WO2012072082A1 - Methods for increasing intracellular activity of hsp70 - Google Patents

Methods for increasing intracellular activity of hsp70 Download PDF

Info

Publication number
WO2012072082A1
WO2012072082A1 PCT/DK2011/050444 DK2011050444W WO2012072082A1 WO 2012072082 A1 WO2012072082 A1 WO 2012072082A1 DK 2011050444 W DK2011050444 W DK 2011050444W WO 2012072082 A1 WO2012072082 A1 WO 2012072082A1
Authority
WO
WIPO (PCT)
Prior art keywords
disease
hsp70
bioactive agent
amino acids
agent according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/DK2011/050444
Other languages
English (en)
French (fr)
Inventor
Thomas Kirkegaard Jensen
Anders Mørkeberg HINSBY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Strategic Partners AS
Original Assignee
Orphazyme AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN2011800575624A priority Critical patent/CN103338784A/zh
Priority to EP19193723.4A priority patent/EP3626255A1/en
Priority to AU2011335545A priority patent/AU2011335545A1/en
Priority to ES11844130T priority patent/ES2753169T3/es
Priority to PL11844130T priority patent/PL2646044T3/pl
Priority to US13/885,553 priority patent/US9662375B2/en
Priority to RU2013125923/10A priority patent/RU2013125923A/ru
Priority to EP11844130.2A priority patent/EP2646044B1/en
Priority to BR112013013143A priority patent/BR112013013143A2/pt
Priority to JP2013541210A priority patent/JP2013544263A/ja
Priority to DK11844130T priority patent/DK2646044T3/da
Priority to CA2817773A priority patent/CA2817773A1/en
Application filed by Orphazyme AS filed Critical Orphazyme AS
Publication of WO2012072082A1 publication Critical patent/WO2012072082A1/en
Priority to IL225941A priority patent/IL225941A0/en
Anticipated expiration legal-status Critical
Priority to US15/600,407 priority patent/US10532085B2/en
Priority to US16/698,473 priority patent/US20200188492A1/en
Priority to US17/855,002 priority patent/US20220374361A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/4523Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/4545Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines having two or more nitrogen atoms in the same ring, e.g. oxadiazines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06FELECTRIC DIGITAL DATA PROCESSING
    • G06F12/00Accessing, addressing or allocating within memory systems or architectures
    • G06F12/02Addressing or allocation; Relocation
    • G06F12/08Addressing or allocation; Relocation in hierarchically structured memory systems, e.g. virtual memory systems
    • G06F12/0802Addressing of a memory level in which the access to the desired data or data block requires associative addressing means, e.g. caches
    • G06F12/0806Multiuser, multiprocessor or multiprocessing cache systems
    • G06F12/0815Cache consistency protocols
    • G06F12/0831Cache consistency protocols using a bus scheme, e.g. with bus monitoring or watching means
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06FELECTRIC DIGITAL DATA PROCESSING
    • G06F12/00Accessing, addressing or allocating within memory systems or architectures
    • G06F12/02Addressing or allocation; Relocation
    • G06F12/08Addressing or allocation; Relocation in hierarchically structured memory systems, e.g. virtual memory systems
    • G06F12/0802Addressing of a memory level in which the access to the desired data or data block requires associative addressing means, e.g. caches
    • G06F12/0877Cache access modes
    • G06F12/0882Page mode
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06FELECTRIC DIGITAL DATA PROCESSING
    • G06F13/00Interconnection of, or transfer of information or other signals between, memories, input/output devices or central processing units
    • G06F13/14Handling requests for interconnection or transfer
    • G06F13/16Handling requests for interconnection or transfer for access to memory bus
    • G06F13/1668Details of memory controller
    • G06F13/1673Details of memory controller using buffers
    • GPHYSICS
    • G06COMPUTING OR CALCULATING; COUNTING
    • G06FELECTRIC DIGITAL DATA PROCESSING
    • G06F13/00Interconnection of, or transfer of information or other signals between, memories, input/output devices or central processing units
    • G06F13/38Information transfer, e.g. on bus
    • G06F13/40Bus structure
    • G06F13/4063Device-to-bus coupling
    • G06F13/4068Electrical coupling
    • G06F13/4072Drivers or receivers
    • G06F13/4077Precharging or discharging
    • GPHYSICS
    • G11INFORMATION STORAGE
    • G11CSTATIC STORES
    • G11C11/00Digital stores characterised by the use of particular electric or magnetic storage elements; Storage elements therefor
    • G11C11/21Digital stores characterised by the use of particular electric or magnetic storage elements; Storage elements therefor using electric elements
    • G11C11/34Digital stores characterised by the use of particular electric or magnetic storage elements; Storage elements therefor using electric elements using semiconductor devices
    • G11C11/40Digital stores characterised by the use of particular electric or magnetic storage elements; Storage elements therefor using electric elements using semiconductor devices using transistors
    • G11C11/401Digital stores characterised by the use of particular electric or magnetic storage elements; Storage elements therefor using electric elements using semiconductor devices using transistors forming cells needing refreshing or charge regeneration, i.e. dynamic cells
    • G11C11/4063Auxiliary circuits, e.g. for addressing, decoding, driving, writing, sensing or timing
    • G11C11/407Auxiliary circuits, e.g. for addressing, decoding, driving, writing, sensing or timing for memory cells of the field-effect type
    • G11C11/4074Power supply or voltage generation circuits, e.g. bias voltage generators, substrate voltage generators, back-up power, power control circuits
    • GPHYSICS
    • G11INFORMATION STORAGE
    • G11CSTATIC STORES
    • G11C11/00Digital stores characterised by the use of particular electric or magnetic storage elements; Storage elements therefor
    • G11C11/21Digital stores characterised by the use of particular electric or magnetic storage elements; Storage elements therefor using electric elements
    • G11C11/34Digital stores characterised by the use of particular electric or magnetic storage elements; Storage elements therefor using electric elements using semiconductor devices
    • G11C11/40Digital stores characterised by the use of particular electric or magnetic storage elements; Storage elements therefor using electric elements using semiconductor devices using transistors
    • G11C11/401Digital stores characterised by the use of particular electric or magnetic storage elements; Storage elements therefor using electric elements using semiconductor devices using transistors forming cells needing refreshing or charge regeneration, i.e. dynamic cells
    • G11C11/4063Auxiliary circuits, e.g. for addressing, decoding, driving, writing, sensing or timing
    • G11C11/407Auxiliary circuits, e.g. for addressing, decoding, driving, writing, sensing or timing for memory cells of the field-effect type
    • G11C11/409Read-write [R-W] circuits 
    • G11C11/4093Input/output [I/O] data interface arrangements, e.g. data buffers
    • GPHYSICS
    • G11INFORMATION STORAGE
    • G11CSTATIC STORES
    • G11C7/00Arrangements for writing information into, or reading information out from, a digital store
    • G11C7/06Sense amplifiers; Associated circuits, e.g. timing or triggering circuits
    • G11C7/065Differential amplifiers of latching type
    • GPHYSICS
    • G11INFORMATION STORAGE
    • G11CSTATIC STORES
    • G11C7/00Arrangements for writing information into, or reading information out from, a digital store
    • G11C7/10Input/output [I/O] data interface arrangements, e.g. I/O data control circuits, I/O data buffers
    • G11C7/1072Input/output [I/O] data interface arrangements, e.g. I/O data control circuits, I/O data buffers for memories with random access ports synchronised on clock signal pulse trains, e.g. synchronous memories, self timed memories
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts

Definitions

  • the present invention relates to a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of a lysosomal storage disease which arise from a defect in an enzyme whose activity is not directly associated with the presence of lysosomal BMP as a co-factor; such as glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • glycogen storage diseases gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycos
  • the molecular chaperones are found in all compartments of a cell where
  • HSPs heat shock proteins
  • Hsp70 proteins A primary example of a family of chaperones is the Hsp70 proteins. This family has recently been implicated in other aspects of cellular homeostasis besides serving as a chaperone - most markedly through its anti-apoptotic features, its functions in immunity, and the apparent dependence of cancer cells on the upregulation of Hsp70. Furthermore, Hsp70 can serve a role in safeguarding lysosomal integrity.
  • the lysosomal storage diseases are a rare group of diseases, characterized by the accumulation of substances in the lysosomal compartment and resulting destabilization hereof, with a resulting devastating effect for affected individuals. Substances accumulate in the lysosomal compartment due to deficiencies in the enzymes involved in their catabolism.
  • ERT enzyme replacement therapy
  • HSP70 is also beneficial in reversing the pathology of lysosomal storage diseases which arise from a defect in an enzyme whose activity is not directly associated with the presence of lysosomal BMP as a co-factor; such as glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • glycogen storage diseases gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of
  • Hsp70 can serve a role in safeguarding lysosomal integrity.
  • the molecular mechanism has remained unclear.
  • the molecular basis for the contribution of Hsp70 to lysosomal membrane stability is further examined, and its effect on reversing the pathology of lysosomal storage diseases is addressed; specifically when said lysosomal storage diseases does not arise from a defect in an enzyme whose activity is associated with the presence of lysosomal BMP as a co-factor.
  • the present invention provides a method for treating a lysosomal storage disease by increasing directly or indirectly the intracellular concentration and/or activity of Hsp70 in individuals in need thereof, by providing Hsp70, or a functional fragment or variant thereof, or by providing an Hsp70 inducer or co-inducer.
  • the present invention relates in one aspect to a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of a lysosomal storage disease which does not arise from a defect in an enzyme whose activity is associated with the presence of lysosomal BMP as a co-factor.
  • the present invention relates in one aspect to a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of a disease selected from the group consisting of glycogen storage diseases,
  • gangliosidoses neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of a lysosomal storage disease, wherein said said lysosomal storage disease is not selected from the group of Niemann-Pick disease, Farber disease, Krabbe disease, Sialidosis type I, Metachromatic leukodystrophy, Gaucher disease, Fabry disease and saposin-deficiency.
  • said bioactive agent is Hsp70, or a functional fragment or variant thereof.
  • said bioactive agent is an Hsp70 inducer or co- inducer.
  • Said treatment may be prophylactic, curative or ameliorating.
  • the invention also concerns a method for increasing the uptake of a compound, said method comprising the step of administering said compound together with Hsp70 or a functional fragment or variant thereof.
  • said Hsp70 or a functional fragment or variant thereof is covalently bound to said compound.
  • said Hsp70 or a functional fragment or variant thereof is non-covalently bound to said compound.
  • the present invention also relates to a method of treatment of a lysosomal storage disease comprising administration of the bioactive agent according to the present invention in combination with at least one other treatment modality.
  • Hsp70 is administered together with enzyme replacement therapy in the treatment of a lysosomal storage disorder.
  • Hsp70 is used to facilitate the uptake of enzymes in enzyme replacement therapy, thereby increasing the amount of enzyme having been taken up by the relevant cells.
  • Lysosomal storage disorder The terms “lysosomal storage disorder” and “lysosomal storage disease” are used as synonyms.
  • Functional fragment of Hsp70 is to be construed as meaning any fragment of Hsp70 having the desired function.
  • a functional fragment is a fragment capable of reversing the pathology of a lysosomal storage disease as specified herein.
  • a functional fragment is a fragment capable of inducing autophagy.
  • a functional fragment of Hsp70 is a fragment capable of increasing the uptake of said substance. It is appreciated that the exact quantitative effect of the functional fragment may be different from the effect of the full-length molecule. In some instances, the functional fragment may indeed be more effective than the full-length molecule. Furthermore, the use of fragments instead of full-length molecules may be advantageous in view of the smaller size of the fragments.
  • Functional variant of Hsp70 is to be construed as meaning any variant of Hsp70 having the desired function.
  • a functional fragment is a fragment capable of reversing the pathology of a lysosomal storage disease as specified herein.
  • a functional variant is a fragment capable of inducing autophagy.
  • a functional variant of Hsp70 is a fragment capable of increasing the uptake of said substance. It is appreciated that the exact quantitative effect of the functional variant may be different from the effect of the full-length molecule. In some instances, the functional variant may indeed be more effective than the full-length molecule.
  • Bioactive agent i. e., biologically active substance/agent
  • biologically active substance/agent is any agent, drug, compound, composition of matter or mixture which provides some pharmacologic, often beneficial, effect that can be demonstrated in vivo or in vitro. As used herein, this term further includes any physiologically or pharmacologically active substance that produces a localized or systemic effect in an individual. Further examples of bioactive agents include, but are not limited to, agents comprising or consisting of an
  • agents comprising or consisting of a polysaccharide agents comprising or consisting of an optionally glycosylated peptide, agents comprising or consisting of an optionally glycosylated polypeptide, agents comprising or consisting of a nucleic acid, agents comprising or consisting of an oligonucleotide, agents
  • a bioactive agent is a substance capable of increasing the intracellular concentration and/or activity of Hsp70.
  • drug or “medicament” as used herein includes biologically, physiologically, or pharmacologically active substances that act locally or systemically in the human or animal body.
  • treating refer equally to curative therapy, prophylactic or preventative therapy and ameliorating or palliative therapy.
  • the term includes an approach for obtaining beneficial or desired physiological results, which may be established clinically.
  • beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) condition, delay or slowing of progression or worsening of condition/symptoms, amelioration or palliation of the condition or symptoms, and remission (whether partial or total), whether detectable or undetectable.
  • the term "palliation”, and variations thereof, as used herein, means that the extent and/or undesirable manifestations of a physiological condition or symptom are lessened and/or time course of the progression is slowed or lengthened, as compared to not administering compositions of the present invention.
  • a “treatment effect” or “therapeutic effect” is manifested if there is a change in the condition being treated, as measured by the criteria constituting the definition of the terms “treating” and “treatment.”
  • There is a “change” in the condition being treated if there is at least 5% improvement, preferably 10% improvement, more preferably at least 25%, even more preferably at least 50%, such as at least 75%, and most preferably at least 100% improvement.
  • the change can be based on improvements in the severity of the treated condition in an individual, or on a difference in the frequency of improved conditions in populations of individuals with and without treatment with the bioactive agent, or with the bioactive agent in combination with a pharmaceutical composition of the present invention.
  • “Pharmacologically effective amount” "pharmaceutically effective amount” or
  • physiologically effective amount of a "bioactive agent” is the amount of an active agent present in a pharmaceutical composition as described herein that is needed to provide a desired level of active agent in the bloodstream or at the site of action in an individual (e.g. the lungs, the gastric system, the colorectal system, prostate, etc.) to be treated to give an anticipated physiological response when such composition is administered.
  • the precise amount will depend upon numerous factors, e.g., the active agent, the activity of the composition, the delivery device employed, the physical characteristics of the composition, intended patient use (i.e. the number of doses administered per day), patient considerations, and the like, and can readily be determined by one skilled in the art, based upon the information provided herein.
  • an “effective amount” of a bioactive agent can be administered in one administration, or through multiple administrations of an amount that total an effective amount, preferably within a 24-hour period. It can be determined using standard clinical procedures for determining appropriate amounts and timing of administration. It is understood that the "effective amount” can be the result of empirical and/or individualized (case-by-case) determination on the part of the treating health care professional and/or individual.
  • enhancing and “improving” a beneficial effect, and variations thereof, as used herein, refers to the therapeutic effect of the bioactive agent against placebo, or an increase in the therapeutic effect of a state-of-the-art medical treatment above that normally obtained when a pharmaceutical composition is administered without the bioactive agent of this invention.
  • An increase in the therapeutic effects is manifested when there is an acceleration and/or increase in intensity and/or extent of the therapeutic effects obtained as a result of administering the bioactive agent(s). It also includes extension of the longevity of therapeutic benefits.
  • the enhancing effect preferably, but not necessarily, results in treatment of acute symptoms for which the pharmaceutical composition alone is not effective or is less effective therapeutically. Enhancement is achieved when there is at least a 5% increase in the therapeutic effects, such as at least 10% increase in the therapeutic effects when a bioactive agent of the present invention is co-administered with a pharmaceutical composition compared with administration of the pharmaceutical composition alone.
  • the increase is at least 25%, more preferably at least 50%, even more preferably at least 75%, most preferably at least 100%.
  • “Co-administering” or “co-administration” of bioactive agent(s), or bioactive agents and state-of-the-art medicaments refers to the administration of one or more bioactive agents of the present invention, or administration of one or more bioactive agents of the present invention and a state-of-the-art pharmaceutical composition within a certain time period.
  • the time period is preferably less than 72 hours, such as less than 48 hours, for example less than 24 hours, such as less than 12 hours, for example less than 6 hours, such as less than 3 hours.
  • these terms also mean that the bioactive agent and a therapeutic composition can be administered together (simultaneously or essentially simultaneously).
  • “Individual” refers to vertebrates, in particular a member of a mammalian species, preferably primates including humans.
  • an individual as used herein is a human being, male or female, of any age.
  • an "individual in need thereof” refers to an individual who may benefit from the present invention.
  • said individual in need thereof is a diseased individual, wherein said disease is a lysosomal storage disease.
  • nucleotide refers to any of the four nucleotide
  • Each natural nucleotide comprises or essentially consists of a sugar moiety (ribose or deoxyribose), a phosphate moiety, and a natural/standard base moiety.
  • Natural nucleotides bind to complementary nucleotides according to well-known rules of base pairing (Watson and Crick), where adenine (A) pairs with thymine (T) or uracil (U); and where guanine (G) pairs with cytosine (C), wherein corresponding base-pairs are part of complementary, anti-parallel nucleotide strands.
  • the base pairing results in a specific hybridization between predetermined and complementary nucleotides.
  • the base pairing is the basis by which enzymes are able to catalyze the synthesis of an oligonucleotide
  • building blocks (normally the triphosphates of ribo or deoxyribo derivatives of A, T, U, C, or G) are directed by a template oligonucleotide to form a complementary oligonucleotide with the correct, complementary sequence.
  • the recognition of an oligonucleotide sequence by its complementary sequence is mediated by corresponding and interacting bases forming base pairs. In nature, the specific interactions leading to base pairing are governed by the size of the bases and the pattern of hydrogen bond donors and acceptors of the bases.
  • base pair recognition between bases is influenced by hydrogen bonds formed between the bases.
  • a six membered ring (a pyrimidine in natural oligonucleotides) is juxtaposed to a ring system composed of a fused, six membered ring and a five membered ring (a purine in natural oligonucleotides), with a middle hydrogen bond linking two ring atoms, and hydrogen bonds on either side joining functional groups appended to each of the rings, with donor groups paired with acceptor groups.
  • nucleic acid or “nucleic acid molecule” refers to polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action.
  • Nucleic acid molecules can be composed of monomers that are naturally-occurring nucleotides (such as DNA and RNA), or analogs of naturally-occurring nucleotides (e.g. alpha- enantiomeric forms of naturally-occurring nucleotides), or a combination of both.
  • Modified nucleotides can have alterations in sugar moieties and/or in pyrimidine or purine base moieties.
  • Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters.
  • the entire sugar moiety can be replaced with sterically and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs.
  • modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes.
  • Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages.
  • nucleic acid molecule also includes e.g. so-called “peptide nucleic acids,” which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single stranded or double stranded.
  • nucleic acid molecule refers to a nucleic acid molecule having a complementary nucleotide sequence and reverse orientation as compared to a reference nucleotide sequence.
  • sequence 5' ATGCACGGG 3' is complementary to 5' CCCGTGCAT 3'.
  • an "isolated nucleic acid molecule” is a nucleic acid molecule that is not integrated in the genomic DNA of an organism.
  • a DNA molecule that encodes a growth factor that has been separated from the genomic DNA of a cell is an isolated DNA molecule.
  • Another example of an isolated nucleic acid molecule is a chemically- synthesized nucleic acid molecule that is not integrated in the genome of an organism.
  • a nucleic acid molecule that has been isolated from a particular species is smaller than the complete DNA molecule of a chromosome from that species.
  • nucleic acid molecule construct is a nucleic acid molecule, either single- or double- stranded, that has been modified through human intervention to contain segments of nucleic acid combined and juxtaposed in an arrangement not existing in nature.
  • Linear DNA denotes non-circular DNA molecules having free 5' and 3' ends.
  • Linear DNA can be prepared from closed circular DNA molecules, such as plasmids, by enzymatic digestion or physical disruption.
  • Codon DNA is a single-stranded DNA molecule that is formed from an mRNA template by the enzyme reverse transcriptase. Typically, a primer complementary to portions of mRNA is employed for the initiation of reverse transcription.
  • cDNA refers to a double- stranded DNA molecule consisting of such a single-stranded DNA molecule and its complementary DNA strand.
  • cDNA also refers to a clone of a cDNA molecule synthesized from an RNA template.
  • Heterologous DNA refers to a DNA molecule, or a population of DNA molecules, that does not exist naturally within a given host cell.
  • DNA molecules heterologous to a particular host cell may contain DNA derived from the host cell species (i.e., endogenous DNA) so long as that host DNA is combined with non-host DNA (i.e., exogenous DNA).
  • a DNA molecule containing a non-host DNA segment encoding a polypeptide operably linked to a host DNA segment comprising a transcription promoter is considered to be a heterologous DNA molecule.
  • a heterologous DNA molecule can comprise an endogenous gene operably linked with an exogenous promoter.
  • a DNA molecule comprising a gene derived from a wild-type cell is considered to be heterologous DNA if that DNA molecule is introduced into a mutant cell that lacks the wild-type gene.
  • polypeptide is a polymer of amino acid residues preferably joined exclusively by peptide bonds, whether produced naturally or synthetically.
  • a polypeptide produced by expression of a non-host DNA molecule is a "heterologous" peptide or polypeptide.
  • the term "polypeptide” as used herein covers proteins, peptides and polypeptides, wherein said proteins, peptides or polypeptides may or may not have been post-translationally modified. Post-translational modification may for example be phosphorylation, methylation and glycosylation.
  • expression refers to the biosynthesis of a gene or a gene product.
  • hybridize means annealing nucleic acid strands from different sources; that is, to form base pairs between complementary regions of two strands of DNA that were not originally paired.
  • hybridization under stringent conditions is defined according to Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring
  • hybridization under stringent conditions means that after washing for 1 h with 1 times SSC and 0.1 % SDS at 50 degree C, preferably at 55 degree C, more preferably at 62 degree C and most preferably at 68 degree C, particularly for 1 h in 0.2 times SSC and 0.1 % SDS at 50 degree C, preferably at 55 degree C, more preferably at 62 degree C and most preferably at 68 degree C, a positive hybridization signal is observed.
  • a stretch of "Complete homology” is defined as a match of pairing nucleotides along the sequence of the interacting nucleotides; e.g. in natural occurring RNA the pairing of A with U and G with C.
  • a “promoter” is a nucleotide sequence that directs the transcription of a structural gene. Typically, a promoter is located in the 5' non-coding region of a gene, proximal to the transcriptional start site of a structural gene. Sequence elements within promoters that function in the initiation of transcription are often characterized by consensus nucleotide sequences. If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter. Repressible promoters are also known.
  • a “regulatory element” is a nucleotide sequence that modulates the activity of a promoter.
  • a regulatory element may contain a nucleotide sequence that binds with cellular factors enabling transcription exclusively or preferentially in particular cells, tissues, or organelles. These types of regulatory elements are normally associated with genes that are expressed in a "cell-specific,” “tissue-specific,” or “organelle-specific” manner.
  • An “enhancer” is a type of regulatory element that can increase the efficiency of transcription, regardless of the distance or orientation of the enhancer relative to the start site of transcription.
  • a "cloning vector” is a nucleic acid molecule, such as a plasmid, cosmid, or bacteriophage that has the capability of replicating autonomously in a host cell.
  • Cloning vectors typically contain one or a small number of restriction endonuclease recognition sites that allow insertion of a nucleic acid molecule in a determinable fashion without loss of an essential biological function of the vector, as well as nucleotide sequences encoding a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector.
  • Marker genes typically include genes that provide tetracycline or ampicillin resistance.
  • an "expression vector” is a nucleic acid molecule encoding a gene that is expressed in a host cell.
  • an expression vector comprises a transcription promoter, a gene, and a transcription terminator. Gene expression is usually placed under the control of a promoter, and such a gene is said to be “operably linked to” the promoter.
  • a regulatory element and a core promoter are operably linked if the regulatory element modulates the activity of the core promoter.
  • Simpler vectors called “transcription vectors” are only capable of being transcribed but not translated: they can be replicated in a target cell but not expressed, unlike expression vectors. Transcription vectors are used to amplify their insert.
  • a “recombinant host” is a cell that contains a heterologous nucleic acid molecule, such as a cloning vector or expression vector.
  • Transfection describes the introduction of foreign material into eukaryotic cells.
  • the term 'transfection' for non-viral methods is most often used in reference to mammalian cells, while the term 'transformation' is preferred to describe non-viral DNA transfer in bacteria and non-animal eukaryotic cells such as fungi, algae and plants. Both chemical and physical methods may be employed to transfect cells.
  • a "polypeptide” is a polymer of amino acid residues preferably joined exclusively by peptide bonds, whether produced naturally or synthetically.
  • a polypeptide produced by expression of a non-host DNA molecule is a "heterologous" peptide or polypeptide.
  • polypeptide as used herein covers proteins, peptides and polypeptides, wherein said proteins, peptides or polypeptides may or may not have been post-translationally modified.
  • Post-translational modification may for example be phosphorylation, methylation and glucosylation.
  • amino acid residue can be a natural or non-natural amino acid residue linked peptide bonds or bonds different from peptide bonds.
  • the amino acid residues can be in D-configuration or L-configuration.
  • An amino acid residue comprises an amino terminal part (NH 2 ) and a carboxy terminal part (COOH) separated by a central part comprising a carbon atom, or a chain of carbon atoms, at least one of which comprises at least one side chain or functional group.
  • NH 2 refers to the amino group present at the amino terminal end of an amino acid or peptide
  • COOH refers to the carboxy group present at the carboxy terminal end of an amino acid or peptide.
  • the generic term amino acid comprises both natural and non-natural amino acids.
  • non-natural amino acids examples include those listed e.g. in 37 C.F.R. section 1 .822(b)(4), all of which are incorporated herein by reference.
  • non-natural amino acid residues include, but are not limited to, modified amino acid residues, L-amino acid residues, and stereoisomers of D-amino acid residues.
  • an “equivalent amino acid residue” refers to an amino acid residue capable of replacing another amino acid residue in a polypeptide without substantially altering the structure and/or functionality of the polypeptide.
  • Equivalent amino acids thus have similar properties such as bulkiness of the side-chain, side chain polarity (polar or non-polar), hydrophobicity (hydrophobic or hydrophilic), pH (acidic, neutral or basic) and side chain organization of carbon molecules (aromatic/aliphatic).
  • “equivalent amino acid residues” can be regarded as "conservative amino acid substitutions”.
  • the classification of equivalent amino acids refers in one embodiment to the following classes: 1 ) HRK, 2) DENQ, 3) C, 4) STPAG, 5) MILV and 6) FYW
  • one amino acid may be substituted for another, in one embodiment, within the groups of amino acids indicated herein below: i) Amino acids having polar side chains (Asp, Glu, Lys, Arg, His, Asn, Gin, Ser, Thr, Tyr, and Cys,)
  • the present invention also relates to variants of Hsp70, or fragments thereof, wherein the substitutions have been designed by computational analysis that uses sequence homology to predict whether a substitution affects protein function (e.g. Pauline C. Ng and Steven Henikoff, Genome Research, Vol. 1 1 , Issue 5, 863-874, May 2001 ). Due to the imprecision of standard analytical methods, molecular weights and lengths of polymers are understood to be approximate values. When such a value is expressed as "about” X or “approximately” X, the stated value of X will be understood to be accurate to +/- 20%, such as +/- 10%, for example +/- 5%. Description of Drawings
  • Figure 1 Scheme of major sphingolipid hydrolysis and associated diseases.
  • FIG. 2 Lysosomal Hsp70 stabilizes lysosomal membranes
  • LMF light membrane fraction
  • FIG. 4 Hsp70 increases endocytic uptake of other molecules.
  • Panel A immortalized mouse embryonic fibroblasts (iMEF), either wildtype (WT) or transgenic for Hsp70 (TG) where incubated with 20 ⁇ g/mL Alexa Fluor-488-labelled BSA (BSA * ) for 24h. Endocytic uptake was verified by fluorescence microscopy (not shown). Cells where then harvested and analyzed for uptake of BSA * . As evident from the figure the Hsp70- transgenic iMEFs had a significantly higher uptake of BSA * than wildtype iMEFs.
  • Panel B U20S osteosarcoma cells where incubated with 20 ⁇ g/mL BSA * for 24h either with 3000 nM rHsp70 or without as indicated. Endocytic uptake was verified by fluorescence microscopy (not shown). Cells where then harvested and analyzed for uptake of BSA * . As evident from the figure, the U20S cells in which BSA * and rHsp70 where added together had a significantly higher uptake of BSA * than cells incubated with BSA * alone.
  • FIG. 5 Pulse-Chase experiment.
  • Upper panel A shows raw data
  • lower panel B shows rhHSP70 treated cells normalized to untreated cells at same timepoint.
  • FIG. 6 Arimoclomol dose-titration experiment. Various concentrations of Arimoclomol ('Ari') added for 48h to primary fibroblasts from Niemann-Pick Disease type A patient (patient id: 83/24). Read-out: lysosomal cross-sectional area.
  • Figure 7 Test of rhHSP70 in non-sphingolipidosis. rhHSP70 labelled with Alexa Fluor 488 (for visualization of uptake) was added for 48h to primary fibroblasts from
  • Niemann-Pick Disease type C1 patient (Coriell Cell Repository ID: GM17918). Readout: lysosomal cross-sectional area (Primary cellular pathology), performed by laser confocal microscopy. Conclusion: rhHSP70 effectively reverts the lysosomal primary pathology in Niemann-Pick Disease type C1 (i.e. accumulation of lysosomes).
  • Figure 8 Test of rhHSP70 in non-sphingolipidosis. rhHSP70 labelled with Alexa Fluor 488 (for visualization of uptake) was added for 48h to primary fibroblasts from
  • Mucopolysaccharidosis type IIIA aka Sanfilippo type IIIA patient (Coriell Cell
  • Mucopolysaccharidosis type IVA (aka (Morbus) Morquio type IVA) patient (Coriell Cell Repository ID: GM00958). Read-out: lysosomal cross-sectional area (Primary cellular pathology) , performed by laser confocal microscopy. Conclusion: rhHSP70 effectively reverts the lysosomal primary pathology in Mucopolysaccharidosis type IVA (i.e accumulation of lysosomes).
  • Mucopolysaccharidosis type IIIA primary patient fibroblasts (i.e accumulation of lysosomes).
  • Figure 1 1 rhHSP70 induces autophagy in MCF-7-LC3-EGFP cells.
  • the addition of 2C ⁇ g/ml_ rhHSP70 to culture medium leads to translocation and accumulation of LC3- EGFP, a marker for macroautophagy.
  • Figure 12 Control NPC-/- mice (A) have shallower and more sporadic growth patterns than HSP70 treated mice (B). Points where growth curves stop abruptly, indicates mice killed for organs.
  • Panel A Series 1 and 3 are female; Series 2 and 5-8 are male.
  • panel B Series 2 and 4-7 are female; Series 1 , 3, and 8 are male.
  • Figure 14 Cholesterol measured after 7 weeks (panel A) and 9 weeks (panel B) in control and treated animals.
  • Figure 15 GSL measured after 7 weeks (panel A) and 9 weeks (panel B) in control and treated animals.
  • Figure 16 Sphingosine measured after 7 and 9 weeks in control and treated animals.
  • Figure 17 Arimoclomol induces an increased HSP70 expression in Niemann-Pick Disease type C patient cells.
  • Panel A NPC GM18453 patient cells subjected to 60 min HS at 42 degree.
  • Panel B NPC GM18453 patient cells - No HS.
  • Figure 18 Iroxanadine induces an increased HSP70 expression in Niemann-Pick Disease type A patient cells.
  • NPDA Cells B534 R496L), 40 degree Heat Shock for 60min.
  • Vertical axis Heat Shock Protein 70 induction (A.U.).
  • Figure 19 Arimoclomol induces an increased HSP70 expression in Fabry disease patient cells. Fabrys Disease patient cells treated with Arimoclomol. Vertical axis: Heat Shock Protein 70 induction (A.U.).
  • HSP70 is beneficial in reversing the pathology of lysosomal storage diseases; including those lysosomal storage diseases which arise from a defect in an enzyme whose activity is not directly associated with the presence of lysosomal BMP as a co-factor; such as glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • glycogen storage diseases gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucop
  • the lysosomes receive both hetero- and autophagic cargo, which in the lumen of this organelle find their final destination.
  • the degradation is carried out by a number of acid hydrolases (phosphatases, nucleases, glycosidases, proteases, peptidases, sulfatases, lipases, etc) capable of digesting all major cellular
  • cathepsin proteases can be divided into three sub-groups according to their active site amino acid, i.e. cysteine (B, C, H, F, K, L, O, S, V, W and X/Z), aspartate (D and E) and serine (G) cathepsins.
  • the cathepsins function optimally at the acidic pH of the lysosomes (pH 4-5) although they can still function at the neutral pH outside the lysosomes, albeit having decreased stability and/or altered specificity.
  • cathepsins Until recently the function of cathepsins was thought to be limited to intralysosomal protein-turnover, and the degradation of the extracellular matrix once secreted.
  • the lysosomes and late endosomes are also responsible for the metabolism of cellular lipids, such as the glycosphingolipids, through a series of endolysomal enzymes and co-ensymes, whose proper function depend on the lipid composition of the intra-lysosomal membranes.
  • endolysosomal lipid metabolism can be easily appreciated by the fact that clinical disease is apparent in case of dysfunction at any stage of sphingolipid metabolism, giving rise to diseases such as Tay-Sachs, Sandhoff, Farber, Fabry, Gaucher, Krabbe and Niemann-Pick disease.
  • endocytic membranes serves an essential role in the mammalian cell through its delivery of membrane components, various solute molecules and receptor- associated ligands to a range of intracellular compartments. Whilst the various endocytic routes until recently appeared simple, with the main pathways converging on the lysosomes, where degradation and possible recycling back to the plasma membrane would take place, recent evidence shows that these pathways are more complex than first imagined.
  • Endocytosis is best understood in terms of the receptor-mediated endocytosis of molecules via the formation of clathrin-coated pits, although a variety of non-clathrin mediated endocytic routes (e.g. macropinocytosis, phagocytosis, uptake via caveolae- formation and non-clathrin-coated-pit formation) have also been identified.
  • non-clathrin mediated endocytic routes e.g. macropinocytosis, phagocytosis, uptake via caveolae- formation and non-clathrin-coated-pit formation
  • the nomenclature of the endocytic system has not been fully standardized, and the commonly used term "early endosome" actually describes two distinct endosomal compartments - the sorting endosome and the endocytic recycling compartment (ERC).
  • receptors such as the transferrin receptor, the low density lipoprotein receptor and the mannose 6- phosphate receptor (MPR) concentrate into clathrin-coated pits on the surface of the plasma membrane by virtue of interactions between sequence motifs in their cytoplasmic tails and elements in the clathrin coat. After shedding of its clathrin-coat, the newly formed endosome fuses with other endosomes and pre-existing sorting endosomes to become a sorting endosome. As the name implies, its primary task is to sort newly acquired components to their correct locations.
  • MPR mannose 6- phosphate receptor
  • the destinations include the plasma membrane, the late endosomes and the ERC.
  • the sorting endosome As the sorting endosome matures, it experiences a drop in pH, which facilitates the release of receptor-bound ligands into the lumen of the endosome.
  • the molecules destined to recycling must be sorted out. It is believed that this process takes place through the pinching off of narrow tubules, a process, which favors the sorting of membrane proteins from solute molecules as the surface-area-to-volume ratio of the tubules is greater than that of the vesicular sorting endosome.
  • the pinched-off-tubules can either relay the membrane proteins directly back to the plasma membrane (the direct return pathway) or to the ERC.
  • the ERC is mainly a collection of tubular organelles, whose localization varies between cell types. While the ERC is capable of sorting molecules to several different destinations, most of the molecules that transit via the ERC return to the plasma membrane.
  • the pre-existing compartment model argues that transport of molecules to the late endosomes occurs via an endocytic carrier vesicle (ECV), a specific transport vesicle between pre-existing sorting and late endosomal compartments.
  • ECV endocytic carrier vesicle
  • multivesicular bodies This term has been used interchangeably as another name for the ECVs and late endosomes as well as for all endocytic vesicles containing multivesicular regions or elements, including the hybrid organelle that forms when the lysosomes fuse with the late endosomes (which contain multivesicular structures).
  • late endosomes contain more luminal membrane vesicles than early endosomes and are thus often the compartment described by the term "multivesicular bodies”.
  • the late endosomes also receive cargo via the MPR pathway from the frans-golgi network (TGN) (the biosynthetic route).
  • TGN frans-golgi network
  • IGF-II cation-independent MPR/lnsulin-like growth factor-ll
  • MPRs The recognition of acid hydrolases by MPRs requires the addition of carbohydrates in the endoplasmic reticulum and the subsequent modification and phosphorylation of the carbohydrate residues to mannose-6-phosphate moieties in the c/s-Golgi
  • the MPR-bound hydrolases are first delivered to endosomes, where they dissociate from the receptors due to the drop in the lumenal pH, hereby allowing the receptors to recycle back to the TGN.
  • GGAs ADP ribosylation factor-binding proteins
  • AP-1 and AP-2 are used in clathrin-coated pits during endocytosis at the plasma membrane, while AP- 3 and AP-4 function in the trafficking of the lysosome-associated membrane proteins (LAMPs).
  • LAMPs lysosome-associated membrane proteins
  • Autophagy is the third well-characterized route by which macromolecules reach the lysosome.
  • Autophagy is an evolutionary conserved pathway involved in the turnover of long-lived proteins and organelles. It usually operates at low basal levels, although it can be induced, for example under conditions of nutrient starvation. Under these conditions macroautophagy is the major pathway responsible for delivering material to the lysosomes.
  • Macroautophagy is characterized by a flat membrane cistern wrapping around cytoplasmic organelles and/or a portion of cytosol thereby forming a closed double-membrane bound vacuole, the autophagosome.
  • the autophagosome finally fuses with lysosomes forming autophagolysosomes/autolysosomes, where the degradation and recycling of the engulfed macromolecules occur.
  • the origin of the autophagosome membrane is still not clarified.
  • the endoplasmic reticulum, Golgi, a less-well characterized membrane compartment called the phagophore as well as de novo synthesis have all been proposed as origins of the autophagosome membrane.
  • yeast genetics and the subsequent discovery of mammalian homologues is rapidly enhancing the understanding of the process of autophagy and will hopefully shed light also on the origin of the autophagosomal membrane in the near future.
  • microautophagy is characterized by engulfment of cytosol by the lysosomes through invaginations of the lysosomal membrane. Besides the macromolecules, which are present in the engulfed cytosol, this process may also involve the uptake of organelles such as peroxisomes.
  • chaperone-mediated transport of cytosolic proteins into the lysosomal lumen presents a more direct and selective form of autophagy. This pathway is dependent on the presence of the constitutively expressed member of the Heat shock protein 70 family, Hsc70, on both sides of the lysosomal membrane. The process is furthermore dependent on the recognition of a KDEL sequence motif in target proteins by LAMP-2a.
  • rhHSP70 binds to BMP and facilitates an increased enzyme activity for those enzymes that that are dependent on BMP as a cofactor.
  • the HSP70-BMP interaction was shown to be of importance for reversing the pathology of LSDs associated with BMP-interacting enzymes (WO 2009/155936).
  • rhHSP70 is a potential inducer of autophagy (see figure 1 1 ).
  • An increased autophagic flux may be contemplated to affect the lysosomes due to the fusion of autophagosomes to lysosomes, as the last step in the autophagic pathway. It may also be contemplated that an induction of autophagy by HSP70 leads to an increased autophagic clearance of lysosomes having a pathologic accumulation of substrate due to a LSD. Reformation of lysosomes and lysosomal secretion
  • the lysosomes After fusion of lysosomes with late endosomes or autophagosomes, the lysosomes are reformed from the resultant hybrid organelles through sequestration of membrane proteins and condensation of the lumenal content.
  • membrane proteins that need to be removed or recycled from the hybrid organelle, the most obvious are the MPRs, as they by definition are absent from lysosomes.
  • the lysosomes cannot be seen as the terminal point of the endocytic pathways as they are also able to form secretory lysosomes through fusion with secretory granules, a process that is Ca 2+ - dependent and was first recognised in secretory cells of haematopoietic origin.
  • Programmed cell death is the means to this end, endowing the multicellular organism with the potential to rid itself of unwanted cells without the leakage of cellular constituents, thus avoiding the inflammation associated with necrosis, the conceptual counterpart to programmed cell death.
  • apoptosis is used in Greek to describe the "dropping off” or “falling off” of petals from flowers, or leaves from trees and was first coined by Currie and colleagues in 1972 to describe a common type of programmed cell death, which the authors had observed in a number of tissues and cell types. The authors had noticed that the events they observed had significant morphological similarities, which were distinct from the morphological features characterizing cells undergoing pathological, necrotic death and suggested that these common morphological features might be due to an identical underlying process.
  • caspases cyste aspartate-specific protease
  • the classical apoptotic features include cell shrinkage and blebbing of the cytoplasmic membrane, condensation of chromatin within the nucleus in clear, geometrical shapes, fragmentation of DNA into ⁇ 200bp integers, the so-called nucleosomal ladder, cellular detachment from its neighboring cells and disintegration of the cell into small, enclosed vesicles termed apoptotic bodies.
  • these apoptotic bodies are ultimately phagocytosed by macrophages or neighboring cells hereby completing the removal of the unwanted cell.
  • PCD Programmed cell death
  • PCD is gradually taking over, but the term apoptosis is still used to describe a cell death program orchestrated by the activation of caspases, in particular caspase-3.
  • caspase-3 the term of caspases
  • PCD caspase-activation leading to non-apoptotic PCD
  • PCD has revealed a remarkable plasticity of the cellular death programme(s) and PCD can thus be more accurately defined as cell death dependent on signals or activities within the dying cell.
  • PCD can be subdivided into apoptosis, apoptosis-like and necrosis-like PCD, according to the nuclear morphology of the dying cells, each definition coined to distinct morphological characteristics, the main feature being the shape of chromatin condensation or the absence hereof, although it would be preferable to make distinctions of PCD based on the signaling pathways participating under any given set of conditions leading to PCD. This way of distinguishing between different modes of PCD is not yet applicable however, as the threads leading to the varying kinds of cell death remains to be sorted out. Necrosis
  • Necrosis is the conceptual counterpart to PCD, as it cannot be prevented by any other means than removing the stimulus giving rise to the necrosis. This mode of cell death is usually seen during pathological insults to an organism.
  • apoptosis is defined by the activation of members of the family of cysteine endopeptidases known as the caspases and the morphology associated with their activation.
  • the caspases reside in cells as inactive zymogens, which can be rapidly activated by proteolytic processing.
  • This processing proceeds in a hierarchic cascade in which an apoptotic stimulus activates an initiator caspase (e.g. caspase-8 and -9), which in turn activates the next level in the hierarchy, the effector caspases (e.g. caspase-3, -6 and -7).
  • the latter are considered the executioners of apoptosis as they cleave a number of substrates, the processing of which ultimately leads to the phenotype associated with apoptosis.
  • the apoptotic programme can be activated by a variety of stimuli, which can be broadly divided into extracellular and intracellular stimuli, the latter seeing the mitochondrion as an essential player.
  • the extracellular stimuli and the following response giving rise to apoptosis are also referred to as the extrinsic signaling pathway and are comprised of a series of events starting with activation of one of a variety of death receptors such as Fas/Apo-1/CD95, TNFR or TRAIL.
  • DD death domain
  • FADD Fas-associating protein with death domain
  • AIF Apoptosis Inducing Factor
  • Smac/DIABLO Smac/DIABLO which antagonizes the effects of the proteins known as inhibitors-of-apoptosis (IAP) proteins and endonuclease G, a DNAse.
  • CytC Upon release from the mitochondrion, CytC accumulates in the cytoplasm, where it binds to the protein Apaf-1 (apoptotic protease-activating factor-1 ) resulting in a conformational change, which promote oligomerisation of Apaf-1 .
  • Apaf-1 apoptotic protease-activating factor-1
  • This oligomer then binds procaspase-9 through homotypic interactions between caspase recruitment domains (CARDs) resulting in the formation of a complex called the apoptosome.
  • CARDs caspase recruitment domains
  • Apoptosis can also be triggered by intracellular factors eliciting mitochondrial outer membrane permeabilisation (MOMP), a process known as the intrinsic pathway. These factors include second messengers associated with cellular stress such as Ca 2+ , NO and arachidonic acid as well as bilirubin, bile salts and stimuli which can give rise to protein denaturation and nuclear and mitochondrial DNA damage such as ionizing radiation, heat stress, reactive oxygen species (ROS) and chemotherapeutic agents. In the event of nuclear DNA damage, this is sensed by a variety of protein kinases, which depends on the form of DNA damage but also the noxa eliciting it.
  • MOMP mitochondrial outer membrane permeabilisation
  • p53 The activity of these kinases induce the accumulation of p53, which can then act as a transcription factor, giving rise to an enhanced transcription of pro-apoptotic genes such as Bax, Noxa and PUMA, all of which can induce MOMP.
  • p53 induces the expression of mitochondrial enzymes that locally generate ROS as well as a mitochondrial matrix protein (p53AIP1 ), which overexpression triggers loss of mitochondrial membrane potential and apoptosis.
  • caspases As the executioners of PCD has been challenged and mounting evidence suggest that there is more to life - and especially death - of a cell than can be ascribed to the caspases alone.
  • caspase-specific pharmacological inhibitors as well as inactivation of caspase-pathways by factors such as energy depletion, nitrative/oxidative stress and members of the inhibitor of apoptosis protein (IAP) family did not always stop the progression towards death, they revealed, or even enhanced, a subset of underlying caspase-independent death-programs.
  • IAP apoptosis protein
  • LMP partial lysosomal membrane permeabilization
  • the death triggered by partial LMP can be inhibited by pharmacological inhibitors of cysteine and aspartate cathepsins, and the increase in the cytosolic cathepsin activity precedes the activation of caspases and mitochondrial membrane potential changes suggesting a direct role for cytosolic cathepsins in the death process.
  • the role of LMP and cathepsins in cell death is not limited to the experimental models employing direct lysosomal disrupters.
  • LMP also participates in the execution of cell death in response to a wide variety of classic apoptotic stimuli, such as activation of death receptors of tumour necrosis factor (TNF) receptor family, interleukin-1 , p53 activation, growth factor starvation, microtubule stabilizing agents, etoposide, sigma-2 receptor activation, synthetic retinoid CD437, B cell receptor activation, staurosporine, osmotic stress, as well as small molecules identified in a screen for novel cancer drugs that induce p53 independent apoptosis.
  • TNF tumour necrosis factor
  • cytotoxic effects of LMP often rely, at least partially, on the activation of the mitochondrial death pathway.
  • An elegant microinjection study has demonstrated that when localized to the cytosol, a single lysosomal hydrolase, cathepsin D, is sufficient to trigger the mitochondrial outer membrane permeabilization and apoptosis in human fibroblasts at cellular doses corresponding to half of the total cellular cathepsin D activity.
  • Cathepsin D is, however, not sufficient to trigger PCD in all cell death models involving LMP.
  • Other well-documented mediators of LMP-triggered PCD include cysteine cathepsins B and L as well as reactive oxygen species.
  • permeabilization may be Bid, a proapoptotic BH3-only protein of the Bcl-2 family that can be processed and activated by several cysteine cathepsins, but not by cathepsin D, at cytosolic pH.
  • Cathepsin D has, however, been suggested to cleave and activate Bid in the acidic environment of the endolysosomal compartment following TNF receptor-1 (TNF-R1 ) internalization.
  • TNF-R1 TNF receptor-1
  • Cathepsin D may also activate Bax in a Bid-independent manner as demonstrated in staurosporine-treated T cells.
  • LMP triggers mitochondrial membrane permeabilization through a Bid- independent activation of Bax and Bak.
  • the Bax activation is independent of cathepsin D, but relies instead on reactive oxygen species.
  • ciprofloxacine-induced mitochondrial membrane permeabilization is not fully inhibited in cells lacking both Bax and Bak.
  • the alternative mechanisms connecting LMP to the mitochondrial membrane permeabilization may include the direct effects of reactive oxygen species and/or lipid mediators such as arachidonic acid that can be generated in a cathepsin B-dependent manner.
  • Immortalized MEFs from cathepsin B and L deficient mice, but not from cathepsin D deficient mice, are highly resistant to TNF, whereas the opposite picture emerges when the cells are treated with staurosporine.
  • Extensive studies on TNF-induced cell death pathways have further revealed that the role of individual cathepsins in PCD depends on the cell type studied.
  • TNF-induced death of immortalized MEFs depends on cysteine cathepsins, but not cathepsin D.
  • cathepsin D depletion effectively protects HeLa cervix cancer cells against TNF- and cisplatin-induced cytotoxicity.
  • LMP and cytosolic cathepsins are not limited to the activation of the intrinsic apoptosis pathway.
  • small cell lung cancer cells treated with microtubule stabilizing drugs paclitaxel, epothilone B and discodermolide
  • LMP occurs early in the death process and cysteine cathepsins mediate micronucleation and cell death in a caspase-independent manner.
  • cysteine cathepsinsins In TNF-treated human carcinoma cell lines LMP occurs downstream of mitochondrial outer membrane permeabilization.
  • cysteine cathepsin activity or expression confers significant protection against TNF-induced cell death without significantly inhibiting the effector caspase activation.
  • cathepsin B is responsible for apoptosis-like changes, such as chromatin condensation, phosphatidylserine exposure and plasma membrane blebbing, in the absence of caspase activity in TNF-treated murine WEHI-S
  • Hsp70 heat shock protein 70
  • T cells fibrosarcoma cells.
  • Hsp70 heat shock protein 70
  • cathepsin B can induce nuclear apoptosis in isolated nuclei.
  • cathepsins appear to carry both the ability to act as initiator- as well as effector proteases of programmed cell death depending on the stimulus and the cellular context.
  • LMP followed by the release of lysosomal contents, especially cathepsins, to the cytosol is considered to be the key activation step of the lysosomal death pathway.
  • the signaling pathways leading to LMP are still only beginning to emerge.
  • One of the best studied mechanisms is the signaling from the tumor necrosis factor receptor 1 although the clarification of this signaling pathway to LMP has been greatly complicated by widely different responses in different target cells.
  • TNF can either induce caspase-dependent or -independent LMP depending on cellular context.
  • the TNF-related ligands FasL, TRAIL and TWEAK have also all been associated with caspase-independent PCD with either apoptotic or necrotic morphology.
  • TNF also stimulates sphingomyelin breakdown to phosphorylcholine and ceramide by activating neutral sphingomyelinase (SMase) at the plasma membrane and acid or acidic SMase (aSMase) in the lysosomal compartment.
  • SMase neutral sphingomyelinase
  • aSMase acid or acidic SMase
  • FAN neutral SMase
  • Studies based on FAN deficient iMEFs as well as human fibroblasts expressing a dominant negative form of FAN have shown that FAN does not only mediate TNF-induced ceramide production, but also contributes to the caspase-8 processing and cell death.
  • TNF-induced LMP in murine hepatocytes depends on caspase-8, its reduced processing may explain the reduced LMP in TNF-treated hepatocytes expressing dominant negative FAN.
  • the role of ceramide and its metabolites can, however, not be ruled out.
  • Their role in TNF-induced death signaling is supported by the reduced TNF and Fas-induced hepatotoxicity in mice deficient for aSMase, which is activated downstream of caspase-8.
  • ceramide Especially sphingosine that is generated from ceramide in a reaction catalyzed by the lysosomal enzyme acid ceramidase is a plausible candidate, as it, contrary to ceramide, can act as a detergent, directly destabilizing the lysosomal membrane.
  • TNF regulates sphingosine levels also by cathepsin B-mediated downregulation of sphingosine kinase-1 , en enzyme that converts the pro- apoptotic sphingosine to an anti-apoptotic sphingosine-1 -phospate.
  • This activity of cathepsin B could result in the accumulation of sphingosine in the lysosomes and may thus, at least partially, explain the requirement of cathepsin B for an efficient LMP in TNF-treated hepatocytes.
  • TNF can also trigger LMP and cell death in the presence of caspase inhibitors.
  • This pathway is independent of caspase-8, but requires the death domain-containing receptor interacting protein-1 (RIP-1 ) and involves the generation of reactive oxygen species.
  • Oxidative stress can, together with intra-lysosomal iron, generate oxygen radicals through a Fenton-type chemistry and thereby may cause oxidation of lysosomal membrane lipids, resulting in the destabilization of the membrane and the release of the lysosomal content.
  • the molecular links between RIP-1 , oxidative stress and LMP are, however, still missing.
  • the induction of cell death by several classic apoptosis inducers e.g. p53, etoposide and staurosporine
  • the signaling pathways from these stimuli to LMP remain to be revealed.
  • PI3K phosphatidylinositol 3-kinase
  • PI3K which is commonly activated in human cancer cells, may also contribute to lysosomal stability of tumor cells and thereby increase their cell death resistance.
  • the role of PI3K on the stability of tumor cell lysosomes is purely speculative, recent data advocate for a role for Hsp70 in the protection of lysosomes against membrane-disruptive stimuli. This work has been mainly done in tumor cells, which also often demonstrate a localization of Hsp70 on the plasma membrane as well as in the endolysosomal compartment.
  • cysteine cathepsins can be effectively inhibited by at least three cytosolic protease inhibitors, i.e. cystatin A and B and serine protease inhibitor 2A (Spi2A) which was recently found to possess potent inhibitor activity also against several cysteine cathepsins (B, H, K, L and V) and cathepsin G.
  • cytosolic protease inhibitors i.e. cystatin A and B and serine protease inhibitor 2A (Spi2A) which was recently found to possess potent inhibitor activity also against several cysteine cathepsins (B, H, K, L and V) and cathepsin G.
  • cystatin B-deficient mice which display increased apoptosis of cerebellar granule cells.
  • the expression of Spi2A is induced upon TNF-treatment via the NF- ⁇ pathway, and effectively inhibits TNF- induced cytosolic cathepsin B activity and cell death in MEFs.
  • the cytosolic serine protease inhibitor (serpin) -6 can protect against both the induction as well as the lethal effects from lysosomal injury caused by hypo-osmotic stress as well as a variety of other lysosomal stresses, demonstrating that protection against LMP is an evolutionarily conserved mechanism.
  • Lysosomal storage diseases are a group of approximately 40 rare inherited metabolic disorders that result from defects in lysosomal function. LSDs are caused by lysosomal dysfunction usually as a consequence of deficiency of a single enzyme required for the metabolism of lipids, glycoproteins or mucopolysaccharides. Although each disorder results from different gene mutations that translate into a deficiency in enzyme activity, they all share a common biochemical characteristic - all lysosomal disorders originate from an abnormal accumulation of substances inside the lysosome.
  • mucopolysaccharidoses represent a group of diseases with a prevalence of approx. 1 :25.000.
  • lysosomal storage diseases are generally classified by the nature of the primary stored material involved, and can be broadly broken into the following:
  • o sphingolipidoses including Gaucher's and Niemann-Pick diseases
  • o gangliosidoses including Tay-Sachs disease
  • glycoproteinosis glycoproteinosis
  • LSD LSD-related diseases
  • the symptoms of LSD vary, depending on the particular disorder and can be mild to severe. They can include developmental delay, movement disorders, seizures, dementia, deafness and/or blindness. Some people with LSD have enlarged livers (hepatomegaly) and enlarged spleens (splenomegaly), pulmonary and cardiac problems, and abnormal bone growth.
  • the majority of patients are initially screened by an enzyme assay, which is the most efficient method to arrive at a definitive diagnosis.
  • mutation analysis may be performed. As there may be numerous different mutations, sequencing of the gene encoding the particular affected enzyme is sometimes necessary to confirm the diagnosis. Prenatal diagnosis may be useful when there is a known genetic risk factor.
  • the present invention is in one embodiment related to a method for treating a lysosomal storage disease which arises from a defect in an enzyme whose activity is not directly associated with the presence of lysosomal BMP as a co-factor.
  • said lysosomal storage disease is not selected from the group of Niemann-Pick disease, Farber disease, Krabbe disease, Sialidosis type I,
  • Metachromatic leukodystrophy, Gaucher disease, Fabry disease and saposin- deficiency Metachromatic leukodystrophy, Gaucher disease, Fabry disease and saposin- deficiency.
  • said lysosomal storage disease is selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid
  • lipofuscinoses cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II. Lysosomal sphinqolipid hydrolysis
  • a multitude of enzymes are involved in the lysosomal catabolism of sphingolipids (or glycophingolipids) (see figure 1 ). These enzymes, or more specifically hydrolases, are each responsible for the degradation of a specific sphingolipid.
  • SAPs sphingolipid activator proteins
  • the lipid composition of late endosomal and lysosomal compartments are characterized by the presence of negatively charged phospholipids such as BMP and PI (phosphatidylinositol), which also stimulates the activity of some hydrolases.
  • BMP-dependent lysosomal hydrolases include sialidase, a -galactosidase A, glucosylceramidase, ⁇ -galactosylceramidase, arylsulfatase A, acid ceramidase and Sphingomyelinase.
  • Saposins are small lysosomal proteins that serve as activators of various lysosomal lipid-degrading enzymes. They probably act by isolating the lipid substrate from the membrane surroundings, thus making it more accessible to the soluble degradative enzymes. All mammalian saposins are synthesized as a single precursor molecule (prosaposin) which contains four Saposin-B domains, yielding the active saposins after proteolytic cleavage, and two Saposin-A domains that are removed in the activation reaction. The Saposin-B domains also occur in other proteins, many of them active in the lysis of membranes.
  • Prosaposin is a protein which in humans is encoded by the PSAP gene. This gene encodes a highly conserved glycoprotein which is a precursor for 4 cleavage products: saposin A, B, C, and D. Saposin is an acronym for Sphingolipid Activator Protein or SAP. Each domain of the precursor protein is approximately 80 amino acid residues long with nearly identical placement of cysteine residues and glycosylation sites. Saposins A-D localize primarily to the lysosomal compartment where they facilitate the catabolism of glycosphingolipids with short oligosaccharide groups. The precursor protein exists both as a secretory protein and as an integral membrane protein and has neurotrophic activities. Saposins A-D are required for the hydrolysis of certain shingolipids by specific lysosomal hydrolases.
  • the saposins are important co-activators of sialidase (SAP-B), a -galactosidase A (SAP-B), glucosylceramidase (SAP-C), ⁇ -galactosylceramidase (SAP-C), arylsulfatase A (SAP-B) and acid ceramidase (SAP-D).
  • Acidic sphingomyelinase (aSMase) is not critically dependent on any of the known activator proteins, however the presence of saposins increases the activity of this enzyme.
  • a fifth saposin; GM2-activator protein has also been characterised.
  • BMP Bis(monoacylglycero)phosphate
  • Lysobisphosphatidic acid is a major part of the lipid composition of late endosomal and lysosomal compartments. It is a negatively charged phospholipid, more specifically a glycerol-phospholipid.
  • BMP was first isolated from rabbit lung but is now known to be a common if minor constituent of all animal tissues. Its stereochemical configuration differs from that of other animal glycero-phospholipids in that the phosphodiester moiety is linked to positions sn-1 and sn-1 ' of glycerol, rather than to position sn-3. It remains unclear whether positions sn-3 and 3' or sn-2 and sn-2' in the glycerol moieties are esterified with fatty acids.
  • compositions can be distinctive with 18:1 (n-9) and 18:2(n-6), 20:4 and 22:6(n-3) being abundant, although this is highly dependent on the specific tissue, cell type or organelle.
  • Such distinctive compositions suggest quite specific functions, some of which have yet to be revealed.
  • BMP is usually a rather minor component of animal tissues. However, it is highly enriched in the lysosomes of liver and other tissues, where it can amount to 15% or more of the membrane phospholipids, and it is now recognized as a marker for this organelle. It is the late endosomes and the lysosomes that contain the unique lipid, BMP. Indeed, there appear to be internal membranes of the late endosomes that contain as much as 70% of the phospholipids as BMP.
  • a phospholipase A 2 removes the fatty acid from position sn-2 of phosphatidylglycerol in the first step.
  • the lysophosphatidylglycerol is acylated on the sn-2' position of the head group glycerol moiety to yield sn-3:sn-1 ' lysobisphosphatidic acid, by means of a transacylase reaction with lysophosphatidylglycerol as both the acyl donor and acyl acceptor.
  • the third step has still to be adequately described but must involve removal of the fatty acid from position sn-1 of the primary glycerol unit and a rearrangement of the phosphoryl ester from the sn-3 to the sn-1 position. Finally position sn-2 of the primary glycerol unit is esterified, probably by a transacylation reaction with another phospholipid as donor (hence the distinctive fatty acid compositions).
  • biosynthetic routes may be possible.
  • BMP in lysosomes
  • It may have a structural role in developing the complex intraluminal membrane system, aided by a tendency not to form a bilayer. It is a cone-shaped molecule, and it encourages fusion of membranes at the pH in the endosomes. Further, its unique stereochemistry means that it is resistant to phospholipases, so it will hinder or prevent self digestion of the lysosomal membranes.
  • the fatty acid constituents may turn over rapidly by transacylation, but the glycerophosphate backbone is stable. A further possibility is that this lipid may associate with specific proteins in membrane domains, functionally similar to rafts.
  • BMP is known to greatly stimulate the enzymes involved in the degradation of glycosylceramides, such as the sphingolipid activator proteins like the saposins. In this instance, it may simply function to provide a suitable environment for the interaction of the glycosphingolipid hydrolases and their activator. In addition, it has a dynamic role in the provision of arachidonate for eicosanoid production in alveolar macrophages.
  • a stippled circle marks the enzymes, or the disease in which this enzyme is defect, which show a dependence on BMP.
  • BMP is involved in the pathology of lysosomal storage diseases such as Niemann-Pick C disease (cholesterol accumulation) and certain drug-induced lipidoses. In these circumstances, its composition tends to change to favour molecular species that contain less of the polyunsaturated components. It is an antigen recognized by autoimmune sera from patients with a rare and poorly understood disease known as antiphospholipid syndrome, so it is probably a factor in the pathological basis of this illness.
  • Lipid storage disorders are a subgroup of the lysosomal storage disorders in which harmful amounts of lipids accumulate in the intracellular space due to reduced expression or function of the enzymes needed to metabolize lipids. Over time, this excessive storage of lipids can cause permanent cellular and tissue damage, particularly in the brain, peripheral nervous system, liver, spleen and bone marrow.
  • lipid storage disorders characterized by the accumulation of lipids (i.e., lipid storage disorders) have been characterized; including Niemann-Pick disease
  • NPD Newcastle disease sarcoma
  • Farber disease Farber disease
  • Krabbe disease Fabry disease
  • Gaucher disease Sialidosis type I
  • Metachromatic leukodystrophy Saposin-deficiency.
  • lipid storage disorders include: gangliosidoses, neuronal ceroid lipofuscinosis and other lipid storage disorders, as outlined herein below.
  • Sandhoff disease or GM2 gangliosidosis type II
  • classic infantile Sandhoff disease juvenile
  • Gangliosidoses are lipid storage disorders caused by the accumulation of lipids known as gangliosides.
  • Gangliosides are molecules composed of a glycosphingolipid
  • ceramide and oligosaccharide with one or more sialic acids (AKA n -acetyl neuraminic acid, NANA) linked on the sugar chain.
  • AKA n -acetyl neuraminic acid, NANA sialic acids linked on the sugar chain.
  • the 60+ known gangliosides differ mainly in the position and number of NANA residues. It is a component of the cell plasma membrane that modulates cell signal transduction events. They are found predominantly in the nervous system where they constitute 6% of all phospholipids.
  • GM1 gangliosidoses also known as NOS gangliosidosis
  • NOS gangliosidosis are caused by a deficiency of beta-galactosidase, with resulting abnormal storage of acidic lipid materials in cells of the central and peripheral nervous systems, but particularly in the nerve cells.
  • GM1 has three forms: early infantile, late infantile, and adult.
  • the GM2 gangliosidoses are a group of related genetic disorders that result from a deficiency of the enzyme beta-hexosaminidase. This enzyme catalyzes the
  • Beta-hexosaminidase is a vital hydrolytic enzyme, found in the lysosomes, that breaks down lipids. When beta-hexosaminidase is no longer functioning properly, the lipids accumulate in the nervous tissue of the brain. Gangliosides are made and biodegraded rapidly in early life as the brain develops.
  • Tay-Sachs disease All three disorders are rare in the general population: Tay-Sachs disease, AB variant, and Sandhoff disease might easily have been defined together as a single disease, because the three disorders are associated with failure of the same metabolic pathway and have the same outcome. Each represents a distinct molecular point of failure in a subunit that is required for activation of the enzyme.
  • Tay-Sachs disease (abbreviated TSD, also known as GM2 gangliosidosis type I or Hexosaminidase A deficiency) is a rare, autosomal recessive metabolic disorder that causes progressive destruction of nerve cells in the brain and spinal cord.
  • the disease results from mutations on chromosome 15 in the HEXA gene encoding the alpha- subunit of the lysosomal enzyme beta-N-acetylhexosaminidase A.
  • Tay-Sachs disease is classified in variant forms, based on the time of onset of neurological symptoms. The variant forms reflect diversity in the mutation base:
  • Sandhoff disease also known as Jatzkewitz-Pilz syndrome, GM2 gangliosidosis type II and Hexosaminidase A and B deficiency
  • the disease results from mutations on chromosome 5 in the HEXB gene, critical for the lysosomal enzymes beta-N-acetylhexosaminidase A and B.
  • Sandhoff Disease is clinically indistinguishable from Tay-Sachs Disease. There are three subsets of the disease based on when the patient shows symptoms: classic infantile, juvenile and adult late onset.
  • GM2-gangliosidosis AB variant is a rare, autosomal recessive metabolic disorder that causes progressive destruction of nerve cells in the brain and spinal cord. AB variant is caused by a failure in the gene that makes an enzyme cofactor for beta- hexosaminidase, called the GM2 activator.
  • GM3 gangliosidosis is a ganglioside biosynthesis disorder caused by (N- acetylneuraminyl)-galactosylglucosylceramide N-acetyl transferase deficiency with excessive accumulation of ganglioside GM3 in the liver and brain tissue and absence of higher ganglioside homologs.
  • Mucolipidosis type IV is an autosomal recessive lysosomal storage disorder.
  • the disorder is caused by mutations in the MCOLN1 gene, which encodes a non- selective cation channel, mucolipinl .
  • Mucolipinl is thought to be localized in endosomes.
  • An important property of mucolipinl is that decreasing pH (acidification) results in deactivation of the protein, likely through an assembly defect.
  • There are at least 29 known mutations in MCOLN1 located throughout the gene. Many of the known mutations result in no expression of mucolipinl , whereas milder mutations produce a dysfunctioning form of the cation channel.
  • ML IV causes affected cells to accumulate auto-fluorescent vacuoles considered to be aberrant lysosomes.
  • bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of neuronal ceroid lipofuscinosis. It is an aspect of the present invention to provide a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of neuronal ceroid lipofuscinosis selected from the group consisting of Batten disease (or Spielmeyer-Vogt disease), Bielschowsky-Jansky disease, Kufs disease and Santavuori-Haltia disease.
  • NCL Neuronal Ceroid Lipofuscinoses
  • Lysosomal acid lipase is the essential enzyme for hydrolysis of triglycerides and cholesteryl esters in lysosomes. Its deficiency produces 2 human phenotypes: Wolman disease and cholesteryl ester storage disease. Wolman disease is fatal in infancy, and cholesteryl ester storage disease is a milder form and usually manifests in adulthood.
  • Wolman disease is caused by genetic defects of lysosomal acid lipase that leave no residual enzyme activity.
  • Wolman disease is also called primary familial xanthomatosis with involvement and calcification of the adrenal glands.
  • Wolman disease has accumulation of both triglycerides and cholesteryl esters, while cholesteryl ester storage disease has mainly elevated cholesteryl esters. Lysosomal acid lipase genotypes determine the level of residual enzymatic activity, resulting in the severity of the phenotype.
  • Cerebrotendineous xanthomatosis or cerebrotendinous xanthomatosis is an autosomal recessive form of xanthomatosis associated with the deposition of a form of cholesterol (cholestanol) in the brain and other tissues and with elevated levels of cholesterol in plasma but with normal total cholesterol level.
  • CTX is associated with mutations in the CYP27A1 gene (sterol 27-hydroxylase). Mucopolysaccharidoses
  • bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of mucopolysaccharidoses. It is an aspect of the present invention to provide a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of a disease selected from the group consisting of a type I
  • mucopolysaccharidosis a type II mucopolysaccharidosis, a type III
  • mucopolysaccharidosis a type IV mucopolysaccharidosis, a type VI
  • mucopolysaccharidosis a type VII mucopolysaccharidosis, a type VIII
  • mucopolysaccharidosis and a type IX mucopolysaccharidosis.
  • a disease selected from the group consisting of Hurler syndrome, Hurler- Scheie syndrome, Scheie syndrome, Hunter's syndrome, DiFerrante syndrome, Maroteaux-Lamy syndrome (mild or severe), Morquio syndrome (classic or Morquio- like), and Sanfilippo syndrome (type A, B, C, or D).
  • Mucopolysaccharides are sulfated polymers composed of a central protein moiety attached to repeating disaccharide branches normally degraded into inorganic sulfated monosaccharides in lysosomes.
  • Dermatan sulfate consists of alternating units of L-iduronic acid and N - acetylgalactosamine, usually found in the matrix of many different connective tissues.
  • Heparan sulfate is formed by the joining of a uronic acid (D-glucuronic acid or L- iduronic acid) alternating with A/ -acetylglucosamine and is associated with the cell plasma membrane of almost all cells.
  • a uronic acid D-glucuronic acid or L- iduronic acid
  • Keratan sulfate is made of D-galactose residues alternating with N - acetylglucosamine and is found largely in cartilage, nucleus pulposus, and cornea.
  • Chondroitin sulfate is composed of D-glucuronic acid and N - acetylgalactosamine and is largely found in cartilage and cornea.
  • MSP Mucopolysaccharidoses
  • glycosaminoglycans such as dermatan sulfate, keratan sulfate, heparan sulfate, and chondroitin sulfate resulting in organ accumulation and eventual dysfunction.
  • Glycosaminoglycans or mucopolysaccharides are normally a component of the cornea, cartilage, bone, connective tissue, and the reticuloendothelial system and are therefore target organs for excessive storage.
  • the catabolic enzymes involved in the breakdown of glycosaminoglycans or mucopolysaccharides are deficient.
  • glycosaminoglycans requires 4 glycosidases, 5 sulfatases, and 1 nonhydrolytic transferase.
  • the MPSs share similar clinical features of a chronic and progressive course, multisystem involvement, organomegaly, dysostosis multiplex, and abnormal facies. Mode of transmission is autosomal recessive except for MPS II, which is X- linked.
  • MPSs are progressive disorders, characterized by involvement of multiple organs, including brain, liver, spleen, heart and blood vessels and many are associated with coarse facial features, clouding of the cornea and mental retardation. Diagnosis can often be made by examination of urine, which reveals increased concentration of glycosaminoglycan fragments.
  • MPS type I includes Hurler (MPS type I H), Hurler-Scheie (MPS type I H/S), and Scheie syndromes (MPS type I S).
  • Alpha-L-iduronidase which cleaves terminal L- iduronic acid residues from both dermatan and heparan sulfate, is deficient.
  • MPS type II Hunter syndrome
  • lduronate-2 sulfatase known as the Hunter corrective factor
  • Purified human recombinant idursulfase has been shown to alter disease manifestations in individuals with Hunter syndrome.
  • MPS type III Safilippo syndrome
  • deficiencies in heparan N -sulfatase type A
  • alpha A/ -acetylglucosaminidase type B
  • acetyltransferase type C
  • A/ -acetylglucosamine 6-sulfatase type D
  • All 4 enzymes are required for the degradation of heparan sulphate.
  • MPS type IV Musquio syndrome
  • results from defective degradation of keratan sulfate.Two enzyme deficiencies are recognized: A/ -acetylgalactosamine-6-sulfatase (also known as galactose-6-sulfatase) in type IV A, and beta-galactosidase in type IV B.
  • MPS type VI Maroteaux-Lamy syndrome
  • arylsulfatase B ie, N - acetylgalactosamine 4-sulfatase
  • MPS type VII Sly syndrome or beta-glucuronidase deficiency
  • beta-glucuronidase is caused by a deficiency in beta-glucuronidase, which removes the glucuronic acid residues present in dermatan sulfate, heparan sulfate, and chondroitin sulfates.
  • DiFerrante syndrome (mucopolysaccharidosis VIII) is a disorder described in very few patients.
  • GSD glycogen storage disease
  • a glycogen storage disease selected from the group consisting of cardiac glycogenosis, Andersen disease, Cori disease (or Forbes disease), Hers disease, McArdle disease, Pompe disease, Tauri disease (or Tarui disease), and von Gierke disease.
  • Glycogen storage disease (GSD, also glycogenosis and dextrinosis) is the result of defects in the processing of glycogen synthesis or breakdown within muscles, liver, and other cell types. GSD has two classes of cause: genetic and acquired. Genetic GSD is caused by any inborn error of metabolism (genetically defective enzymes) involved in these processes.
  • a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of Cardiac glycogenosis (cardiomegaly due to excessive glycogen deposition in cardiac muscle as part of a generalized glycogenosis).
  • bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of Andersen disease (also known as GSD type IV; enzyme deficiency: glycogen branching enzyme).
  • bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of Cori disease or Forbes disease (also known as GSD type III; enzyme deficiency: glucogen debrancher).
  • a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of Hers disease (also known as GSD type VI; enzyme deficiency: liver glycogen
  • bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of McArdle disease (also known as GSD type V; enzyme deficiency: muscle glycogen
  • a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of Pompe disease (also known as GSD type II; enzyme deficiency: acid alpha-glucosidase / acid maltase).
  • Pompe disease is also known as infantile acid maltase disease; a variant of GSD type II.
  • Another variant of GSD type II is 'slowly progressive acid maltase disease' or Danon disease.
  • a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of Tauri disease or Tarui disease (also known as GSD type VI I; enzyme deficiency: muscle phosphofructokinase).
  • a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of von Gierke disease (also known as GSD type I; enzyme deficiency: glucose-6- phosphatase).
  • a disease selected from the group consisting of mucolipidosis II (l-cell disease) and mucolipidosis III (pseudo-Hurler polydystrophy).
  • the defective enzyme is UDP-A/ -acetylglucosamine lysosomal enzyme N - acetylglucosamine 1 -phosphotransferase.
  • This enzyme catalyzes the first step in the synthesis of the mannose 6-phosphate recognition marker, which mediates lysosomal enzymes to reach their target lysosome after being processed in the Golgi complex. Its mode of transmission is autosomal recessive.
  • bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of a disease selected from the group consisting of aspartylglucosaminuria, fucosidosis, mannosidosis, alpha-mannosidosis, alpha-mannosidosis type I, alpha- mannosidosis type II, beta-mannosidosis, and sialidosis type II (mucolipidosis I).
  • a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of mannosidoses, such as alpha-mannosidosis and/or beta-mannosidosis.
  • Lysosomal alpha-mannosidase is a major exoglycosidase in the glycoprotein degradation pathway. A deficiency of this enzyme causes the lysosomal storage disease alpha-mannosidosis. Lysosomal alpha-D-mannosidase is involved in the catabolism of N -linked glycoproteins through the sequential degradation of high- mannose, hybrid, and complex oligosaccharides.
  • Alpha-mannosidosis can be divided into the infantile phenotype (or type I) and the juvenile-adult phenotype (or type II) according to its clinical manifestations
  • Beta-mannosidosis is an autosomal recessive lysosomal storage disease resulting from a deficiency of the lysosomal enzyme beta-mannosidase.
  • a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of aspartylglucosaminuria.
  • Aspartylglucosaminuria also called aspartylglycosaminuria, is a rare, autosomal recessive lysosomal storage disorder caused by deficient activity of the enzyme N- aspartyl-beta-glucosaminidase (aspartylglucosaminidase). This enzyme normally cleaves long sugar chains known as oligosaccharides in the lysosome.
  • a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of fucosidosis.
  • Fucosidosis also called alpha-l-fucosidase deficiency, is a rare autosomal recessive lysosomal storage disease in which the enzyme fucosidase is not properly used in the cells to break down fucose. This enzyme normally cleaves long sugar chains known as oligosaccharides in the lysosome
  • a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of Sialidosis type II or mucolipidosis I (also known as Neuraminidase deficiency).
  • Sialidosis type I is not a target of the present invention.
  • sialidosis type II in the context of the present invention is meant to refer to the variant or disease associated with an enzyme that is not directly dependent on BMP as a co-factor - more correctly denoted mucolipidosis I (or neuraminidase deficieny).
  • Mucolipidosis type I (ML I) is a rare inherited lysosomal storage disease that has clinical and histologic findings similar to the mucopolysaccharidoses and the sphingolipidoses. Initially classified as a lipomucopolysaccharidosis, this disease was later classified into the group of similar diseases now known as the mucolipidoses.
  • ML I patients with ML I were subsequently found to have an isolated deficiency of alpha-/V - acetyl neuraminidase (neuraminidase or sialidase) in leukocytes and cultured fibroblasts and, thus, have increased amounts of sialyloligosaccharide in the urine. Because of the neuraminidase deficiency, ML I is now categorized with the sialidoses, a group of biochemically distinct disease entities due to an isolated neuraminidase deficiency. Two major clinical phenotypes of ML I are recognized.
  • alpha-/V - acetyl neuraminidase neuraminidase or sialidase
  • Current treatment modalities for LSD are examples of a disease which involves an enzyme defect, a defect in the posttranslational modification of enzymes, a defect in a non-enzyme protein, a defect in a membrane transport protein, a defect in an enzyme protecting protein, a defect in a transmembrane protein, and/or a defect in a non-transmembrane protein.
  • transplantation is being performed at specialized centers for a number of these diseases.
  • Transplantation therapy is however accompanied by major side effects and often poses complications to the patients.
  • substrate reduction therapy a method used to decrease the accumulation of storage material, is currently being evaluated for some of these diseases.
  • Enzyme replacement therapy has been developed for a subset of the lysosomal storage diseases, and Cerezyme® has been on the market for a number of years for the treatment of Gaucher disease.
  • the defective enzyme, glucocerebrosidase is made by recombinant techniques, and given by intravenous infusion over a few hours.
  • Treatment is not a cure and patients require lifelong treatment to halt disease progression. Some symptoms may improve by ERT.
  • ERT is a very expensive form of therapy, which is a financial burden to the society and makes it inaccessible to some patients.
  • ERT is targeted specifically at one disease only.
  • Some side effects has been reported for Cerezyme®, including the development of an immune response, nausea, vomiting, abdominal pain, diarrhea, rash, fatigue, headache, fever, dizziness, chills, backache, and rapid heart rate as well as symptoms suggestive of allergic reactions.
  • the disclosures made in the present invention thus provide a new and innovative method for treatment of the lysosomal storage diseases. This is particularly relevant for these diseases for which no effective therapy has been developed, those that may benefit from a less expensive treatment, and those that may benefit from a combination therapy comprising the bioactive agent of the present invention.
  • the method according to the present invention provides for a treatment modality which is substantially cheaper to produce than ERT and which targets more than one specific lysosomal storage disorder.
  • proteins are collectively called molecular chaperones, because, like their human counterparts, they prevent unwanted interactions between their immature clients.
  • the molecular chaperones are found in all compartments of a cell where
  • HSPs heat shock proteins
  • Hsp70 proteins constitute the central part of an ubiquitous chaperone system present in most compartments of eukaryotic cells, in eubacteria, and in many archae. This family has recently been implicated in other aspects of cellular homeostasis besides serving as a chaperone - most markedly through its anti-apoptotic features, its functions in immunity, and the apparent dependence of cancer cells on the upregulation of Hsp70.
  • Hsp70 proteins are involved in a wide range of cellular processes including protein folding and degradation of unstable cellular proteins as well as serving other cytoprotective roles.
  • the common function of Hsp70 in these processes appears to be the binding of short hydrophobic segments in partially folded polypeptides, thereby facilitating proper folding and preventing aggregation.
  • Hsp70 chaperones interact in vivo with different classes of proteins that serve to regulate critical steps of their functional cycle; amongst these the J-domain family protein Hsp40.
  • additional partner proteins have been identified, some of which are linking Hsp70 to other chaperone systems such as the Hsp90 system.
  • Some of the important functions attributed to the molecular chaperones include import of proteins into cellular compartments, folding of proteins in the cytosol, endoplasmic reticulum and mitochondria, prevention of protein aggregation and refolding of misfolded proteins.
  • the human Hsp70 family includes 10 members encoded by different genes, and this section is meant to provide an overview of these family members with respect to function, expression patterns and homology/sequence identity. Some confusion exists about the nomenclature of the different human Hsp70 family members, although a set of general guidelines has been set forth by Tavaria et a/., which provides a logical link between locus names, genes and proteins.
  • Hsp70 genes and proteins are referred to herein by their locus name.
  • the name Hsp70 may refer to the two inducible Hsp70 family members with loci names HSPA1 A and HSPA1 B or to the whole Hsp70 family in general as evident from the consensus of the text.
  • Hsp70 is meant to denote any of the two inducible Hsp70 family members with loci names HSPA1 A and HSPA1 B.
  • the genes transcribed from the loci HSPA1 A and HSPA1 B are the two heat/stress- inducible Hsp70-genes and the majority of the literature concerning human Hsp70 refers to the proteins encoded by these two genes.
  • the genes give rise to proteins consisting of 641 amino acids, having 99% identity to each other and were the first human Hsp70 family members to be cloned and characterized.
  • the genes are linked in the MHC-class III complex at 6p21 .3, are intron-less and with promoter regions containing HSEs, enabling them to bind HSFs and induce transcription in response to a variety of cellular assaults.
  • HSPA1A Homo sapiens heat shock 70kDa protein 1 A
  • SEQ ID NO:1 The protein sequence for Homo sapiens heat shock 70kDa protein 1 A (HSPA1A) is (SEQ ID NO:1 ) (Accession no. NM_005345.5):
  • HSPA1 A The nucleic acid sequence for Homo sapiens heat shock 70kDa protein 1A (HSPA1 A) is (SEQ ID NO:2) (Accession no. NM_005345.5):
  • HSPA1 B The protein sequence for Homo sapiens heat shock 70kDa protein 1 B (HSPA1 B) is (SEQ ID NO:3) (Accession no: NM_005346):
  • HSPA1 B is (SEQ ID NO:4) (Accession no: NM_005346):
  • Hsp70 family members Two Hsp70 family members have been termed "chauvinist genes" because male germ cells favor their expression with strong prejudice.
  • the hspA IL gene is a constitutively expressed intron-less Hsp70 family member located 4kb telomeric to the HSPA1 A locus in the same MHC-class III complex on chromosome 6. It is expressed in low amounts both before and after heat shock but with the expression pattern favoring the testes in mouse, rat and humans with the 641 amino acids (aa) protein being 90% identical to HspAIA.
  • the hspA2 gene was first isolated from a mouse genomic library and has later been shown to be constitutively expressed albeit in low levels in various tissues in the human body including skeletal muscle, ovary, small intestine, colon, brain, placenta and the kidneys, but highly expressed in testis. Its expression, or rather lack thereof, has been connected with abnormal human spermatogenesis and male hspA2 ⁇ /') mice are sterile.
  • the gene is located on chromosome 14, giving rise to a 639 aa protein with 84% identity to HspAI A, although the exact location is subject to discussion as two papers have presented different loci positions - 14q24.1 vs. 14q22.
  • HspA6 and HspA7 The hspA6 and hspA7 genes are heat inducible members of the Hsp70 family with no apparent counterparts in mice. They contain HSEs in their promoter-sites and the genes are intron-less. They are co-localized on chromosome 1 and are 94% identical to each other in the nucleotide sequence. However, only HspA6 is functional as the hspA7gene harbors a single nucleotide insertion generating a premature stop codon at +1324. The HspA6 protein is 643 aa long and displays 77% identity to HspAI A and HspA1 B.
  • the hspA5 and hspA9 genes are the two compartment-specific members of the Hsp70 family.
  • the 655 aa HspA5 protein is located in the endoplasmic reticulum (ER) and facilitates folding and transport of newly synthesized proteins in this compartment.
  • the protein is 64% identical to HspAIA, the gene being located at 9q34.
  • the 679 aa HspA9 protein is located in the mitochondria where it assists in folding of proteins after their transport across the mitochondrial membrane.
  • HspA9 is located at 5q31 .1 , the protein being 52% identical to HspAIA.
  • Hsp70 The cognate Hsp70 member known as Hsc70 is encoded by a gene named hspA8 at 1 1 q24, giving rise to a 646 aa protein with 86% identity to HspAIA, and is constitutively expressed in all tissues and cell lines.
  • the protein is analogous to Hsp70 in its cellular functions, providing the required chaperoning under normal circumstances, but has also been ascribed a role in the un-coating of clathrin-coated vesicles as well as in chaperone-mediated autophagy.
  • HSPA3 exists at all and since HSPA4 is most likely a member of the Hsp1 10 family and nothing is known about it so far, except for its chromosomal location at 5q31 .1 -2.
  • HSPA8 hspA8/HspA8 (Hsc70) 11 q24 86 Hsc70; Hsp73
  • Table 1 List of the Human Hsp70 Gene Family. The genes are listed according to locus name, names used herein, chromosomal location (position), amino acid sequence identity to HspAlA as well as alternative names often seen in the literature.
  • shock/stress induces a rapid binding of heat shock transcription factors (HSF) to a region encompassing nGAAn sequences named heat shock elements (HSEs).
  • HSF heat shock transcription factors
  • HSFs heat shock transcription factors
  • HSFs heat shock elements
  • PKC protein kinase
  • HSF trimers enter the nucleus, where they bind HSEs located in the promoter region of Hsp70 genes and become further phosphorylated by HSF kinases.
  • HSF1 Three HSFs have so far been characterized in humans (HSF1 , HSF2 and HSF4).
  • HSF1 is the major transcription factor activated under most stress conditions and responds to a wide range of stimuli, which can be categorized into physiological (e.g. cell division, hormonal stimulation), pathological (e.g. infections, fever, inflammation, malignancy) and environmental conditions (e.g. heat shock, heavy metals, ethanol).
  • HSF2 responds only to hemin
  • HSF4 is preferentially expressed in the human heart, pancreas, brain and skeletal muscle, lacks the c-terminal hydrophobic repeat that is shared among all vertebrate HSFs and appears to repress expression of HSPs.
  • Hsp70 gene regulation responsible for synthesis of the constitutively expressed Hsp70 Hsc70
  • Hsc70 The Hsp70 gene regulation responsible for synthesis of the constitutively expressed Hsp70 (Hsc70) is not clearly understood, but HSFs do not seem
  • HSFs are the most prominent of the factors regulating HSP expression, other transcription factors have been shown to possess the same capability.
  • Specific CCAAT-box binding factors (CBF) have been shown to induce Hsp70 transcription
  • the tumor-suppressor p53 can repress transcription by binding to the promoter-region of Hsp70 and by neutralizing CBF
  • HSFs can be antagonized by the heat shock factor binding protein 1 (HSBP1 ), which in this way attenuates Hsp70 transcription.
  • CBF CCAAT-box binding factors
  • Hsp70 The structure and function of the Hsp70 system are best understood for the eubacterial Hsp70, DnaK, its Hsp40 co-chaperone DnaJ and the nucleotide exchange factor GrpE.
  • the mechanism is generally considered to be analogous in eukaryotes, although evidence suggests an uncoupling of GrpE. This section will focus on the eukaryotic Hsp70 system, but will also include comments on the eubacterial system, where this is considered appropriate.
  • Hsp70 is comprised of two functional entities - an N-terminal ATPase domain and a smaller C-terminal peptide-binding domain.
  • the ATPase domain is comprised of two subdomains separated by a cleft containing the nucleotide-binding site, which determines the peptide-binding properties of the C-terminal domain.
  • peptide substrates bind and dissociate rapidly, albeit with low affinity, whereas in a state where either no nucleotide or ADP is bound to the N-terminal domain, the rates of peptide binding and dissociation decrease and the affinity increases.
  • ATP hydrolysis thus serves as a molecular switch between two states of Hsp70, the cycling of which is regulated by the J-domain family protein Hsp40 in eukaryotes and DnaJ and GrpE in eubacteria.
  • the N-terminal J-domain of Hsp40 binds to Hsp70 accelerating ATP-hydrolysis, hereby facilitating peptide capture, whereas the C-terminal part of Hsp40 functions as a chaperone by recognizing hydrophobic peptides, whereby Hsp70 is recruited to nascent polypeptide chains.
  • the molecular chaperones do not provide specific steric information for the folding of the bound protein, but rather inhibit unproductive interactions, thus allowing the protein to fold more efficiently into its native structure.
  • GrpE induces the release of ADP from DnaK (bacterial Hsp70), whereas for eukaryotic Hsp70 proteins such a factor appears to be dispensable because the rate-limiting step in this ATPase cycle is not the dissociation of bound ADP but rather the ATP-hydrolysis itself.
  • Hsp70 interacting protein serving as a positive regulator by stabilizing the ADP-bound state of Hsp70
  • proteins Carboxy-terminus of Hsp70-binding protein (CHIP) and Bcl-2-associated athanogene-1 (Bag-1 ) both have inhibitory effects - CHIP by inhibiting the ATPase activity of Hsp70 and Bag-1 by antagonizing the refolding activity of Hsp70.
  • Hsp40 proteins Hdj1 and Hdj2 which, besides their Hsp40 functions (described above), have been shown to facilitate the coupling of Hsp70 and Hsp90 through Hop (Hsp-organizing protein), an adaptor protein which physically links the chaperones through its two tetratricopeptide repeat (TPR) domains that bind the extended C-terminal sequences of Hsp70 and Hsp90, respectively.
  • TPR tetratricopeptide repeat
  • the protein CHIP is, apart from its negative regulatory role on Hsp70, able to associate with Hsp90 through an N-terminal TPR domain and targets Hsp90 substrates for degradation through a C-terminal ubiquitin ligase domain, but is also capable of cooperating functionally with BAG-1 , which binds to Hsp70 (as well as the proteasome.
  • Hsp70 is also able to affect the survival of cells in various other ways, including protection of mitochondrial function after ischemia-reperfusion injury, blocking activation of the stress kinase c-jun N-terminal kinase (JNK) upon stimulation of primary fibroblasts with TNF, and a Hsp70/Bag-1 complex has been proposed to regulate cell growth and mitogenesis during conditions of cellular stress.
  • JNK stress kinase c-jun N-terminal kinase
  • Hsp70 to protect cells from cell death induced by an array of stimuli such as TNF, TRAIL, oxidative stress, UV-radiation and the anti-cancer drugs doxorubicin, etoposide and taxol further emphasize its anti-apoptotic features.
  • stimuli such as TNF, TRAIL, oxidative stress, UV-radiation and the anti-cancer drugs doxorubicin, etoposide and taxol
  • Hsp70 parts of the potent cytoprotective effect of Hsp70 are due to stabilization of lysosomal membranes.
  • the depletion of Hsp70 triggers an early permeabilization of lysosomal membranes and cathepsin- mediated cell death in cancer cells, and exogenous Hsp70 effectively inhibits lysosomal destabilization induced by various stresses.
  • mice deficient for Hsp70 suffer from pancreatitis caused by the leakage of lysosomal proteases into the cytosol. All of these events stress the role of Hsp70 as an important regulator of PCD and hence survival factor for cells.
  • Hsp70 intracellular functions of Hsp70 are essential for proper cell homeostasis, not least so in the face of noxious challenges.
  • eHsp70 extracellular Hsp70
  • involvement in a general physiological adaptation to stress and protection versus cellular damage are also emerging themes for eHsp70.
  • eHsp70 has been shown to protect motor neurons otherwise destined to die during chick embryonic development, and also protect motor neurons isolated from chick spinal cords upon trophic factor deprivation.
  • An in vivo protective role for eHsp70 has also been described when it comes to light damage of the retina.
  • Yu et al. intravitreally injected a solution of recombinant Hsp70 and Hsc70 after exposure to damage-inducing light at a dose which had previously been described to cause extensive photoreceptor degeneration.
  • the presence of the eHsp70 mixture in the vitreous chamber of the right eye resulted in significantly more photoreceptors surviving in the retina.
  • evaluation of uptake of fluorescein- labelled Hsc/Hsp70 demonstrated that it was present in the retina 6h after
  • Extracellular Hsp70 administered via intranasal treatment has also been shown to prevent the consequences of unavoidable stress in rats and it was recently described that intraperitoneally injected recombinant human Hsp70 was effective in increasing the lifespan, delaying symptom onset, preserving motor function and prolonging motor neuron survival in a mouse model of amyotrophic lateral sclerosis. Additional in vitro work using Hsp70 or the Hsc/Hsp70 mixture in neuronal systems has furthermore shown that eHsp70 can enhance neuronal cell stress tolerance and reduce polyglutamine toxicity and aggregation.
  • Hsp70 major histocompatibility complex
  • APC antigen presenting cells
  • Hsp70-peptide complexes are then presented on MHC class 1 molecules leading to a cytotoxic t-cell response.
  • Hsp70 is also capable of binding microbial peptides and unmethylated CpG motifs in bacterial DNA.
  • eHsp70 In addition to its role as an antigen-presenting chaperone, eHsp70 has also been implicated in the stimulation of innate immunity. Whilst a number of cell types have been shown to release Hsp70, eHsp70 has also been shown to bind to a number of receptors on different leucocyte sub-populations including natural killer (NK) cells, macrophages, monocytes and dendritic cells.
  • NK natural killer
  • the receptors involved in eHsp70 recognition mainly include pattern recognition receptors (PRR's) and consist of a variety of receptors from different receptor families such as the toll like receptors (TLR), scavenger receptors and c-type lectins.
  • eHsp70 Upon receptor binding, eHsp70 is capable of eliciting a wide cytokine-response including release of pro-inflammatory cytokines such as TNF-a, IL-1 b, IL-12, IL-6 and GM-CSF, a process triggered by translocation of NF- kB to the nucleus, suggesting a cytokine action of eHsp70, which has also led to the suggestion of coining the term chaperokine to eHsp70 in order to better describe the uniqe functions of eHsp70 as both a chaperone and cytokine.
  • pro-inflammatory cytokines such as TNF-a, IL-1 b, IL-12, IL-6 and GM-CSF
  • Hsp70 Aside for the data demonstrating transfer of eHsp70 between neighboring cells such as in the glia/axon model, several reports have documented the presence of free eHsp70 in the circulation. For Hsp70 to be present in this compartment, it necessarily has to be released from an organ/cell. Two major ways of achieving this are usually considered. One is a passive way in which the observation of eHsp70 in the peripheral circulation is the consequence of release from an intracellular pool of Hsp70 due to cell lysis or death. Alternatively, or perhaps additionally, Hsp70 is actively released via a non- classical exocytotic pathway.
  • Hsp70 along with other heat shock proteins are only released under pathological circumstances resulting in necrotic death and not during programmed cell death. No doubt, severe trauma and pathological conditions resulting in necrosis can lead to the release of Hsp70 to the bloodstream. This has been well documented and would also logically be expected. Recent studies however, have shown that Hsp70 can be released from intact cells by active mechanisms and that the degree of stimulus determines the mode of release. Strong evidence for the non- necrotic release of Hsp70 also comes from studies on exercise-induced release of eHsp70 to the peripheral bloodstream.
  • Hsp70 does not contain any classical peptide leader sequence, which could target it for secretion.
  • classical secretion was already questioned early, this suggests that alternate mechanisms for eHsp70 release must exist. It has been demonstrated that eHsp70 can be released in vesicles characterized as exosomes, but evidence has also been presented that eHsp70 can be released as free eHsp70, both in cellular systems as well as in vivo. It has been suggested that lipid rafts are needed for eHsp70 release although this has also been disputed.
  • Bioactive agent according to the present invention
  • the present invention relates in one embodiment to the use of a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70.
  • a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70.
  • Increasing the intracellular concentration and/or activity of Hsp70 according to the present invention can be obtained by providing one of the following classes of compounds and therapies:
  • ROS Reactive oxygen species
  • a bioactive agent according to the present invention is thus any agent, chemical or compound that increases the intracellular concentration and/or activity of Hsp70; and includes HSP70 itself, or a functional fragment or variant thereof, and any Hsp70 inducer or co-inducer known to the skilled person.
  • a bioactive agent may increase the intracellular concentration and/or activity of Hsp70 either directly or indirectly.
  • the bioactive agent according to the present invention is Hsp70, or a functional fragment or variant thereof.
  • the bioactive agent according to the present invention is an Hsp70 inducer or co-inducer.
  • the bioactive agent according to the present invention comprises a combination of Hsp70, or a functional fragment or variant thereof, and an Hsp70 inducer or co-inducer.
  • bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70, for use in the treatment of a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous
  • cholesterosis Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysacc
  • a bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in the treatment of a lysosomal storage disease, wherein said lysosomal storage disease arise from a defect in an enzyme whose activity is not directly associated with the presence of lysosomal BMP as a co-factor.
  • said lysosomal storage disease is not selected from the group of Niemann-Pick disease, Farber disease, Krabbe disease, Sialidosis type I,
  • said lysosomal storage disease is selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid
  • lipofuscinoses cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • said treatment may be prophylactic, curative or ameliorating.
  • said treatment is prophylactic.
  • said treatment is curative.
  • said treatment is ameliorating.
  • Bioactive agent - Hsp70 or a functional fragment or variant thereof
  • Hsp70 or a functional fragment or variant thereof, for use as a medicament. It is a further aspect of the present invention to provide Hsp70, or a functional fragment or variant thereof, for use in the treatment of a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid
  • lipofuscinoses cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • Hsp70 or a functional fragment or variant thereof, for the manufacture of a medicament for treating a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosa
  • Hsp70 or a functional fragment or variant thereof, for use in the treatment of a lysosomal storage disease, wherein said lysosomal storage disease arise from a defect in an enzyme whose activity is not directly associated with the presence of lysosomal BMP as a co-factor.
  • said lysosomal storage disease is not selected from the group of Niemann-Pick disease, Farber disease, Krabbe disease, Sialidosis type I,
  • Metachromatic leukodystrophy, Gaucher disease, Fabry disease and saposin- deficiency Metachromatic leukodystrophy, Gaucher disease, Fabry disease and saposin- deficiency.
  • said lysosomal storage disease is selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid
  • lipofuscinoses cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidosies, and sialidosis type II.
  • Hsp70 or a functional fragment or variant thereof, according to the present invention may be any natural or synthetic product, and may be produced by any conventional technique known to the person skilled in the art.
  • Hsp70 is purified from a natural source.
  • Said natural source may be any plant, animal or bacteria which expresses, or may be induced to express, Hsp70 in a form suitable for administering to an individual in need thereof.
  • Hsp70 is made synthetically. It follows that Hsp70, or a functional fragment or variant thereof, may in one preferred embodiment be a recombinant protein made by conventional techniques therefore and as such is denoted rHsp70.
  • the Hsp70 according to the present invention may have a sequence which is derived from any suitable species of plant, animal or bacteria.
  • said rHsp70 is derived from a mammal.
  • Said mammal may be selected form the group consisting of human (homo sapiens), mouse (mus musculus), cow, dog, rat, ferret, pig, sheep, and monkey.
  • said rHsp70 is derived from bacteria.
  • Hsp70 is characterized in part by having a very high degree of interspecies sequence conservation, thus possibly allowing for Hsp70 derived from one species to be used in another species without eliciting a harmful immune response.
  • said rHsp70 has a sequence derived from human Hsp70.
  • said rHsp70 has a sequence derived from more than one species.
  • Said Hsp70, or a functional fragment or variant htereof, may thus in one embodiment be a chimera.
  • a recombinant protein is a protein that is derived from recombinant DNA.
  • Recombinant DNA is a form of DNA that does not exist naturally, which is created by combining DNA sequences that would not normally occur together.
  • recombinant DNA is introduced through the addition of relevant DNA into an existing organismal DNA, such as the plasmids of bacteria, to code for different traits for a specific purpose. It differs from genetic recombination, in that it does not occur through processes within the cell, but is engineered by man.
  • the Hsp70 according to the present invention has 100% identity to the wild-type Hsp70 protein.
  • the Hsp70 according to the present invention has less than 100% identity to the wild-type Hsp70 protein, such as between 99.9 to 95% identity, for example 95 to 90% identity, such as 90 to 85% identity, for example 85 to 80% identity, such as 80 to 75% identity, for example 75 to 60% identity to the wild-type protein. Regardless of the degree of identity, any variant of Hsp70 that retains all or most of its biological functions is encompassed by the present invention.
  • the bioactive agent is Hsp70. In one embodiment, said Hsp70 is full length Hsp70.
  • a functional fragment or variant of Hsp70 is any fragment of Hsp70 having the desired function, which in terms of the present invention is a capability to reverse the pathology of a lysosomal storage disease and/or increase the cellular uptake of other molecules.
  • the bioactive agent is a functional fragment or variant of Hsp70. In one embodiment, the bioactive agent is a functional fragment or variant of Hsp70, in which Hsp70 is modified by deletion(s), addition(s) or substitution(s) of the wild type Hsp70.
  • the wild type Hsp70 protein has a total length of 641 amino acids.
  • a fragment of Hsp70 is in one embodiment meant to comprise any fragment with a total length of less than the wild type protein of 641 amino acids, such as less than 625 amino acids, for example less than 600 amino aids, such as less than 575 amino acids, for example less than 550 amino aids, such as less than 525 amino acids, for example less than 500 amino aids, such as less than 475 amino acids, for example less than 450 amino aids, such as less than 425 amino acids, for example less than 400 amino aids, such as less than 375 amino acids, for example less than 350 amino aids, such as less than 325 amino acids, for example less than 300 amino aids, such as less than 275 amino acids, for example less than 250 amino aids, such as less than 225 amino acids, for example less than 200 amino aids, such as less than 175 amino acids, for example less than 150 amino aids, such as less than 125 amino acids, for example less than 100 amino aids
  • the wild type Hsp70 protein has a total length of 641 amino acids.
  • a fragment of Hsp70 is in one embodiment meant to comprise any fragment with a total length of more than 10 amino acids, such as more than 25 amino acids, for example more than 50 amino aids, such as more than 75 amino acids, for example more than 100 amino aids, such as more than 125 amino acids, for example more than 150 amino aids, such as more than 175 amino acids, for example more than 200 amino aids, such as more than 225 amino acids, for example more than 250 amino aids, such as more than 275 amino acids, for example more than 300 amino aids, such as more than 325 amino acids, for example more than 350 amino aids, such as more than 375 amino acids, for example more than 400 amino aids, such as more than 425 amino acids, for example more than 450 amino aids, such as more than 475 amino acids, for example more than 500 amino aids, such as more than 525 amino acids, for example more than 550 amino aids, such as more than 575 amino
  • the total length of the fragment of Hsp70 according to the present invention may in one embodiment be within the range of 5 to 25 amino acids, such as 25 to 50 amino acids, for example 50 to 75 amino acids, such as 75 to 100 amino acids, for example 100 to 125 amino acids, such as 125 to 150 amino acids, for example 150 to 175 amino acids, such as 175 to 200 amino acids, for example 200 to 225 amino acids, such as 225 to 250 amino acids, for example 250 to 275 amino acids, such as 275 to 300 amino acids, for example 300 to 325 amino acids, such as 325 to 350 amino acids, for example 350 to 375 amino acids, such as 375 to 400 amino acids, for example 400 to 425 amino acids, such as 425 to 450 amino acids, for example 450 to 475 amino acids, such as 475 to 500 amino acids, for example 500 to 525 amino acids, such as 525 to 550 amino acids, for example 550 to 575 amino acids, such as 575 to 600 amino acids, for example 600 to 625 amino acids, such as 625 amino acids
  • the fragment or variant of Hsp70 comprises all or part of the ATPase domain of Hsp70. It follows that the fragment or variant of Hsp70 according to the present invention in one embodiment comprises all or part of amino acids number 30 to 382. In another embodiment, the fragment or variant of Hsp70 comprises tryptophan at amino acid position 90 of the Hsp70 ATPase domain.
  • a fragment of Hsp70 may be a truncated version of the wild type protein, meaning that it is a shorter version.
  • a fragment may be truncated by shortening of the protein from either the amino-terminal or the carboxy-terminal ends of the protein, or it may be truncated by deletion of one or more internal regions of any size of the protein.
  • a fragment or variant of Hsp70 may in one embodiment have 100% identity to the wild- type protein.
  • the fragment or variant of Hsp70 may also be a variant of Hsp70 which has less than 100% identity to the wild-type protein, such as between 99.9 to 95% identity, for example 95 to 90% identity, such as 90 to 85% identity, for example 85 to 80% identity, such as 80 to 75% identity, for example 75 to 60% identity to the wild-type protein.
  • a fragment or variant of Hsp70 may in one embodiment have 100% identity to the wild- type protein.
  • the fragment or variant of Hsp70 may also be a variant of Hsp70 which has less than 100% identity to the wild-type protein, such as between 99.9 to 95% identity, for example 95 to 90% identity, such as 90 to 85% identity, for example 85 to 80% identity, such as 80 to 75% identity, for example 75 to 60% identity to the wild-type protein.
  • the exact quantitative effect of the functional fragment or variant may be different from the effect of the full-length molecule.
  • the functional fragment or variant may indeed be more effective than the full-length molecule.
  • the use of fragments instead of full-length molecules may be advantageous in view of the smaller size of the fragments.
  • a functional fragment or variant of Hsp70 may be a variant of Hsp70 in which one or more amino acids has been substituted. Said substitution(s) may be an equivalent or conservative substitution(s), or a non-equivalent or non- conservative substitution(s).
  • between 0.1 to 1 % of the amino acid residues of wild type Hsp70 has been substituted, such as between 1 to 2% amino acid residues, for example between 2 to 3% amino acid residues, such as between 3 to 4% amino acid residues, for example between 4 to 5% amino acid residues, such as between 5 to 10% amino acid residues, for example between 10 to 15% amino acid residues, such as between 15 to 20% amino acid residues, for example between 20 to 30% amino acid residues, such as between 30 to 40% amino acid residues, for example between 40 to 50% amino acid residues, such as between 50 to 60% amino acid residues, for example between 60 to 70% amino acid residues, such as between 70 to 80% amino acid residues, for example between 80 to 90% amino acid residues, such as between 90 to 100% amino acid residues.
  • between 1 to 5 of the amino acid residues of wild type Hsp70 has been substituted, such as between 5 to 10 amino acid residues, for example between 10 to 15 amino acid residues, such as between 15 to 20 amino acid residues, for example between 20 to 30 amino acid residues, such as between 30 to 40 amino acid residues, for example between 40 to 50 amino acid residues, such as between 50 to 75 amino acid residues, for example between 75 to 100 amino acid residues, such as between 100 to 150 amino acid residues, for example between 150 to 200 amino acid residues, such as between 200 to 300 amino acid residues, for example between 300 to 400 amino acid residues, such as between 400 to 500 amino acid residues.
  • the functional fragment or variant of Hsp70 is a fusion protein. In one embodiment, said functional fragment or variant of Hsp70 is fused to a tag.
  • Hsp70 or a functional fragment or variant thereof
  • ERT enzyme replacement therapies
  • Gaucher disease and Fabry disease As discussed herein above, there are no cures for the lysosomal storage diseases and treatment is mostly symptomatic, with the exception of the development of enzyme replacement therapies (ERT) for Gaucher disease and Fabry disease.
  • ERT enzyme replacement therapies
  • ERT is a very expensive form of therapy that is effective for one specific disease only.
  • Hsp70, or a functional fragment or variant thereof, to an individual in need thereof has a number of advantages compared to conventional treatment modalities for the lysosomal storage disorders.
  • a recombinant protein such as rHsp70 or a functional fragment or variant thereof
  • modern technology a simple and straight-forward way of producing sufficient amounts of rHsp70, or a functional fragment or variant thereof.
  • Conventional techniques for producing recombinant enzymes are well known to the skilled person.
  • producing a recombinant protein, such as rHsp70 a functional fragment or variant thereof is a cheap method for producing sufficient amounts of rHsp70, or a functional fragment or variant thereof. Compared to the production of enzymes for ERT, the cost is drastically reduced.
  • the use of Hsp70, or a functional fragment or variant thereof can be used for treatment of more than one specific lysosomal storage disorder.
  • the bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 may be used for treatment of any lysosomal storage disease which may be reverted by modulating the enzymatic activity of the involved defective enzyme, wherein said enzyme interacts with BMP.
  • Hsp70 is an endogenously occurring molecule, i.e. a molecule that originate from within an organism, tissue, or cell, it is to be expected that no or a very limited immune response is triggered by administering Hsp70, or a functional fragment or variant thereof. This is a major advantage as it facilitates treatment and reduces potential side effects when administered to an individual.
  • Hsp70, or a functional fragment or variant thereof may be expressed from a vector.
  • the invention thus in one embodiment relates to a vector encoding Hsp70, or a functional fragment or variant thereof.
  • Hsp70 or a functional fragment or variant thereof, may be administered to an individual in need thereof in the form of a vector.
  • the vector used for expressing Hsp70, or a functional fragment or variant thereof may be selected from the group consisting of: viral vectors (retroviral and adenoviral) or non-viral vectors (plasmid, cosmid, bacteriophage).
  • said vector comprises one or more of a origin of replication, a marker for selection and one or more recognition sites for a restriction endonuclease.
  • said vector is operably linked to regulatory sequences controlling the transcription of said Hsp70, or a functional fragment or variant thereof, in a suitable host cell.
  • the present invention in one embodiment relates to a method for producing Hsp70, or a functional fragment or variant thereof, as described herein; said method comprising the steps of providing a vector encoding said Hsp70, or a functional fragment or variant thereof, and expressing said vector either in vitro, or in vivo in a suitable host organism, thereby producing said Hsp70, or a functional fragment or variant thereof.
  • the invention further relates to an isolated recombinant or transgenic host cell comprising a vector encoding Hsp70, or a functional fragment or variant thereof, according to the present invention.
  • the invention also relates to a method for generating a recombinant or transgenic host cell, said method comprising the steps of providing a vector encoding Hsp70, or a functional fragment or variant thereof, introducing said vector into said recombinant or transgenic host cell and optionally also expressing said vector in said recombinant or transgenic host cell, thereby generating a recombinant or transgenic host cell producing said Hsp70, or a functional fragment or variant thereof.
  • the present invention relates to a transgenic, mammalian organism comprising the host cell described above.
  • the transgenic, mammalian organism comprising the recombinant or transgenic host cell according to the present invention is non-human.
  • the transgenic host cell may be selected from the group consisting of a mammalian, plant, bacterial, yeast or fungal host cell.
  • Lipoplexes and polyplexes have been created that have the ability to protect the DNA from undesirable degradation during the transfection process.
  • Plasmid DNA can be covered with lipids in an organized structure like a micelle or a liposome. When the organized structure is complexed with DNA it is called a lipoplex.
  • lipids There are three types of lipids that may be employed for forming liposomes; anionic (negatively charged), neutral, or cationic (positively charged).
  • Complexes of polymers with DNA are called polyplexes. Most polyplexes consist of cationic polymers and their production is regulated by ionic interactions.
  • Hsp70 may be administered as naked DNA.
  • the bioactive agent according to the present invention is an Hsp70 inducer or co-inducer.
  • An Hsp70 inducer is a compound that can by itself amplify Hsp70 gene expression and protein expression without a concomitant stress.
  • Hsp70 co-inducer is a compound that cannot amplify Hsp70 gene expression and protein expression without a concomitant (mild) stress, but the stress-induced increase in Hsp70 levels is further elevated or enhanced by their presence.
  • a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses,
  • a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glyco
  • an Hsp70 inducer or co- inducer for use in treating a lysosomal storage disease, wherein said lysosomal storage disease arise from a defect in an enzyme whose activity is not directly associated with the presence of lysosomal BMP as a co-factor.
  • said lysosomal storage disease is not selected from the group of Niemann-Pick disease, Farber disease, Krabbe disease, Sialidosis type I,
  • said lysosomal storage disease is selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid
  • lipofuscinoses cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • the bioactive agent according to the present invention is an Hsp70 inducer or co-inducer. In a particular embodiment, the bioactive agent according to the present invention is an Hsp70 inducer. In another particular embodiment, the bioactive agent according to the present invention is an Hsp70 co-inducer.
  • the bioactive agent according to the present invention is an Hsp70 co-inducer.
  • said Hsp70 co-inducer is a small-molecule drug.
  • the Hsp70 co-inducer according to the present invention is a hydroxylamine derivative. Said hydroxylamine derivative may in a further embodiment
  • BRLP-42 Bimoclomol
  • BRX- 220 Arimoclomol
  • BRX-345 BGP-15.
  • said hydroxylamine derivative is Arimoclomol (BRX-220).
  • Bimoclomol ([2-hydroxy-3-(1 -piperidinyl) propoxy]-3-pyridine-carboximidoyl-chloride maleate) is a non-toxic compound that was originally developed for treatment of diabetic complications such as neuropathies. Bimoclomol has been shown to improve cell survival under experimental stress conditions partly by increasing intracellular heat shock proteins (HSPs), including Hsp70, via an activation of HSF-1 . It has been shown that bimoclomol possess the capability of Hsp70 co-induction in the absence of unfolded proteins, and that bimoclomol interacts with and increases the fluidity of negatively charged membrane lipids.
  • HSPs heat shock proteins
  • BRX-345 is a structural analog of bimoclomol with a somewhat lesser ability to induce HSPs.
  • Arimoclomol (BRX-220) is an analog of bimoclomol, which also interacts with and amplifies the heat shock response. Arimoclomol is currently in clinical trials for the treatment of ALS (amyotrophic lateral sclerosis); a progressive neurodegenerative disorder. Arimoclomol is owned by CytRx Corporation.
  • the bioactive agent according to the present invention is Iroxanadine (5-(piperidin-1 -ylmethyl)-3-pyridin-3-yl-5,6-dihydro-2H-1 ,2,4-oxadiazine).
  • a hydroxylamine derivative Hsp70 co-inducer for use in the treatment of a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid
  • lipofuscinoses cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glyco
  • said lysosomal storage disease is not selected from the group of Niemann-Pick disease, Farber disease, Krabbe disease, Sialidosis type I,
  • Metachromatic leukodystrophy, Gaucher disease, Fabry disease and saposin- deficiency Metachromatic leukodystrophy, Gaucher disease, Fabry disease and saposin- deficiency.
  • said lysosomal storage disease is selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid
  • lipofuscinoses cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • the bioactive agent according to the present invention is an Hsp70 inducer.
  • said Hsp70 inducer is a membrane fluidizer.
  • the Hsp70 inducer is a membrane fluidizer selected from the group of benzyl alcohol, heptanol, AL721 , Docosahexaenoic acid, aliphatic alcohols, oleyl alcohol, dimethylaminoethanol, A 2 C, farnesol and anaesthetics such as lidocaine, ropivacaine, bupivacaine and
  • mepivacaine as well as others known to the skilled person.
  • mepivacaine Besides the denaturation of a proportion of cellular proteins during heat (proteotoxicity), a change in the fluidity of membranes is also proposed as being a cellular
  • thermosensor that initiates the heat shock response and induces HSPs.
  • chemically induced membrane perturbations - analogous with heat induced plasma membrane fluidization - are capable of activating HSP, without causing protein denaturation.
  • Membrane fluidity refers to the viscosity of the lipid bilayer of a cell membrane.
  • the membrane phospholipids incorporate fatty acids of varying length and saturation.
  • the membrane fluidizers act by intercalating between membrane lipids thus inducing a disordering effect by weakening of van der Vaals interactions between the lipid acyl chains. It is thus an aspect of the present invention to provide a membrane fluidizer selected from the group of benzyl alcohol, heptanol, AL721 , Docosahexaenoic acid, aliphatic alcohols, oleyl alcohol, dimethylaminoethanol, A 2 C, farnesol and anaesthetics such as lidocaine, ropivacaine, bupivacaine and mepivacaine, as well as others known to the skilled person, for use in the treatment of a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses
  • a membrane fluidizer selected from the group of benzyl alcohol, heptanol, AL721 , Docosahexaenoic acid, aliphatic alcohols, oleyl alcohol, dimethylaminoethanol, A 2 C, farnesol and anaesthetics such as lidocaine, ropivacaine, bupivacaine and mepivacaine, as well as others known to the skilled person, for the manufacture of a medicament for treating a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and
  • a membrane fluidizer selected from the group of benzyl alcohol, heptanol, AL721 , Docosahexaenoic acid, aliphatic alcohols, oleyl alcohol, dimethylaminoethanol, A 2 C, farnesol and anaesthetics such as lidocaine, ropivacaine, bupivacaine and mepivacaine, as well as others known to the skilled person, for use in treating a lysosomal storage disease, wherein said lysosomal storage disease arise from a defect in an enzyme whose activity is not associated with the presence of lysosomal BMP as a co-factor.
  • said lysosomal storage disease is not selected from the group of Niemann-Pick disease, Farber disease, Krabbe disease, Sialidosis type I,
  • said lysosomal storage disease is selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid
  • lipofuscinoses cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II.
  • sub-lethal heat therapy comprises increasing the temperature of an individual to a core temperature of about 38°C, such as about 39°C, for example about 40°C, such as about 41 °C, for example about 42°C, such as about 43°C.
  • a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuri
  • a lysosomal storage disease arise from a defect in an enzyme whose activity is not directly associated with the presence of lysosomal BMP as a co-factor.
  • Psychological stress such as predatory fear and electric shock can evoke a stress induced eHsp70 release, a process which is suggested to be dependent on cathecholamine signaling.
  • adrenaline and noradrenalin can evoke Hsp70 release.
  • Hsp70 the membrane-interactive compound alkyllysophospholipid Edelfosine (ET-18- OCH3 or 1 -octadecyl-2-methyl-rac-glycero-3-phosphocholine); anti-inflammatory drugs including cyclooxygenase 1 /2 inhibitors such as celecoxib and rofecoxib, as well as NSAIDs suh as acetyl-salicylic acid, sodium salicylate and indomethacin;
  • cyclooxygenase 1 /2 inhibitors such as celecoxib and rofecoxib, as well as NSAIDs suh as acetyl-salicylic acid, sodium salicylate and indomethacin;
  • geranylgeranylacetone GGA
  • rebamipide carbenoxolone
  • polaprezinc zinc L- carnosine
  • dexamethasone cocaine, nicotine, alcohol, alpha-adrenergic agonists, cyclopentenone prostanoids, paeoniflorin, glycyrrhizin, celastrol, dihydrocelastrol, dihydrocelastrol diacetate and curcumin, as well as other HSP inducers known to the skilled person, for use in treating a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses
  • composition according to the present invention geranylgeranylacetone (GGA), rebamipide, carbenoxolone, polaprezinc (zinc L- carnosine), dexamethasone, cocaine, nicotine, alcohol, alpha-adrenergic agonists, cyclopentenone prostanoids, paeoniflorin, glycyrrhizin, celastrol, dihydrocelastrol, dihydrocelastrol diacetate and curcumin, as well as other HSP inducers known to the skilled person, for use in treating a lysosomal storage disease, wherein said lysosomal storage disease arise from a defect in an enzyme whose activity is not directly associated with the presence of lysosomal BMP as a co-factor.
  • Pharmaceutical composition according to the present invention composition according to the present invention
  • the present invention relates to the use of a bioactive agent capable of increasing the concentration and/or activity of Hsp70, thereby benefiting patients suffering from a disease selected from the group consisting of glycogen storage diseases,
  • the present invention further provides a pharmaceutical composition, for medicinal application, which comprises a bioactive agent of the present invention or pharmaceutically acceptable salts thereof, as herein defined, and a pharmaceutically acceptable carrier therefore.
  • composition such as a
  • a pharmaceutical composition comprising a bioactive agent identified herein that may be administered to an individual in need thereof.
  • a pharmaceutical composition is a composition that is safe to administer to an individual; and may thus be a
  • the invention relates to a composition comprising a bioactive agent according to the present invention.
  • the composition as disclosed herein may in one embodiment be formulated in combination with a physiologically acceptable carrier.
  • the composition as disclosed herein may in one embodiment be formulated in combination with a pharmaceutically acceptable carrier.
  • compositions containing a bioactive agent of the present invention may be prepared by conventional techniques, e.g. as described in Remington: The Science and Practice of Pharmacy 1995, edited by E. W. Martin, Mack Publishing Company, 19th edition, Easton, Pa.
  • the bioactive agents of the present invention may be formulated for parenteral administration and may be presented in unit dose form in ampoules, pre-filled syringes, small volume infusion or in multi-dose containers with an added preservative.
  • the compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, carriers, diluents, or solvents including aqueous solutions of mineral salts or other water-soluble molecules, propylene glycol, polyethylene glycol, vegetable oils, animal oils, synthetic oils, injectable organic esters, and may contain formulatory agents such as preserving, wetting, emulsifying or suspending, stabilizing and/or dispersing agents, colorants, buffers, thickeners, solubilizing agents and the like.
  • the active ingredient may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution for constitution before use with a suitable vehicle, e.g., sterile, pyrogen-free water.
  • a suitable vehicle e.g., sterile, pyrogen-free water.
  • salts of the bioactive agents where they can be prepared, are also intended to be covered by this invention, as are specific hydrate forms of a salt. These salts will be ones which are acceptable in their application to a
  • the salt will retain the biological activity of the parent compound and the salt will not have untoward or deleterious effects in its application and use in treating diseases.
  • compositions are prepared in a standard manner. If the parent compound is a base it is treated with an excess of an organic or inorganic acid in a suitable solvent. If the parent compound is an acid, it is treated with an inorganic or organic base in a suitable solvent.
  • the Hsp70, or a functional fragment or variant thereof is formulated in a biodegradable microsphere, such as a liposome.
  • a biodegradable microsphere such as a liposome.
  • Any suitable route of administration may be employed for providing a mammal, preferably a human, with an effective amount of a bioactive agent according to the present invention, wherein said bioactive agent in one embodiment may be Hsp70, or a functional fragment or variant thereof.
  • Administering bioactive agents or pharmaceutical compositions to an individual in need thereof may occur via three major routes of delivery: 1 ) Topical (applied to body surfaces such as skin or mucous membranes), 2) Enteral (via the gastrointestinal or digestive tract) and 3) Parenteral (routes other than the gastrointestinal or digestive tract). Topical administration includes epicutaneous (application onto the skin), inhalational, enema, eye drops (onto the conjunctiva), ear drops, intranasal route, and vaginal administration.
  • Enteral administration is any form of administration that involves any part of the gastrointestinal tract and includes oral administration (by mouth e.g. tablets, capsules or drops), intrarectal (e.g. suppository or enema) administration besides by gastric or duodenal feeding tube.
  • oral administration by mouth e.g. tablets, capsules or drops
  • intrarectal e.g. suppository or enema
  • gastric or duodenal feeding tube e.g. suppository or enema
  • Parenteral delivery such as by injection or infusion, are effective to deliver the bioactive agent to a target site or to introduce the drug into the bloodstream, and includes intravenous (into a vein), intra-arterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), subcutaneous (under the skin), intraosseous (into the bone marrow), intradermal, (into the skin itself), intrathecal or intraspinal (into the spinal canal), intraperitoneal, (into the peritoneum), transdermal (diffusion through the intact skin), transmucosal (diffusion through a mucous membrane, e.g.
  • Sublingual administration is also a form of parenteral administration, whereby bioactive agents diffuse into the bloodstream through the mucosal tissue under the tongue.
  • the bioactive agent of the present invention may be administered by any parenteral route of delivery and preferably any of the above. Parenteral delivery has the advantage of avoiding degradation in the gastrointestinal tract, as associated with enteral delivery.
  • Parenteral delivery has the further advantage of of abolishing first pass metabolism, as associated with enteral delivery, because it allows compounds to be absorbed directly into the systemic circulation.
  • First-pass metabolism is a phenomenon of drug metabolism whereby the concentration of a drug is greatly reduced before it reaches the systemic circulation. It is the fraction of lost drug during the process of absorption which is generally related to the liver and gut wall. After a drug is swallowed, it is absorbed by the digestive system and enters the hepatic portal system. It is carried through the portal vein into the liver before it reaches the rest of the body. The liver metabolizes many drugs, sometimes to such an extent that only a small amount of active drug emerges from the liver to the rest of the circulatory system. This first pass through the liver thus greatly reduces the bioavailability of the drug.
  • the four primary systems that affect the first pass effect of a drug are the enzymes of the gastrointestinal lumen, gut wall enzymes, bacterial enzymes, and hepatic enzymes.
  • Appropriate dosage forms for such administration may be prepared by conventional techniques.
  • Appropriate dosage forms for administration by inhalation such as an aerosol formulation or a metered dose inhaler, may be prepared by conventional techniques.
  • a particular mode of administration of a bioactive agent according to the present invention is by parenteral administration.
  • a particular mode of parenteral administration of a bioactive agent of the present invention is by intravenous, subcutaneous, intramuscular, intraarterial, subcutaneous or intraperitoneal injection.
  • a particular mode of parenteral administration of a bioactive agent of the present invention is by inhalation.
  • a particular mode of parenteral administration of a bioactive agent of the present invention is by intravenous infusion.
  • Intravenous infusion according to the present invention may in one embodiment occur over a time period of from 10 minutes to 20 minutes, such as 20 to 30 minutes, for example 30 to 40 minutes, such as 40 to 50 minutes, for example 50 to 60 minutes, such as 60 to 90 minutes, for example 90 to 120 minutes, such as 2 hours to 3 hours, for example 3 to 4 hours, such as 4 to 5 hours, for example 5 to 6 hours, such as 6 to 7 hours, for example 7 to 8 hours.
  • the mode of parenteral administration of a bioactive agent of the present invention is by transmucosal delivery.
  • Said transmucosal delivery is in one embodiment sublingual delivery, in another embodiment said transmucosal delivery is buccal delivery, and in yet another embodiment said transmucosal delivery is insufflation or intranasal delivery.
  • Dosage forms include tablets, troches, dispersions, suspensions, solutions, capsules, creams, ointments, emulsions, gels, lotions, pastes, aerosols, or other forms known in the art.
  • the effective dosage of active ingredient employed may vary depending on the particular composition employed, the mode of administration, the condition being treated and the severity of the condition being treated. Such dosage may be ascertained readily by a person skilled in the art.
  • the bioactive agent of the present invention is administered at a daily dosage of from about 1 microgram to about 100 milligram per kilogram of animal body weight, given as a single daily dose or in divided doses, or in sustained release form.
  • the dosage regimen may be adjusted within this range or even outside of this range to provide the optimal therapeutic response.
  • the bioactive agent of the present invention is administered at a dosage of from about 1 ⁇ g to about 10 ⁇ g per kg body weight, such as from about 10 ⁇ g to about 50 ⁇ g per kg body weight, for example from about 50 ⁇ g to about 100 ⁇ g per kg body weight, such as from about 100 ⁇ g to about 250 ⁇ g per kg body weight, for example from about 250 ⁇ g to about 500 ⁇ g per kg body weight, such as from about 500 ⁇ g to about 750 ⁇ g per kg body weight, for example from about 750 ⁇ g to about 1000 ⁇ g per kg body weight, such as from about 1 mg to about 10 mg per kg body weight, for example from about 10 mg to about 50 mg per kg body weight, such as from about 50 mg to about 100 mg per kg body weight.
  • Said dosage may be administered in certain time intervals, and may be expressed as mg per kg body weight per time unit.
  • Said time unit may in one embodiment be per minute, such as per hour, for example per day, such as per week.
  • bioactive agent capable of increasing the intracellular concentration and/or activity of Hsp70 for use in treatment of a disease selected from the group consisting of glycogen storage diseases,
  • Wolman's disease Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II in combination with other treatment modalities.
  • the present invention in one aspect relates to a method of treatment of a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II comprising administration of the bioactive agent according to any the present invention in combination with at least one other treatment modality.
  • a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of
  • the bioactive agent according to the present invention is administered to an individual in need thereof in combination with at least one other treatment modality, such as conventional or known treatment modalities for the disease in question.
  • bioactive agent according to the present invention may be Hsp70 or a functional fragment or variant thereof, or an Hsp70 inducer or co-inducer.
  • Administering more than one treatment modality in combination may occur either simultaneously, or sequentially.
  • Simultaneous administration may be two compounds comprised in the same composition or comprised in separate compositions, or may be one composition and one other treatment modality performed essentially at the same time.
  • Sequential administration means that the more than one treatment modalities are administered at different time points, such as administering one treatment modality first, and administering the second treatment modality subsequently.
  • the time frame for administering more than one treatment modality sequentially may be determined by a skilled person in the art for achieving the optimal effect, and may in one embodiment be between 30 minutes to 72 hours.
  • the treatment modalities in the form of chemical compounds may be administered together or separately, each at its most effective dosage.
  • the bioactive agent according to the present invention is administered to an individual in need thereof in combination with one or more of enzyme replacement therapy (ERT), pain relievers, corticosteroids, a transplantation such as bone marrow transplantation, cord blood transplantation or stem cell transplantation, substrate reduction therapy and/or symptomatic and supportive therapy such as physical therapy.
  • ERT enzyme replacement therapy
  • pain relievers corticosteroids
  • corticosteroids a transplantation such as bone marrow transplantation, cord blood transplantation or stem cell transplantation
  • substrate reduction therapy and/or symptomatic and supportive therapy such as physical therapy.
  • Hsp70 increases the endocytic uptake of other molecules (figure 4). This increased uptake may occur independently on Hsp70 due to a passive mechanism which allows a compound to be more readily taken up by the cell in the presence of Hsp70, or it may be occur dependently on Hsp70 due to a direct association with Hsp70.
  • Hsp70 to increase the cellular uptake of compounds is an advantage in that it allows for Hsp70, or a functional fragment or variant thereof, administered to cells to be readily taken up by the cell.
  • Hsp70 to increase the cellular uptake of compounds is an advantage in combination treatment regimens, as the presence of Hsp70 may incresase the uptake of both Hsp70 and the compound given in combination with Hsp70.
  • one compound is an enzyme for ERT, and the other is Hsp70, or a functional fragment or variant thereof, this may help effectively reduce the amount of enzyme for ERT needed to achieve an effective intracellular dosis. This is relevant as ERT is very expensive.
  • the bioactive agent according to the present invention comprises a combination of Hsp70, or a functional fragment or variant thereof, and an Hsp70 inducer or co-inducer
  • the presence of Hsp70 may therefore increase the uptake of said Hsp70 inducer or co-inducer.
  • the present invention relates in one aspect to a method for treating an individual in need thereof.
  • gangliosidoses neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II, comprising administration of the bioactive agent according to the present invention to an individual in need thereof.
  • said treatment may be prophylactic, curative or ameliorating.
  • said treatment is prophylactic.
  • said treatment is curative.
  • said treatment is ameliorating.
  • the bioactive agent used according to the present invention may in one embodiment be formulated as a pharmaceutical composition.
  • said treatment reduces the intracellular accumulation of substances in an individual in need thereof.
  • Said substance may be a substance which is normally degraded in the lysosomes.
  • said substance is a shingolipid.
  • the treatment according to the present invention reduces the intracellular accumulation of a lysosomally degradable substance to less than 100% of the accumulated amount, such than less than 90% of the accumulated amount, for example less than 80% of the accumulated amount, such than less than 70% of the accumulated amount, for example less than 60% of the accumulated amount, such than less than 50% of the accumulated amount, for example less than 40% of the accumulated amount, such than less than 30% of the accumulated amount, for example less than 20% of the accumulated amount, such than less than 10% of the accumulated amount, for example less than 5% of the accumulated amount.
  • a lysosomally degradable substance to less than 100% of the accumulated amount, such than less than 90% of the accumulated amount, for example less than 80% of the accumulated amount, such than less than 70% of the accumulated amount, for example less than 60% of the accumulated amount, such than less than 50% of the accumulated amount, for example less than 40% of the accumulated amount, such than less than 30% of the accumulated amount, for example less than
  • the treatment according to the present invention reduces the intracellular accumulation of a lysosomally degradable substance by at least 5%, such as at least 10%, for example at least 15%, such as at least 20%, for example at least 25%, such as at least 30%, for example at least 35%, such as at least 40%, for example at least 45%, such as at least 50%, for example at least 55%, such as at least 60%, for example at least 65%, such as at least 70%, for example at least 75%, such as at least 80%, for example at least 85%, such as at least 90%, for example at least 95%, such as at least 100%.
  • at least 5% such as at least 10%, for example at least 15%, such as at least 20%, for example at least 25%, such as at least 30%, for example at least 35%, such as at least 40%, for example at least 45%, such as at least 50%, for example at least 55%, such as at least 60%, for example at least 65%, such as at least 70%, for example at least 75%, such as at least
  • the rate of reducing the intracellular concentration of a lysosomaly degradable substance may depend on factors such as administration form, dosage regimens and the like. In one embodiment, said treatment prolongs the life expectancy of said individual in need thereof.
  • the life expectancy may in one embodiment be increased by between 6 months to 1 year, such as from 1 year to 2 years, for example from 2 to 3 years, such as from 3 to 4 years, for example from 4 to 5 years, such as from 5 to 6 years, for example from 6 to 7 years, such as from 7 to 8 years, for example from 8 to 9 years, such as from 9 to 10 years, for example from 10 to 12 years, such as from 12 to 14 years, for example from 14 to 16 years, such as from 16 to 18 years, for example from 18 to 20 years, such as from 20 to 25 years, for example from 25 to 30 years, such as from 30 to 40 years, for example from 40 to 50 years, such as from 50 to 60 years, for example from 60 to 70 years, such as from 70 to 80 years, for example from 80 to 90 years, such as from 90 to 100 years.
  • 6 months to 1 year such as from 1 year to 2 years, for example from 2 to 3 years, such as from 3 to 4 years, for example from 4 to 5 years, such as from 5 to 6 years, for example from
  • life expectancy is increased by at least 6 months, such as at least 1 year, such as at least 2 years, for example 3 years, such as at least 4 years, for example 5 years, such as at least 6 years, for example 7 years, such as at least 8 years, for example 9 years, such as at least 10 years, for example 12 years, such as at least 14 years, for example 16 years, such as at least 18 years, for example 20 years, such as at least 25 years, for example 30 years, such as at least 40 years, for example 50 years, such as at least 60 years, for example 70 years, such as at least 80 years, for example 90 years, such as at least 100 years.
  • a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopoly
  • the present invention relates to a method for prolonging life expectancy in a patient with a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II, wherein said method comprises administration of the bioactive agent according to the present invention to an individual in need thereof, wherein said life expectancy is increased by between 6 months to 1 year, such as from 1 year to 2 years, for example from 2 to 3 years, such as from 3 to 4 years, for example from 4 to 5 years, such as from 5 to 6 years, for example from 6 to 7 years, such as from 7 to 8 years, for example from 8 to 9 years,
  • the present invention relates to a method for prolonging life expectancy in a patient with a disease selected from the group consisting of glycogen storage diseases, gangliosidoses, neuronal ceroid lipofuscinoses, cerebrotendinous cholesterosis, Wolman's disease, cholesteryl ester storage disease, disorders of glycosaminoglycan metabolism, mucopolysaccharidoses, disorders of glycoprotein metabolism, mucolipidoses, aspartylglucosaminuria, fucosidosis, mannosidoses, and sialidosis type II, wherein said method comprises administration of the bioactive agent according to the present invention to an individual in need thereof, wherein said life expectancy is increased by at least 6 months, such as at least 1 year, such as at least 2 years, for example 3 years, such as at least 4 years, for example 5 years, such as at least 6 years, for example 7 years, such as at least 8 years, for example 9 years, such as at least 10 years, for example 12 years,
  • Example 1 Interaction between Hsp70 and Bis(monoacylglycero)phosphate Activates Acid Sphingomyelinase, Stabilizes Lysosomal Membranes and Promotes Cell Survival.
  • Heat shock protein 70 is an evolutionarily highly conserved molecular chaperone that promotes the survival of stressed cells by inhibiting lysosomal membrane permeabilization, a hallmark of stress-induced cell death. Clues to its molecular mechanism of action may lay in the recently reported stress- and cancer- associated translocation of a small portion of Hsp70 to the lysosomal compartment.
  • Hsp70 stabilizes lysosomes by enhancing the activity of acid sphingomyelinase (ASM), a lysosomal lipase that hydrolyzes sphingomyelin to ceramide and phosphorylcholine.
  • ASM acid sphingomyelinase
  • Hsp70 binds with high affinity and specificity to an endo-lysosomal anionic phospholipid
  • BMP bis(monoacylglycero)phosphate
  • the reduced ASM activity in cells from patients with Niemann-Pick disease A a severe lysosomal storage disorder caused by mutations in the ASM gene
  • NPDA Niemann-Pick disease A
  • this phenotype can be effectively corrected by restoring the lysosomal ASM activity by treatment with recombinant Hsp70 or ASM.
  • Lysosomal proteases are important effectors in evolutionarily conserved cell death programs induced by a wide variety of stresses. Cathepsin-dependent cell death is characterized by an early lysosomal membrane permeabilization and subsequent translocation of cathepsins into the cytosol, where they can initiate caspase-dependent and -independent cell death pathways.
  • Hsp70 target recombinant Hsp70
  • RNA short interfering RNA
  • Hsp70 palmitoyl-oleoyl- phosphatidylcholine (POPC) large unilamellar vesicles (LUVs) containing various membrane-associated anionic lipids, i.e. palmitoyl-oleoyl-phosphatidylserine (POPS; primarily in plasma membrane), cardiolipin (primarily mitochondrial) and BMP (primarily in late endosomes/lysosomes).
  • POPC palmitoyl-oleoyl- phosphatidylcholine
  • LUVs large unilamellar vesicles containing various membrane-associated anionic lipids, i.e. palmitoyl-oleoyl-phosphatidylserine (POPS; primarily in plasma membrane), cardiolipin (primarily mitochondrial) and BMP (primarily in late endosomes/lysosomes).
  • the binding to BMP was almost 20 times stronger at the acidic pH as compared to the neutral pH, whereas the binding to POPS was only slightly increased upon acidification.
  • the high affinity binding of Hsp70 to BMP in acidic pH was confirmed in an independent set of BIAcore experiments.
  • BMP antibodies delivered to the endo-lysosomal compartment by endocytosis effectively inhibited the ability of rHsp70 to stabilize the lysosomes in living cells, and sensitized the cells to cisplatin, an anti-cancer drug that induces lysosomal leakage.
  • the W90F mutation specifically abolished the interaction between rHsp70 and BMP whilst retaining the structural (folding as analyzed by far- and near-UV circular dichroism) and functional (luciferace folding and ATP hydrolysis) aspects of the Hsp70 chaperone.
  • the rHsp70-W90F mutant provided us with an invaluable tool to further test whether the direct interaction between Hsp70 and BMP endows Hsp70 with its lysosome protective attributes.
  • mutant Hsp70 proteins were endocytosed essentially as effectively as the wild type Hsp70. Because the concentration of BMP increases in endocytic vesicles as the endosomes matures to form lysosomes, the pH-regulation might be the way by which Hsp70 is targeted to lysosomes.
  • BMP binds ASM with high affinity and stimulates its ability to hydrolyze sphingomyelin to ceramide and phosphorylcholine.
  • the BIAcore analysis revealed that pretreatment of the BMP-containing LUVs with rHsp70 at sub-equimolar concentrations facilitated the subsequent binding of ASM, whereas higher rHsp70 concentrations showed an inhibitory effect.
  • Hsp70 transgenic murine embryonic fibroblasts (Hsp70- MEFs), which are protected against stress-induced lysosomal damage, displayed significantly higher ASM activity than wild type MEFs (WT-MEFs), and the treatment of WT-MEFs with rHsp70 at a cytoprotective concentration (300 nM) increased the ASM activity to the level comparable to that in Hsp70-MEFs.
  • WT-MEFs wild type MEFs
  • rHsp70 rHsp70 at a cytoprotective concentration (300 nM) increased the ASM activity to the level comparable to that in Hsp70-MEFs.
  • desipramine a well characterized pharmacological ASM inhibitor.
  • Desipramine reduced the viability of MEFs in a dose-dependent manner and the cell death was associated with a massive permeabilization of lysosomes as demonstrated by the leakage of lysosomal cathepsins into the cytosol. Notably, desipramine-induced cell death and lysosomal leakage were significantly reduced in Hsp70-MEFs as compared to WT-MEFs.
  • rHsp70 was also capable of enhancing the enzymatic activity of the endogenous mutated ASM as well as the simultaneously loaded rASM in the patient cells.
  • sphingomyelin metabolism rather than direct physical stabilization of the membrane.
  • BMP is localized exclusively in the inner membranes of the endo-lysosomal compartment, where its major function is to support the disintegration and lipid extraction from lipid vesicles by ASM and sphingolipid activator proteins.
  • ASM-mediated increase in lysosomal ceramide concentration modifies the steric conformation of lysosomal membranes and thereby facilitates their fusion with other intracellular vesicles and plasma membrane.
  • the changes in the lysosomal membrane composition and volume as a result of the ceramide-induced enhanced fusion capacity may contribute to the Hsp70-mediated increase in lysosomal stability.
  • various apoptotic stimuli induce the translocation of ASM to the outer leaflet of plasma membrane, where ceramide can form lipid microdomains that function as sites for activation of membrane-associated signaling molecules involved in apoptotic signaling.
  • ceramide may have opposing effects on cell survival depending on whether it is produced inside the lysosome or on the plasma membrane.
  • WT- and Hsp70-MEFs were generated, immortalized and maintained as described in the art.
  • Human NPDA fibroblasts (83/24) originate from a skin biopsy of a 5 month old patient with hepatosplenomegaly.
  • Recombinant proteins were generated using the pET-16b vector system and Ni 2+ -affinity-purification (Novagen), and labeled with Alexa Fluor 488 according to manufacturers protocol (Molecular Probes).
  • Molecular Probes Molecular Probes
  • the photo-oxidation-induced loss of the lysosomal pH-gradient and leakage of acridine orange to the cytosol from individual lysosomes was quantified visually as "loss of red dots" in U2-0-S cells and as a decrease in red and an increase in green fluorescence by Zeiss LSM DUO Software in fibroblasts.
  • the total and cytoplasmic (digitonin- extracted) cathepsin activities were measured in digitonin-treated samples using zFR- AFC (Enzyme System Products) probe as described in the art.
  • HEPES buffer (20 mM HEPES, 0.1 mM EDTA, pH as indicated) essentially as described in the art.
  • Surface plasmon resonance measurements were performed with immobilized LUVs using a BIAcore 2000 system as described in the art.
  • Hsp70 siRNA (5'- GCCAUGACGAAAGACAACAAUCUGU -3') and a control Hsp70 siRNA were transfected with Oligofectamine (Invitrogen). Immunodetection was performed with standard protocols. Apoptosis-like cell death and lysosomal membrane
  • permeabilization were analyzed essentially as described in the art.
  • ASM activity was analyzed by Amplex Red Sphingomyelinase Assay Kit (A12220) from Molecular Probes with modifications described in the art.
  • Statistical analysis was performed using a two-tailed, paired Student's T-test and all groups of data were tested for the comparability of their variances using an F-test.
  • Human U-2-OS osteosarcoma cells were cultivated in RPMI 1640 (Invitrogen) supplemented with 6% heat-inactivated calf serum and penicillin- streptomycin. Hsp70 transgenic and appropriate control MEFs were generated and maintained as described in the art. Human primary NPDA fibroblasts where grown in MEF media further supplemented with 1 % Na-Pyruvate, 1 % HEPES, 1 % L-Glutamine. All cells were grown at 37 °C in a humidified air atmosphere with 5% C0 2 and repeatedly tested and found negative for mycoplasma. Unless otherwise stated, all chemicals were purchased from Sigma-Aldrich (Sigma-Aldrich Denmark A/S).
  • Loss of lysosomal pH gradient was quantified by counting the loss of intense red staining.
  • a more elaborate method for assaying lysosomal integrity was developed to handle the larger lysosomal compartment of the various fibroblasts used in this study.
  • Cells for single cell imaging were selected from 8 pre-defined areas of each well in transmitted light-mode after which the same cells were immediately and continuously exposed to 489 nm light from a 100 mW diode laser while laser scanning micrographs where captured every 330 ms on a Zeiss LSM LIVE DUO confocal system in two channels defined by bandpass filters for 495-555 nm (green) and LP650 nm (Red) light.
  • the resulting timelapse movies where subsequently analysed by the integrated Zeiss LSM DUO software.
  • the total and cytoplasmic (digitonin-extracted) cathepsin activities were measured in digitonin-treated samples using zFR-AFC (Enzyme System Products) probe as described in the art.
  • Lysotracker Red® was used for live visualization of the lysosomal compartment. Fluorescence images were taken using a Zeiss Axiovert 100M laser scanning microscope. Lysotracker quantification and timelapse movies for lysosomal integrity were done on a Zeiss LSM LIVE DUO system. Tryptophan fluorescence spectra and liposome 90° light scattering.
  • the tryptophan fluorescence spectra (RFI) and liposome 90° light scattering (RSI) were analyzed in a HEPES buffer (20 mM HEPES, 0.1 mM EDTA, pH 7.4 or 6.0 as indicated) employing LUVs consisting of indicated lipids essentially as described in the art.
  • RFI tryptophan fluorescence spectra
  • RSI liposome 90° light scattering
  • lipid mixture consisting of 10mol% sphingomyelin, 50mol% phosphatidylcholine, 20mol% cholesterol and 20mol% BMP dissolved in organic solvents, was dried under a stream of argon and rehydrated in Tris/HCI buffer (pH 7.4). The mixture was freeze-thawed nine times in liquid nitrogen and then in an incubator at 37°C. After ultrasound bath for 15 min the mixture was passed 21 times through a polycarbonate membrane with a pore diameter of 100 nm. Surface plasmon resonance measurements were performed using a BIAcore 2000 system at 25 °C. LUVs (total lipid concentration 0.1 mM) were
  • a L1 sensor chip (BIAcore) in PBS (loading buffer).
  • the running buffer used was sodium acetate buffer (50 mM, pH 4.5).
  • acid sphingomyelinase (0.2 ⁇ , 60 ⁇ in running buffer) was injected directly on the liposome surface. Response units between 4100 RU - 5250RU were obtained.
  • the protein of interest was injected in running buffer at a flow rate of 20 ⁇ /min at the concentrations indicated. After injection a dissociation phase of 10 min was appended. In the case where rASM followed rHsp70, rASM was added for 180 sec after the 10 min rHsp70-dissociation phase followed by yet a 10 min dissociation phase.
  • mice Eight treated (rHSP70) NPC _/" versus eight control (PBS only) NPC _/" controls. Mice were treated IP three times per week with either 10mg/kg of rHSP70 or vehicle alone (PBS) from 3 weeks of age. Three control and three treated mice were sacrificed at 7 or 9 weeks old (i.e. after 4 or 6 weeks of treatment, respectively). Organs were perfused (PBS), weighed and frozen for biochemical and immunohistochemical analysis.
  • mice Rearing analysis was performed only at 9 and 10 weeks of age. Briefly, animals are allowed to acclimatise in an open field box. After 5', counts are made of the activity of the mice including the number of times the animal rears in the centre of the box without support, or at the edges of the box using the walls for support.
  • Perfused brains were embedded in OCT and snap frozen in isopentane on dry-ice. Brains were sectioned onto gelatine coated slides and stored at -80C prior to antibody staining.
  • Control animals (upper panel) appear to have shallower growth curves than the treated animals, which rise more steadily and reach higher weights.
  • mice appeared to have deteriorated quite badly within the space of a few days.
  • the cause may be inadvertently due to the rapid weight loss, as the drug doses made up a few days prior were effectively becoming overdoses as the mice got smaller, potentially amplifying any toxic effects.
  • HSP70 treated mice showed increased tremor from 3 weeks of treatment and remained increased until endstage. This tremor was particularly pronounced in the lowest frequency range and was clearly visible to the naked eye.
  • Gait analysis showed no difference in any of the three variables measured (front:hind paw placement, stride length or gait width)
  • liver shows a significant reduction of GSLs in mice treated with HSP70 (p ⁇ 0.05, * )(Fig. 15A). There are also reductions in spleen and brain, but are not statistically significant (probably due to the low n-number).
  • HSP70 treatment results in a reduction of peripheral storage of cholesterol compared to control mice at 7 weeks, though the brain is still under contention, as only one of the three repeats showed a reduction.
  • cholesterol levels are equal in the treated and control groups. This may be due to any one of several factors. Firstly, the mice may be developing antibodies against the protein, inhibiting its effects and causing the initial effect of the drug to wear off. Secondly, the high dose may be causing chronic toxic effects, impacting on cholesterol metabolism and the overall health of the mice.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Theoretical Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Physics & Mathematics (AREA)
  • Physics & Mathematics (AREA)
  • Computer Hardware Design (AREA)
  • Zoology (AREA)
  • Microelectronics & Electronic Packaging (AREA)
  • Obesity (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/DK2011/050444 2010-11-30 2011-11-22 Methods for increasing intracellular activity of hsp70 Ceased WO2012072082A1 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
EP19193723.4A EP3626255A1 (en) 2010-11-30 2011-11-22 Methods for increasing intracellular activity of hsp70
AU2011335545A AU2011335545A1 (en) 2010-11-30 2011-11-22 Methods for increasing intracellular activity of Hsp70
ES11844130T ES2753169T3 (es) 2010-11-30 2011-11-22 Procedimientos para aumentar la actividad intracelular de Hsp70
PL11844130T PL2646044T3 (pl) 2010-11-30 2011-11-22 Sposoby zwiększenia aktywności wewnątrzkomórkowej Hsp70
US13/885,553 US9662375B2 (en) 2010-11-30 2011-11-22 Methods for increasing intracellular activity of Hsp70
RU2013125923/10A RU2013125923A (ru) 2010-11-30 2011-11-22 СПОСОБЫ УВЕЛИЧЕНИЯ ВНУТРИКЛЕТОЧНОЙ АКТИВНОСТИ Hsp70
EP11844130.2A EP2646044B1 (en) 2010-11-30 2011-11-22 Methods for increasing intracellular activity of hsp70
JP2013541210A JP2013544263A (ja) 2010-11-30 2011-11-22 Hsp70の細胞内活性を上昇させる方法
BR112013013143A BR112013013143A2 (pt) 2010-11-30 2011-11-22 composto, e, método de tratamento de uma doença de armazenagem lisossômica
CN2011800575624A CN103338784A (zh) 2010-11-30 2011-11-22 用于增加Hsp70细胞内活性的方法
CA2817773A CA2817773A1 (en) 2010-11-30 2011-11-22 Methods for increasing intracellular activity of hsp70
DK11844130T DK2646044T3 (da) 2010-11-30 2011-11-22 Metoder til at øge den intracellulære aktivitet af Hsp70
IL225941A IL225941A0 (en) 2010-11-30 2013-04-25 Methods to increase the intracellular activity of @@@hsp
US15/600,407 US10532085B2 (en) 2010-11-30 2017-05-19 Methods for increasing intracellular activity of Hsp70
US16/698,473 US20200188492A1 (en) 2010-11-30 2019-11-27 Methods for increasing intracellular activity of hsp70
US17/855,002 US20220374361A1 (en) 2010-11-30 2022-06-30 Methods for increasing intracellular activity of hsp70

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DKPA201070520 2010-11-30
DKPA201070520 2010-11-30

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/885,553 A-371-Of-International US9662375B2 (en) 2010-11-30 2011-11-22 Methods for increasing intracellular activity of Hsp70
US15/600,407 Continuation US10532085B2 (en) 2010-11-30 2017-05-19 Methods for increasing intracellular activity of Hsp70

Publications (1)

Publication Number Publication Date
WO2012072082A1 true WO2012072082A1 (en) 2012-06-07

Family

ID=46171210

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2011/050444 Ceased WO2012072082A1 (en) 2010-11-30 2011-11-22 Methods for increasing intracellular activity of hsp70

Country Status (15)

Country Link
US (4) US9662375B2 (https=)
EP (2) EP3626255A1 (https=)
JP (1) JP2013544263A (https=)
CN (1) CN103338784A (https=)
AU (1) AU2011335545A1 (https=)
BR (1) BR112013013143A2 (https=)
CA (1) CA2817773A1 (https=)
DK (1) DK2646044T3 (https=)
ES (1) ES2753169T3 (https=)
HU (1) HUE046235T2 (https=)
IL (1) IL225941A0 (https=)
PL (1) PL2646044T3 (https=)
PT (1) PT2646044T (https=)
RU (1) RU2013125923A (https=)
WO (1) WO2012072082A1 (https=)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104768551A (zh) * 2012-07-31 2015-07-08 天主教大学产学协力团 将瑞巴派特作为有效成分而包含的高脂血症及与之相关的疾病的预防或治疗用组合物
US20160038521A1 (en) * 2013-03-15 2016-02-11 University Of Iowa Research Foundation Therapeutic methods
WO2017178029A1 (en) * 2016-04-13 2017-10-19 Orphazyme Aps Heat shock proteins and cholesterol homeostasis
US10532085B2 (en) 2010-11-30 2020-01-14 Orphazyme A/S Methods for increasing intracellular activity of Hsp70
CN110974833A (zh) * 2019-12-02 2020-04-10 吉林省博大伟业制药有限公司 一种单独应用聚普瑞锌治疗萎缩性胃炎药物的医药用途
US10709700B2 (en) 2014-09-15 2020-07-14 Orphazyme A/S Arimoclomol formulation
US11045460B2 (en) 2008-06-26 2021-06-29 Orphazyme A/S Use of Hsp70 as a regulator of enzymatic activity
US11253505B2 (en) 2016-04-29 2022-02-22 Orphazyme A/S Arimoclomol for treating glucocerebrosidase associated disorders
US11707456B2 (en) 2020-11-19 2023-07-25 Kempharm Denmark A/S Processes for preparing arimoclomol citrate and intermediates thereof

Families Citing this family (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10967298B2 (en) 2012-03-15 2021-04-06 Flodesign Sonics, Inc. Driver and control for variable impedence load
US9752113B2 (en) 2012-03-15 2017-09-05 Flodesign Sonics, Inc. Acoustic perfusion devices
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
US10322949B2 (en) 2012-03-15 2019-06-18 Flodesign Sonics, Inc. Transducer and reflector configurations for an acoustophoretic device
US10689609B2 (en) 2012-03-15 2020-06-23 Flodesign Sonics, Inc. Acoustic bioreactor processes
US9458450B2 (en) 2012-03-15 2016-10-04 Flodesign Sonics, Inc. Acoustophoretic separation technology using multi-dimensional standing waves
US9950282B2 (en) 2012-03-15 2018-04-24 Flodesign Sonics, Inc. Electronic configuration and control for acoustic standing wave generation
US9745548B2 (en) 2012-03-15 2017-08-29 Flodesign Sonics, Inc. Acoustic perfusion devices
US10737953B2 (en) 2012-04-20 2020-08-11 Flodesign Sonics, Inc. Acoustophoretic method for use in bioreactors
US9745569B2 (en) 2013-09-13 2017-08-29 Flodesign Sonics, Inc. System for generating high concentration factors for low cell density suspensions
WO2015105955A1 (en) 2014-01-08 2015-07-16 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
US10357542B2 (en) 2014-02-04 2019-07-23 New York University Progranulin (PGRN) and its derivatives for diagnosis and treatment of lysosomal storage diseases
US9744483B2 (en) 2014-07-02 2017-08-29 Flodesign Sonics, Inc. Large scale acoustic separation device
US11021699B2 (en) 2015-04-29 2021-06-01 FioDesign Sonics, Inc. Separation using angled acoustic waves
US11377651B2 (en) 2016-10-19 2022-07-05 Flodesign Sonics, Inc. Cell therapy processes utilizing acoustophoresis
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes
US11459540B2 (en) 2015-07-28 2022-10-04 Flodesign Sonics, Inc. Expanded bed affinity selection
US11474085B2 (en) 2015-07-28 2022-10-18 Flodesign Sonics, Inc. Expanded bed affinity selection
WO2017024137A1 (en) * 2015-08-04 2017-02-09 New York University Progranulin (pgrn) fragments and derivatives for treatment or alleviation of lysosomal storage diseases
US11085035B2 (en) 2016-05-03 2021-08-10 Flodesign Sonics, Inc. Therapeutic cell washing, concentration, and separation utilizing acoustophoresis
US11214789B2 (en) 2016-05-03 2022-01-04 Flodesign Sonics, Inc. Concentration and washing of particles with acoustics
WO2018075830A1 (en) 2016-10-19 2018-04-26 Flodesign Sonics, Inc. Affinity cell extraction by acoustics
CN107022553A (zh) * 2017-06-08 2017-08-08 扬州大学 芍药hsp70基因及其植物表达载体和应用
KR102439221B1 (ko) 2017-12-14 2022-09-01 프로디자인 소닉스, 인크. 음향 트랜스듀서 구동기 및 제어기
EP3784695B1 (en) * 2018-04-27 2023-08-09 The Medical College of Wisconsin, Inc. Use of lentivector-transduced t-rapa cells for amelioration of lysosomal storage disorders
BR112020021962A2 (pt) * 2018-04-30 2021-01-26 Amicus Therapeutics, Inc. construtos para terapia gênica e métodos de uso
KR20210015790A (ko) * 2018-05-28 2021-02-10 오르파짐 에이/에스 질환의 바이오마커로서 pbmc 샘플에서 hsp70 단백질 수준
US20220087962A1 (en) * 2019-01-30 2022-03-24 Arizona Board Of Regents On Behalf Of The University Of Arizona Compositions and methods for treating age-related diseases or conditions
WO2021055801A1 (en) 2019-09-18 2021-03-25 The Medical College Of Wisconsin, Inc. Improved alpha-galactosidase protein for enzyme replacement therapy (ert) and methods of use
US12600705B2 (en) 2020-02-14 2026-04-14 University Of Pittsburgh-Of The Commonwealth System Of Higher Education Heat shock protein modulators and anti-Huntington disease therapeutic agents
EP4125946A4 (en) * 2020-03-27 2024-04-24 Board of Regents, The University of Texas System MONOCLONAL ANTIBODIES TARGETING HSP70 AND THEIR THERAPEUTIC USES
WO2022136640A1 (en) * 2020-12-24 2022-06-30 Orphazyme A/S Arimoclomol for the treatment of niemann pick disease, type c, in patients with er type missense mutations
CN116549431A (zh) * 2023-03-27 2023-08-08 上海市第十人民医院 花生四烯酸在制备防治电离辐射损伤药物中的应用
CN116688129A (zh) * 2023-05-24 2023-09-05 中山大学附属第一医院 靶向苯丙酮酸促进糖尿病伤口愈合以及抑制过度nlrp3炎症小体的激活

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003086452A2 (en) * 2002-04-05 2003-10-23 Genzyme Corporation Methods of enhancing lysosomal storage disease therapy
US20030236300A1 (en) * 1999-10-27 2003-12-25 Yale University Conductance of improperly folded proteins through the secretory pathway and related methods for treating disease
US20050153906A1 (en) * 2001-02-20 2005-07-14 Bedwell David M. Aminoglycoside treatment for lysosomal storage diseases
WO2008112525A2 (en) * 2007-03-09 2008-09-18 Link Medicine Corporation Treatment of lysosomal storage diseases
WO2009137796A2 (en) * 2008-05-08 2009-11-12 Northwestern University Method of regulating the heat shock response
WO2009155936A1 (en) * 2008-06-26 2009-12-30 Orphazyme Aps Use of hsp70 as a regulator of enzymatic activity
WO2010053655A2 (en) * 2008-11-07 2010-05-14 University Of Kansas Therapeutic methods with withaferin a and analogs

Family Cites Families (114)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5348945A (en) 1990-04-06 1994-09-20 Wake Forest University Method of treatment with hsp70
ES2171454T3 (es) 1993-06-04 2002-09-16 Whitehead Biomedical Inst Proteinas de estres y sus usos.
WO1995025744A1 (en) 1994-03-21 1995-09-28 Rijksuniversiteit Utrecht Peptide fragments of microbial stress proteins and pharmaceutical composition made thereof for the treatment and prevention of inflammatory diseases
US5985270A (en) 1995-09-13 1999-11-16 Fordham University Adoptive immunotherapy using macrophages sensitized with heat shock protein-epitope complexes
US5837251A (en) 1995-09-13 1998-11-17 Fordham University Compositions and methods using complexes of heat shock proteins and antigenic molecules for the treatment and prevention of neoplastic diseases
US5935576A (en) 1995-09-13 1999-08-10 Fordham University Compositions and methods for the treatment and prevention of neoplastic diseases using heat shock proteins complexed with exogenous antigens
HU222994B1 (hu) 1995-11-02 2004-01-28 BIOREX Kutató és Fejlesztő Rt. Hidroxilaminszármazékok és azok alkalmazása sejtek molekuláris chaperon-termelésének fokozására alkalmas gyógyszerkészítmények előállítására
US5962313A (en) 1996-01-18 1999-10-05 Avigen, Inc. Adeno-associated virus vectors comprising a gene encoding a lyosomal enzyme
EP0950061A4 (en) 1996-09-20 2000-04-12 Univ New Mexico Heat shock protein complexes
US7157089B1 (en) 1996-11-26 2007-01-02 Stressgen Biotechnologies Corporation Immune responses using compositions containing stress proteins
US6017540A (en) 1997-02-07 2000-01-25 Fordham University Prevention and treatment of primary and metastatic neoplastic diseases and infectious diseases with heat shock/stress protein-peptide complexes
US5830464A (en) 1997-02-07 1998-11-03 Fordham University Compositions and methods for the treatment and growth inhibition of cancer using heat shock/stress protein-peptide complexes in combination with adoptive immunotherapy
US6007821A (en) 1997-10-16 1999-12-28 Fordham University Method and compositions for the treatment of autoimmune disease using heat shock proteins
US5948646A (en) 1997-12-11 1999-09-07 Fordham University Methods for preparation of vaccines against cancer comprising heat shock protein-peptide complexes
BR9907228A (pt) 1998-01-23 2000-10-24 Nat Jewish Med & Res Center Uso de uma proteìna de choque térmico, processo para proteger um mamìfero de uma doença, formulação para proteger um mamìfero de desenvolver uma doença, uso de uma molécula de ácido nucleico, e processo para prescrever um tratamento para hiper-sensibilidade das vias aéreas ou limitação do fluxo de ar associado com uma doença envolvendo resposta inflamatória
WO1999042121A1 (en) 1998-02-20 1999-08-26 University Of Miami Modified heat shock protein-antigenic peptide complex
WO1999049881A2 (de) 1998-03-27 1999-10-07 Gabriele Multhoff Verwendung von hsp70 protein
FR2777890B1 (fr) 1998-04-22 2000-12-29 Roussy Inst Gustave Composes peptidiques d'hsp70 utiles dans l'immunotherapie du cancer
US6274597B1 (en) 1998-06-01 2001-08-14 Mount Sinai School Of Medicine Of New York University Method of enhancing lysosomal α-Galactosidase A
US6475490B1 (en) 1998-10-19 2002-11-05 Fordham University Compositions and methods for promoting tissue repair using heat shock proteins
HU226617B1 (en) 1998-12-14 2009-04-28 Cytrx Corp Optically active pyridyl-4h-1,2,4-oxadiazine derivatives, and pharmaceutical composition containing the compound as active ingredient
HUP9900475D0 (en) 1999-02-26 1999-04-28 Biorex Kutato Fejlesztoe Kft O-(3-piperidino-2-hydroxy-1-propyl)-hiyroximic acid-halogenid derivative, it's use for treating insulin resistance, and pharmaceutical compositions containing them as active component
CA2383213A1 (en) 1999-09-10 2001-03-15 Fordham University Methods and compositions for the treatment and prevention of graft rejection using heat shock proteins
US20020039583A1 (en) 1999-09-30 2002-04-04 Subjeck John R. Stress protein compositions and methods for prevention and treatment of cancer and infectious disease
WO2001034184A2 (en) 1999-11-05 2001-05-17 The Board Of Regents Of The University Of Nebraska Methods and compositions for protection against bovine herpesvirus 1
US6964851B2 (en) 1999-12-07 2005-11-15 Stressgen Biotechnologies Corp. Compositions and methods for detecting stress-inducible proteins
GB9930443D0 (en) 1999-12-22 2000-02-16 King S College London Novel use of heat shock proteins
US20020127219A1 (en) 1999-12-30 2002-09-12 Okkels Jens Sigurd Lysosomal enzymes and lysosomal enzyme activators
US20010034042A1 (en) 2000-01-20 2001-10-25 Srivastava Pramod K. Complexes of peptide-binding fragments of heat shock proteins and their use as immunotherapeutic agents
AU2001227960A1 (en) 2000-01-21 2001-07-31 University Of Connecticut Health Center Heat shock/stress protein complexes as vaccines against neurodegenerative disorders
WO2001052877A1 (en) 2000-01-21 2001-07-26 University Of Connecticut Health Center Compositions and methods to treat neurodegenerative disorders
HUP0001583A2 (hu) 2000-04-18 2002-11-28 BIOREX Kutató és Fejlesztő Rt. Egy piridin-1-oxid-származék és eljárás annak átalakítására gyógyászati hatású vegyületekké
AU2001269923A1 (en) 2000-06-19 2002-01-02 Genzyme Corporation Combination enzyme replacement, gene therapy and small molecule therapy for lysosomal storage diseases
AU2001277961A1 (en) 2000-08-07 2002-02-18 Antigenics, Llc Compositions comprising heat shock proteins or alpha(2)macroglobulin, antigenic molecules and saponins, and methods of use thereof
ES2326114T3 (es) 2000-09-13 2009-10-01 Multimmune Gmbh Un peptido de hsp70 estimulador de la actividad de las celulas asesinas naturales (nk) y los usos del mismo.
CA2422867A1 (en) 2000-09-15 2002-04-25 University Of Connecticut Health Center Improved formulations using heat shock/stress protein-peptide complexes
US20020172682A1 (en) 2000-10-20 2002-11-21 University Of Connecticut Health Center Using heat shock proteins to increase immune response
IT1319277B1 (it) 2000-10-24 2003-09-26 Chiesi Farma Spa Proteine di fusione utili per il trattamento di immunizzazione dellamalattia di alzheimer.
AU2002239462A1 (en) 2000-11-03 2002-06-03 The Board Of Regents Of The University Of Nebraska Compositions for protection against bovine viral diseases
EP1209226A3 (en) 2000-11-07 2002-06-05 GSF-Forschungszentrum für Umwelt und Gesundheit GmbH Maturation of dendritic cells by recombinant heat shock protein 70 (hsp70)
US20020142299A1 (en) 2001-01-09 2002-10-03 Davidson Beverly L. PTD-modified proteins
CN1635896A (zh) 2001-08-20 2005-07-06 康涅狄格大学健康中心 包含用于治疗癌症及感染性疾病的热休克蛋白或α2-巨球蛋白的组合物制备方法
JP2005512517A (ja) 2001-09-27 2005-05-12 イ・デ・エム・イミュノ−デジネ・モレキュル 誘導性Hsp70由来のポリペプチドとこのポリペプチドを含有する医薬組成物
HU0103939D0 (en) 2001-09-27 2001-11-28 Biorex Kutato Fejlesztoe Kft Pharmaceutical composition containing methformin and n-[2-hydroxy-3-(1-piperidinyl)-propoxy]-pyridine-1-oxide-3-carboximidoyl chloride
GB0123756D0 (en) 2001-10-03 2001-11-21 King S College London A novel chaperone-type of adjuvant for vaccination - Basic 1
US7125843B2 (en) 2001-10-19 2006-10-24 Neose Technologies, Inc. Glycoconjugates including more than one peptide
ITMI20012573A1 (it) 2001-12-06 2003-06-06 D B P Dev Biotechonologica L P Gli acilsalicilati:una nuova classe di induttori di risposta heat shock
JP2005514418A (ja) 2002-01-11 2005-05-19 ビオレックス クタトー エス フェイレストェー アールテー. カルボキサミジン誘導体及び血管疾患の治療におけるそれらの使用
WO2003061684A2 (en) 2002-01-24 2003-07-31 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Tumour treatment compositions comprising hsp70 and tumour necrosis factor
US20030216315A1 (en) 2002-02-13 2003-11-20 Duke University Modulation of immune response by non-peptide binding stress response polypeptides
IL148401A0 (en) 2002-02-26 2002-09-12 Hadasit Med Res Service Hsp70-derived peptides and uses thereof in the diagnosis and treatment of autoimmune diseases
US6984389B2 (en) 2002-04-25 2006-01-10 University Of Connecticut Health Center Using heat shock proteins to improve the therapeutic benefit of a non-vaccine treatment modality
WO2003090686A2 (en) 2002-04-25 2003-11-06 University Of Connecticut Health Center Using heat shock proteins to improve the therapeutic benefit of a non-vaccine treatment modality
JP2005533015A (ja) 2002-05-02 2005-11-04 ユニバーシティー オブ コネティカット ヘルス センター 抗体療法の有効性を増強するための熱ショックタンパク質の使用
AU2003301296A1 (en) 2002-05-02 2004-05-04 University Of Connecticut Health Center Using heat shock proteins and alpha-2-macroglobulins to increase immune response to vaccines
US20070010434A1 (en) 2002-09-16 2007-01-11 Genetech, Inc. Novel compositions and methods for the treatment of immune related diseases
US8436136B2 (en) 2003-05-21 2013-05-07 Biotech Tools S.A. Peptide complex
US7244616B2 (en) 2003-06-27 2007-07-17 Bayer Pharmaceuticals Corporation Use of molecular chaperones for the enhanced production of secreted, recombinant proteins in mammalian cells
HUP0303584A3 (en) 2003-10-30 2009-12-28 Cytrx Corp Use of a hydroximic acid halide derivative in the treatment of neurodegenerative diseases
DE60335549D1 (de) 2003-11-12 2011-02-10 Alfa Biogene Internat B V Gewinnung von Hitzeschockproteinen
CN101214249A (zh) 2003-11-25 2008-07-09 纽约大学西奈山医学院 尼曼-皮克病的基于陪伴分子的治疗
US7700737B2 (en) 2003-12-05 2010-04-20 Multimmune Gmbh Therapeutic and diagnostic anti-Hsp70 antibodies
US20060009520A1 (en) 2004-05-12 2006-01-12 Tall Alan R Retinoid-based methods for altering macrophage cholesterol
WO2005120558A2 (en) 2004-05-25 2005-12-22 University Of Connecticut Health Center Methods for making compositions comprising heat shock proteins or alpha-2-macroglobulin for the treatment of cancer and infectious disease
US7270305B2 (en) 2004-06-15 2007-09-18 The Boeing Company Aircraft leading edge apparatuses and corresponding methods
CA2590061A1 (en) 2004-12-10 2006-06-15 Zernike Business Support B.V. Hsp and supraventricular arrhythmia
AU2006254796B2 (en) 2005-06-08 2012-08-16 Amicus Therapeutics, Inc. Treatment of CNS disorders associated with mutations in genes encoding lysosomal enzymes
WO2007041285A2 (en) 2005-09-29 2007-04-12 Viral Genetics, Inc. Complexes of inactivated pepsin fraction and heat shock protein
EP1945632B1 (en) 2005-11-08 2013-09-18 Vertex Pharmaceuticals Incorporated Heterocyclic modulators of atp-binding cassette transporters
US20080039400A1 (en) 2006-01-24 2008-02-14 Universiteit Utrecht Uu Holding B.V. Treatment and prevention of inflammatory bowel diseases
CA2640454A1 (en) 2006-01-26 2007-08-09 Foldrx Pharmaceuticals, Inc. Compounds and methods for modulating protein trafficking
KR20090019790A (ko) 2006-05-19 2009-02-25 더 스크립스 리서치 인스티튜트 단백질 미스폴딩의 치료
WO2007150064A2 (en) 2006-06-23 2007-12-27 Amicus Therapeutics, Inc. METHOD FOR THE TREATMENT OF NEUROLOGICAL DISORDERS BY ENHANCING THE ACTIVITY OF β-GLUCOCEREBROSIDASE
WO2008005937A2 (en) 2006-06-30 2008-01-10 Sloan-Kettering Institute For Cancer Research Treatment of neurodegenerative diseases through inhibiton of hsp90
US20080044390A1 (en) 2006-08-11 2008-02-21 Xiaowei Jin Methods and compositions for the treatment of neurodegenerative disorders
CN101511872A (zh) 2006-08-29 2009-08-19 为人技术株式会社 用于抑制凋亡的药物组合物及其递送方法
EP2132309A4 (en) 2007-02-23 2011-01-05 Univ Florida COMPOSITIONS AND METHODS OF TREATING GLYCOLOGICAL MEMORY DISEASES
GB0705626D0 (en) 2007-03-23 2007-05-02 Royal Veterinary College Method for enhancing sperm survival
WO2008127680A2 (en) 2007-04-11 2008-10-23 The Jackson Laboratory Diagnosis and treatment of diseases caused by misfolded proteins
JP5586453B2 (ja) 2007-04-13 2014-09-10 アミカス セラピューティックス インコーポレイテッド 特異的薬理シャペロンによるゴーシェ病の治療および代理マーカーを用いた治療の監視
KR20190028822A (ko) 2007-04-25 2019-03-19 사이토크로마 인코포레이티드 비타민 d 화합물과 밀랍성 담체를 포함하는 경구 조절성 방출 조성물
MX2009011473A (es) 2007-04-26 2010-01-18 Amicus Therapeutics Inc Regimenes de dosificacion para el tratamiento de enfermedades por almacenamiento lisosomal que utilizan chaperonas farmacologicas.
TW200901958A (en) 2007-05-04 2009-01-16 Cytrx Corp Diabetic wound healing
US7678764B2 (en) 2007-06-29 2010-03-16 Johnson & Johnson Regenerative Therapeutics, Llc Protein formulations for use at elevated temperatures
US8742068B2 (en) 2007-07-06 2014-06-03 Universiteit Utrecht Holding B.V. Treatment and prevention of inflammatory diseases and autoimmune diseases
US20090020360A1 (en) * 2007-07-18 2009-01-22 May Brian A Landing ladder
EP2195333A1 (en) 2007-09-12 2010-06-16 Anaphore, Inc. Hsp70-based treatment for autoimmune diseases
EP2252288A1 (en) 2007-11-21 2010-11-24 Summit Corporation Plc Treatment of protein folding disorders
CA2706727A1 (en) 2007-11-29 2009-06-11 Michael S. Mcgrath Compositions and methods for treating lysosomal disorders
US8354274B2 (en) * 2008-01-30 2013-01-15 Geron Corporation Synthetic surfaces for culturing cells in chemically defined media
WO2009095452A1 (en) 2008-01-31 2009-08-06 Crystax Pharmaceuticals, S.L. Crystal structure of the atpase domain of proteins of the hsp70 family
EP2271213A4 (en) 2008-02-01 2011-06-29 Scripps Research Inst METHOD FOR THE TREATMENT OF A GRADE SUFFERED BY PROTEIN HOMEOSTASIS
JP5627571B2 (ja) 2008-05-07 2014-11-19 バイオマリン ファーマシューティカル インコーポレイテッド リソソーム標的化ペプチドおよびその使用
GB0809360D0 (en) 2008-05-22 2008-07-02 Isis Innovation Calcium modulation
WO2010015816A2 (en) 2008-08-06 2010-02-11 Summit Corporation Plc Treatment of lysosomal storage disorders and other proteostatic diseases
WO2010022461A1 (en) 2008-08-29 2010-03-04 Children, Youth And Women's Health Service Sulphated sugars to increase activity of sulphatases en lysosomal storage disorders
JP2012504143A (ja) 2008-09-29 2012-02-16 バーテックス ファーマシューティカルズ インコーポレイテッド 3−(6−(1−(2,2−ジフルオロベンゾ[d][1,3]ジオキソール−5−イル)シクロプロパンカルボキサミド)−3−メチルピリジン−2−イル)安息香酸の用量単位
WO2010086418A1 (en) 2009-01-29 2010-08-05 Alfa Biogene International B.V. Functional food product comprising heat shock protein or a hydrolysate thereof
EP2218458A1 (en) 2009-02-13 2010-08-18 Fondazione Telethon Molecules able to modulate the expression of at least a gene involved in degradative pathways and uses thereof
US8932571B2 (en) 2009-03-10 2015-01-13 Alfa Biogene International B.V. Skin care product
GB0906159D0 (en) 2009-04-09 2009-05-20 Summit Corp Plc Drug combination for the treatment of proteostatic diseases
EP3679942A1 (en) 2009-06-17 2020-07-15 BioMarin Pharmaceutical Inc. Formulations for lysosomal enzymes
NZ713967A (en) 2009-07-28 2017-01-27 Shire Human Genetic Therapies Compositions and methods for treating gaucher disease
US20120156180A1 (en) 2009-08-10 2012-06-21 The Board Of Trustees Of The University Of Illinois Compositions and methods for the treatment of krabbe and other neurodegenerative diseases
US20110081428A1 (en) 2009-09-16 2011-04-07 The Buck Institute For Age Research Use of thioflavin-like compounds to increase life span and/or health span
US8609416B2 (en) 2009-12-18 2013-12-17 Ventria Bioscience Methods and compositions comprising heat shock proteins
RU2013125923A (ru) * 2010-11-30 2015-01-10 Орфазиме Апс СПОСОБЫ УВЕЛИЧЕНИЯ ВНУТРИКЛЕТОЧНОЙ АКТИВНОСТИ Hsp70
JP2015512913A (ja) 2012-03-28 2015-04-30 ザ ユナイテッド ステイツ オブ アメリカ, アズ リプレゼンテッド バイ ザ セクレタリー, デパートメント オブ ヘルス アンド ヒューマン サービシーズ グルコセレブロシダーゼ活性剤として有用なサリチル酸誘導体
AU2013337354A1 (en) 2012-11-05 2015-05-21 Genzyme Corporation Compositions and methods for treating proteinopathies
US10709700B2 (en) 2014-09-15 2020-07-14 Orphazyme A/S Arimoclomol formulation
KR20210059796A (ko) * 2016-04-29 2021-05-25 오르파짐 에이/에스 글루코세레브로시다제 연관 장애를 치료하기 위한 아리모클로몰
DK4171559T3 (da) * 2020-06-24 2025-12-15 Zevra Denmark As Arimoclomol til behandling af Gauchers sygdom
MX2021015819A (es) * 2020-12-24 2022-06-27 Kempharm Denmark As Uso de arimoclomol en el tratamiento de la enfermedad de niemann pick.
US12472749B2 (en) * 2021-02-12 2025-11-18 Hewlett-Packard Development Company, L.P. Appending data on a replaceable supply component

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030236300A1 (en) * 1999-10-27 2003-12-25 Yale University Conductance of improperly folded proteins through the secretory pathway and related methods for treating disease
US20050153906A1 (en) * 2001-02-20 2005-07-14 Bedwell David M. Aminoglycoside treatment for lysosomal storage diseases
WO2003086452A2 (en) * 2002-04-05 2003-10-23 Genzyme Corporation Methods of enhancing lysosomal storage disease therapy
WO2008112525A2 (en) * 2007-03-09 2008-09-18 Link Medicine Corporation Treatment of lysosomal storage diseases
WO2009137796A2 (en) * 2008-05-08 2009-11-12 Northwestern University Method of regulating the heat shock response
WO2009155936A1 (en) * 2008-06-26 2009-12-30 Orphazyme Aps Use of hsp70 as a regulator of enzymatic activity
WO2010053655A2 (en) * 2008-11-07 2010-05-14 University Of Kansas Therapeutic methods with withaferin a and analogs

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KEELING K. M. ET AL.: "Gentamicin-mediated suppression of Hurler syndrome stop mutations restores a low level of alpha- L-iduronidase activity and reduces lysosomal glycosaminoglycan accumulation", HUMAN MOLECULAR GENETICS, vol. 10, no. 3, 2001, pages 291 - 299, XP002363481 *
KIRKEGAARD T. ET AL.: "Hsp70 stabilizes lysosomes and reverts Niemann-Pick disease-associated lysosomal pathology", NATURE, vol. 463, no. 7280, 2010, pages 549 - 554, XP055117528 *
MEIKLE P. J. ET AL.: "Effect of lysosomal storage on bis(monoacylglycero)phosphate", BIOCHEM J., vol. 411, no. 1, 2008, pages 71 - 78, XP055060018 *
See also references of EP2646044A4 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11045460B2 (en) 2008-06-26 2021-06-29 Orphazyme A/S Use of Hsp70 as a regulator of enzymatic activity
US11938125B2 (en) 2008-06-26 2024-03-26 Zevra Denmark A/S Use of Hsp70 as a regulator of enzymatic activity
US11304941B2 (en) 2008-06-26 2022-04-19 Orphazyme A/S Use of HSP70 as a regulator of enzymatic activity
US10532085B2 (en) 2010-11-30 2020-01-14 Orphazyme A/S Methods for increasing intracellular activity of Hsp70
CN104768551A (zh) * 2012-07-31 2015-07-08 天主教大学产学协力团 将瑞巴派特作为有效成分而包含的高脂血症及与之相关的疾病的预防或治疗用组合物
US20160038521A1 (en) * 2013-03-15 2016-02-11 University Of Iowa Research Foundation Therapeutic methods
EP2996684A4 (en) * 2013-03-15 2016-11-30 Univ Iowa Res Found THERAPEUTIC PROCEDURES
US11229633B2 (en) 2014-09-15 2022-01-25 Orphazyme A/S Arimoclomol formulation
US10709700B2 (en) 2014-09-15 2020-07-14 Orphazyme A/S Arimoclomol formulation
US10898476B2 (en) 2016-04-13 2021-01-26 Orphazyme A/S Heat shock proteins and cholesterol homeostasis
WO2017178029A1 (en) * 2016-04-13 2017-10-19 Orphazyme Aps Heat shock proteins and cholesterol homeostasis
US11253505B2 (en) 2016-04-29 2022-02-22 Orphazyme A/S Arimoclomol for treating glucocerebrosidase associated disorders
CN110974833A (zh) * 2019-12-02 2020-04-10 吉林省博大伟业制药有限公司 一种单独应用聚普瑞锌治疗萎缩性胃炎药物的医药用途
US11707456B2 (en) 2020-11-19 2023-07-25 Kempharm Denmark A/S Processes for preparing arimoclomol citrate and intermediates thereof

Also Published As

Publication number Publication date
EP2646044B1 (en) 2019-08-28
US20200188492A1 (en) 2020-06-18
US9662375B2 (en) 2017-05-30
PT2646044T (pt) 2019-11-12
EP3626255A1 (en) 2020-03-25
EP2646044A4 (en) 2014-08-06
US20220374361A1 (en) 2022-11-24
DK2646044T3 (da) 2019-11-25
US20130230506A1 (en) 2013-09-05
CN103338784A (zh) 2013-10-02
PL2646044T3 (pl) 2020-03-31
CA2817773A1 (en) 2012-06-07
RU2013125923A (ru) 2015-01-10
EP2646044A1 (en) 2013-10-09
HUE046235T2 (hu) 2020-02-28
AU2011335545A1 (en) 2013-06-13
BR112013013143A2 (pt) 2016-08-23
US20170266263A1 (en) 2017-09-21
IL225941A0 (en) 2013-07-31
JP2013544263A (ja) 2013-12-12
ES2753169T3 (es) 2020-04-07
US10532085B2 (en) 2020-01-14

Similar Documents

Publication Publication Date Title
US20220374361A1 (en) Methods for increasing intracellular activity of hsp70
US12576076B2 (en) Use of HSP70 as a regulator of enzymatic activity
HK40101370A (en) Use of hsp70 as a regulator of enzymatic activity
AU2013202235B2 (en) Use of Hsp70 as a regulator of enzymatic activity
HK1175395B (en) Use of hsp70 as a regulator of enzymatic activity
HK1153678B (en) Use of hsp70 as a regulator of enzymatic activity

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11844130

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
ENP Entry into the national phase

Ref document number: 2817773

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 13885553

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2013541210

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2011335545

Country of ref document: AU

Date of ref document: 20111122

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2013125923

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112013013143

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112013013143

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20130527