on a support.
  • both primers are non-immobilized.
  • a nucleic acid is clonally amplified onto a support on which multiple copies of a primer are immobilized.
  • An exemplary nucleic acid is one of a collection of nucleic acids. Individual nucleic acids of the collection for example can have one or more adaptor sequences at their 5' and/or 3' ends and variable sequences in between, such as gDNA or cDNA.
  • the 3' adaptor has a low T m region (where T m is the temperature at which half of the DNA molecules are in non-denatured or double-stranded state and half are in denatured, e.g., random coil, state), and the 5' adaptor optionally has a higher Tm region, or vice versa.
  • the low T m region is for example an A-rich, T-rich or pyrimidine-rich region, such as an AT (or U)- rich sequence, such as polyT, polyA, polyU and any combinations of A, T and U bases.
  • the methods described herein can be used for many different purposes, including sequencing, screening, diagnosis, in situ nucleic acid synthesis, monitoring gene expression, nucleic acid fingerprinting, etc.
  • Non-limiting exemplary methods of clonal nucleic acid amplification on a support are as follows.
  • the disclosed methods, compositions, systems, apparatuses and kits include nucleic acids (e.g., primers, templates etc.,) that are attached to a support.
  • the nucleic acids can be attached using any suitable method.
  • the attachment between the nucleic acid molecule and the support is mediated by covalent bonding, by hydrogen bonding (for example attachment of a template nucleic acid to a support mediated by hybridization of the template to another nucleic acid, e.g., primer, which is covalently attached to the support), Van Der Waal's forces, affinity interactions, and the like.
  • the support can be comprised of any material and have any dimensions or shape.
  • the support can be selected to have properties or reactivities that interfere only minimally with the amplification process.
  • the support is comprised of solid material; alternatively, it can be comprised at least partially of semi-solid, fluid or liquid material.
  • the support is spherical, spheroidal, tubular, pellet-shaped, rod-shaped, octahedral, hexagonal, square or trapezoidal in shape.
  • the support is porous.
  • the support can be comprised of a hydrophilic porous matrix such as a hydrogel. See, e.g., U.S. Patent Publication No. 2010-0304982, Hinz et al; and US Patent Publication No. 2010-0136544, Agresti et al.; all of which foregoing applications are incorporated by reference herein.
  • novel methods of generating a localized clonal population of immobilized clonal amplicons in or on a support are provided.
  • the support can for example be solid or semisolid.
  • the amplified clonal population is optionally immobilized to the support's external surface or can also be within the internal surfaces of a support (e.g., where the support is semisolid, e.g., with a gel or matrix structure).
  • Exemplary supports can be solid or semi-solid.
  • the semi-solid support comprises polyacrylamide, cellulose, polyamide (nylon) and cross-linked agarose, dextran and -polyethylene glycol.
  • the disclosed methods and compositions include the attachment of one or more individual members of a collection (e.g., a collection) of nucleic acids to one or more supports of a population of supports.
  • a collection e.g., a collection
  • different nucleic acids of the collection can be attached to different supports.
  • the resulting population of supports includes a plurality of supports each comprising a single nucleic acid.
  • the nucleic acids of the collection are double stranded, and the collection is denatured to form a population of single- stranded nucleic acids.
  • the support includes primers, and one or more of the single stranded nucleic acids can be attached to the support through hybridization to primers on the surface.
  • the collection of nucleic acids can be appropriately diluted and contacted with the population of supports in solution, such that at least 40%, 50%, 60%), 70%o, 80%), 90%) or 95%> of the supports (or immobilization sites where the population of supports consists of one or a few supports) become attached to no more than one nucleic acid.
  • the ratio of the number of nucleic acids to the total number of supports can be set to facilitate mono-clone formation by, e.g., maximizing the number of resulting supports (or number of immobilization sites on a single support) that include only a single nucleic acid, or choosing a ratio that is statistically predicted to give more clonal supports (e.g., beads) than lower or higher ratios.
  • a single support is used in any of the amplification methods herein, where the single support has a plurality of primers that can hybridize to the templates.
  • the concentration of the template collection is adjusted before it is contacted with a solid support so that individual template molecules in the collection get attached or associated (e.g., by hybridization to primers immobilized on the solid support) at a density of at least 10 2 , 10 3 , 10 4 , 10 5 , 4 x 10 5 , 5 x 10 5 , 6 x 10 5 , 8 x 10 5 , 10 6 , 5 x 10 6 or 10 7 molecules per mm 2 .
  • individual template molecules are amplified in-situ on the support, giving rise to clonal populations that are spatially-centered anound the point of hybridization of the initial template.
  • the amplification generates no more than about 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 15 , or 10 20 amplicons from a single amplified template.
  • the colonies of clonal amplicons are situated on the solid support at a density of at least 10 2 , 10 3 , 10 4 , 10 5 , 4 x 10 5 , 5 x 10 5 , 6 x 10 5 , 8 x 10 5 , 10 6 , 5 x 10 6 or 10 7 molecules per mm 2 .
  • the nucleic acid collection can be contacted with one or more supports under conditions where multiple nucleic acids bind to the same support.
  • Such contacting can be particularly useful in methods that involve parallel clonal amplification of nucleic acids in different regions of the same support.
  • the ratio of the number of nucleic acids to the surface area of the support can be adjusted to facilitate mono-clone formation by, e.g., ensuring that the nucleic acids are appropriately spaced in the support to favor formation of monoclonal populations of amplified nucleic acids without substantial cross-contamination between different clonal populations.
  • the collection of nucleic acids to be amplified is adjusted to such a dilution that the resulting amplified clonal populations generated from individual nucleic acids are generally discrete or distinct, e.g., without overlap.
  • individual nucleic acids within 50%, 70%>, 80%> or 90% or more of the amplified clonal populations are not interspersed with substantially non- identical nucleic acids.
  • different amplified populations are not in contact or completely overlapping with other amplified populations, or are distinguishable from each other using a detection method of choice.
  • the nucleic acids are attached to the surface of a support.
  • the nucleic acids can be attached within the support.
  • the nucleic acids can be attached throughout the volume of the support including on the surface and within the support.
  • the support (or at least one support in a population of supports) can be attached to at least one primer, optionally to a population of primers.
  • the support (or at least one support) can include a population of primers.
  • the primers of the population can be substantially identical each other, or may include a substantially identical sequence.
  • One, some or all of the primers can include a sequence that is
  • the population of primers can include at least two noncomplementary primers.
  • the primers can be attached to the support through their 5' end, and have free 3' ends.
  • the support can be the surface of a slide or the surface of a bead.
  • the primers have low melting temperature, such as oligo (dT) 2 o, and can hybridize to the low T m region of the collection adaptor.
  • the distances between the primers need to be shorter than the adapter length to allow templates waking, or alternatively, a long primer with 5' end long linker will increase the chance of walking.
  • the support is attached to and/or contacted with a primer and a template (or reverse strand) under conditions where the primer and template hybridize to each other to form a nucleic acid duplex.
  • the duplex can include a double stranded portion that comprises complementary sequences of the template and primer, where at least one nucleotide residue of the complementary sequences are base paired with each other.
  • the duplex can also include a single stranded portion.
  • the duplex can also include a single stranded portion.
  • the single stranded portion can include any sequence within the template (or primer) that is not complementary to any other sequence in the primer (or template).
  • a non-limiting exemplary method of clonal nucleic acid amplification on a support is as follows.
  • a nucleic acid (which shall be designated for convenience as the reverse strand) is clonally amplified onto a support on which multiple copies of a complementary forward primer are attached.
  • An exemplary nucleic acid is one of a plurality of DNA collection molecules, that for example the plurality of nucleic acid members have one or more common (“adaptor") sequences at or near their 5' and/or 3' ends and variable sequences in between, suoh as gDNA or cDNA.
  • the 3' common portion e.g., adaptor
  • the 5' common sequence e.g., adaptor
  • both the 5' and 3' common sequences are breathable.
  • the breathable (e.g., low T m ) region is for example a region that is rich in A, T and/or U, such as an AT (or U)-rich sequence, such as polyT, polyA, polyU and any
  • FIG. 1 One non-limiting exemplary method of clonal nucleic acid amplification on a support is shown in Figure 1.
  • a non-limiting description of an exemplary method is as follows.
  • a double stranded DNA library molecule is denatured and the single stranded DNA is attached to the support through hybridization to the primers on the surface.
  • the ratio of number of DNA molecules to support area or number of beads is set to facilitate mono-clone formation.
  • Primers are attached on a support through their 5' and have free 3'.
  • the support can be the surface of a slide or the surface of a bead.
  • the primers have low melting temperature, such as oligo (dT) 2 o or oligo (dA) 30 and can hybridize to the low Tm region of the library adaptor.
  • the distances between the primers can be shorter than the adapter length to allow templates waking, or alternatively, a long primer with 5' end long linker will increase the chance of walking.
  • a nucleic acid is clonally amplified onto a support on which multiple copies of a primer are attached.
  • An exemplary nucleic acid is one of a plurality of DNA library molecules, which for example have one or more common (e.g., "adaptor") sequences at their 5' and/or 3' ends and variable sequences in between, such as gDNA or cDNA.
  • the 3' adaptor has a low Tm region, and the 5' adaptor optionally has a higher Tm region, or vice versa.
  • the low Tm region is for example a pyrimidine-rich region, such as an AT (or U)-rich sequence, such as polyT, polyA, polyU and any combinations of A, T and U bases or bases complementary to such bases. Exemplary methods are described herein.
  • primers whether in soluble form or attached to a support, is incubated with a DNA polymerization or extension reaction mix, which optionally comprises any one or more of reagents such as enzyme, dNTPs and buffers.
  • the primer e.g., a forward primer
  • the extension is a template-dependent extension of a primer along a template comprising the successive incorporation of nucleotides that are individually
  • the extension is achieved by an enzyme with polymerase activity or other extension activity, such as a polymerase.
  • the enzyme can optionally have other activities including 3'-5' exonuclease activity (proofreading activity) and/or 5 '-3' exonuclease activity. Alternatively, in some embodiments the enzyme can lack one or more of these activities.
  • the polymerase has strand-displacing activity. Examples of useful strand-displacing polymerases include Bacteriophage ⁇ 29 DNA polymerase and Bst DNA polymerase.
  • the enzyme is active at elevated temperatures, e.g., at or above 45 °C, above 50 °C, 60 °C, 65 °C, 70 °C, 75 °C, or 85 °C.
  • An exemplary polymerase is Bst DNA Polymerase (Exonuclease Minus), is a 67 kDa Bacillus stearothermophilus DNA Polymerase protein (large fragment), exemplified in accession number 2BDP A, which has 5 '-3' polymerase activity and strand displacement activity but lacks 3 '-5' exonuclease activity.
  • polymerases include Taq DNA polymerase I from Thermus aquaticus (exemplified by accession number 1TAQ), Eco DNA polymerase I from Echerichia coli (accession number P00582), Aea DNA polymerase I from Aquifex aeolicus (accession number 067779), or functional fragments or variants thereof, e.g., with at least 80%, 85%, 90%, 95% or 99% sequence identity at the nucleotide level.
  • the extension step produces a nucleic acid, which comprises a double- stranded duplex portion in which two complementary strands are hybridized to each other.
  • walking involves subjecting the nucleic acid to partially-denaturing conditions that denature a portion of the nucleic acid strand but are insufficient to fully denature the nucleic acid across its entire length.
  • the nucleic acid is not subjected to fully- denaturing conditions during a portion or the entire duration of the walking procedure.
  • a nucleic acid molecule can be considered partially-denatured when a portion of at least one strand of the nucleic acid remains hybridized to a complementary strand, while another portion is in an unhybridized state (even if it is in the presence of a complementary sequence).
  • the unhybridized portion is optionally at least 5, 7, 8, 10, 12, 15, 17, 20, or 50 nucleotides long.
  • the hybridized portion is optionally at least 5, 7, 8, 10, 12, 15, 17, 20, or 50 nucleotides long.
  • a nucleic acid can be considered to be partially denatured when a substantial fraction of individual molecules of the nucleic acid (e.g., above 20%>, 30%>, 50%>, or 70%) are in a partially denatured state.
  • a substantial fraction of individual molecules of the nucleic acid e.g., above 20%>, 30%>, 50%>, or 70%
  • less than a substantial amount of individual molecule are fully denatured, e.g., not more than 5%, 10%>, 20%>, 30%> or 50%> of the nucleic acid molecules in the sample.
  • a nucleic acid is optionally considered fully denatured when it lacks any double-strandedness (or lacks any hybridization to a complementary strand) in more than 80% or 90% of individual molecules of the nucleic acid.
  • nucleic acid Under exemplary conditions at least 50%) of the nucleic acid is partly denatured, but less than 20%> or 10%> is fully denatured. In other situations, at least 30%> of the nucleic acid is partly denatured, but less than 10%> or 5% is fully denatured. Similarly, a nucleic acid can be considered to be non-denatured when a minority of "breathable" portions of interest in the nucleic acid, e.g., a PBS, are denatured. In exemplary annealing conditions at least 10%, 30%, 50%, 60%, 70%, 80% or 90% of PBSs of nucleic acid molecules in the sample are hybridized to corresponding primers.
  • partially denaturing conditions are achieved by maintaining the duplexes as a suitable temperature range.
  • the nucleic acid is maintained at temperature sufficiently elevated to achieve some heat-denaturation (e.g., above 45 °C, 50 °C, 55 °C, 60 °C, 65 °C, or 70 °C) but not high enough to achieve complete heat-denaturation (e.g., below 95 °C or 90 °C or 85 °C or 80 °C or 75 °C).
  • Complete heat-denaturation conditions are for example conditions that would result in complete separation of a significant fraction (e.g., more than 10%, 20%, 30%>, 40%> or 50%>) of a large plurality of strands from their extended and/or full-length complements.
  • the nucleic acid is subjected to isothermal conditions, where temperature variation is constrained within a limited range during at least some portion of the amplification (e.g., the temperature variation is within 20 °C, optionally within 10 °C, for example within 5 °C, or 2 °C).
  • the temperature is maintained at or around 50 °C, 55 °C, 60 °C, 65 °C, or 70 °C for at least about 10, 15, 20, 30, 45, 60 or 120 minutes.
  • any temperature variation is not more than 20 °C, optionally within 10 °C, for example within 5 °C, or 2 °C during one or more amplification cycles (e.g., e.g., 1, 5, 10, 20, or all amplification cycles performed).
  • thermocycling can be performed (where temperature variance is within isothermal or non-isothermal ranges).
  • the temperature variation is constrained between the denaturation step and another step such as annealing and/or extension.
  • the difference between the denaturation temperature and the annealing or extension temperature is not more than 20 °C, optionally within 10 °C, for example within 5 °C, or 2 °C, for one or more cycles of amplification.
  • the temperature is for example constrained for at least 5, 10, 15, 20, 30, 35 or substantially all cycles of amplification.
  • Partial denaturation can also be achieved by other means, e.g., chemical means using chemical denaturants such as urea or formamide, with concentrations suitably adjusted, or using high or low pH (e.g., pH between 4-6 or 8-9).
  • partial denaturation and amplification is achieved using recombinase-polymerase amplification (RPA). Exemplary RPA methods are described herein.
  • the sequence of the negative and/or positive strand designed such that a primer-binding sequence or a portion thereof is breathable, i.e., is susceptible to denaturation under the conditions of choice (e.g., amplification conditions).
  • the breathable portion is optionally more susceptible than a majority of nucleic acids of similar length with randomized sequence, or more susceptible than at least another portion of the strand comprising the breathable sequence.
  • the breathable sequence shows a significant amount of denaturation (e.g., at least 10%, 20%, 30%, 50%, 70%, 80%, 90% or 95% of molecules are are completely denatured across the breathable sequence) at the amplification conditions of choice.
  • the breathable sequence is designed to be fully-denatured in 50%> of strand molecules at 30, 35, 40, 42, 45, 50, 55, 60, 65 or 70 °C under the conditions of choice (e.g., amplification conditions).
  • the T m of a nucleic acid strand is the temperature at which at least a desired fraction of a clonal population of duplexes are rendered completely single-stranded under the chosen reagent conditions, where an individual duplex comprises the nucleic acid strand in question hybridized to its full-length complement.
  • the desired fraction is 50% if the fraction is not specified.
  • the desired fraction is optionally at least 10%, 20%, 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%), 85%o, 90%), 95%) or 99%.
  • a sequence can be considered breathable if the theoretically-predicted melting temperature of the breathable sequence is not more than 20, 30, 35, 40, 45, 50, 55, 60 or 65 °C under the amplification conditions of choice, using known theoretical calculations for predicted melting temperature (T m ).
  • T m predicted melting temperature
  • the thermal stability, melting behavior and/or T m is a theoretically-predicted temperature according to the teachings of Breslauer et al., Proc. Nat. Acad. Sci. 83, 3746-50 (1986).
  • T m is predicted as follows:
  • the T m is empirically measured by known methods, (e.g., Spink, Methods Cell Biol. 2008;84: 115-41; Meunier-Prest et al, Nucleic Acids Res. 2003 December 1; 31(23): el50; Brewood et al, Nucleic Acids Res. 2008 September; 36(15): e98.)
  • At least one PBS on each strand is breathable - e.g., the forward PBS and the reverse PBS are both breathable.
  • a nucleic acid such as a forward or reverse strand comprises two breathable sequences. For example, a 5' portion and a 3' portion can be breathable.
  • an exemplary breathable PBS may be pyrimidine-rich (e.g., with a high content of As and/or Ts and/or Us).
  • the PBS comprises for example a poly-A, poly-T or puly-U sequence, or a polypyrimidine tract.
  • One or more amplification or other primers e.g., an immobilized primer
  • An exemplary PBS of a nucleic acid strand comprises a poly-T sequence, e.g., a stretch of at least 10, 15, 20, 25 or 30 thymidine nucleotides, while the corresponding primer has a complementary sequence to the PBS, e.g., a stretch of at least 10, 15, 20, 25 or 30 adenosine nucleotides.
  • Exemplary low-melt primers optionally have a high proportion (e.g., at least 50%, 60%, 65%, 70%, 75%, 80%, 85% 90% 95% or 100%) of nucleobases that generally (e.g., under amplification conditions of choice) form no more than two hydrogen bonds with a
  • nucleobases include A (adenine), T (thymine) and U (uracil).
  • exemplary low-melt primers optionally have a high proportion of any one or more of A (adenine), T (thymine) and/or U (uracil) nucleotides or derivatives thereof.
  • the derivatives comprise nucleobases that are complementary to A (adenine), T (thymine) and/or U (uracil).
  • the portion of the primer that hybridizes to the PBS optionally has at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90% 95% or 100% of A (adenine), T (thymine) or U (uracil) nucleotides, or any combination thereof.
  • the portion of the primer that hybridizes to the PBS comprises a polyA sequence (e.g., at least 5, 10, 15, 20, 25 or 30 nucleotides long).
  • Other exemplary primers comprise (NA x ) n repeats.
  • n in lower case
  • n is from 2 to 30, e.g., from 3 to 10, for example 4 to 8.
  • “N" (in upper case) is any nucleotide - and optionally, N is C or G.
  • A is the shorthand convention for adenine, and "x” denotes the number of adenine residues in the repeat, for example 2, 3, 4, 5, 6, 10 or more.
  • exemplary primers comprise multiple repeats of (CAA) n , CA) n , (CAAA) n or even (GAA) n .
  • only one strand has a breathable PBS.
  • both the forward and reverse strands have a breathable PBS.
  • the breathable PBS is optionally complementary to a primer that is either immobilized to a support or is not immobilized (e.g., in soluble form).
  • the strand comprising the breathable PBS is either immobilized to a support or is not immobilized (e.g., in soluble form).
  • both primers are immobilized, or or both strands are immobilized.
  • neither primer is immobilized, or neither strand is immobilized.
  • An amplification cycle optionally comprises breathing, annealing and extension.
  • the nucleic acid to be amplified is optionally subjected to conditions which are suitable for or optimized for at least one of these steps.
  • the nucleic acid is subjected to conditions which are suitable for more than one of these steps, (e.g., annealing and extension, or breathing and extension). In some instances, all three of these steps can take place
  • the nucleic acid can be subjected to conditions which permit or facilitate breathing.
  • “breathing” is said to occur when the two strands of a double-stranded duplex are substantially hybridized to each other, but are denatured across a local portion of interest (e.g., the terminal ends or primer-binding sites).
  • One or more breathable sequences e.g., a forward and/or reverse PBS having a low Tm portion
  • breathable sequences e.g., a forward and/or reverse PBS having a low Tm portion
  • a first complementary strand e.g., a forward or reverse strand
  • An exemplary first strand is a primer extension product from a first primer.
  • An exemplary second strand is for example a second unextended primer (e.g., a PBS- complementary oligonucleotide comprising, e.g., a dT or dA sequence).
  • the first and second strands are immobilized on a support, and can be closely situated (e.g., in close enough proximity to allow walking).
  • the conditions for breathing are optionally partially-denaturing conditions under which the PBS is generally denatured but another portion of nucleic acid remains in a hybridized or double-stranded state.
  • DNA helicase can be included in the reaction mix to facilitate the partial denaturing.
  • the nucleic acid is then subjected to conditions which facilitate annealing, e.g., the temperature is decreased, to enable hybridization between the breathable PBS and the second strand.
  • the same conditions are used to facilitate both breathing and extension.
  • annealing conditions are different from breathing conditions - for example, the annealing conditions are nondenaturing conditions or conditions that favor denaturation less than the breathing conditions.
  • annealing conditions involve a lower temperature (such as 37 °C) than breathing conditions, in which a higher temperature (e.g., 60-65 °C) is used .
  • fully denaturing conditions are avoided during one or more cycles of amplification (e.g., the majority of amplification cycles or substantially all
  • Extension conditions are generally permissive or highly suitable for primer extension.
  • the extension conditions of choice are the same as or different from annealing and/or breathing conditions.
  • the same set of conditions is used for all three steps (e.g., isothermal amplification), such that subjecting the sample to a single set of conditions for a sustained period enables multiple amplification cycles of breathing, annealing and extension to take place.
  • strand extension is performed for example by a strand displacing DNA polymerase, such as Bst DNA polymerase large fragment, Klenow DNA polymerase, phi29 DNA polymerase, Vent DNA polymerase, any functional fragments and/or variants, or any combination of such enzymes.
  • a strand displacing DNA polymerase such as Bst DNA polymerase large fragment, Klenow DNA polymerase, phi29 DNA polymerase, Vent DNA polymerase, any functional fragments and/or variants, or any combination of such enzymes.
  • the strand-displacement capability optionally facilitates extension through duplex portions of partially-denatured nucleic acids.
  • one or more of the PBS-breathing and primer extension steps are repeated multiple times to amplify an initial nucleic acid.
  • one or more nucleic acid reagents e.g., primers
  • the primer-extension products remain substantially attached to the support, e.g., by virtue of attachment of an unextended extended primer to the support prior to amplification, or by hybridization to such a primer).
  • a localized clonal population of clonal amplicons is formed around a discrete site on the support.
  • An exemplary discrete site is a point of attachment of an initial nucleic acid strand to the support, and from which other nucleic acids within the clonal population are directly or indirectly generated by primer extension, using the initial nucleic acid or its copies as a template.
  • a sample is prepared of a population of one or more nucleic acids to be amplified.
  • the population of nucleic acids can be in single-stranded or double-stranded form; optionally one or more nucleic acids individually comprises a nucleic acid strand with a known 3' end sequence and a known 5' end sequence which are substantially identical or
  • a 3' portion of the nucleic acid strand can for example be complementary to an immobilized primer, whereas a 5' portion can be identical to a soluble primer.
  • the 5' and/or 3' portions can be common ("universal") or invariant between individual nucleic acids within the population.
  • the nucleic acids within the population individually comprise variant (e.g., unknown) sequence between the common portions, such as genomic DNA, cDNAs, mRNAs, mate -pair fragments, exomes. etc.
  • the collection can for example have enough members to ensure over 50%, 70%, or 90%> coverage of the corresponding genetice source (e.g., the genome or the exome).
  • compositions comprising any one or any subset or all of the following: at least one reverse nucleic acid strand, a plurality of forward primers immobilized on at least one support, a plurality of reverse primers in solution, and a polymerase.
  • the forward and/or reverse primers are optionally low-melt or rich in adenine, thymine or uracil as described herein.
  • An exemplary composition comprises clonal populations of nucleic acid strands
  • reverse strands where individual reverse strands of each clonal population comprise a low- melt (e.g., breathable) primer-binding sequence at the 3' end and/or a low-melt primer sequence on the 5' end.
  • the composition optionally includes a plurality of reverse primers that are substantially identical to the low-melt primer sequence on a 5' portion or end of the reverse strand.
  • the composition optionally includes a plurality of forward primers that are substantially complementary to the low-melt primer-binding sequence on a 3' portion or end of the reverse strand.
  • the forward primer and/or the reverse primer is immobilized by attachment to a support. For example the forward primer is immobilized and the reverse primer is not immobilized, or vice versa.
  • An exemplary composition comprises any one or more of: (1) a reverse nucleic acid strand, (2) a plurality of low-melt forward primers immobilized on a support, (3) a plurality of low-melt reverse primers in solution, and (4) a polymerase.
  • the composition further comprises one or more extended forward strands that are londer than unextended forward primers and are optionally full-length complements of one or more reverse strands.
  • one or more extended forward strands are hybridized to a complementary reverse strand, where the reverse strand is optionally also hybridized to another different forward primer or to a different forward strand.
  • the different forward strand is optionally a less-than-full-length complement of the reverse strand.
  • the composition can contain any one or more reagents described herein, and/or be subjected to any one or more procedures or conditions (e.g., temperatures) described herein.
  • the composition comprises a plurality of spatially-separated clonal populations are attached to one or more solid supports.
  • a plurality of spatially- separated clonal populations are attached to the same support.
  • the composition is optionally free of another enzyme that is not a polymerase, e.g., a recombinase or reverse transcriptase or helicase or nicking enzyme.
  • the composition comprises a collection of nucleic acids producible by any one or more methods described herein.
  • the collection can comprise immobilized nucleic acids which occupy one or more distinct areas on a surface, each area comprising a plurality of identical nucleic acid strands and optionally, a plurality of identical complementary strands hybridized thereto, where the complementary strands have no attachment or linkage or association with the solid support except by virtue of hybridization to the immobilized nucleic acid.
  • an individual nucleic acid strand within such an area is located so that another nucleic acid strand is located on the surface within a distance of the length of that strand.
  • the number of distinct areas/mm 2 of surface on which the nucleic acids are immobilized is greater than 10 2 , greater than 10 3 , greater than 10 4 , greater than 10 5 , greater than 10 6 , greater than 10 7 , or greater than 10 8 .
  • the collections of amplified clonal populations can form arrays, which can be one- dimensional (e.g., a queue of generally monoclonal microbeads) or two-dimensional (e.g., the amplified clonal populations are situated on a planar support), or three-dimensional.
  • the individual clonal populations of an array are optionally but not necessarily situated or arranged such that they are addressed or addressable.
  • different clonal populations are spaced at an appropriate distance from one another, which distance is generally sufficient to permit different clonal populations to be distinguished from each other.
  • localized clonal populations are scattered in an ordered or disordered, e.g., random, pattern over a planar substrate.
  • an exemplary array comprises a plurality of microbeads, where an individual microbead generally comprises a monoclonal population of nucleic acids, and different microbeads generally comprise different clonal populations (e.g., which differ in sequence).
  • the microbeads are distributed or packed in a monolayer over a planar substrate.
  • the array comprises a single (e.g., planar) support, the single support comprising a plurality of spatially discrete clonal populations of nucleic acids, where different clonal populations optionally differ in sequence.
  • one or more nucleic acids within individual clonal popluations can be attached to the planar substrate directly.
  • the nucleic acids of individual clonal populations are attached to microbeads, for example as discussed herein.
  • the clonal microbeads are optionally packed closely together over a planar substrate, in random or ordered fashion.
  • more than 20%, 30%, 50%, 70%, 80%, 90%, 95% or 99% of the microbeads are in contact with at least one, two, four or six other microbeads.
  • less than 10%, 20%, 30%, 50%, 70%, 80%, 90%, 95% or 99% of the microbeads are in contact with one, two, four or six other microbeads.
  • the features of an array are generally discrete or distinct from each other.
  • 50%, 70%, 80% or 90% or more of the features of an array are not in contact or not completely overlapping with other features on the same array, or are distinguishable from each other using a detection method of choice.
  • the features can partially overlap with each other as long as they remain distinguishable from each other.
  • kits comprising any one or more reagents (e.g., nucleic acids or enzymes or supports) described herein.
  • a kit can contain one or more primers, optionally immobilized.
  • An exemplary kit comprises two primers, where the denaturation temperature of one primer is optionally at least 10, 20, 30 or 40 °C from the other.
  • the lower-melting primer comprises a adenine/thymine/uracil-rich portion such as a polyA tract such as those described herein, e.g., a polyA, T or U sequence that is at least 10, 15, 20, 25 or 30 nucleotides long.
  • the kit further contains one or more supports described herein, comprising the immobilized primers.
  • An exemplary support comprises a planar suface. Where multiple supports are used, the kit can comprise microbeads bearing identical primers.
  • the kit optionally contains one or more polymerases, e.g., a strand-displacing polymerase, and/or any combination of amplification reagents described herein.
  • polymerases e.g., a strand-displacing polymerase, and/or any combination of amplification reagents described herein.
  • the kit can also comprise instructions for diluting an initial population of templates to be amplified, and/or a dilution medium.
  • the amplified and/or immobilized nucleic acid molecules generated from methods described herein can be subjected to many different applications, including sequencing, screening, diagnosis, in situ nucleic acid synthesis, monitoring gene expression, nucleic acid fingerprinting, forensics, diagnostics, etc.
  • nucleic acid molecules for sequence analysis.
  • one or more nucleic acid molecules e.g., amplicons
  • at least one sequencing analysis primer is or comprises an oligonucleotide.
  • at least one probe comprises one or more nucleotides or one or more oligonucleotides.
  • Oligonucleotides used as sequence analysis primers or probes for example can hybridize to at least one of the same sequences as at least one immobilization primer, e.g., the oligonucleotides optionally have the same sequences as the immobilization primers.
  • sequence analysis is performed by contacting one or more target nucleic acid molecules to be analyzed with one or more sequence analysis primers and/or probes, removing any unhybridized probes and determining the label of the ligated probe.
  • sequence analysis is performed by contacting one or more target nucleic acid molecules to be analyzed with one or more sequence analysis primers and/or probes, and detecting any resulting hybridization between at least one target nucleic acid and at least one labeled sequence analysis primer and/or probe.
  • sequence analysis method comprises extending one or more sequence analysis primers hybridized to target nucleic acid molecules by ligating any adjacently-hybridized oligonucleotides probes to the sequence analysis primer, removing any unligated probes and determining the label of the ligated probe.
  • sequence analysis is performed by contacting one or more target nucleic acid molecules to be analyzed with one or more sequence analysis primers and labeled nucleotide probes and a template-dependent polymerase, allowing the polymerase to incorporate a labeled nucleotide into a polymerase extension product of the sequence analysis primer, removing any unincorporated nucleotides, and determining the identity of the
  • nucleotide probes are for example fluorescently-labeled, and/or the identity of the incorporated nucleotide is determined from its label.
  • nucleotide probe is not labeled and the presence or incorporation of the nucleotide into a polymerase extension product is measured by virtue of a by-product generated by incorporation.
  • incorporation of a nucleotide into an extension product is optionally detected by measuring changes in pH or ions or an electric current, for example by using a field-effect transistor.
  • the probe e.g., a nucleotide or an oligonucleotide
  • the probe is optionally further extendable by polymerase or ligase.
  • the probe is optionally not extendable by a polymerase or ligase.
  • Such non-extendable probes are optionally rendered extendable during the sequence analysis process (e.g., after their identity is determined).
  • nucleotide probes include A, G, C, T bases, where nucleotide probes with a different base at the interrogation position of the probe have a different fluorescent label.
  • all or less than all (e.g., at least one) sequencing analysis primer or sequencing analysis probe comprises a labeled nucleotides/oligonucleotides.
  • the labeled nucleotides/oligonucleotides all have the same label or are differentially labeled.
  • the labeled nucleotides/oligonucleotides are fluorescence labeled. For example a mixture of labeled and non-labeled nucleotides is used.
  • sequence analysis is parallel sequence analysis of nucleic acid molecules present in at least 2, e.g., at least 10, 1000, 1000, 106, 109 or 1012 different distinct areas.
  • the sequence analysis technology can be polymerase-based sequence analysis, for example Sanger sequence analysis.
  • sequence analysis technology include sequence analysis by synthesis, or sequence analysis using reversible terminators, or ligation based sequence analysis, e.g., two-base encoding using SOLiD.
  • the apparatus can comprise one or more supports, each support comprising a plurality of immobilized primers (which are optionally identical).
  • the apparatus can comprise a nucleic acid polymerase or ligase, and/or a plurality of nucleotides (optionally labeled) and means for partially separating annealed nucleic acid strands.
  • Exemplary means for separating annealed nucleic acid strands comprises a controlled heating means, e.g., a heating means that can maintain the reagents at a constant temperature.
  • the apparatus optionally comprises a source of one or more reactants described herein and detector means for detecting one or more signals produced after one or more of said reactants have been applied to said nucleic acid molecules.
  • the means for detecting optionally has sufficient resolution to distinguish between the distinct immobilization sites of the support, or between multiple supports (if in the form of microbeads).
  • the apparatus comprises a support which has primers immobilized on a planar surface.
  • the apparatus comprises a charge coupled device (CCD), which optionally is operatively connected with an imaging device.
  • CCD charge coupled device
  • each immobilization site is a separate bead, and wherein each bead comprises a clonal population of amplicons after amplification.
  • each bead can be distributed into or on an array before, during or after amplification.
  • the array for example is any array of wells, where beads bearing amplicons are distributed individually into separate wells.
  • the array is a large-scale FET array.
  • the clonal populations generated by any method herein appear discrete from each other when detected or analyzed (e.g., by optical or electrochemical detection) and/or spatially separated.
  • nucleotide incorporation is detected by the generation of H+ ions
  • such ions can only diffuse a short distance, for example ⁇ 100 nm in a buffer solution. This limited capacity for diffusion ensures H+ generated in one clonal population will generally not interfere with nearby clonal populations and will only be significantly detectable by the sensor directly under the clonal population.
  • oligo(dT)35 5'-dual-biotin labeled oligo(dT)35 were bound to DynaBeads MyOne streptavidin CI magnetic beads. 80 million oligo(dT)35-bound beads and 800 ul DNA template at 0.01 pg/ul were mixed in hybridization buffer.
  • the DNA template sequence was as follows:
  • the following amplification protocol was performed to hybridize the DNA templates to the beads: 95 °C 2 min, 50 °C 1 min, 40 °C 1 min, 30 °C 1 min, 25 °C 2 min.
  • P2 primer (CTG CCC CGG GTT CCT CAT TCT) 50 uM 2 ul
  • This reaction mix was incubated at 60 °C for 45 minutes and 90 minutes with shaking. Beads were washed and the amplified DNA on the beads quantified with TaqMan qPCR, using the following reactants:
  • TaqMan forward primer AGTCGGTGATTCGTGGAAGAC
  • TaqMan reverse primer CTCATTCTCTCCTAGCAAACCAC
  • TaqMan probe Fam-CCCCTGTGGCGACCAC-NFQ
  • Binding of template to bead was done as described in Example 1, using the following template: TTTTTTTTTTTTTTTTTTTT CCACTACGCCTCCGCTTTC CTC TCT ATG GGC AGT CGG TGA TTC GTG GAA GAC GGG GGC AGT CTA TAC CCC TGT GGC GAC CAC TGC GCG GTG GTT TGC TAG GAG AGA ATG AGG AAC CCG GGG CAG
  • a template-walking reaction was performed as described in Example 1, except that 5 ul of 1 uM P2 primer (CTG CCC CGG GTT CCT CAT TCT) and 5 ul of 8 u/ul Bst DNA
  • polymerase large fragment was added to the reaction, and the beads were incubated at a range of temperatures - specifically, 46 °C, 51 °C, 58 °C, 60 °C, 63 °C, 65 °C for 45 minutes with shaking.
  • TaqMan forward primer AGTCGGTGATTCGTGGAAGAC
  • TaqMan reverse primer CTCATTCTCTCCTAGCAAACCAC
  • TaqMan probe Fam-CCCCTGTGGCGACCAC-NFQ
  • 01igo(dT)35 beads were prepared as in Example 1 , and 80 million oligo(dT)35- bound beads were incubated with 800 ul of a mixture of two DNA templates (at equal molar ratio) at 0.04 pg/ul in hybridization buffer.
  • the DNA template sequence is as following.
  • DNA template 1 [00201]
  • TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT CCACTACGCCTCCGCTTTC CTC TCT ATG GGC AGT CGG TGA TTC GTG GAA GAC GGG GGC AGT CTA TAC CCC TGT GGC GAC CAC TGC GCG GTG GTT TGC TAG GAG AGA ATG AGG AAC CCG GGG CAG
  • DNA template 2 [00203]
  • Binding of template to beads and template-walking was performed as described in Example 1 , except that 20 ul of 8 u/ul Bst DNA polymerase large fragment was added, and beads were incubated at 60 °C for 45 minutes with shaking. The beads were washed and diluted in a 96-well qPCR plate to approximately 5 beads per well. 96 duplex TaqMan qPCR reactions were performed with the following primers and probes.
  • TaqMan forward primerl AGTCGGTGATTCGTGGAAGAC
  • TaqMan reverse primerl CTCATTCTCTCCTAGCAAACCAC
  • TaqMan probe 1 Vic-CCCCTGTGGCGACCAC-NFQ
  • TaqMan forward primer2 G AAAC AGTTGATC ATGGAC AACC AT
  • TaqMan reverse primer2 TCATCTTAGTATCTGCTGTACCGTACAT
  • TaqMan probe2 Fam-CCGCCTTGGCCGTACAG-NFQ
  • Figure 6 shows the Ct values of the 96 duplex TaqMan qPCR reactions.
  • Beads were prepared as in Example 1, except 5'-dual-biotin labeled oligo(dA)35 was used instead of 01igo(dt)35 as the bead-immobilized primer.
  • TaqMan forward primer AGTCGGTGATTCGTGGAAGAC
  • TaqMan reverse primer CTCATTCTCTCCTAGCAAACCAC
  • TaqMan probe Fam-CCCCTGTGGCGACCAC-NFQ
  • oligo(dA)35 were bound to DynaBeads MyOne streptavidin CI magnetic beads. 80 million oligo(dA)35-bound beads were mixed with 800 ul E coli DH10B genomic DNA fragment library at 0.1 pg/ul in hybridization buffer. Hybridization buffer was used as a negative control.
  • the DH10B fragment library had the following structure. [00223] AAAAAAAAAAAAAAAAAAA— PI adaptor—150 bp to 200 bp DH10B genomic DNA fragments— P2 adaptor
  • P2 primer (CTG CCC CGG GTT CCT CAT TCT) 50 uM 2 ul
  • the beads were incubated at 37C for 3 minutes and then at 60C for 45 minutes with shaking. The beads were then washed and stained with fluorescent label by hybridizing a cy5 labeled oligonucleotide targeting the PI adaptor sequence in the DH10B fragment library. The stained beads were laid on a microscope slide and imaged on a fluorescent microscope.
  • a shifted overlay of the white light image of the beads and the cy5 fluorescent image of the beads revealed the white light images of the beads as black dots and the cy5 -labeled beads as red dots. About 15% of the beads were seen to be positively stained with cy5 and the rest were negative.
  • Hybridization and primer extension template was diluted in lx NEB Buffer 2 to a final concentration of 100 pM. Template was heated at 95°C for 3 min and then keep on ice. Hybridization/reaction mixes were prepared as follows:
  • reaction mixture 10 ⁇ was added to each lane, and the flow cell incubated at 60°C for 20 minutes. Each lane was washed twice with 1 ml lx TMAX buffer, and the nucleic acid subjected to analysis as desired.
  • This example describes clonal amplification of nucleic acids onto supports in the form of matrices, followed by sequencing of the resulting amplified population using the Ion Torrent PGMTM sequencer, which is an ion-based sequencing system that detects byproducts of nucleotide incorporation using a chemically sensitive field effect transistor (chemFET).
  • Ion Torrent PGMTM sequencer is an ion-based sequencing system that detects byproducts of nucleotide incorporation using a chemically sensitive field effect transistor (chemFET).
  • At least one primer for template walking is immobilized on a surface (e.g., the floor) of individual wells, where an individual well is operatively connected to a corresponding transistor.
  • a double-stranded adapter (“ION Adaptor 1”) was prepared by hybridizing the single-stranded complementary oligonucleotides ION Adaptor Oligo 1 and ION Adaptor Oligo 1 ' to each other according to the procedure in Appendix C of the User Manual for the SOLiDTM 4 System (Applied Biosystems, Life Technologies).
  • ION Adaptor Oligo 1 included a priming sequence that was 30 mer long (i.e., was 30 nucleotides in length) and ION Adaptor Oligo 1 ' included the complement of this 30mer priming sequence at the 5' end, plus an additional two thymidine residues ("TT”) at the 3' end.
  • Hybridization of ION Adaptor Oligo 1 with ION Adaptor Oligo 1 ' forms the double-stranded adaptor "Ion Adaptor 1", which includes a 30-mer double-stranded priming sequence and has one blunt end and one "sticky" end including a 3' overhang of two additional T residues.
  • a third primer, Ion Adapter A PCR primer, which contained only the first 20 nucleotides of ION Adaptor Oligo 1, was used in the PCR step as described below.
  • ION Adaptor 2 a second double-stranded adaptor
  • ION Adaptor 2 was prepared by hybridizing the complementary single-stranded oligonucleotides Ion T-T ailed Adapter Oligo 2 and Ion A-Tailed Adapter Oligo 2' using the procedure in Appendix C of the SOLiD 4.0 User Manual.
  • ION T-tailed Adaptor Oligo 2 was 52mer in length and included a priming sequence of 30 nucleotides to the 5' end, followed by a stretch of 22 thymidine (“T”) residues at the 3' end.
  • ION A-tailed Adaptor Oligo 2' was 50mer in length and included a stretch of 20 adenine ("A") residues at the 5' end, followed by a 30-nucleotide stretch complementary to the priming sequence of ION T-tailed Adaptor Oligo 2.
  • Hybridization of the ION T-tailed Adaptor Oligo 2 with the ION A-tailed Adaptor Oligo 2' forms the double-stranded adaptor "Ion Adaptor 2", which includes a 30mer double stranded priming sequence flanking a 20mer poly-A/poly-T duplex, and has one blunt end and one "sticky" end including a 3' overhang of two additional T residues.
  • the double-stranded adaptors Ion Adaptor 1 and Ion Adaptor 2 were ligated to the end-repaired DNA.
  • the ligation product was size-selected and subjected to 8 cycles of amplification using the following primers: Ion Adapter A PCR primer (which contained only the first 20 nucleotides of ION Adaptor Oligo 1) and ION T-tailed Adapter Oligo 2.
  • the amplified reaction product was subjected to size selection, yielding a final adapted double- stranded DNA library with a median size of 209bp.
  • Annealing templates to particles The double-stranded library was annealed to the SNAPP particles. Briefly, 10 million SNAPPs were washed 2X in buffer (each wash carried out by pipetting up and down to resuspend the SNAPPs, then pelleting the SNAPPs by
  • the dsDNA adapter-ligated and size-selected library was diluted in buffer, such that the library was added at an average ratio of 1 double-stranded template molecule per SNAPP, in a total volume of lOOul.
  • SNAPPs were resuspended in the following amplification reaction mixture: [00250] IX Phi29 DNA Polymerase Reaction Buffer, 0. lmg/mL BSA, luM ION Adaptor A PCR primer, lmM equimolar dNTP mix and 100U Phi29 enzyme (NEB #M0269L)
  • the double-stranded amplified DNA on the SNAPPs was then denatured to remove complementary strands that were not covalently attached to the SNAPP, by performing 2 washes in ION Denaturing Solution (125mM NaOH, 0.1% Tween-20) with a 5 minute incubation at room temperature for each wash.
  • ION Denaturing Solution 125mM NaOH, 0.1% Tween-20
  • the SNAPPS were then washed 2X in Life TEX Buffer (10 mM Tris, 1 mM EDTA, 0.01 ) Triton X-100). The SNAPPs were then subjected to an ion-based sequencing reaction using the Ion Torrent PGMTM sequencer, as described below:
  • the SNAPPs including the amplified DNA were washed 2X in Annealing Buffer, which includes Gibco brand PBS, pH 7.2 (1.54 mM Potassium Phosphate monobasic,
  • thermocycler As follows:
  • Annealed SNAPPs were washed 2X in Annealing Buffer, with approximately 7ul of buffer left on the SNAPP pellet after the final wash.
  • SNAPPs were gently sonicated for 10 seconds in a water bath to disperse any clumps.
  • 2ul of 50% glycerol (diluted in Annealing Buffer) was added and the sample was loaded on an Ion Torrent PGMTM 314 sequencing chip from the Ion Sequencing 314 Kit (part number 4462909, Ion Torrent Systems, Life Technologies. Briefly, the chip was primed by addition of 50ul Annealing Buffer (part number 603-1047-01, included in the PGM Reagents Kit, part number 4465455, Ion Torrent Systems). lOul of sample was injected into the port of the chip, and the chip was then centrifuged for 10 minutes. The PGMTM sequencing run was performed using standard nucleotide flow order for 55 cycles.
  • both the forward and reverse primers have a breathable PBS prone to local denaturation at the isothermal amplification conditions of choice.
  • Each PBS thus has a corresponding tendency to reassociate with a new unextended primer.
  • the forward primer is immobilized on a support, and thus the forward PBS, after dissociating from a first forward primer, can rehybridize with a second different forward primer that is immobilized close to the first forward primer.
  • the reverse PBS tends to dissociate from a first soluble reverse primer and re-hybridize to a second soluble reverse primer, which is then extended.
  • Hybridization template at ⁇ total concentration in lXSSPEt buffer, and pre- denatured by heat (95°C for 3minutes) and held on ice. 12ul was added to each lane. The mix was subjected to 75°C for 2min, 50°C for lmin, 40°C for lmin, 30°C for lmin, 25°C for 2 minutes. The lanes were washed with O.lXSSPEt (2xlml).
  • Primer Extension The following master mix was prepared: 5 ⁇ of 10X NEB Buffer 2; 0.5 ⁇ of lOOmM dNTP; 1 ⁇ of Klenow (NEB 5u/ul, M0212L); 43.5 ⁇ of dH20 (Total of 50 ⁇ ). 12uL of reaction mix was added to all lanes, and incubated at 37C for 30 min. Lanes were washed with 2xSSC+0.1% SDS, 1XTMAX (1ml) and incubated with 1XNEB ThermoPol buffer at 60°C for 40 min and washed again with 2xSSC+0.1% SDS, 1XTMAX (lml).
  • Template walking The following master mix was prepared: 10 ⁇ of 10X NEB ThermoPol Buffer ; 2 ⁇ of 1 OOmM dNTP; 50 ⁇ of soluble primer PE;40 ⁇ of Bst (NEB 120u/ul); 47 ⁇ of dH20 (Total of 100 ⁇ ). 12 ⁇ ⁇ master mix was added to each lane and incubated at 60°C for 30 min. 12 ⁇ of the supernatant was taken out and diluted 1 : 100, with 5 ⁇ used for Taqman assays. Lanes were washed with 2xSSC+0.1% SDS, IXTMAX (1ml). In a HiDi wash (2X12uL for 5min) the lanes were washed with IXTMAX (2xlml).
  • a reaction nmix was prepared with 10 ⁇ 1 of TaqMan Fast Universal Master Mix, No UNG; 1 ⁇ of 20x primer probe mix; 4 ⁇ of H20; 5 ⁇ of Stock solution (Total: 20 ⁇ ). The mix was subjected to 95°C (20 sec) and 40 thermocycles (95°C 3 sec, 60°C 30 sec), followed by data collection.
  • Amplification using two breathable primers was more efficient than using one breathable primer alone.
  • any feature can be claimed in combination with any other, or be claimed as not present in combination with another feature.
  • a feature can be any piece of information that can characterize an invention or can limit the scope of a claim, for example any variation, step, feature, property, composition, method, step, degree, level, component, material, substance, element, mode, variable, aspect, measure, amount, option, embodiment, clause, descriptive term, claim element or limitation.
  • features described herein are intended to be optional unless explicitly indicated to be necessary in the specification.
  • Non- limiting examples of language indicating that a feature is regarded as optional in the specification include terms such as “variation,” “where,” “while,” “when,” “optionally,” “include,” “preferred,” “especial,” “recommended,” “advisable,” “particular,” “should,” “alternative,” “typical,” “representative,” “various,” “such as,” “the like,” “can,” “may,” “example,” “embodiment,” or “aspect,” “in some,” “example,” “exemplary”, “instance”, “if or any combination and/or variation of such terms.
  • Any indication that a feature is optional is intended provide adequate support (e.g., under 35 U.S.C. 112 or Art. 83 and 84 of EPC) for claims that include closed or exclusive or negative language with reference to the optional feature.
  • Exclusive language specifically excludes the particular recited feature from including any additional subject matter. For example, if it is indicated that A can be drug X, such language is intended to provide support for a claim that explicitly specifies that A consists of X alone, or that A does not include any other drugs besides X.
  • "Negative" language explicitly excludes the optional feature itself from the scope of the claims. For example, if it is indicated that element A can include X, such language is intended to provide support for a claim that explicitly specifies that A does not include X.
  • Non-limiting examples of exclusive or negative terms include “only,” “solely,” “consisting of,” “consisting essentially of,” “alone,” “without”, “in the absence of (e.g., other items of the same type, structure and/or function)” “excluding,” “not including”, “not”, “doesn't”, “cannot,” or any combination and/or variation of such language.
  • a dog is intended to include support for one dog, no more than one dog, at least one dog, a plurality of dogs, etc.
  • qualifying terms that indicate singularity include “a single”, “one,” “alone”, “only one,” “not more than one”, etc.
  • qualifying terms that indicate (potential or actual) plurality include “at least one,” “one or more,” “more than one,” “two or more,” “a multiplicity,” “a plurality,” “any combination of,” “any permutation of,” “any one or more of,” etc.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Immobilizing And Processing Of Enzymes And Microorganisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
PCT/US2011/065535 2009-05-13 2011-12-16 Methods, compositions, systems, apparatuses and kits for nucleic acid amplification Ceased WO2012083189A2 (en)

Priority Applications (23)

Application Number Priority Date Filing Date Title
CN202410224895.0A CN118086471A (zh) 2010-12-17 2011-12-16 用于核酸扩增的方法、组合物、系统、仪器和试剂盒
JP2013544833A JP5907990B2 (ja) 2010-12-17 2011-12-16 核酸増幅のための方法、組成物、システム、装置およびキット
EP19154117.6A EP3564392B1 (en) 2010-12-17 2011-12-16 Methods for nucleic acid amplification
EP16196078.6A EP3147374B1 (en) 2010-12-17 2011-12-16 Methods for nucleic acid amplification
CN201180067596.1A CN103370425B (zh) 2010-12-17 2011-12-16 用于核酸扩增的方法、组合物、系统、仪器和试剂盒
CN201910119594.0A CN110079588B (zh) 2010-12-17 2011-12-16 用于核酸扩增的方法、组合物、系统、仪器和试剂盒
EP11808489.6A EP2652148B1 (en) 2010-12-17 2011-12-16 Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
PCT/US2012/066869 WO2013082164A1 (en) 2011-11-28 2012-11-28 Enhanced ligation reactions
US14/360,892 US9315861B2 (en) 2010-12-17 2012-11-28 Enhanced ligation reactions
US13/828,049 US9309566B2 (en) 2010-12-17 2013-03-14 Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US13/842,296 US9309557B2 (en) 2010-12-17 2013-03-15 Nucleic acid amplification
US13/923,232 US9371557B2 (en) 2010-12-17 2013-06-20 Nucleic acid amplification
US14/023,361 US9334531B2 (en) 2010-12-17 2013-09-10 Nucleic acid amplification
US14/085,718 US20140148345A1 (en) 2010-12-17 2013-11-20 Nucleic acid amplification
US14/085,727 US9309558B2 (en) 2010-12-17 2013-11-20 Nucleic acid amplification
US14/789,922 US10113195B2 (en) 2010-12-17 2015-07-01 Nucleic acid amplification
US15/071,086 US9765388B2 (en) 2010-12-17 2016-03-15 Enhanced ligation reactions
US15/091,717 US10329544B2 (en) 2009-05-13 2016-04-06 Nucleic acid amplification
US15/695,244 US10093969B2 (en) 2010-12-17 2017-09-05 Enhanced ligation reactions
US16/168,810 US10858695B2 (en) 2010-12-17 2018-10-23 Nucleic acid amplification
US16/442,341 US11001815B2 (en) 2010-12-17 2019-06-14 Nucleic acid amplification
US17/302,192 US11725195B2 (en) 2010-12-17 2021-04-27 Nucleic acid amplification
US18/221,099 US20240067939A1 (en) 2010-12-17 2023-07-12 Nucleic acid amplification

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US201061424599P 2010-12-17 2010-12-17
US61/424,599 2010-12-17
US201161445324P 2011-02-22 2011-02-22
US61/445,324 2011-02-22
US201161451919P 2011-03-11 2011-03-11
US61/451,919 2011-03-11
US201161526478P 2011-08-23 2011-08-23
US61/526,478 2011-08-23
US201161552660P 2011-10-28 2011-10-28
US61/552,660 2011-10-28

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US13/328,844 Continuation-In-Part US20120156728A1 (en) 2009-05-13 2011-12-16 Clonal amplification of nucleic acid on solid surface with template walking

Related Child Applications (5)

Application Number Title Priority Date Filing Date
US13/328,844 Continuation-In-Part US20120156728A1 (en) 2009-05-13 2011-12-16 Clonal amplification of nucleic acid on solid surface with template walking
US13/828,049 Continuation-In-Part US9309566B2 (en) 2009-05-13 2013-03-14 Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US13/842,296 Continuation-In-Part US9309557B2 (en) 2009-05-13 2013-03-15 Nucleic acid amplification
US14/085,727 Continuation-In-Part US9309558B2 (en) 2010-12-17 2013-11-20 Nucleic acid amplification
US14/789,922 Continuation-In-Part US10113195B2 (en) 2010-12-17 2015-07-01 Nucleic acid amplification

Publications (2)

Publication Number Publication Date
WO2012083189A2 true WO2012083189A2 (en) 2012-06-21
WO2012083189A3 WO2012083189A3 (en) 2012-08-23

Family

ID=45478545

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/065535 Ceased WO2012083189A2 (en) 2009-05-13 2011-12-16 Methods, compositions, systems, apparatuses and kits for nucleic acid amplification

Country Status (5)

Country Link
US (10) US20120156728A1 (enExample)
EP (3) EP3147374B1 (enExample)
JP (1) JP5907990B2 (enExample)
CN (3) CN110079588B (enExample)
WO (1) WO2012083189A2 (enExample)

Cited By (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014043143A1 (en) * 2012-09-11 2014-03-20 Life Technologies Corporation Nucleic acid amplification
EP2699698A4 (en) * 2011-04-20 2015-01-21 Mesa Tech International Inc OSCILLATING AMPLIFICATION REACTION FOR NUCLEIC ACIDS
US9309558B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Nucleic acid amplification
US9309566B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US9334531B2 (en) 2010-12-17 2016-05-10 Life Technologies Corporation Nucleic acid amplification
US9476080B2 (en) 2010-12-17 2016-10-25 Life Technologies Corporation Clonal amplification of nucleic acid on solid surface with template walking
EP3095879A1 (en) * 2012-04-19 2016-11-23 Life Technologies Corporation Nucleic acid amplification
US9944922B2 (en) 2008-05-05 2018-04-17 Los Alamos National Security, Llc Highly simplified lateral flow-based nucleic acid sample preparation and passive fluid flow control
US10030262B2 (en) 2012-04-19 2018-07-24 Life Technologies Corporation Method of performing digital PCR
US10066260B2 (en) 2013-03-14 2018-09-04 Life Technologies Corporation Matrix arrays and methods for making same
US10458978B2 (en) 2006-08-22 2019-10-29 Triad National Security, Llc Miniaturized lateral flow device for rapid and sensitive detection of proteins or nucleic acids
WO2020076976A1 (en) * 2018-10-10 2020-04-16 Readcoor, Inc. Three-dimensional spatial molecular indexing
EP3692049A4 (en) * 2017-10-04 2021-06-23 Centrillion Technology Holdings Corporation METHOD AND SYSTEM FOR ENZYMATIC SYNTHESIS OF OLIGONUCLEOTIDES
JP2022027975A (ja) * 2012-07-24 2022-02-14 ナテラ, インコーポレイテッド 高度多重pcr法および組成物
US11268117B2 (en) 2016-06-10 2022-03-08 Life Technologies Corporation Methods and compositions for nucleic acid amplification
US11293056B2 (en) 2017-11-07 2022-04-05 Life Technologies Corporation Methods and compositions for manipulating nucleic acids
US11591643B2 (en) 2016-06-30 2023-02-28 Lumiradx Uk Ltd. In or relating to uncleic acid amplification processes
CN116064734A (zh) * 2012-04-19 2023-05-05 生命技术公司 核酸扩增
US11655496B2 (en) 2018-01-04 2023-05-23 Lumiradx Uk Ltd. Amplification of nucleic acids
US11746376B2 (en) 2010-05-18 2023-09-05 Natera, Inc. Methods for amplification of cell-free DNA using ligated adaptors and universal and inner target-specific primers for multiplexed nested PCR
US11939634B2 (en) 2010-05-18 2024-03-26 Natera, Inc. Methods for simultaneous amplification of target loci
US11946101B2 (en) 2015-05-11 2024-04-02 Natera, Inc. Methods and compositions for determining ploidy
US12020778B2 (en) 2010-05-18 2024-06-25 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US12024738B2 (en) 2018-04-14 2024-07-02 Natera, Inc. Methods for cancer detection and monitoring
US12023672B2 (en) 2015-04-24 2024-07-02 Mesa Biotech, Inc. Fluidic test cassette
US12084720B2 (en) 2017-12-14 2024-09-10 Natera, Inc. Assessing graft suitability for transplantation
US12100478B2 (en) 2012-08-17 2024-09-24 Natera, Inc. Method for non-invasive prenatal testing using parental mosaicism data
US12110552B2 (en) 2010-05-18 2024-10-08 Natera, Inc. Methods for simultaneous amplification of target loci
US12146195B2 (en) 2016-04-15 2024-11-19 Natera, Inc. Methods for lung cancer detection
US12152275B2 (en) 2010-05-18 2024-11-26 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US12203136B2 (en) 2020-08-17 2025-01-21 Readcoor, Llc Methods and systems for spatial mapping of genetic variants
US12203142B2 (en) 2014-04-21 2025-01-21 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US12221653B2 (en) 2010-05-18 2025-02-11 Natera, Inc. Methods for simultaneous amplification of target loci
US12226745B2 (en) 2017-11-07 2025-02-18 Life Technologies Corporation Methods and compositions for manipulating nucleic acids
US12234509B2 (en) 2018-07-03 2025-02-25 Natera, Inc. Methods for detection of donor-derived cell-free DNA
US12260934B2 (en) 2014-06-05 2025-03-25 Natera, Inc. Systems and methods for detection of aneuploidy
US12270073B2 (en) 2010-05-18 2025-04-08 Natera, Inc. Methods for preparing a biological sample obtained from an individual for use in a genetic testing assay
US12305229B2 (en) 2014-04-21 2025-05-20 Natera, Inc. Methods for simultaneous amplification of target loci
US12410476B2 (en) 2010-05-18 2025-09-09 Natera, Inc. Methods for simultaneous amplification of target loci
US12460264B2 (en) 2016-11-02 2025-11-04 Natera, Inc. Method of detecting tumour recurrence
US12492429B2 (en) 2014-04-21 2025-12-09 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US12509728B2 (en) 2005-07-29 2025-12-30 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US12545960B2 (en) 2010-05-18 2026-02-10 Natera, Inc. Methods for simultaneous amplification of target loci
US12553083B2 (en) 2010-05-18 2026-02-17 Natera, Inc. Methods for enriching and sequencing nucleic acids for non-invasive cancer testing
US12559790B2 (en) 2020-01-29 2026-02-24 10X Genomics, Inc. Compositions and methods for analyte detection
US12571043B2 (en) 2005-11-26 2026-03-10 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals

Families Citing this family (110)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8583380B2 (en) 2008-09-05 2013-11-12 Aueon, Inc. Methods for stratifying and annotating cancer drug treatment options
US10030045B2 (en) 2010-02-19 2018-07-24 Ohio State Innovation Foundation Primers and methods for nucleic acid amplification
CN103228798B (zh) 2010-09-24 2015-12-09 斯坦福大学托管董事会 使用固定的引物直接捕获、扩增及测序靶标dna
US9399217B2 (en) 2010-10-04 2016-07-26 Genapsys, Inc. Chamber free nanoreactor system
US9184099B2 (en) 2010-10-04 2015-11-10 The Board Of Trustees Of The Leland Stanford Junior University Biosensor devices, systems and methods therefor
WO2012047889A2 (en) 2010-10-04 2012-04-12 Genapsys Inc. Systems and methods for automated reusable parallel biological reactions
US10494671B2 (en) 2011-01-17 2019-12-03 Life Technologies Corporation Enzymatic ligation of nucleic acids
EP3567121B1 (en) 2011-01-17 2023-08-30 Life Technologies Corporation Workflow for detection of ligands using nucleic acids
US8585973B2 (en) 2011-05-27 2013-11-19 The Board Of Trustees Of The Leland Stanford Junior University Nano-sensor array
US9926596B2 (en) 2011-05-27 2018-03-27 Genapsys, Inc. Systems and methods for genetic and biological analysis
EP2785868B1 (en) 2011-12-01 2017-04-12 Genapsys Inc. Systems and methods for high efficiency electronic sequencing and detection
SG10201504490QA (en) 2012-01-26 2015-07-30 Nugen Technologies Inc Compositions And Methods For Targeted Nucleic Acid Sequence Enrichment And High Efficiency Library Generation
US9957549B2 (en) 2012-06-18 2018-05-01 Nugen Technologies, Inc. Compositions and methods for negative selection of non-desired nucleic acid sequences
US20150011396A1 (en) 2012-07-09 2015-01-08 Benjamin G. Schroeder Methods for creating directional bisulfite-converted nucleic acid libraries for next generation sequencing
EP2888371B1 (en) * 2012-08-24 2017-08-02 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid paired end sequencing
EP3257952B1 (en) 2012-09-11 2020-02-12 Life Technologies Corporation Nucleic acid amplification
WO2014138385A1 (en) * 2013-03-06 2014-09-12 Ohio State Innovation Foundation Isothermal amplification of nuleic acid, and library preparation and clone generation in sequencing
US10590474B2 (en) * 2013-03-11 2020-03-17 Elitechgroup B.V. Methods for true isothermal strand displacement amplification
EP2971106B1 (en) * 2013-03-11 2020-02-26 ELITechGroup, Inc. Methods for true isothermal strand displacement amplification
US10975423B2 (en) * 2013-03-11 2021-04-13 Elitechgroup, Inc. Methods for true isothermal strand displacement amplification
CN105051214B (zh) 2013-03-15 2018-12-28 吉纳普赛斯股份有限公司 用于生物分析的系统和方法
US20140274738A1 (en) 2013-03-15 2014-09-18 Nugen Technologies, Inc. Sequential sequencing
EP4610368B1 (en) 2013-08-05 2026-02-04 Twist Bioscience Corporation De novo synthesized gene libraries
WO2015073711A1 (en) 2013-11-13 2015-05-21 Nugen Technologies, Inc. Compositions and methods for identification of a duplicate sequencing read
WO2015089238A1 (en) 2013-12-11 2015-06-18 Genapsys, Inc. Systems and methods for biological analysis and computation
WO2015131107A1 (en) 2014-02-28 2015-09-03 Nugen Technologies, Inc. Reduced representation bisulfite sequencing with diversity adaptors
US9822401B2 (en) 2014-04-18 2017-11-21 Genapsys, Inc. Methods and systems for nucleic acid amplification
SG11201609055RA (en) 2014-05-08 2016-11-29 Fluidigm Corp Integrated single cell sequencing
EP3155127B1 (en) 2014-06-13 2020-07-22 Life Technologies Corporation Multiplex nucleic acid amplification
DE112015004899B4 (de) 2014-11-27 2022-10-20 Hitachi High-Tech Corporation Spot-array-substrat, verfahren zum herstellen eines solchen und nukleinsäurepolymer-analyseverfahren und -vorrichtung
CA3253836A1 (en) 2015-02-04 2025-12-01 Twist Bioscience Corporation Compositions and methods for synthetic gene assembly
WO2016126882A1 (en) 2015-02-04 2016-08-11 Twist Bioscience Corporation Methods and devices for de novo oligonucleic acid assembly
EP3259372B1 (en) 2015-02-17 2020-11-18 MGI Tech Co., Ltd. Dna sequencing using controlled strand displacement
GB201502645D0 (en) * 2015-02-17 2015-04-01 Touchlight Genetics Ltd Method
CN114002299B (zh) 2015-03-05 2024-12-24 生命技术公司 生物传感器的表面稳定
EP4282977B1 (en) 2015-04-10 2024-06-05 10x Genomics Sweden AB Spatially distinguished, multiplex nucleic acid analysis of biological specimens
US9981239B2 (en) 2015-04-21 2018-05-29 Twist Bioscience Corporation Devices and methods for oligonucleic acid library synthesis
US11220705B2 (en) 2015-04-24 2022-01-11 Qiagen Gmbh Method for immobilizing a nucleic acid molecule on solid support
WO2016170182A1 (en) 2015-04-24 2016-10-27 Qiagen Gmbh Method for immobilizing a nucleic acid molecule on a solid support
KR20170138566A (ko) 2015-04-29 2017-12-15 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 가닥 특이적 cDNA 라이브러리를 작제하기 위한 조성물 및 방법
ES2789349T3 (es) 2015-05-29 2020-10-26 Illumina Cambridge Ltd Utilización mejorada de cebadores de superficie en grupos
CN107849600A (zh) 2015-06-09 2018-03-27 生命技术公司 用于分子标记的方法、系统、组合物、试剂盒、装置和计算机可读媒体
IL258164B (en) 2015-09-18 2022-09-01 Twist Bioscience Corp Methods for modulating protein and cellular activity and method for nucleic acid synthesis
CN108698012A (zh) 2015-09-22 2018-10-23 特韦斯特生物科学公司 用于核酸合成的柔性基底
EP3359669B1 (en) 2015-10-06 2020-05-13 Pierce Biotechnology, Inc. Devices and methods for producing proteins
CN115920796A (zh) 2015-12-01 2023-04-07 特韦斯特生物科学公司 功能化表面及其制备
US10626390B2 (en) 2016-02-08 2020-04-21 RGENE, Inc. Multiple ligase compositions, systems, and methods
JP2017209051A (ja) * 2016-05-25 2017-11-30 株式会社ニコン 標的生体分子の検出方法、標的生体分子検出用基板、及び標的生体分子検出装置
WO2017214127A1 (en) 2016-06-06 2017-12-14 Redvault Biosciences, Lp Target reporter constructs and uses thereof
WO2018017884A1 (en) 2016-07-20 2018-01-25 Genapsys, Inc. Systems and methods for nucleic acid sequencing
EP4039824A1 (en) * 2016-08-15 2022-08-10 Pacific Biosciences of California, Inc. Method and system for sequencing nucleic acids
SG11201901563UA (en) 2016-08-22 2019-03-28 Twist Bioscience Corp De novo synthesized nucleic acid libraries
JP6871364B2 (ja) 2016-09-21 2021-05-12 ツイスト バイオサイエンス コーポレーション 核酸に基づくデータ保存
WO2018065299A1 (en) * 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Nucleic acid sequencing using nanotransistors
AU2017378492B2 (en) 2016-12-16 2022-06-16 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
CN114958998A (zh) * 2017-01-10 2022-08-30 深圳华大智造科技股份有限公司 一种提高核酸聚合测序质量的方法、反应体系和试剂盒
CA3063364A1 (en) 2017-01-26 2018-08-02 Qiagen Gmbh Method for enriching template nucleic acids
EP4556433A3 (en) 2017-02-22 2025-08-06 Twist Bioscience Corporation Nucleic acid based data storage
WO2018170169A1 (en) 2017-03-15 2018-09-20 Twist Bioscience Corporation Variant libraries of the immunological synapse and synthesis thereof
US10737267B2 (en) 2017-04-04 2020-08-11 Omniome, Inc. Fluidic apparatus and methods useful for chemical and biological reactions
US12492430B2 (en) 2017-04-11 2025-12-09 Tecan Genomics, Inc. Library quantitation and qualification
CN111566209B (zh) 2017-06-12 2024-08-30 特韦斯特生物科学公司 无缝核酸装配方法
WO2018231864A1 (en) 2017-06-12 2018-12-20 Twist Bioscience Corporation Methods for seamless nucleic acid assembly
WO2019035897A1 (en) 2017-08-15 2019-02-21 Omniome, Inc. SCANNING APPARATUS AND METHODS USEFUL FOR DETECTION OF CHEMICAL OR BIOLOGICAL ANALYTES
EP3681906A4 (en) 2017-09-11 2021-06-09 Twist Bioscience Corporation GPCR-BINDING PROTEINS AND THEIR SYNTHESIS
JP2021500858A (ja) 2017-09-21 2021-01-14 ジナプシス インコーポレイテッド 核酸シーケンシングのためのシステム及び方法
AU2018353136B2 (en) 2017-10-19 2022-05-19 Pacific Biosciences Of California, Inc. Simultaneous background reduction and complex stabilization in binding assay workflows
US11099202B2 (en) 2017-10-20 2021-08-24 Tecan Genomics, Inc. Reagent delivery system
KR102889470B1 (ko) 2017-10-20 2025-11-21 트위스트 바이오사이언스 코포레이션 폴리뉴클레오타이드 합성을 위한 가열된 나노웰
CA3088911A1 (en) 2018-01-04 2019-07-11 Twist Bioscience Corporation Dna-based storage device and method for synthesizing polynucleotides using the device
GB201804585D0 (en) * 2018-03-22 2018-05-09 Dnae Diagnostics Ltd Methods for amplication of nucleic acids with Endonuclease-Mediated shifting equilibrium amplification (EM-SEq)
AU2019255987A1 (en) 2018-04-19 2020-12-10 Pacific Biosciences Of California, Inc. Improving accuracy of base calls in nucleic acid sequencing methods
WO2019222706A1 (en) 2018-05-18 2019-11-21 Twist Bioscience Corporation Polynucleotides, reagents, and methods for nucleic acid hybridization
WO2020018824A1 (en) 2018-07-19 2020-01-23 Ultima Genomics, Inc. Nucleic acid clonal amplification and sequencing methods, systems, and kits
EP3826762A1 (en) 2018-07-23 2021-06-02 DNA Script Massively parallel enzymatic synthesis of nucleic acid strands
US20240011086A1 (en) 2018-11-15 2024-01-11 Omniome, Inc. Electronic detection of nucleic acid structure
WO2020117653A1 (en) 2018-12-04 2020-06-11 Omniome, Inc. Mixed-phase fluids for nucleic acid sequencing and other analytical assays
SG11202012762WA (en) 2018-12-05 2021-01-28 Illumina Cambridge Ltd Methods and compositions for cluster generation by bridge amplification
WO2020123311A2 (en) 2018-12-10 2020-06-18 10X Genomics, Inc. Resolving spatial arrays using deconvolution
CN112654714B (zh) * 2018-12-17 2024-10-11 伊卢米纳剑桥有限公司 用于测序的引物寡核苷酸
KR102872035B1 (ko) 2018-12-18 2025-10-16 일루미나 케임브리지 리미티드 단일 표면 프라이머를 사용하는 페어드 엔드 서열분석을 위한 방법 및 조성물
CN113227348B (zh) 2018-12-20 2025-05-27 加利福尼亚太平洋生物科学股份有限公司 用于分析核酸和其他分析物的温度控制
CA3124980A1 (en) 2018-12-26 2020-07-02 Twist Bioscience Corporation Highly accurate de novo polynucleotide synthesis
US11649485B2 (en) 2019-01-06 2023-05-16 10X Genomics, Inc. Generating capture probes for spatial analysis
US11926867B2 (en) 2019-01-06 2024-03-12 10X Genomics, Inc. Generating capture probes for spatial analysis
WO2020167656A1 (en) 2019-02-11 2020-08-20 Ultima Genomics, Inc. Methods for nucleic acid analysis
US11680950B2 (en) 2019-02-20 2023-06-20 Pacific Biosciences Of California, Inc. Scanning apparatus and methods for detecting chemical and biological analytes
CN113785057A (zh) 2019-02-26 2021-12-10 特韦斯特生物科学公司 用于抗体优化的变异核酸文库
JP2022521551A (ja) 2019-02-26 2022-04-08 ツイスト バイオサイエンス コーポレーション Glp1受容体の変異体核酸ライブラリ
GB201905303D0 (en) 2019-04-15 2019-05-29 Thermo Fisher Scient Geneart Gmbh Multiplex assembly of nucleic acid molecules
WO2020227031A1 (en) 2019-05-03 2020-11-12 Life Technologies Corporation Methods and compositions for manipulating nucleic acids
WO2020252186A1 (en) 2019-06-11 2020-12-17 Omniome, Inc. Calibrated focus sensing
AU2020298294A1 (en) 2019-06-21 2022-02-17 Twist Bioscience Corporation Barcode-based nucleic acid sequence assembly
US10656368B1 (en) 2019-07-24 2020-05-19 Omniome, Inc. Method and system for biological imaging using a wide field objective lens
JP7675700B2 (ja) 2019-08-21 2025-05-13 ライフ テクノロジーズ コーポレーション シーケンシングのためのシステムおよび方法
US11180520B2 (en) 2019-09-10 2021-11-23 Omniome, Inc. Reversible modifications of nucleotides
WO2021061842A1 (en) 2019-09-23 2021-04-01 Twist Bioscience Corporation Variant nucleic acid libraries for single domain antibodies
US12091777B2 (en) 2019-09-23 2024-09-17 Twist Bioscience Corporation Variant nucleic acid libraries for CRTH2
BR112022011235A2 (pt) 2019-12-09 2022-12-13 Twist Bioscience Corp Bibliotecas de variantes de ácido nucleico para receptores de adenosina
US11821035B1 (en) 2020-01-29 2023-11-21 10X Genomics, Inc. Compositions and methods of making gene expression libraries
US12076701B2 (en) 2020-01-31 2024-09-03 10X Genomics, Inc. Capturing oligonucleotides in spatial transcriptomics
US12059674B2 (en) 2020-02-03 2024-08-13 Tecan Genomics, Inc. Reagent storage system
CN115243792A (zh) 2020-02-04 2022-10-25 加利福尼亚太平洋生物科学股份有限公司 流通池及其制造和使用方法
US20220170093A1 (en) 2020-11-16 2022-06-02 Life Technologies Corporation System and method for sequencing
US12576400B2 (en) 2021-01-08 2026-03-17 Cellanome, Inc. Methods for incubating and analyzing a cell in a compartment of a fluidic device
MX2023007842A (es) 2021-01-08 2023-09-19 Cellanome Inc Dispositivos y metodos para analizar muestras biologicas.
US11236388B1 (en) * 2021-06-17 2022-02-01 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
US11859241B2 (en) 2021-06-17 2024-01-02 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
EP4573213A1 (en) 2022-08-15 2025-06-25 Element Biosciences, Inc. Spatially resolved surface capture of nucleic acids
GB202215624D0 (en) 2022-10-21 2022-12-07 Dnae Diagnostics Ltd Clonal amplification

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003072805A2 (en) 2002-02-21 2003-09-04 Asm Scientific, Inc. Recombinase polymerase amplification
US20100136544A1 (en) 2007-03-07 2010-06-03 Jeremy Agresti Assays and other reactions involving droplets
US20100304982A1 (en) 2009-05-29 2010-12-02 Ion Torrent Systems, Inc. Scaffolded nucleic acid polymer particles and methods of making and using

Family Cites Families (102)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US1009396A (en) 1911-06-03 1911-11-21 Arthur E Fahrman Perforating-machine.
US4883750A (en) 1984-12-13 1989-11-28 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
US4988617A (en) 1988-03-25 1991-01-29 California Institute Of Technology Method of detecting a nucleotide change in nucleic acids
US5223414A (en) 1990-05-07 1993-06-29 Sri International Process for nucleic acid hybridization and amplification
US5426180A (en) 1991-03-27 1995-06-20 Research Corporation Technologies, Inc. Methods of making single-stranded circular oligonucleotides
WO1994003624A1 (en) 1992-08-04 1994-02-17 Auerbach Jeffrey I Methods for the isothermal amplification of nucleic acid molecules
RU2048522C1 (ru) 1992-10-14 1995-11-20 Институт белка РАН Способ размножения нуклеиновых кислот, способ их экспрессии и среда для их осуществления
US6001568A (en) 1992-10-26 1999-12-14 Institut Belka Solid medium for amplification and expression of nucleic acids as colonies
US5593826A (en) 1993-03-22 1997-01-14 Perkin-Elmer Corporation, Applied Biosystems, Inc. Enzymatic ligation of 3'amino-substituted oligonucleotides
DE69433010T2 (de) 1993-04-12 2004-06-09 Northwestern University, Evanston Verfahren zur darstellung von oligonukleotiden
SE9400522D0 (sv) 1994-02-16 1994-02-16 Ulf Landegren Method and reagent for detecting specific nucleotide sequences
AT402203B (de) 1995-06-13 1997-03-25 Himmler Gottfried Dipl Ing Dr Verfahren zur transkriptionsfreien amplifizierung von nucleinsäuren
US5773258A (en) * 1995-08-25 1998-06-30 Roche Molecular Systems, Inc. Nucleic acid amplification using a reversibly inactivated thermostable enzyme
US5670325A (en) 1996-08-14 1997-09-23 Exact Laboratories, Inc. Method for the detection of clonal populations of transformed cells in a genomically heterogeneous cellular sample
CA2244891C (en) 1996-02-09 2008-12-30 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US5928870A (en) 1997-06-16 1999-07-27 Exact Laboratories, Inc. Methods for the detection of loss of heterozygosity
WO1998008975A1 (en) 1996-08-29 1998-03-05 Daikin Industries, Ltd. Methods for targeting, enriching, detecting and/or isolating target nucleic acid sequence using reca-like recombinase
US5948653A (en) 1997-03-21 1999-09-07 Pati; Sushma Sequence alterations using homologous recombination
EP2327797B1 (en) * 1997-04-01 2015-11-25 Illumina Cambridge Limited Method of nucleic acid sequencing
US6432360B1 (en) 1997-10-10 2002-08-13 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6511803B1 (en) 1997-10-10 2003-01-28 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6306590B1 (en) 1998-06-08 2001-10-23 Caliper Technologies Corp. Microfluidic matrix localization apparatus and methods
AR021833A1 (es) 1998-09-30 2002-08-07 Applied Research Systems Metodos de amplificacion y secuenciacion de acido nucleico
GB9902970D0 (en) 1999-02-11 1999-03-31 Zeneca Ltd Novel matrix
US6531302B1 (en) * 1999-04-12 2003-03-11 Nanogen/Becton Dickinson Partnership Anchored strand displacement amplification on an electronically addressable microchip
AUPQ008799A0 (en) * 1999-04-30 1999-05-27 Tillett, Daniel Genome sequencing
US6300070B1 (en) * 1999-06-04 2001-10-09 Mosaic Technologies, Inc. Solid phase methods for amplifying multiple nucleic acids
US6440706B1 (en) 1999-08-02 2002-08-27 Johns Hopkins University Digital amplification
US6413792B1 (en) 2000-04-24 2002-07-02 Eagle Research Development, Llc Ultra-fast nucleic acid sequencing device and a method for making and using the same
WO2001092579A2 (en) 2000-05-30 2001-12-06 Pe Corporation (Ny) Methods for detecting target nucleic acids using coupled ligation and amplification
AR031640A1 (es) * 2000-12-08 2003-09-24 Applied Research Systems Amplificacion isotermica de acidos nucleicos en un soporte solido
US6946251B2 (en) * 2001-03-09 2005-09-20 Nugen Technologies, Inc. Methods and compositions for amplification of RNA sequences using RNA-DNA composite primers
ATE397095T1 (de) 2001-04-20 2008-06-15 Penn State Res Found Verfahren zur manipulation von nukleinsäuren
WO2002086088A2 (en) 2001-04-24 2002-10-31 Li-Cor, Inc. Polymerases with charge-switch activity and methods of generating such polymerases
US20040161741A1 (en) * 2001-06-30 2004-08-19 Elazar Rabani Novel compositions and processes for analyte detection, quantification and amplification
US8030000B2 (en) 2002-02-21 2011-10-04 Alere San Diego, Inc. Recombinase polymerase amplification
US7399590B2 (en) 2002-02-21 2008-07-15 Asm Scientific, Inc. Recombinase polymerase amplification
US20050118616A1 (en) * 2002-08-16 2005-06-02 Kawashima Tadashi R. Amplification of target nucleotide sequence without polymerase chain reaction
WO2004029223A2 (en) 2002-09-30 2004-04-08 Parallele Bioscience, Inc. Polynucleotide synthesis and labeling by kinetic sampling ligation
US7255994B2 (en) 2003-06-10 2007-08-14 Applera Corporation Ligation assay
WO2005007796A2 (en) 2003-07-21 2005-01-27 Molecular Cytomics Ltd. Improved multiwell plate
US7432055B2 (en) 2004-03-05 2008-10-07 Uchicago Argonne Llc Dual phase multiplex polymerase chain reaction
JP5026958B2 (ja) 2004-06-01 2012-09-19 アリーア サン ディエゴ, インコーポレイテッド リコンビナーゼポリメラーゼ増幅
CN101189345A (zh) 2005-02-01 2008-05-28 Ab先进基因分析公司 珠基测序的试剂、方法和文库
US7604940B1 (en) 2005-03-16 2009-10-20 Applied Biosystems, Llc Compositions and methods for analyzing isolated polynucleotides
WO2006099579A2 (en) * 2005-03-16 2006-09-21 Applera Corporation Compositions and methods for clonal amplification and analysis of polynucleotides
GB0514910D0 (en) 2005-07-20 2005-08-24 Solexa Ltd Method for sequencing a polynucleotide template
GB0514936D0 (en) * 2005-07-20 2005-08-24 Solexa Ltd Preparation of templates for nucleic acid sequencing
JP5027126B2 (ja) 2005-07-25 2012-09-19 アリーア サン ディエゴ, インコーポレイテッド リコンビナーゼポリメラーゼ増幅を多重化するための方法
ATE550441T1 (de) * 2005-09-06 2012-04-15 Gen Probe Inc Verfahren, zusammensetzungen und kits zur isothermischen amplifikation von nukleinsäuren
US8192930B2 (en) 2006-02-08 2012-06-05 Illumina Cambridge Limited Method for sequencing a polynucleotide template
EP2021503A1 (en) * 2006-03-17 2009-02-11 Solexa Ltd. Isothermal methods for creating clonal single molecule arrays
US7282337B1 (en) 2006-04-14 2007-10-16 Helicos Biosciences Corporation Methods for increasing accuracy of nucleic acid sequencing
JP2009538123A (ja) 2006-04-19 2009-11-05 アプライド バイオシステムズ, エルエルシー ゲル非含有ビーズベースの配列決定のための試薬、方法およびライブラリー
JP2009535053A (ja) 2006-05-04 2009-10-01 エーエスエム サイエンティフィック, インコーポレイテッド レコンビナーゼポリメラーゼ増幅
WO2008015396A2 (en) 2006-07-31 2008-02-07 Solexa Limited Method of library preparation avoiding the formation of adaptor dimers
US7754429B2 (en) 2006-10-06 2010-07-13 Illumina Cambridge Limited Method for pair-wise sequencing a plurity of target polynucleotides
US20080118917A1 (en) 2006-11-21 2008-05-22 Applera Corporation Isothermal SNP Detection Method
US8262900B2 (en) * 2006-12-14 2012-09-11 Life Technologies Corporation Methods and apparatus for measuring analytes using large scale FET arrays
EP2639578B1 (en) 2006-12-14 2016-09-14 Life Technologies Corporation Apparatus for measuring analytes using large scale fet arrays
US7932034B2 (en) 2006-12-20 2011-04-26 The Board Of Trustees Of The Leland Stanford Junior University Heat and pH measurement for sequencing of DNA
JP5368321B2 (ja) 2007-03-02 2013-12-18 ディ・エヌ・エイ・エレクトロニクス・リミテッド 固相pH検出を用いたqPCR
EP2191011B1 (en) 2007-08-29 2017-03-29 Illumina Cambridge Limited Method for sequencing a polynucleotide template
CA2700838A1 (en) 2007-09-28 2009-04-09 Pacific Biosciences Of California, Inc. Error-free amplification of dna for clonal sequencing
US20090286286A1 (en) 2007-11-06 2009-11-19 Ambergen , Inc. Methods for controlling amplification
US20090171078A1 (en) 2007-11-20 2009-07-02 Applied Biosystems Inc. Method of sequencing nucleic acids using elaborated nucleotide phosphorotiolate compounds
CA2712426A1 (en) 2008-02-05 2009-08-13 F. Hoffmann-La Roche Ag Paired end sequencing
EP2247727A4 (en) * 2008-02-12 2011-08-03 Nugen Technologies Inc PROCESS FOR ARCHIVING AND CLONING EXPANSION
US20090203531A1 (en) * 2008-02-12 2009-08-13 Nurith Kurn Method for Archiving and Clonal Expansion
GB0810573D0 (en) 2008-06-10 2008-07-16 Univ Westminster Anti-bacterial ligase inhibitors
HRP20171286T1 (hr) * 2008-06-11 2017-11-17 Orion Pharma (Uk) Limited Izotermna amplifikacija nukleinske kiseline
EP2291533B2 (en) 2008-07-02 2020-09-30 Illumina Cambridge Limited Using populations of beads for the fabrication of arrays on surfaces
US8530156B2 (en) * 2008-08-08 2013-09-10 President And Fellows Of Harvard College Chemically cleavable phosphoramidite linkers for sequencing by ligation
CN101413034B (zh) 2008-11-21 2011-02-09 东南大学 高通量核酸分子克隆制备分子克隆芯片的方法
EP2379748A4 (en) 2008-12-23 2012-08-29 Illumina Inc MULTIBASE RELEASE FOR LONG READINGS IN SEQUENCING BY SYNTHESIS PROTOCOLS
US9447461B2 (en) 2009-03-24 2016-09-20 California Institute Of Technology Analysis devices, kits, and related methods for digital quantification of nucleic acids and other analytes
US20100255487A1 (en) * 2009-03-27 2010-10-07 Life Technologies Corporation Methods and apparatus for single molecule sequencing using energy transfer detection
US9334531B2 (en) 2010-12-17 2016-05-10 Life Technologies Corporation Nucleic acid amplification
US20120156728A1 (en) 2010-12-17 2012-06-21 Life Technologies Corporation Clonal amplification of nucleic acid on solid surface with template walking
US9309566B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US9309557B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Nucleic acid amplification
EP2435461B1 (en) 2009-05-29 2017-08-09 Life Technologies Corporation Scaffolded nucleic acid polymer particles and methods of making and using
EP3360974B1 (en) 2009-06-05 2025-04-09 Abbott Diagnostics Scarborough, Inc. Recombinase polymerase amplification reagents
WO2011056866A2 (en) * 2009-11-05 2011-05-12 Epicentre Technologies Corporation Methods and kits for 3'-end-tagging of rna
US8759037B2 (en) 2010-02-23 2014-06-24 Illumina Cambridge Limited Amplification methods to minimise sequence specific bias
WO2011106460A2 (en) 2010-02-23 2011-09-01 Life Technologies Corporation Methods for flip-strand immobilizing and sequencing nucleic acids
US20110318748A1 (en) 2010-02-26 2011-12-29 Life Technologies Corporation Modified Proteins and Methods of Making and Using Same
US9029103B2 (en) 2010-08-27 2015-05-12 Illumina Cambridge Limited Methods for sequencing polynucleotides
EP2426214A1 (en) 2010-09-01 2012-03-07 Koninklijke Philips Electronics N.V. Method for amplifying nucleic acids
EP2617061B1 (en) 2010-09-15 2021-06-30 Life Technologies Corporation Methods and apparatus for measuring analytes
US10494671B2 (en) 2011-01-17 2019-12-03 Life Technologies Corporation Enzymatic ligation of nucleic acids
US20130344540A1 (en) 2011-02-03 2013-12-26 Mark T. Reed Methods for minimizing sequence specific bias
US8809021B2 (en) 2011-04-07 2014-08-19 Alere San Diego Inc. Monitoring recombinase polymerase amplification mixtures
US9139874B2 (en) 2011-07-07 2015-09-22 Life Technologies Corporation Bi-directional sequencing compositions and methods
DE102011054101A1 (de) 2011-09-30 2013-04-04 Albert-Ludwigs-Universität Freiburg Verfahren zur räumlichen Anordnung von Probenfragmenten zur Amplifikation und Immobilisierung für weitere Derivatisierungen
WO2013158313A1 (en) 2012-04-19 2013-10-24 Life Technologies Corporation Nucleic acid amplification
EP3461910B1 (en) 2012-04-19 2020-08-26 Life Technologies Corporation Nucleic acid amplification
US8895249B2 (en) 2012-06-15 2014-11-25 Illumina, Inc. Kinetic exclusion amplification of nucleic acid libraries
EP2888371B1 (en) 2012-08-24 2017-08-02 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid paired end sequencing
WO2014043143A1 (en) 2012-09-11 2014-03-20 Life Technologies Corporation Nucleic acid amplification
EP3257952B1 (en) 2012-09-11 2020-02-12 Life Technologies Corporation Nucleic acid amplification
WO2014151961A1 (en) 2013-03-14 2014-09-25 Life Technologies Corporation Matrix arrays and methods for making same

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003072805A2 (en) 2002-02-21 2003-09-04 Asm Scientific, Inc. Recombinase polymerase amplification
US20100136544A1 (en) 2007-03-07 2010-06-03 Jeremy Agresti Assays and other reactions involving droplets
US20100304982A1 (en) 2009-05-29 2010-12-02 Ion Torrent Systems, Inc. Scaffolded nucleic acid polymer particles and methods of making and using

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
BORER P.N. ET AL., J. MOL. BIOL., vol. 86, 1974, pages 843
BRESLAUER ET AL., PROC. NAT. ACAD. SCI., vol. 83, 1986, pages 3746 - 50
BREWOOD ET AL., NUCLEIC ACIDS RES., vol. 36, no. 15, September 2008 (2008-09-01), pages E98
BREWOOD, NUCLCIC ACIDS RCS., vol. 36, no. 15, September 2008 (2008-09-01), pages C98
MEUNIER-PREST ET AL., NUCLEIC ACIDS RES., vol. 31, no. 23, 1 December 2003 (2003-12-01), pages C150
MEUNIER-PREST ET AL., NUCLEIC ACIDS RES., vol. 31, no. 23, 1 December 2003 (2003-12-01), pages E150
RYCHLIK, W.; RHOADS, R.E., NUCL. ACIDS RCS., vol. 17, 1989, pages 8543
SANTALUCIA, J., PROC. NAT. ACAD. SCI. USA, vol. 95, 1998, pages 1460
SPINK, METHODS CELL BIOL., vol. 84, 2008, pages 115 - 41

Cited By (79)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12509728B2 (en) 2005-07-29 2025-12-30 Natera, Inc. System and method for cleaning noisy genetic data and determining chromosome copy number
US12571043B2 (en) 2005-11-26 2026-03-10 Natera, Inc. System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals
US10458978B2 (en) 2006-08-22 2019-10-29 Triad National Security, Llc Miniaturized lateral flow device for rapid and sensitive detection of proteins or nucleic acids
US9944922B2 (en) 2008-05-05 2018-04-17 Los Alamos National Security, Llc Highly simplified lateral flow-based nucleic acid sample preparation and passive fluid flow control
US10329544B2 (en) 2009-05-13 2019-06-25 Life Technologies Corporation Nucleic acid amplification
US12020778B2 (en) 2010-05-18 2024-06-25 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US12152275B2 (en) 2010-05-18 2024-11-26 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US12553086B2 (en) 2010-05-18 2026-02-17 Natera, Inc. Methods for simultaneous amplification of target loci
US12221653B2 (en) 2010-05-18 2025-02-11 Natera, Inc. Methods for simultaneous amplification of target loci
US12553083B2 (en) 2010-05-18 2026-02-17 Natera, Inc. Methods for enriching and sequencing nucleic acids for non-invasive cancer testing
US12110552B2 (en) 2010-05-18 2024-10-08 Natera, Inc. Methods for simultaneous amplification of target loci
US12545960B2 (en) 2010-05-18 2026-02-10 Natera, Inc. Methods for simultaneous amplification of target loci
US11939634B2 (en) 2010-05-18 2024-03-26 Natera, Inc. Methods for simultaneous amplification of target loci
US12270073B2 (en) 2010-05-18 2025-04-08 Natera, Inc. Methods for preparing a biological sample obtained from an individual for use in a genetic testing assay
US12410476B2 (en) 2010-05-18 2025-09-09 Natera, Inc. Methods for simultaneous amplification of target loci
US12509730B2 (en) 2010-05-18 2025-12-30 Natera, Inc. Methods for simultaneous amplification of target loci
US12494267B2 (en) 2010-05-18 2025-12-09 Natera, Inc. Methods for non-invasive prenatal ploidy calling
US11746376B2 (en) 2010-05-18 2023-09-05 Natera, Inc. Methods for amplification of cell-free DNA using ligated adaptors and universal and inner target-specific primers for multiplexed nested PCR
US9476080B2 (en) 2010-12-17 2016-10-25 Life Technologies Corporation Clonal amplification of nucleic acid on solid surface with template walking
US10233488B2 (en) 2010-12-17 2019-03-19 Life Technologies Corporation Clonal amplification of nucleic acid on solid surface with template walking
US12351865B2 (en) 2010-12-17 2025-07-08 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US10113195B2 (en) 2010-12-17 2018-10-30 Life Technologies Corporation Nucleic acid amplification
US10858695B2 (en) 2010-12-17 2020-12-08 Life Technologies Corporation Nucleic acid amplification
US10913976B2 (en) 2010-12-17 2021-02-09 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US11001815B2 (en) 2010-12-17 2021-05-11 Life Technologies Corporation Nucleic acid amplification
US11578360B2 (en) 2010-12-17 2023-02-14 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US9371557B2 (en) 2010-12-17 2016-06-21 Life Technologies Corporation Nucleic acid amplification
US9334531B2 (en) 2010-12-17 2016-05-10 Life Technologies Corporation Nucleic acid amplification
US9309566B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US9309557B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Nucleic acid amplification
US9309558B2 (en) 2010-12-17 2016-04-12 Life Technologies Corporation Nucleic acid amplification
US11725195B2 (en) 2010-12-17 2023-08-15 Life Technologies Corporation Nucleic acid amplification
US10519492B2 (en) 2011-04-20 2019-12-31 Mesa Biotech, Inc. Integrated device for nucleic acid detection and identification
US11999997B2 (en) 2011-04-20 2024-06-04 Mesa Biotech, Inc. Integrated device for nucleic acid detection and identification
US12421543B2 (en) 2011-04-20 2025-09-23 Mesa Biotech LLC Oscillating amplification reaction for nucleic acids
US10316358B2 (en) 2011-04-20 2019-06-11 Mesa Biotech, Inc. Oscillating amplification reaction for nucleic acids
US11268142B2 (en) 2011-04-20 2022-03-08 Mesa Biotech, Inc. Integrated device for nucleic acid detection and identification
US11293058B2 (en) 2011-04-20 2022-04-05 Mesa Biotech, Inc. Oscillating amplification reaction for nucleic acids
EP2699698A4 (en) * 2011-04-20 2015-01-21 Mesa Tech International Inc OSCILLATING AMPLIFICATION REACTION FOR NUCLEIC ACIDS
US9428781B2 (en) 2011-04-20 2016-08-30 Mesa Biotech, Inc. Oscillating amplification reaction for nucleic acids
US10030262B2 (en) 2012-04-19 2018-07-24 Life Technologies Corporation Method of performing digital PCR
EP3095879A1 (en) * 2012-04-19 2016-11-23 Life Technologies Corporation Nucleic acid amplification
CN116064734A (zh) * 2012-04-19 2023-05-05 生命技术公司 核酸扩增
EP3461910A1 (en) * 2012-04-19 2019-04-03 Life Technologies Corporation Nucleic acid amplification
JP2022027975A (ja) * 2012-07-24 2022-02-14 ナテラ, インコーポレイテッド 高度多重pcr法および組成物
JP7510913B2 (ja) 2012-07-24 2024-07-04 ナテラ, インコーポレイテッド 高度多重pcr法および組成物
JP2022037145A (ja) * 2012-07-24 2022-03-08 ナテラ, インコーポレイテッド 高度多重pcr法および組成物
JP7503043B2 (ja) 2012-07-24 2024-06-19 ナテラ, インコーポレイテッド 高度多重pcr法および組成物
US12100478B2 (en) 2012-08-17 2024-09-24 Natera, Inc. Method for non-invasive prenatal testing using parental mosaicism data
WO2014043143A1 (en) * 2012-09-11 2014-03-20 Life Technologies Corporation Nucleic acid amplification
US10066260B2 (en) 2013-03-14 2018-09-04 Life Technologies Corporation Matrix arrays and methods for making same
US11578356B2 (en) 2013-03-14 2023-02-14 Life Technologies Corporation Matrix arrays and methods for making same
US10738353B2 (en) 2013-03-14 2020-08-11 Life Technologies Corporation Matrix arrays and methods for making same
US12203142B2 (en) 2014-04-21 2025-01-21 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US12486542B2 (en) 2014-04-21 2025-12-02 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US12492429B2 (en) 2014-04-21 2025-12-09 Natera, Inc. Detecting mutations and ploidy in chromosomal segments
US12305229B2 (en) 2014-04-21 2025-05-20 Natera, Inc. Methods for simultaneous amplification of target loci
US12260934B2 (en) 2014-06-05 2025-03-25 Natera, Inc. Systems and methods for detection of aneuploidy
US12128414B2 (en) 2015-04-24 2024-10-29 Mesa Biotech LLC Automated method for performing an assay
US12023672B2 (en) 2015-04-24 2024-07-02 Mesa Biotech, Inc. Fluidic test cassette
US11946101B2 (en) 2015-05-11 2024-04-02 Natera, Inc. Methods and compositions for determining ploidy
US12146195B2 (en) 2016-04-15 2024-11-19 Natera, Inc. Methods for lung cancer detection
US11268117B2 (en) 2016-06-10 2022-03-08 Life Technologies Corporation Methods and compositions for nucleic acid amplification
US12571016B2 (en) 2016-06-10 2026-03-10 Life Technologies Corporation Methods and compositions for nucleic acid amplification
US11591643B2 (en) 2016-06-30 2023-02-28 Lumiradx Uk Ltd. In or relating to uncleic acid amplification processes
US12460264B2 (en) 2016-11-02 2025-11-04 Natera, Inc. Method of detecting tumour recurrence
EP3692049A4 (en) * 2017-10-04 2021-06-23 Centrillion Technology Holdings Corporation METHOD AND SYSTEM FOR ENZYMATIC SYNTHESIS OF OLIGONUCLEOTIDES
US12428676B2 (en) 2017-11-07 2025-09-30 Life Technologies Corporation Methods and compositions for manipulating nucleic acids
US12226745B2 (en) 2017-11-07 2025-02-18 Life Technologies Corporation Methods and compositions for manipulating nucleic acids
US11293056B2 (en) 2017-11-07 2022-04-05 Life Technologies Corporation Methods and compositions for manipulating nucleic acids
US12084720B2 (en) 2017-12-14 2024-09-10 Natera, Inc. Assessing graft suitability for transplantation
US11655496B2 (en) 2018-01-04 2023-05-23 Lumiradx Uk Ltd. Amplification of nucleic acids
US12385096B2 (en) 2018-04-14 2025-08-12 Natera, Inc. Methods for cancer detection and monitoring
US12024738B2 (en) 2018-04-14 2024-07-02 Natera, Inc. Methods for cancer detection and monitoring
US12234509B2 (en) 2018-07-03 2025-02-25 Natera, Inc. Methods for detection of donor-derived cell-free DNA
WO2020076976A1 (en) * 2018-10-10 2020-04-16 Readcoor, Inc. Three-dimensional spatial molecular indexing
US12098425B2 (en) 2018-10-10 2024-09-24 Readcoor, Llc Three-dimensional spatial molecular indexing
US12559790B2 (en) 2020-01-29 2026-02-24 10X Genomics, Inc. Compositions and methods for analyte detection
US12203136B2 (en) 2020-08-17 2025-01-21 Readcoor, Llc Methods and systems for spatial mapping of genetic variants

Also Published As

Publication number Publication date
CN103370425A (zh) 2013-10-23
JP2014503207A (ja) 2014-02-13
US20230175051A1 (en) 2023-06-08
EP3147374B1 (en) 2019-01-30
EP2652148B1 (en) 2016-11-30
US20150031026A1 (en) 2015-01-29
EP3564392B1 (en) 2021-11-24
WO2012083189A3 (en) 2012-08-23
US20120156728A1 (en) 2012-06-21
EP3564392A1 (en) 2019-11-06
US9765388B2 (en) 2017-09-19
US10913976B2 (en) 2021-02-09
US9315861B2 (en) 2016-04-19
US12351865B2 (en) 2025-07-08
CN110079588A (zh) 2019-08-02
US20160186224A1 (en) 2016-06-30
CN110079588B (zh) 2024-03-15
US20180010177A1 (en) 2018-01-11
CN118086471A (zh) 2024-05-28
EP3147374A1 (en) 2017-03-29
US20190024159A1 (en) 2019-01-24
US11578360B2 (en) 2023-02-14
US20210032691A1 (en) 2021-02-04
US10093969B2 (en) 2018-10-09
US9476080B2 (en) 2016-10-25
CN103370425B (zh) 2019-03-19
JP5907990B2 (ja) 2016-05-11
US20170067098A1 (en) 2017-03-09
US10597705B2 (en) 2020-03-24
US20190264272A1 (en) 2019-08-29
US10233488B2 (en) 2019-03-19
US20150275284A1 (en) 2015-10-01
EP2652148A2 (en) 2013-10-23

Similar Documents

Publication Publication Date Title
US12351865B2 (en) Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
EP3260554B1 (en) Methods, compositions, systems, apparatuses and kits for nucleic acid paired end sequencing
US9309566B2 (en) Methods, compositions, systems, apparatuses and kits for nucleic acid amplification
US10858695B2 (en) Nucleic acid amplification
US9944924B2 (en) Polynucleotide modification on solid support
CN102597256B (zh) 选择和扩增多核苷酸的方法
CN112654718B (zh) 通过桥式扩增进行簇生成的方法和组合物
WO2017214561A1 (en) Methods and compositions for nucleic acid amplification
US20100151473A1 (en) Methods and compositions for hybridizing nucleic acids
WO2026050627A1 (en) Methods of preparation of a next generation sequencing (ngs) library and ngs target enrichment

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11808489

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2013544833

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2011808489

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011808489

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 201948053690

Country of ref document: IN