WO2012036391A2 - 돼지 써코바이러스２(ｐｃｖ２) 유전자의 표면발현용 벡터 및 이로 형질전환된 살모넬라 백신 균주 - Google Patents

돼지 써코바이러스２(ｐｃｖ２) 유전자의 표면발현용 벡터 및 이로 형질전환된 살모넬라 백신 균주 Download PDF

Info

Publication number
WO2012036391A2
WO2012036391A2 PCT/KR2011/006359 KR2011006359W WO2012036391A2 WO 2012036391 A2 WO2012036391 A2 WO 2012036391A2 KR 2011006359 W KR2011006359 W KR 2011006359W WO 2012036391 A2 WO2012036391 A2 WO 2012036391A2
Authority
WO
WIPO (PCT)
Prior art keywords
salmonella
pcv2
recombinant
infection
gene
Prior art date
Application number
PCT/KR2011/006359
Other languages
English (en)
French (fr)
Other versions
WO2012036391A3 (ko
Inventor
양용진
문성철
장현
안교은
손원근
Original Assignee
주식회사 코미팜
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 코미팜 filed Critical 주식회사 코미팜
Publication of WO2012036391A2 publication Critical patent/WO2012036391A2/ko
Publication of WO2012036391A3 publication Critical patent/WO2012036391A3/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A61K2039/6068—Other bacterial proteins, e.g. OMP
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/035—Fusion polypeptide containing a localisation/targetting motif containing a signal for targeting to the external surface of a cell, e.g. to the outer membrane of Gram negative bacteria, GPI- anchored eukaryote proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/10011—Circoviridae
    • C12N2750/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/10011—Circoviridae
    • C12N2750/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the present invention relates to a recombinant vector for cell surface expression of porcine circovirus (PCV) gene using Salmonella-derived extracellular membrane protein and / or a non-pathogenic Salmonella vaccine strain transformed therefrom, and to a method for preventing disease caused by Salmonella infection or PCV2 infection. It relates to the use in the prevention and treatment.
  • PCV porcine circovirus
  • PCV2 Porcine CircoVirus type 2
  • PCV2 Porcine CircoVirus type 2
  • PMWS postweaning multi-systemic wasting syndrome
  • Salmonella infections can be important contaminants such as contaminated feed, water, or adult donors that carry germs without symptoms. That is, the carrier axis is caused by various stresses, etc., and is orally infected through the feces of the onset axis. The excretion of the fungus occurs for about three months after recovery from the disease. A few pigs, however, permanently carry and excrete the bacteria. The fungus survives long in manure and has been reported to survive up to 20 weeks in feces. So the contamination of the barn is important in the epidemiology of diseases caused by these serotypes.
  • Salmonella choleraesuis and Salmonella typhisuis are the main causative agents of acute sepsis caused by Salmonella, Salmonella typhimurium, Salmonella enteritidis and Salmonella derby are the main causes of chronic enteritis.
  • Salmonella infection prevention is an important infection prevention bacterium of HACCP which is carried out not only for the disease damage caused by the infection but also for meat safety.
  • the symptoms and damages caused by Salmonella infection have been reported, but there is no commercialized vaccine, and antibiotics are prescribed.
  • many cases of recurrence occur due to the characteristics of Salmonella, which is parasitic in cells.
  • the problem of the PCV2 inactivating vaccine is that the antibody is still weakly formed by the vaccine and is still infected with the virus in the pig body even after vaccination, thereby causing symptoms easily by immune stress or other infectious agents.
  • the development of effective vaccines against PCV2 is becoming increasingly important.
  • the present inventors have attempted to develop a vaccine that can prevent PCV2 virus infection disease as well as improve the problems of the existing Salmonella vaccine by using a cell surface display technology, which is one of the latest advanced molecular biological technologies.
  • the present invention was completed by developing a live vector of Salmonella, a non-pathogenic strain expressing the structural protein of PCV2 virus using Salmonella-derived extracellular membrane protein as a surface anchoring motif.
  • the present invention relates to a vaccine for the treatment or prevention of Salmonella or PCV2 infection,
  • the main object of the present invention is to provide a Salmonella strain vaccine transduced with pig circovirus 2 (PCV2) gene expression vector.
  • PCV2 pig circovirus 2
  • Another object of the present invention is to provide a recombinant expression vector containing a gene encoding the extracellular membrane protein A (OmpA) derived from Salmonella strain and a DNA sequence encoding a portion of the pig circovirus 2 (PCV2) gene.
  • OmpA extracellular membrane protein A
  • PCV2 pig circovirus 2
  • Still another object of the present invention is to provide a method for preventing or treating PCV2 infectious diseases in animals using the Salmonella strain vaccine.
  • the present invention provides a recombinant vector for cell surface expression containing a gene encoding an extracellular membrane protein derived from a Salmonella strain and a DNA sequence encoding a part of a pig circovirus 2 (PCV2) gene.
  • a recombinant vector for cell surface expression containing a gene encoding an extracellular membrane protein derived from a Salmonella strain and a DNA sequence encoding a part of a pig circovirus 2 (PCV2) gene.
  • PCV2 pig circovirus 2
  • the extracellular membrane protein functions as a surface anchoring motif, for example it may be selected from the group consisting of OmpA, OmpS, LamB, OprF, OmpC, PhoE and FadL, and most preferably OmpA can be used. have.
  • OmpA protein derived from the Salmonella strain can be used consisting of the nucleotide sequence represented by SEQ ID NO: 1.
  • the present invention is characterized by using the N-terminal TM (transmembrane) domain of the OmpA protein sequence as the surface expression parent and a representative sequence is described as SEQ ID NO: 2.
  • the DNA sequence encoding a portion of the pig circovirus 2 (PCV2) gene encodes a PCV open reading frame (ORF) selected from the group consisting of ORF1, ORF2, ORF3, ORF4, ORF5, ORF6, ORF7 and combinations thereof. It is preferable to use what is used, and more preferably, to encode PCV2 ORF2.
  • ORF PCV open reading frame
  • the base sequence of a representative PCV2 ORF2 is shown in SEQ ID NO: 3.
  • the recombinant vector for cell surface expression may have a cleavage map of FIG. 13.
  • E. coli it is preferable to use E. coli as the base vector.
  • the present invention also provides a recombinant Salmonella strain transformed with the recombinant vector for cell surface expression described above and use thereof as a vaccine.
  • the Salmonella strains include Salmonella typhimurium, Salmonella derby, Salmonella swarzengrond, Salmonella brendrup, Salmonella embandaka, Salmonella new uporter, Salmonella enteritidis, Salmonella gallinarum, Salmonella pullulum and the like. Preference is given to using Tipimurium, Salmonella blender or Salmonella enteritidis. Most preferably Salmonella typhimurium.
  • the pig circovirus 2 (PCV2) gene is expressed on the surface of the recombinant Salmonella strain.
  • PCV2 ORF2 protein is expressed on the cell surface.
  • the transformed recombinant Salmonella strain includes a strain deposited with accession number KCCM 11099P.
  • Such recombinant Salmonella strain can be used as a live vaccine for the treatment or prevention of diseases caused by Salmonella infection or PCV2 infection.
  • the present invention provides a recombinant fusion protein that is expressed by the recombinant Salmonella strain can induce a humoral immune response in mammals.
  • the present invention can provide a composition for the treatment or prophylaxis of a disease caused by Salmonella infection or PCV2 infection, characterized in that it contains the recombinant Salmonella strain or the recombinant fusion protein.
  • the vaccine composition preferably contains IPTG (Isopropyl- ⁇ -D-Thiogalactopyranoside).
  • the vaccine composition is preferably provided in the form of a feed additive for oral administration.
  • the present invention also provides a method for treating or preventing a disease caused by Salmonella infection or PCV2 infection, comprising administering an immunologically effective amount of the vaccine composition described above to an animal other than a human.
  • the Salmonella strain it is preferable to inoculate the Salmonella strain with a target animal, for example, a pig at 0.5 to 1.5 1 ⁇ 10 9 CFU / ml.
  • PCV2 infection is most representative of postweaning multi-systemic wasting syndrome (PMWS), and the disease caused by Salmonella infection is Salmonellosis.
  • PMWS postweaning multi-systemic wasting syndrome
  • the effect of the present invention is more effective in "young animals", for example, animals of 1 to 35 days of age are preferred, and fewer of them are more preferred.
  • a recombinant vector for cell surface expression and a Salmonella transformed therewith comprising a gene encoding an extracellular membrane protein derived from a Salmonella strain of the present invention and a DNA sequence encoding a part of a pig circovirus 2 (PCV2) gene.
  • the strain is a multivalent vaccine effective for preventing diseases caused by PCV2 virus as well as Salmonella. Since the vaccine can conveniently induce the production of recombinant protein by oral administration, it can more easily reduce the damage caused by the pig circovirus infection or Salmonella infection.
  • 1 is a cleavage map of a TA vector (pcr2.1, invitogen) used for TA cloning of the present invention.
  • FIG. 2 is a schematic diagram showing the TA cloning mechanism of the OmpA and PCV2 ORF2 genes.
  • FIG 3 is a cleavage map of the pGEX 4T-1 vector used as a base vector of the cell surface expression vector of the present invention.
  • Figure 4 is a schematic diagram showing the process of producing the surface expression vector sdv1 vector by cloning the OmpA gene in the pGEX 4T-1 vector.
  • FIG. 5 is a schematic diagram illustrating a process of producing a final sdv1PCV2 vector by cloning the PCV2 ORF2 gene in the sdv1 vector.
  • Figure 6 is a photograph confirming the PCV2 ORF2 and OmpA expressed by the sal-sdv1PCV2 using the PCR method.
  • Figure 12 is a graph confirming the animal test Salmonella antibody value in guinea pig (guinea pig).
  • Figure 13 is a cleavage map of the recombinant vector sal-sdv1PCV2 for cell surface expression of the present invention.
  • Nucleic acid is a term known in the art.
  • Nucleic acid refers to DNA, RNA or derivatives or analog molecules (strands) composed of nucleobases.
  • nucleobases include naturally occurring or derived purine or pyrimidine bases found in DNA (eg, adenine "A”, guanine “G”, thymine “T” or cytosine “C”) or RNA (eg, A , G, uracil "U” or C).
  • polypeptide is intended to include not only a single polypeptide, but also a plurality of polypeptides and includes a chain or chains of one or more amino acids joined to each other by peptide bonds. The term also includes polypeptides having post-translational modifications.
  • a "protein” is also intended to include fragments, analogs and derivatives of a protein that retain essentially the same biological activity or function as the reference protein.
  • nucleic acid sequence encodes a polypeptide sequence, wherein the polypeptide sequence is at least 3 to 5 amino acids, more preferably a polypeptide encoded by the nucleic acid sequence.
  • polypeptide sequence consisting of at least 8-10 amino acids, even more preferably at least 15-20 amino acids.
  • polypeptide sequences that can be immunologically identified using the polypeptide encoded by the sequence.
  • an antigen “polypeptide”, “protein” or “amino acid” sequence may have at least 70% similarity, preferably at least about 80% similarity, more preferably at least about 90-95% similarity to the polypeptide or amino acid sequence of the antigen, Most preferably, about 99% similarity.
  • a “gene” is a nucleotide sequence of a nucleic acid molecule (chromosome, plasmid, etc.) to which genetic functions are involved.
  • a gene is a genetic unit of an organism, including, for example, a polynucleotide sequence (eg, a DNA sequence of a mammal) that occupies a particular physical location ("gene locus") within the organism's genome.
  • the gene may encode an expression product, such as a polypeptide or polynucleotide.
  • genes include coding sequences such as polypeptide coding sequences and noncoding sequences such as promoter sequences, polyadenylation sequences, transcriptional regulatory sequences (eg, enhancer sequences). Many eukaryotic genes have "exons" (coding sequences) intervening "introns” (non-coding sequences).
  • Open reading frame or "ORF”, or “orf” refers to the minimum nucleotide sequence needed to encode a particular viral protein without an intervening stop codon.
  • Promoter refers to a nucleic acid sequence that regulates expression of a gene.
  • a “promoter sequence” is a DNA regulatory region capable of binding to RNA polymerase in a cell and initiating transcription downstream of the coding sequence. Within the promoter sequence are transcription start sites as well as protein binding domains (conservation sequences) responsible for RNA polymerase binding.
  • Sequence concatenation or fusion refers to a single polypeptide chain comprising fused components.
  • the fused components can be connected directly or indirectly.
  • other sequences ie, linkers or functional domains
  • the tyrosine hydroxylase 3'UTR Teyrosine hydroxylase 3 'Untranslated region sequence means the fusion of the ischemic therapeutic gene sequence.
  • Transformation or transfection refers to the process by which extracellular DNA enters a host cell in the presence or absence of an accompanying substance.
  • a “transfected cell” refers to a cell in which extracellular DNA is introduced into the cell and has extracellular DNA. DNA can be introduced into cells so that nucleic acids can be inserted into chromosomes or replicated into extrachromosomal material.
  • “Operably linked” refers to an arrangement of elements in which the mentioned components are configured to perform their general functions.
  • certain promoters operably linked to coding sequences may enable expression of coding sequences in the presence of regulatory proteins and appropriate enzymes.
  • certain regulatory elements need not be adjacent to coding sequences as long as they can function to direct the expression of the coding sequences.
  • vector refers to any nucleic acid comprising a competent nucleotide sequence that is inserted into a host cell and recombined with, inserted into, or spontaneously replicates as a host.
  • vectors include linear nucleic acids, plasmids, phagemids, cosmids, RNA vectors, viral vectors and the like.
  • a “host cell” refers to a eukaryotic or prokaryotic cell into which one or more DNAs or vectors are introduced and should be understood to refer not only to a particular subject cell but also to its progeny or potential progeny. In fact the progeny are not identical to the parent cell because some modifications may occur in subsequent generations due to mutations or environmental influences, but are still included within the scope of the term as used herein.
  • Vaccines or “vaccine compositions” can be used interchangeably herein and include one or more immunologically active ingredients that elicit an immune response in an animal and / or protect the animal from the possibility of death due to disease or infection.
  • a pharmaceutical composition which may or may not include one or more additional ingredients that enhance the immunological activity of the active ingredient.
  • the vaccine may further comprise other ingredients typical of pharmaceutical compositions.
  • an “immune response” to an antigen or vaccine composition is one in which a humoral and / or cell mediated immune response occurs in a subject to a molecule present in the antigen or vaccine composition of interest.
  • a "humoral immune response” includes the production of an antibody having an affinity for the antigen / vaccine of the invention as an antibody mediated immune response, while a “cell mediated immune response” is directed by T lymphocytes and / or other leukocytes. It is mediated.
  • a “cell mediated immune response” is caused by the presentation of antigenic epitopes associated with class I or class II molecules of the major histocompatibility complex (MHC).
  • an "immunologically effective amount” means an antigen or vaccine sufficient to elicit an immune response of either a cellular (T cell) or humoral (B cell or antibody) response, as determined by standard assays known to those of skill in the art. Say the sheep.
  • the effectiveness of an antigen as an immunogen can be determined by proliferation assays, cell lysis assays, such as chromium release assays that measure the ability of T cells to lyse their specific target cells, or by measuring circulating antibody levels specific for antigens in serum. It can measure by measuring a level.
  • the level of protection of the immune response can be measured by antigen attack of a host immunized with the injected antigen.
  • administering means delivering a composition, eg, a mixture of plasmids and carriers, to a therapeutic individual, such that the composition is delivered to a body site and the plasmid transfects target cells.
  • the composition is administered to an individual, for example by systemic administration, typically by subcutaneous, intramuscular, intravenous, or intraperitoneal administration.
  • delivery options for performing myocardial gene delivery include epicardial, endocardial, intracoronary, retroperfusion, and intapericardial. Routes of administration are included (JM Isner, supra). All types of vectors can be delivered by intracardiac and intracardiac infusion via the epicardium and endocardial route of administration. Intravascular and reverse perfusion delivery is not suitable for non-viral gene delivery or other gene delivery methods due to intracellular digestion of plasmid DNA that is not protected by viral vectors or other vectors.
  • Prevention means inhibiting the occurrence of a disease or condition in an animal that has never been diagnosed as having a disease or condition but is prone to such disease or condition.
  • Treatment means (a) inhibiting the development of a disease or condition; (b) alleviation of the disease or condition; And (c) elimination of the disease or condition.
  • therapeutically effective amount herein means an amount sufficient to achieve the above pharmacological effect.
  • mammals for therapeutic purposes refers to any animal classified as a mammal, including humans, livestock and farm livestock and zoos, sports or pet animals such as dogs, horses, cats, cattle, monkeys.
  • the mammal is a pig.
  • Pig can be used interchangeably and refer to any animal that is a member of the family Sugidae.
  • the present invention uses a cell surface expression system of a gene, and relates to a Salmonella vaccine strain, characterized in that the pig circovirus 2 (PCV2) antigen gene is expressed on the surface of Salmonella.
  • PCV2 pig circovirus 2
  • a recombinant expression vector for cell surface expression comprising a gene encoding an extracellular membrane protein derived from a Salmonella strain and a DNA sequence encoding a portion of a pig circovirus 2 (PCV2) gene; And to a Salmonella strain transformed with such a recombinant expression vector, and to a system for preventing and treating diseases related to Salmonella infection or PCV2 infection.
  • PCV2 pig circovirus 2
  • the present invention incorporates extracellular membrane protein A (OmpA) and PCV2 genes derived from Salmonella strains into a base vector to transform Salmonella strains, and standard cloning techniques and conventional methods known to those of ordinary skill in the art. It can be implemented by stably expressing the PCV2 protein on the Salmonella surface.
  • OmpA extracellular membrane protein A
  • PCV2 PCV2 genes derived from Salmonella strains into a base vector to transform Salmonella strains
  • the present invention relates to a recombinant expression vector for cell surface expression containing, in one aspect, a DNA sequence encoding a portion of an extracellular membrane protein derived from Salmonella strains and a PCV2 gene.
  • a vector refers to a structure made of genetic material (nucleic acid).
  • the expression vector contains a replication initiation point that is functional in the bacterial host cell, and a selectable marker for detecting the bacterial host cell comprising the expression vector.
  • the expression vector is a closed circular DNA molecule.
  • Cell surface expression refers to a technique for expressing the surface of gram negative, positive bacteria, mold, yeast, and animal cells by fusing proteins or peptides with an appropriate surface anchoring motif.
  • surface proteins of microorganisms such as bacteria and yeast are used as surface expression mothers to stably express foreign proteins on the surface of microorganisms.
  • the surface expression parent is most important for successful cell surface expression technology.
  • the core of this technique is the selection or development of a parent that can effectively express foreign proteins on the cell surface. Therefore, the surface-expressing parent has a secretion signal that helps to pass the intracellular membrane to send the foreign protein to the cell surface, and secondly, there is a target signal that helps the foreign protein to be stably attached to the surface of the cell membrane. It is expressed in a large amount on the cell surface but has little effect on the growth of the cell, and should be able to be stably expressed without changing the three-dimensional structure of the foreign protein regardless of the size of the protein.
  • Such surface expression matrices include outer membrane proteins, spore proteins, lipoproteins, autotranspoters and S-layer proteins of surfaceappendages.
  • extracellular membrane proteins since the three-dimensional structure has a loop structure passing through the extracellular membrane, the surface expression matrix is frequently used due to the advantage of providing a fusion site for expressing various proteins. Used.
  • the extracellular membrane proteins include OmpA, OmpS, LamB, OprF, and PhoE.
  • the extracellular membrane protein is used as a surface expression parent.
  • the extracellular membrane protein may be selected from the group consisting of OmpA, OmpS, LamB, OprF, OmpC, PhoE and FadL, and most preferably OmpA may be used.
  • OmpA forms a b-barrel structure in the outer membrane.
  • Four loops are formed out of the surface, and these loops are used for cell surface expression techniques.
  • the OmpA protein consists of 325 residues and has two domains, about 170 N-terminal transmembrane (TM) domains and about 136 C-terminal periplasmic domains. In the middle is the Ala-Pro rich hinge region. In the present invention, the N-terminal TM (transmembrane) domain was used as the surface expression parent. Therefore, even if it contains only the TM domain sequence of Omp A, the cell surface display which is the recombinant vector function of this invention is possible.
  • TM transmembrane
  • the extracellular membrane protein is preferably derived from Salmonella.
  • Salmonella extracellular membrane protein (Omp) antigen is recognized as an immune substance that simultaneously activates cellular and humoral immunity, which is important for Salmonella immunity while having a common antigen for each serotype.
  • it may be derived from Salmonella typhimurium or Salonella typhimurium, preferably from Salonella typhimurium.
  • the method for obtaining Omp from Salmonella strains can be carried out according to known methods, ie, the methods described in Arockiasamy et al. (Analytic Biochemistry 283, 2000) or Yuichi et al. (Infection and Immunity 61, 1993).
  • a vector using OmpA derived from Salmonella typhimurium was used as a cell surface expression matrix.
  • a sequence of OmpA derived from Salmonella typhimurium a sequence of SEQ ID NO: 1 may be used.
  • the particularly important N-terminal TM (transmembrane) domain is set forth in SEQ ID NO: 2.
  • the surface expression vector of the present invention uses an extracellular membrane protein such as OmpA as a surface expression matrix and contains a DNA sequence encoding a portion of the pig circovirus 2 (PCV2) antigen gene.
  • OmpA extracellular membrane protein
  • PCV2 pig circovirus 2
  • PCV2 antigen refers to an amino acid sequence that elicits an immune response against PCV2 in a host, which includes the full-length sequence of any PCV2 protein, analogue or immunogenic fragment thereof.
  • An “immunogenic fragment” means a fragment of a protein that induces an immune response in a host, including one or more epitopes, which fragments can be identified using any number of epitope mapping techniques known in the art.
  • PCV2 open reading frame (ORF) sequence selected from the group consisting of ORF1, ORF2, ORF3, ORF4, ORF5, ORF6, ORF7 and combinations thereof of the PCV2 antigen gene, and most preferably PCV2 ORF2 It contains a DNA sequence.
  • ORF open reading frame
  • it may be a DNA sequence represented by SEQ ID NO: 3.
  • the DNA sequence encoding a part of the PCV2 antigen gene, and most preferably, the PCV2 ORF2 DNA sequence is fused with a sequence encoding a TM domain in a gene sequence encoding an OmpA protein.
  • the gene encoding the extracellular membrane protein and the PCV2 antigenic gene sequence also include a gene sequence that is "biologically functional equivalent.”
  • a sequence having about 70% to about 90% homology to an amino acid that is the same or functionally equivalent to an amino acid of the gene may be a biologically equivalent sequence provided that the biological activity of the protein is maintained.
  • the gene encoding the extracellular membrane protein and the PCV2 antigen gene sequence can be inserted into the vector through a generally known method.
  • the DNA sequence and the vector are cleaved with one or more restriction enzymes and the fragments ligated together to bind the DNA sequence to be finally expressed to the vector. Restriction enzyme digestion and ligation are well known to those skilled in the art.
  • the vector may be any expression vector having a promoter encoding the extracellular membrane protein (eg OmpA) and a promoter capable of expressing the PCV2 antigen gene (eg PCV2 ORF2) and a multicloning site for cloning.
  • a promoter encoding the extracellular membrane protein (eg OmpA) and a promoter capable of expressing the PCV2 antigen gene (eg PCV2 ORF2) and a multicloning site for cloning.
  • a plasmid or a bacterial vector e.g., the E. coli vector pGEX 4T-1 (Amersham, cat: 27458001) was used.
  • the gene encoding the extracellular membrane protein and the PCV2 antigen gene in the vector may be operably linked to one promoter or a separate promoter.
  • Promoters included in the vector of the present invention include any conventionally known promoter.
  • the promoter may include promoters that act on prokaryotes, fungi, plants, and animals.
  • promoters that act on bacterial vectors may be used.
  • the promoter preferably includes a Lac operon based promoter such as trc, lac, tac, lacUV5-t7 hybrid, and the like, but is not limited to these examples.
  • a tac promoter was used.
  • the expression vector of the present invention in addition to the regulatory elements usually required for DNA expression, other elements may also be included in the DNA molecule.
  • Enhancers are selected from the group including human actin, human myosin, human hemoglobin, human muscle creatine and virus enhancers, such as SV40, RSV, and EBV enhancers, cytomegalovirus modulators, polyoma enhancers, adenovirus enhancers, and retrovirus LTR enhancers. It may be, but is not limited to these.
  • expression vectors may also include ribosomal binding sites for transcription in the sequences and transcription regions necessary for transcription termination.
  • a polyadenylation signal may be included in the expression construct for proper polyadenylation of the transcript. The nature of the polyadenylation signal is not considered important to the successful implementation of the present invention and any sequence can be used.
  • those skilled in the art will know a number of regulatory sequences useful for expression vectors.
  • the expression vector may comprise a selection marker that allows selection of a subpopulation of cells containing the recombinant vector construct.
  • the marker may be contained in the same vector containing the fusion sequence disclosed herein or may be present on a separate vector.
  • the selectable marker refers to a nucleic acid sequence that, when expressed, gives identifiable characteristics to a cell so that the cell can be easily identified and separated from the cell without the selectable marker. Any selectable marker known in the art can also be used as a selectable marker in the nucleic acids of the invention.
  • IPTG Isopropyl- ⁇ -D-Thiogalactopyranoside
  • IPTG is an inducer of the activity of ⁇ -galactosidase, and can be used as an inducer of expression vectors having a lac promoter or a tac promoter. That is, IPTG can be used to turn on / off the expression of the PCV2 antigen gene, and by using this, the efficiency of PCV2 antigen production by IPTG can be controlled.
  • the recombinant vector of the present invention has the following advantages.
  • Salmonella-derived OmpA is used as the surface expression matrix to increase the cell surface expression rate of the PCV antigen gene
  • PCV2 ORF2 viral protein with a rather large molecular weight of about 20 kda can be expressed on the surface of Salmonella.
  • the present invention is a Salmonella strain that expresses a PCV2 antigen gene (eg, PCV2 ORF2) transformed with the recombinant vector; And its use as a vaccine for the treatment or prophylaxis of diseases according to Salmonella or PCV2 infection.
  • a PCV2 antigen gene eg, PCV2 ORF2
  • Salmonella strains pass through the M cells of the intestinal Peyer's patch and express cytokines in the Peyer's patch or in the lymph nodes, thus exerting a paracrine or endocrine (effect on adjacent cells) form. Salmonella can thus express cytokine genes that can pass through M cells and exert effects throughout the host.
  • Salmonella strains (hosts) in the present invention are Salmonella typhimurium, Salmonella derby, Salmonella Swzegrond, Salmonella blenderup, Salmonella emvandaka, Salmonella new uporter, Salmonella enteritidis, Salmonella gallinarum, Salmonella pullolaum, etc. It is preferable to use Salmonella typhimurium, Salmonella blender or Salmonella enteritidis, which are preferably infected and highly pathogenic species regardless of the breeder. Most preferably Salmonella typhimurium.
  • the strains usable in the present invention can be freely distributed by the National Veterinary Research and Quarantine Service. In one embodiment of the present invention Salmonella typhimurium H683 ⁇ asd strain was used.
  • Recombinant Salmonella strains expressing the PCV2 antigen gene (eg, PCV2 ORF2) on the cell surface using the strains can be prepared by transformation methods commonly used in the art. Conventional molecular biology, microbiology, immunology and recombinant DNA techniques and the like can be used in the technical scope of the art.
  • the recombinant Salmonella strain prepared as an embodiment of the present invention is a recombinant Salmonella strain of Accession No. KCCM 11099P.
  • the recombinant Salmonella strain prepared above can spread the potent physiological activities of various recombinant proteins to the whole body as well as the host intestinal relationship by oral administration.
  • the expression of the foreign immunogen PCV2 gene (eg, PCV2 ORF2) on the surface of a non-pathogenic Salmonella strain orally administered lively is more consistent than vaccines using conventional attenuated pathogenic bacteria or viruses. And induce a strong immune response.
  • the induction of this immune response is due to the body's immune response to live Salmonella strains, as Salmonella's surface structures act as an adjuvant to increase the antigenicity of the surface-expressed foreign protein PCV2 ORF2.
  • recombinant live vaccines of non-pathogenic Salmonella strains using these surface expression systems are more effective than vaccines for the treatment or prevention of existing PCV2 infections.
  • the present invention provides a method for preparing Salmonella, comprising the steps of: (a) culturing the recombinant Salmonella to express PCV2, preferably PCV2 ORF2 protein on Salmonella surface; And (b) recovering Salmonella surface-expressed with said PCV2, preferably PCV2 ORF2 protein, to a method for producing a recombinant Salmonella surface-expressed with PCV2 ORF2 protein.
  • PCV2 protein of the present invention is moved to the surface of the microorganism by the OmpA protein derived from Salmonella typhimurium contained in the expression vector.
  • the PCV2 protein Since the PCV2 protein is expressed on the surface of the microorganism without losing its function, it can be used in the state of surface expression on the microorganism, and is administered to the animal while surface expression on the microorganism to induce an immune response against PCV2 in the animal body. You may.
  • the main feature of the present invention is to effectively express the foreign protein PCV2 ORF2 on the surface of Salmonella strains by utilizing the extracellular membrane protein derived from Salmonella strains, most preferably OmpA, as a novel surface expression matrix of the PCV2 gene, particularly PCV2 ORF2. It is to let.
  • the system of the present invention has the following advantages.
  • GRAS non-pathogenic or ingestible microorganisms
  • the present invention relates to a pharmaceutical composition for immuno-enhancing, characterized in that it contains the Salmonella strain described above.
  • the immunopotentiating activity is caused by the expression of the PCV2 gene or by Salmonella infection.
  • “Pharmaceutical composition” refers to the preparation of one or more active ingredients or formulations described herein having other chemical ingredients such as physiologically compatible carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
  • the composition may comprise additional ingredients known to those skilled in the art and may include one or more veterinary acceptable carriers.
  • “Vetically acceptable carrier” includes any and all solvents, dispersion media, coatings, adjuvant, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, absorption delaying agents, and the like.
  • composition means, for example, a composition comprising a Salmonella strain expressing the PCV2 ORF2 protein. It may also comprise part of the cell culture supernatant.
  • the pharmaceutical composition of the present invention can be administered orally or parenterally. Preferably orally.
  • the oral preparation may be in the form of granules, powders, tablets, capsules, solvents, emulsions or suspensions.
  • dosage forms such as an injection, a drop, an external preparation, or a suppository, can be selected.
  • injectables may include subcutaneous injections, intramuscular injections, intraperitoneal injections and the like.
  • nasal administration or ointment may be indicated.
  • Formulation techniques with the above formulations to contain the medicaments of the invention as the main component are known.
  • tablets for oral administration can be prepared by adding, excipients, disintegrants, binders and glidants to the medicament of the present invention, mixing and compression molding.
  • excipient lactose, starch or mannitol is generally used.
  • disintegrant calcium carbonate, carboxymethyl cellulose calcium, etc. are generally used.
  • binder gum arabic, carboxy methylcellulose or polyvinylpyrrolidone is used.
  • Talc, magnesium stearate, and the like are known as lubricants.
  • the composition containing the Salmonella strain is most preferably a feed additive for oral administration.
  • compositions used in the present invention may comprise known injectable physiologically acceptable sterile solutions.
  • isotonic aqueous solutions such as saline or corresponding plasma protein solutions are readily available.
  • the immunogenic and vaccine compositions of the present invention may comprise diluents, isotonic agents, stabilizers or adjuvant.
  • Diluents can include water, saline, dextrose, ethanol, glycerol, and the like.
  • Isotonic agents can include sodium chloride, dextrose, mannitol, sorbitol and lactose in particular.
  • Stabilizers include, in particular, alkali salts of albumin and ethylenediaminetetraacetic acid.
  • the pharmaceutical composition of the present invention can be used as an external preparation by making the solid, liquid, or semi-solid composition.
  • a solid or liquid composition it can be used as an external preparation by setting it as the composition demonstrated above.
  • Semi-solid compositions can be prepared by adding a thickener as needed to a suitable solvent. Water, ethyl alcohol, polyethylene glycol, etc. can be used for a solvent.
  • a thickener bentonite, polyvinyl alcohol, acrylic acid, methacrylic acid or polyvinyl pyrrolidone is generally used.
  • Preservatives, such as benzalkonium chloride can be added to this composition.
  • a suppository may be formed by combining an oily base such as cacao oil or an aqueous gel base such as a cellulose derivative as a carrier.
  • Suitable dosages of the pharmaceutical compositions of the invention may be determined by factors such as the formulation method, mode of administration, age, weight, sex, degree of disease symptom, food, time of administration, route of administration, rate of excretion and response to the subject animal. Various, usually skilled, physicians can readily determine and prescribe dosages that are effective for the desired treatment.
  • Effective amount of PCV2 antigen means, but is not limited to, the amount of antigen that the PCV2 antigen can induce or induce an immune response.
  • An effective amount is preferably defined as the amount of antigen that confers an immune duration (DOI) of at least 10 weeks, preferably at least 12 weeks, more preferably at least 15 weeks, most preferably at least 20 weeks.
  • DOI immune duration
  • the Salmonella strains included in the composition may be inoculated into animals at a suitable concentration as needed.
  • the target animal may be inoculated with a value of about 0.5 to 1.5 1 ⁇ 10 C10 / FU. .
  • the dosage is not limited to this, and may finally be appropriately determined by the veterinarian's judgment in consideration of the type of dosage form, administration method, age, weight, and symptoms.
  • the present invention relates to a method of treating or preventing to reduce clinical symptoms associated with or caused by a Salmonella infection or a PCV2 infection, wherein the above-mentioned PCV2 antigen gene is described in an animal in need of such treatment.
  • the present invention is effective in “little animals”, which means animals of 1 to 35 days of age, with fewer days being preferred. Thus most preferably refers to animals of one or two days of age.
  • animal means swine, pig or piglet.
  • PCV2 infection is known to be mainly transmitted by contact infection and by placental infection.
  • PCV2 infection Clinical symptoms include (1) interstitial pneumonia with interlobal edema, (2) pale skin or jaundice, (3) mottled atrophic liver, (4) gastric ulcer, (5) nephritis, and (6) genital disorders. Such as abortions, stillbirths, mummies, etc.
  • PDNS pig dermatitis and nephropathy syndrome
  • PRRSV reduced frequency of ' Dwarf disease 'and
  • PMWS Postweaning Multi-systemic Wasting Syndrome
  • Weaning systemic wasting syndrome occurs between 6 and 16 weeks of age when maternal antibodies fall from piglets, especially in pigs 8-12 weeks of age.
  • the post-weaning systemic wasting syndrome has clinical symptoms such as weight loss, water remission, typical atrophy, dyspnea, jaundice, diarrhea, cough, and central nervous system anxiety.
  • Salmonellosis is an acute or chronic gastrointestinal infection of pigs caused by Salmonella infection, also called swine paratyphoid, which is characterized by gastroenteritis and sepsis and occurs mainly in the growing season. In particular, it is the main culprit of increasing the mortality rate by 30-50% due to complex infection with circo.
  • Salmonellasis occurs worldwide, and S. choleraesuis and S. typhimurium are the major Salmonella serotypes that cause disease in pigs. S. choleraesuis and S. typhisuis, which cause acute sepsis in young pigs, are ill only in pigs. In Korea, S. typhimurium is known to be common. In particular, acute sepsis is common in young pigs 2-4 months of age. The main symptoms are elevated body temperature (41-42 ° C), loss of energy and loss of appetite, cyanosis around the ears and leg areas. Most die within four days.
  • Acute enteritis occurs mainly in livestock, and has a poor appetite and is accompanied by severe watery diarrhea, high fever, weakness, pneumonia, and neurological symptoms.
  • Chronic enteritis is severely thin due to continuous diarrhea, and gradually changes from gelatinous murine diarrhea in early yellowish white or grayish white to diarrhea. have.
  • the recombinant Salmonella strain of the present invention is very useful as a multivalent vaccine effective for preventing diseases caused by such Salmonella as well as PCV2 virus.
  • the salmonella strain used was typhimurium H683 ⁇ asd cell line (College of Veterinary Medicine, Cheju National University). 2,6 Diaminopimelic acid (DAP) was used in TSB medium at 50 ug / ml in cell culture, and cultured at 37 ° C. and 160 rpm. It was.
  • DAP 2,6 Diaminopimelic acid
  • cloning of the OmpA partial gene (a.a -21 to 159) was performed from the prepared non-pathogenic salmonella typhimurium H683 ⁇ asd cell line.
  • PCV2 ORF2 was cloned into the TA vector from the recombinant baculovirus seed (PRO-VAC® CIRCOMASTER, Komifam) using PCV2-TA F ', PCV2-TA R' primers.
  • the principle of TA cloning of OmpA and PCV2 ORF2 is shown in Fig. 2.
  • the pGEX 4T-1 vector (Yonsei University, Accession No.?) Shown in Fig. 3 was used as the base vector of the surface display vector. Most of the system of pGEX-4T-1 was treated with EcoNI and BamHI while removing the GST taq portion.
  • sdv1 a basic vector as a surface expression vector (named sdv1) (FIG. 4).
  • cloning was performed again using PCV2-S F 'and PCV2-S R' primers.
  • Sal I site was put in 5'end, and Not I site and his taq were cloned in 3'end.
  • the PCV2 ORF2 gene was cloned into sdv1 vector using Sal I and Not I enzyme sites.
  • the sdv1PCV2 vector was completed by ligation of the sdv1 vector and the PCV2 ORF2 gene.
  • FIG. 5 A cleavage map of the sdv1PCV2 vector is shown in FIG . 13 .
  • PCV2 ORF2 were fused and expressed. There was also amp + for easy selection.
  • Example 2 Confirmation by Transformation and PCR
  • the sdv1PCV2 vector was constructed to express the external protein PCV2 ORF2 protein on the surface of salmonella, and CaCl 2 was transformed in the transfection of this vector on salmonella typhimurium H683 ⁇ asd cell line. The chemical transfection method used was used.
  • DNA 1 ul primer 1: 1 ulprimer 2: 1 ul * A.DW: 17 ul
  • the PCR conditions are as follows. temperature °C Time initial denatureation 94 5 minutes 33 cycle denaturation annealing extension 95 40 seconds 55 40 seconds 72 45 seconds final extension 72 5 minutes end 4
  • PCV2 ORF2 gene We identified the PCF2 ORF2 gene using PCV2-S F '& PCV2-S R' primers, and OmpA (-21_159): OmpA gene using sdv1 F '& sdv1 R'primer.
  • PCV2 ORF2 was overexpressed on the surface by IPTG, ie surface overexpression of PCV2 ORF2 using IPTG 0.15 mM at OD 600 0.5-0.6 after cell culture at 160 rpm at 37 ° C. in DAP at 50 ug / ml, TSB medium Induced. Obtained by incubation (about OD 600 1.3 ⁇ 1.5) for 3 hours after the induction.
  • PCV2 ORF2 protein overexpressed by IPTG was confirmed by SDS-PAGE and western blot methods.
  • the protein fused with OmpA and PCV2 ORF2 was about 48 kda in size, and his tag was on the c-term of the fusion protein.
  • the samples were used by PBS washing the whole cells overexpressed.
  • Western and blot experiments were carried out by diluting his-mouse and mouse-HRP antibodies to 1: 1000 and 1: 5000 as primary and secondary antibodies, respectively.
  • Trypsin site in trypsin and PCV2 ORF2 gene was used to confirm that the fused protein was expressed on the surface.
  • Salmonella overexpressed the fusion protein and treated it with trypsin for 15 min incubation at 37'c. After washing three times with PBS buffer using SDS-PAGE and western blot method was confirmed.
  • the experiment can be divided into two groups of sal-sdv1PCV2 with or without induction using IPTG, and the antibody was inactivated when inoculated with sal-sdv1PCV2 in guinea pig for confirmation and divided into two groups in live state.
  • the experiment was conducted in four groups.
  • Each group used the same amount as 1x10 ⁇ 10 CFU, and all of them were washed three times with PBS buffer to minimize the effect of the medium.
  • 0.2% of formaldehyde was added and overnight incubation at 37 ° C was sufficiently inactivated.
  • Inactivated A and B groups were inoculated after 2 weeks, and C and D groups were inoculated only to observe changes of antibody.
  • the recombinant strain sal-sdv1PCV2 was cultured under IPTG conditions, and then 1x10 ⁇ 10 CFU was injected into guinea pigs.
  • serum was separated and bound to the primary antibody on the plate (100 ul, 1 hr, RT), washed three times (300 ul), and then the secondary antibody was bound again (100 ul 1 hr, RT). Washed three times again (300 ul) and color development was confirmed at OD 450.
  • the recombinant Salmonella strain of the present invention is a multivalent vaccine having not only an excellent antibody production efficiency against PCV2 infection but also an antibody generating effect against Salmonella infection, and is effective in preventing diseases caused by Salmonella or PCV2.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

본 발명은 비병원성 균주인 살모넬라 유래 세포외막 단백질을 이용한 돼지 써코바이러스(PCV) 유전자의 세포표면 발현용 재조합 벡터 및/또는 이로 형질전환된 살모넬라 백신 균주의, PCV2 감염에 따른 질환의 예방 및 치료에 있어서의 용도에 관한 것이다. 본 발명은 이러한 비병원성 균주 살모넬라를 이용하여 PCV2 바이러스의 구조 단백질을 발현시킨 라이브벡터(live vector)를 사용함으로써 살모넬라뿐만 아니라 PCV2 바이러스에 의해 발생하는 질병예방에도 효과가 뛰어난 다가 백신의 제조 및 활용에 유용하다. (대표도)13

Description

돼지 써코바이러스２(ＰＣＶ２) 유전자의 표면발현용 벡터 및 이로 형질전환된 살모넬라 백신 균주
본 발명은 살모넬라 유래 세포외막 단백질을 이용한 돼지 써코바이러스(PCV) 유전자의 세포표면 발현용 재조합 벡터 및/또는 이로 형질전환된 비병원성 살모넬라 백신 균주에 관한 것으로, 이들의 살모넬라 감염 또는 PCV2 감염에 따른 질환의 예방 및 치료에 있어서의 용도에 관한 것이다.
돼지 써코바이러스 제2형(Porcine CircoVirus type 2; PCV2)은 1991년 캐나다를 시작으로 미국, 프랑스, 스페인, 아일랜드, 덴마크, 영국, 독일 등 전 세계적으로 발생하고 있고, 아시아지역에서는 국내를 비롯한 일본과 대만에서도 발생이 확인된 원형의 외가닥 DNA바이러스로서, 써코비리데(Circoviridae)에 속한다. PCV2는 1974년 돼지 신장 세포에서 발견된 비병원성의 PCV1과 달리 감염에 의해 돼지 전신소모성 증후군(Postweaning Multi-systemic Wasting Syndrome; PMWS)을 유발하는 원인체 중 하나인 것으로 알려져 있고, 이는 양돈장에 오염되면 근절하기 힘든 바이러스이다.
최근 국내 양돈산업에 있어 살모넬라, PED, PCV2 등의 감염으로 인한 피해는 연간 약 600만두 이상 폐사하여 양돈농가 손실액이 1조 1,840억원으로 추정(한국농촌경제연구원)되고 있다. 이러한 전염성 질환을 예방하기 위한 백신이 절대적으로 필요하고 상용화된 백신이 있다 하더라도 개선되어야 할 점이 많이 존재하고 있다.
살모넬라 감염원으로는 오염된 원료사료나 물 또는 별 증상 없이 균을 보균하고 있는 성돈이 중요한 전염원이 될 수 있다. 즉 보균축이 여러가지 스트레스 등이 원인이 되어 발병하게되고 발병축의 분변을 통하여 경구감염된다. 균의 배설은 질병에서 회복된후에도 약 3개월동안 일어난다. 그러나 소수의 돼지는 영구적으로 균을 보균하며, 배설한다. 균은 거름속에서 오래 생존하며, 분변중에서는 20주까지 생존함이 보고되었다. 그래서 축사의 오염은 이러한 혈청형에 의해서 유발되는 질병의 역학에 있어서 중요하다. 많은 종류의 살모넬라가 원인균이 될 수 있으며, 그 중에서도 살모넬라 콜레라수이스(Salmonella choleraesuis) 및 살모넬라 타이피수이스(Salmonella typhisuis)는 살모넬라에 의한 급성패혈증의 주된 원인균이고, 살모넬라 타이피뮤리움(Salmonella typhimurium), 살모넬라 엔테라이티디스(Salmonella enteritidis) 및 살모넬라 더비(Salmonella derby) 등은 주로 만성장염을 일으키는 원인균이다.
따라서, 살모넬라 감염 예방은 감염으로 인한 질병의 피해는 물론 식육안전을 위해 실시하고 있는 HACCP의 중요한 감염 예방 세균이기도 하다. 하지만 아직 살모넬라 감염으로 인한 증상과 피해가 보고되고 있으나 상용화된 백신이 없어 항생제 처방을 통한 치료를 하고 있으나 잘 알려진 바와 같이 세포내 기생하는 살모넬라의 특징 때문에 다시 재발하는 경우가 많은 것으로 보고되고 있다.
PCV2 감염으로 인한 피해는 더욱 더 심각하다. PCV2 감염으로 인한 피해로 인해 2010년 정부가 300억원의 예산을 조성 농가에 관납백신을 공급할 정도로 PCV2 백신의 중요성은 이미 다 알려진 사실이다. 이와 관련하여, 종래 특정 돼지 생식기 호흡기 증후군 바이러스(PRRSV) 유전자(ORF2, ORF3, ORF4, ORF5, ORF6, ORF7)가 상이한 벡터 시스템, 즉, 배큘로바이러스, 위광견병 바이러스, TGEV 및 플라스미드 DNA를 통해 발현되는 시스템을 이용하고 있다.
그러나 PCV2 불활화 백신의 문제점은 아직 백신에 의해 항체 형성이 미약하고 백신접종 이후에도 여전히 돼지의 체내에 바이러스가 감염되어 있는 상태를 유지하여 면역 스트레스나 기타 다른 감염원에 의해 쉽게 증상을 발생시키고 있다. 따라서, 양돈 산업계에 미치는 이러한 강력한 영향으로 인해, PCV2에 대한 효과적인 백신 개발이 점차 중요해지고 있다.
이에, 본 발명자들은 최근 첨단 분자생물학적 주요 기술의 하나인 세포 표면 발현(cell surface display) 기술을 이용하여 기존 살모넬라 백신의 문제점을 개선할 뿐만 아니라, PCV2 바이러스 감염 질환도 동시에 예방할 수 있는 백신을 개발하고자 예의 노력한 결과, 살모넬라 유래의 세포외막 단백질을 표면 발현 모체(surface anchoring motif)로 사용하여 PCV2 바이러스의 구조 단백질을 발현시킨 비병원성 균주인 살모넬라의 라이브벡터(live vector)를 개발함으로써 본 발명을 완성하였다.
본 발명은 살모넬라 또는 PCV2 감염의 치료 또는 예방용 백신에 관한 것으로,
*본 발명의 주된 목적은 돼지 써코바이러스2(PCV2) 유전자 발현 벡터가 형질도입된 살모넬라 균주 백신을 제공하는 데 있다.
본 발명의 다른 목적은 살모넬라 균주 유래의 세포외막 단백질 A(OmpA)을 암호화하는 유전자 및 돼지 써코바이러스2(PCV2) 유전자 일부를 암호화하는 DNA서열을 함유하는 재조합 발현벡터를 제공하는 데 있다.
본 발명의 또 다른 목적은 상기 살모넬라 균주 백신을 이용하여 동물의 PCV2 감염 질환을 예방 또는 치료하는 방법을 제공하는 데 있다.
상기 과제를 해결하기 위하여 본 발명은 살모넬라 균주 유래의 세포외막 단백질을 암호화하는 유전자 및 돼지 써코바이러스2(PCV2) 유전자 일부를 암호화하는 DNA서열을 함유하는, 세포표면 발현용 재조합벡터를 제공한다.
상기 세포외막 단백질은 표면 발현 모체(surface anchoring motif)로서 기능하는데, 예를 들어 OmpA, OmpS, LamB, OprF, OmpC, PhoE 및 FadL로 구성된 군에서 선택될 수 있고, 가장 바람직하게는 OmpA를 사용할 수 있다. 대표적으로, 상기 살모넬라 균주 유래의 OmpA 단백질은 서열번호 1로 표시되는 염기서열로 이루어진 것을 사용할 수 있다. 특히, 본 발명에서는 OmpA 단백질 서열 중 N-말단 TM(transmembrane) 도메인을 표면 발현 모체로 이용하는 것을 특징으로 하고 대표적인 서열을 서열번호 2로 기재하였다.
또한, 상기 돼지 써코바이러스2(PCV2) 유전자 일부를 암호화하는 DNA서열은 ORF1, ORF2, ORF3, ORF4, ORF5,ORF6, ORF7 및 이들의 조합으로 구성된 군에서 선택되는 PCV 오픈 리딩프레임(ORF)을 코딩하는 것을 사용하는 것이 바람직하고, 더욱 바람직하게는 PCV2 ORF2를 코딩하는 것을 사용한다. 대표적인 PCV2 ORF2의 염기서열을 서열번호 3으로 표시하였다.
상기 세포표면 발현용 재조합벡터는 도 13의 개열지도를 가질 수 있다. 특히, 기본벡터로서 대장균(E. coli)을 사용하는 것이 바람직하다.
또한, 본 발명은 상기 설명한 세포표면 발현용 재조합벡터로 형질전환된 재조합 살모넬라 균주 및 이의 백신으로서의 용도를 제공한다.
상기 살모넬라 균주는 살모넬라 티피뮤리움, 살모넬라 더비, 살모넬라 스크와젠그론드, 살모넬라 브렌더럽, 살모넬라 엠반다카, 살모넬라 뉴우포터, 살모넬라 엔테라이티디스, 살모넬라 갈리나룸, 살모넬라 풀로룸 등이 있으며, 바람직하게는 살모넬라 티피뮤리움, 살모넬라 브렌더럽 또는 살모넬라 엔테라이티디스를 사용하는 것이 바람직하다. 가장 바람직하게는 살모넬라 티피무리움일 수 있다.
그리고, 이러한 재조합 살모넬라 균주의 표면에 돼지 써코바이러스2(PCV2) 유전자가 발현된다. 특히, PCV2 ORF2 단백질이 세포 표면 발현되어 있다. 상기 형질전환된 재조합 살모넬라 균주는 기탁번호 KCCM 11099P로 기탁되어 있는 균주를 포함한다.
이러한 재조합 살모넬라 균주는 살모넬라 감염 또는 PCV2 감염에 따른 질환의 치료 또는 예방용 생백신으로 사용할 수 있다.
한편, 본 발명은 상기 재조합 살모넬라 균주에 의해 발현되어 포유류에서 체액성 면역반응을 유도할수 있는 재조합 융합 단백질을 제공한다.
또한, 본 발명은 상기 재조합 살모넬라 균주 또는 상기 재조합 융합 단백질을 함유하는 것을 특징으로 하는 살모넬라 감염 또는 PCV2 감염에 따른 질환의 치료 또는 예방 백신용 조성물을 제공할 수 있다. 상기 백신 조성물은 IPTG(Isopropyl-β-D-Thiogalactopyranoside)을 함유하는 것이 바람직하다. 그리고 상기 백신 조성물은 경구 투여용 사료첨가제의 형태로 제공되는 것이 바람직하다.
*또한, 본 발명은 인간을 제외한 동물에게 상기 설명한 백신 조성물의 면역학적 유효량을 투여하는 단계를 포함하는, 살모넬라 감염 또는 PCV2 감염에 따른 질환의 치료 또는 예방방법 상기 동물은 돼지인 방법을 제공한다.
이 때, 상기 살모넬라 균주를 대상 동물, 예를 들어 돼지에 0.5 ~ 1.5 1x10^9 CFU/ml으로 접종시키는 것이 바람직하다.
그리고, 상기 PCV2 감염에 따른 질환은 이유후 전신 소모성 증후군(Postweaning Multi-systemic Wasting Syndrome; PMWS)이 가장 대표적이고, 살모넬라 감염에 따른 질환은 살모넬라증(Salmonellosis)이 대표적이다.
특히, 본 발명의 효과는 "어린 동물"에서 더욱 효과적인데, 예를 들어, 1 내지 35일령의 동물이 바람직하고, 일령이 적을수록 더욱 바람직하다
상술한 바와 같이, 본 발명의 살모넬라 균주 유래의 세포외막 단백질을 암호화하는 유전자 및 돼지 써코바이러스2(PCV2) 유전자 일부를 암호화하는 DNA서열을 함유하는, 세포표면 발현용 재조합벡터 및 이로 형질전환시킨 살모넬라 균주는 살모넬라뿐만 아니라 PCV2 바이러스에 의해 발생하는 질병예방에 효과적인 다가 백신이다. 상기 백신은 경구 투여에 의하여 재조합 단백질의 생산을 편리하게 유도할 수 있으므로 보다 용이하게 돼지 써코바이러스에 의한 감염 또는 살모넬라 감염으로 인한 피해를 줄일 수 있다
도 1은 본 발명의 TA 클로닝에 사용한 TA vector(pcr2.1, invitogen)의 개열지도이다.
도 2는 OmpA 및 PCV2 ORF2 유전자의 TA 클로닝 기작을 간단히 나타낸 도식도이다.
도 3은 본 발명의 세포표면 발현 벡터의 기본 벡터로 사용한 pGEX 4T-1 벡터의 개열지도이다.
도 4는 pGEX 4T-1 벡터에 OmpA 유전자를 클로닝하여 표면발현 벡터인 sdv1 벡터를 제조하는 과정을 개략적으로 나타낸 도식도이다.
도 5는 상기 sdv1 벡터에 PCV2 ORF2 유전자를 클로닝하여 최종 sdv1PCV2 벡터를 제조하는 과정을 개략적으로 나타낸 도식도이다.
도 6은 상기 sal-sdv1PCV2에 의해 발현되는 PCV2 ORF2 및 OmpA을 PCR 방법을 이용하여 확인한 사진이다.
도 7은 IPTG에 의하여 표면에 과발현된 PCV2 ORF2를 웨스턴 블럿을 이용하여 확인한 사진이다.
도 8 내지 도 11은 기니 피그(guinea pig)에서의 동물실험 PCV2 항체가를 확인한 그래프들이다.
도 12는 기니 피그(guinea pig)에서의 동물실험 살모넬라 항체가를 확인한 그래프이다.
도 13은 본 발명의 세포표면 발현용 재조합 벡터 sal-sdv1PCV2의 개열지도이다.
본 발명에서 사용되는 용어에 대한 정의는 이하와 같다.
"핵산"은 당분야에 공지된 용어이다. 여기에서 "핵산"은 핵염기로 구성된 DNA, RNA 또는 이의 유도체 또는 유사체 분자(가닥)을 말한다. 예를 들면 핵염기에는 DNA에서 볼 수 있는 자연 생성 또는 유도된 퓨린 또는 피리미딘 염기(가령, 아데닌 "A", 구아닌 "G", 티민 "T" 또는 시토신 "C") 또는 RNA (가령, A, G, 우라실 "U" 또는C)를 포함한다.
"폴리펩티드"는 단일 폴리펩티드뿐 아니라 다수의 폴리펩티드들을 포함하는 것이며, 펩티드 결합에 의해 서로 결합된 하나 이상의 아미노산의 쇄 또는 쇄들을 포함한다. 상기 용어는 또한 해독후 변형을 가진 폴리펩티드를 포함한다.
"단백질"은 또한 기준 단백질과 본질적으로 동일한 생물 활성 또는 기능을 보유하는, 단백질의 단편, 유사체 및 유도체를 포함하는 것이다.
"∼에 의해 코딩되는" 또는 "∼를 코딩하는"이란 핵산 서열이 폴리펩티드 서열을 코딩하는 것을 말하며, 여기서 상기 폴리펩티드 서열은 상기 핵산 서열에 의해 코딩되는 폴리펩티드인 적어도 3∼5개 아미노산, 더 바람직하게는 적어도 8∼10개 아미노산, 더욱 더 바람직하게는 적어도 15∼20개 아미노산으로 이루어진 아미노산 서열을 포함한다. 상기 서열에 의해 코딩된 폴리펩티드를 사용하여 면역학적으로 확인할 수 있는 폴리펩티드 서열도 포함된다. 따라서, 항원 "폴리펩티드", "단백질" 또는 "아미노산" 서열은 항원의 폴리펩티드 또는 아미노산 서열에 대해 70% 이상의 유사성, 바람직하게는 약 80% 이상의 유사성, 더 바람직하게는 약 90∼95%의 유사성, 가장 바람직하게는 약 99%의 유사성을 가질 수 있다.
본 발명에서 사용되는 "유전자"는 유전적 기능이 관련되어 있는 핵산 분자(염색체, 플라스미드 등)의 뉴클레오티드 서열이다. 유전자는, 예를 들어, 유기체의 게놈 내의 특정 물리적 위치("유전자좌")를 차지하는 폴리뉴클레오티드 서열(예를 들어, 포유동물의 DNA 서열)을 포함하는, 유기체의 유전 단위이다. 유전자는 폴리펩티드 또는 폴리뉴클레오티드와 같은 발현 생성물을 코딩할 수 있다. 일반적으로, 유전자는 폴리펩티드 코딩 서열과 같은 코딩 서열 및 프로모터 서열, 폴리아데닐화 서열, 전사 조절 서열(예를 들어, 인핸서 서열)과 같은 비코딩 서열을 포함한다. 다수의 진핵생물 유전자가 "인트론"(비코딩 서열)이 개재되어 있는 "엑손"(코딩 서열)을 갖는다.
"오픈 리딩 프레임" 또는 "ORF", 또는 "orf"는 정지 코돈이 개재하지 않은 상태로 특정 바이러스 단백질을 코딩하는 데 필요한 최소한의 뉴클레오티드 서열을 말한다.
"프로모터"는 유전자의 발현을 조절하는 핵산 서열을 가리킨다. "프로모터 서열"은 세포 내에서 RNA 중합효소에 결합하여 코딩 서열의 하류로 전사를 개시할 수 있는 DNA 조절 영역이다. 프로모터 서열 내에는 RNA 중합효소 결합을 담당하는 단백질 결합 도메인(보존 서열)뿐만 아니라 전사 개시 부위가 발견된다.
"서열의 연결 또는 융합 (fusion)"은 융합된 구성요소를 포함하는 단일 폴리펩타이드 사슬을 말한다. 융합된 구성요소들은 직접적 또는 간접적으로 연결될 수 있다. 예를 들어, 다른 서열(즉, 링커 혹은 기능도메인)이 융합된 요소들 사이에 위치할 수 있다. 본 발명에서는 티로신 수산화효소 3'UTR(Tyrosine hydroxylase 3‘ Untranslated region) 서열과 허혈성 치료 유전자 서열의 융합을 의미한다.
"형질전환 또는 트랜스펙션"은 세포외부 DNA가, 수반물질이 있고 없는 상태로 숙주 세포로 들어가는 과정을 말한다. "트랜스펙션된 세포"란 세포 외부 DNA가 세포 내로 도입되어 세포 외부 DNA를 가지고 있는 세포를 가리킨다. DNA는 세포로 도입되어 핵산이 염색체에 삽입되거나 혹은 염색체 외 물질로 복제될 수 있다.
"작동 가능하게 연결된"이란 언급된 구성요소들이 그 일반적 기능을 수행하도록 구성되어 있는 요소들의 배열을 말한다. 따라서, 코딩 서열(예를 들어, 관심있는 항원을 코딩하는 서열)에 작동 가능하게 연결된 특정 프로모터는 조절 단백질 및 적절한 효소가 존재할 경우 코딩 서열의 발현을 가능하게 할 수 있다. 일부 경우, 특정 조절요소가 이들이 코딩 서열의 발현을 지시하는 기능을 할 수 있는 한 코딩 서열에 인접할 필요는 없다.
" 벡터" 라는 용어는 숙주 세포에 삽입되어 숙주 세포 게놈과 재조합되고 이에 삽입되거나, 또는 에피좀으로서 자발적으로 복제하는 컴피턴트 뉴클레오티드 서열을 포함하는 임의의 핵산을 의미한다. 이러한 벡터로는 선형 핵산, 플라스미드, 파지미드, 코스미드, RNA 벡터, 바이러스 벡터 등이 있다.
"숙주 세포"는 하나 이상의 DNA 또는 벡터가 도입되는 진핵 또는 원핵 세포를 가리키며, 특정 대상 세포만이 아니라 그 자손 혹은 잠재적 자손까지도 가리키는 것으로 이해되어야 한다. 어떤 변형이 돌연변이 혹은 환경적 영향 때문에 후속 세대에 일어날 수 있기 때문에 사실 상기 자손은 부모 세포와 동일하지는 않지만, 본 명세서에서 사용된 바와 같이 상기 용어의 범주 내에서 여전히 포함된다.
"백신" 또는 "백신 조성물"은 본원에서 상호 교환하여 사용될 수 있으며, 동물에서 면역 반응을 유발하고/하거나, 질병 또는 감염에 의한 사망 가능성으로부터 동물을 보호하는 1종 이상의 면역학적 활성 성분을 포함하는 약학적 조성물을 말하며, 이것은 활성 성분의 면역학적 활성을 증대시키는 1종 이상의 추가적인 성분들을 포함할 수도 있고 포함하지 않을 수도 있다. 백신은 약학적 조성물에 전형적인 그 밖의 성분들을 추가적으로 포함할 수 있다.
항원 또는 백신 조성물에 대한 "면역 반응"은, 피험체에서, 관심있는 항원 또는 백신 조성물 중에 존재하는 분자에 대해 체액성 및/또는 세포 매개성 면역 반응이 발생되는 것이다. "체액성 면역 반응"은 항체 매개성 면역 반응으로서 본 발명의 항원/백신에 대한 친화성을 갖는 항체의 생성을 포함하는 한편, "세포 매개성 면역 반응"은 T 림프구 및/또는 다른 백혈구에 의해 매개되는 것이다. "세포 매개성 면역 반응"은 주요 조직 적합성 복합체(MHC)의 클래스 I 또는 클래스 II 분자와 회합된 항원성 에피토프의 제시에 의해 유발된다.
"면역학적 유효량"이란, 당업자에게 공지되어 있는 표준 분석법에 의해 측정시, 세포성(T세포) 또는 체액성(B 세포 또는 항체) 반응 중 어느 하나의 면역 반응을 유발하기에 충분한 항원 또는 백신의 양을 말한다. 면역원으로서의 항원의 유효성은 증식 분석법, 세포 용해 분석법, 예컨대 T 세포가 그 특정 표적 세포를 용해시키는 능력을 측정하는 크롬 방출 분석법에 의해, 또는 혈청 중의 항원에 특이적인 순환 항체 수준을 측정함으로써 B 세포 활성 수준을 측정하는 것의 의해 측정할 수 있다. 또한, 면역 반응의 보호 수준은, 주사된 항원으로 면역화된 숙주를 항원 공격함으로써 측정할 수 있다.
“투여” 및 유사 용어는 조성물, 예를 들면, 플라스미드와 운반체의 혼합물을 치료 개체에 전달하여, 상기 조성물이 신체 부위에 전달되고 상기 플라스미드가 표적 세포를 트랜스펙션시키도록 하는 것을 의미한다. 따라서, 조성물은 예로써 전신 투여, 전형적으로 피하, 근육내, 정맥내, 또는 복강내 투여에 의해 개체에 투여된다. 하지만, 당분야에 공지된 바와 같이, 심근 유전자 전달을 수행하기 위한 전달 옵션에는 심외막(epicardial), 심내막(endocardial), 관상동맥내(intracoronary), 역관류(retroperfusion), 심막내(intapericardial) 투여 경로가 포함된다(J.M. Isner, supra). 모든 유형의 벡터는 심외막과 심내막 투여 경로를 통한 심근내 주입 및 심막내 주입에 의해 전달될 수 있다. 관상동맥내와 역관류 전달은 바이러스 벡터 또는 다른 벡터에 의해 보호되지 않는 플라스미드 DNA의 순환기내 분해로 인하여, 비-바이러스 유전자 전달 또는 다른 유전자 전달 방법에 적합하지 않다.
"예방"은 질환 또는 질병을 보유하고 있다고 진단된 적은 없으나, 이러한 질환 또는 질병에 걸리기 쉬운 경향이 있는 동물에서 질환 또는 질병의 발생을 억제하는 것을 의미한다.
"치료"는 (a) 질환 또는 질병의 발전의 억제; (b) 질환 또는 질병의 경감; 및 (c) 질환 또는 질환의 제거를 의미한다. 따라서, 본 명세서에서 용어 “치료학적 유효량”은 상기한 약리학적 효과를 달성하는 데 충분한 양을 의미한다.
치료 목적을 위한 "포유류"는 인간, 가축 및 농장 가축 및 동물원, 스포츠 혹은 개, 말, 고양이, 소, 원숭이 등의 애완용 동물을 포함하여 포유류로 분류되는 어떠한 동물도 가리킨다. 바람직하게는 상기 포유류는 돼지이다.
"돼지(porcine, swine, pig)", "양돈", "육돈"은 상호 교환하여 사용될 수 있으며, 멧돼지과(Suidae)의 일원인 임의의 동물을 지칭한다.
*본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 본 발명의 관련 분야에서 통상의 당업자가 일반적으로 이해하는 바와 같은 의미로 사용된다. 또한 본 명세서에는 바람직한 방법이나 시료가 기재되나, 이와 유사하거나 동등한 것들도 본 발명의 범주에 포함된다. 본 명세서에 참고문헌으로 기재되는 모든 간행물의 내용은 본 발명에 도입된다.
이하, 본 발명을 상세히 설명한다.
본 발명은 유전자의 세포 표면 발현 시스템을 이용한 것으로, 돼지 써코바이러스2(PCV2) 항원 유전자가 살모넬라 표면에 발현되는 것을 특징으로 하는 살모넬라 백신 균주에 관한 것이다.
구체적으로, 살모넬라 균주 유래의 세포외막 단백질을 암호화하는 유전자 및 돼지 써코바이러스2(PCV2) 유전자 일부를 암호화하는 DNA서열을 함유함을 특징으로 하는 세포표면 발현용 재조합 발현벡터; 및 이러한 재조합 발현벡터로 형질전환시킨 살모넬라 균주에 관한 것으로, 살모넬라 감염 또는 PCV2 감염 관련 질환 예방 및 치료 시스템에 관한 것이다.
본 발명은 살모넬라 균주 유래의 세포외막 단백질A(OmpA) 및 PCV2 유전자를 기본 벡터에 삽입하여 살모넬라 균주에 형질전환시키고, 당해 분야에 통상의 기술을 가진 자에게 공지된 표준 클로닝 기술 및 통상적인 방법을 이용하여 살모넬라 표면에 안정적으로PCV2 단백질을 발현시킴으로써 구현할 수 있다.
본 발명은 일 관점에서 살모넬라 균주 유래의 세포외막 단백질 및 PCV2 유전자 일부를 암호화하는 DNA서열을 함유하는, 세포표면 발현용 재조합 발현벡터에 관한 것이다.
벡터는 유전 물질(핵산)로 이루어진 구조물을 말한다. 전형적으로, 발현 벡터는 세균 숙주 세포에서 작용성인 복제 개시점, 및 발현 벡터를 포함하는 세균 숙주 세포를 검출하기 위한 선택성 마커를 함유한다. 본원에 기술된 특정 태양에서, 발현 벡터는 폐쇄된 원형 DNA 분자이다.
세포 표면 발현은 단백질이나 펩타이드 등을 적절한 표면 발현 모체(surface anchoring motif)와 융합시켜서 그램 음성, 양성균,곰팡이, 효모, 동물세포의 표면에 발현 시키는 기술을 말한다. 예를 들어, 박테리아나 효모와 같은 미생물의 표면 단백질을 표면 발현 모체로 사용하여 외래 단백질을 미생물 표면에 안정적으로 발현시키는 것이다.
미생물에서 세포 표면 발현을 성공적으로 수행하기 위해서는 우선 세포 표면에 발현시키고자 하는 외래 단백질을 세포 표면까지 안정적이며 효율적으로 이동시킬 수 있는 표면 발현 모체의 사용이 요구된다. 즉, 성공적인 세포표면 발현기술을 위해서는 상기 표면발현 모체가 가장 중요하다. 다시 말하면, 이 기술의 핵심은 외래단백질을 효과적으로 세포표면에 발현시킬 수 있는 모체의 선정 또는 개발에 있다. 따라서, 표면발현 모체는 외래단백질을 세포표면까지 보내기 위해 세포내막을 통과할 수 있도록 도와주는 분비신호가 있고, 둘째 세포 외막 표면에 안정되게 외래단백질이 부착될 수 있도록 도와주는 표적신호가 있으며, 셋째 세포 표면에 다량으로 발현되나 세포의 성장에 거의 영향을 미치지 않고, 단백질의 크기에 관계없이 외래단백질의 3차원 구조에 변화없이 안정적으로 발현될 수 있어야 한다.
이러한 표면발현 모체는 외막 단백질, 포자단백질, 리포단백질(lipoprotein), 자기전달체(autotranspoters) 및 표면 부속물(surfaceappendage)의 S층(S-layer) 단백질 등이 있다. 그 중에서 세포외막 단백질의 경우 그 3차원적인 구조가 세포외막을 통과하는 루프 구조를 가지고 있으므로, 다양한 단백질을 발현할 수 있는 융합 사이트(fusion site)를 제공할 수 있는 장점으로 인하여 표면 발현 모체로 많이 사용된다. 세포외막 단백질로는 OmpA, OmpS, LamB, OprF, PhoE 등을 예로 들 수 있다.
본 발명에서는 이러한 세포외막 단백질을 표면발현 모체로 사용하는 것을 특징으로 한다.
예를 들어, 상기 세포외막 단백질은 OmpA, OmpS, LamB, OprF, OmpC, PhoE 및 FadL로 구성된 군에서 선택될 수 있고, 가장 바람직하게는 OmpA를 사용할 수 있다.
OmpA는 b-barrel 구조를 외막(outer membrane) 안에서 형성하고 있다. 표면 밖으로 4개의 루프(loop)를 형성하고 있으며 이 루프를 이용하여 세포 표면발현 기술에 적용한다.
OmpA 단백질은 325개의 잔기로 이루어진 단백질이며 2개의 도메인을 가지고 있는데, N-terminal transmembrane (TM) 도메인 약 170개 및 C-terminal periplasmic 도메인 약 136개 정도로 이루어져 있다. 가운데는 Ala-Pro rich hinge region이 자리 잡고 있다. 본 발명에서는 N-말단 TM(transmembrane) 도메인을 표면 발현 모체로 이용하였다. 따라서, Omp A의 TM 도메인 서열만 포함해도 본 발명의 재조합벡터 기능인 세포 표면 발현(cell surface display)이 가능하다.
또한, 상기 세포외막 단백질은 살모넬라 유래인 것이 바람직하다. 살모넬라 세포외막 단백질(Omp) 항원은 혈청형별로 공통되는 항원을 가지면서 살모넬라 면역에 중요하게 인식되는 세포성 면역과 체액성 면역을 동시에 활성화시키는 면역물질로 인식되고 있다. 예를 들어, 살모넬라 티피 또는 살로넬라 티피무리움 유래일 수 있고, 바람직하게는 살로넬라 티피무리움 유래이다.
살모넬라 균주로부터 Omp를 획득하는 방법은 공지된 방법 즉, Arockiasamy 등(Analytic Biochemistry 283, 2000) 또는 Yuichi 등(Infection and Immunity 61, 1993)에 기재된 방법에 따라 수행되어질 수 있다.
본 발명의 일 실시예에서는 살모넬라 티피무리움 유래의 OmpA를 세포 표면 발현 모체로 사용한 벡터를 제작하였다. 상기 살모넬라 티피무리움 유래의 OmpA의 서열로는 대표적으로 서열번호 1의 서열을 사용할 수 있다. 그리고, 그 중에서 특히 중요한 N-말단 TM(transmembrane) 도메인을 서열번호 2로 기재하였다.
본 발명의 상기 표면 발현용 벡터는 표면 발현 모체로 OmpA 같은 세포외막 단백질을 사용하고 돼지 써코바이러스2(PCV2) 항원 유전자 일부를 암호화하는 DNA서열을 함유한다.
"PCV2 항원"이란 용어는 숙주에서 PCV2에 대한 면역 반응을 유도하는 아미노산 서열을 의미하는데, 이는 임의의 PCV2 단백질의 전장의 서열, 이의 유사체 또는 이의 면역원성 단편을 포함한다. "면역원성 단편"이란 하나 이상의 에피토프를 포함하여 숙주에서 면역 반응을 유도하는 단백질의 단편을 의미하는데, 이러한 단편은 당업계에 공지된 임의의 수의 에피토프 지도작성 기술을 이용하여 동정할 수 있다.
특히, PCV2 항원 유전자의 ORF1, ORF2, ORF3, ORF4, ORF5,ORF6, ORF7 및 이들의 조합으로 구성된 군에서 선택되는 PCV2 오픈 리딩프레임(ORF) 서열을 함유하는 것이 바람직하고, 가장 바람직하게는 PCV2 ORF2 DNA 서열을 함유한다. 예를 들어 서열번호 3으로 표시되는 DNA 서열일 수 있다.
상기 PCV2 항원 유전자 일부를 암호화하는 DNA서열, 가장 바람직하게는 PCV2 ORF2 DNA 서열은 OmpA 단백질을 암호화하는 유전자 서열 중 TM 도메인을 코딩하는 서열과 융합되는 것을 특징으로 한다.
한편, 상기 세포외막 단백질을 코딩하는 유전자 및 PCV2 항원유전자 서열은 "생물학적으로 기능적 등가"인 유전자 서열도 포함한다. 따라서, 상기 유전자의 아미노산과 동일한 또는 기능적으로 등가인 아미노산의 약 70% 내지 약 90% 상동성을 가지는 서열은 단백질의 생물학적 활성이 유지된다는 조건을 가진다면 생물학적으로 기능적 등가의 서열이 될 수 있다.
본 발명에서, 상기 세포외막 단백질을 코딩하는 유전자 및 PCV2 항원 유전자 서열은 일반적으로 공지된 방법을 통해 벡터에 삽입할 수 있다.
통상적으로, 하나 이상의 제한 효소로 DNA 서열 및 벡터를 절단하고 단편들을 함께 결찰하여 최종적으로 발현될 DNA 서열을 벡터에 결합시킨다. 제한 효소 소화처리 및 결찰은 당업자들에게 익히 알려졌다.
벡터로는 상기 세포외막 단백질(예를 들어, OmpA)을 코딩하는 유전자 및 PCV2 항원 유전자(예를 들어 PCV2 ORF2)을 발현시킬 수 있는 프로모터와 클로닝을 위한 멀티 클로닝사이트를 가지고 있는 임의의 발현벡터를 제한없이 사용할 수 있으나, 특히, 플라스미드 또는 박테리아성 벡터를 사용하는 것이 바람직하다. 본 발명의 일 실시예에서는 E. coli 벡터인 pGEX 4T-1(Amersham, cat : 27458001)를 사용하였다.
그리고, 상기 벡터 내에서 상기 세포외막 단백질을 코딩하는 유전자 및 PCV2 항원 유전자는 하나의 프로모터 또는 별개의 프로모터에 작동 가능하게 연결될 수 있다.
본 발명의 벡터에 포함되는 프로모터는 종래 알려진 임의의 프로모터가 포함된다. 상기 프로모터에는 원핵 생물, 곰팡이,식물 및 동물에서 작용하는 프로모터가 포함될 수 있는데, 특히, 박테리아 벡터에서 작용하는 프로모터를 사용할 수 있다.
상기 프로모터로 바람직하게는 trc, lac, tac, lacUV5-t7 hybrid 등과 같은 Lac operon based 프로모터가 포함되나, 이들 예에 한정되는 것은 아니다. 본 발명의 일 실시예에서는 tac 프로모터를 사용하였다.
한편, 본 발명의 발현벡터는 통상적으로 DNA 발현에 필요한 조절 요소 이외에, 다른 요소가 또한 DNA 분자에 포함될 수 있다.
이러한 추가 요소는 인핸서(enhancer)를 포함한다. 인핸서는 인간 액틴, 인간 미오신, 인간 헤모글로빈, 인간 근육 크레아틴 및 바이러스 인핸서, 이를테면 SV40, RSV, 및 EBV 인핸서, 거대세포 바이러스 최조 인핸서, 폴리오마 인핸서, 아데노바이러스 인핸서 및 레트로 바이러스 LTR 인핸서를 포함한 그룹중에서 선택될 수 있으나, 이들에만 한정되지 않는다.
전사 개시 및 조절 부위를 함유하는 것 이외에, 발현 벡터는 또한 전사 종결에 필요한 서열 및 전사 영역에서 전사에 대한 리보좀 결합 부위를 포함할 수 있다. 예를 들어, 전사체의 적절한 폴리아데닐화 반응을 위해 발현 구조체에 폴리아데닐화 시그날이 포함될 수 있다. 폴리아데닐화 시그날의 성질은 본 발명의 성공적인 실행에 중요한 것으로 보지는 않으며, 임의 서열이 이용될 수 있다. 이 밖에도 당업자들이라면 발현 벡터에 유용한 다수의 조절 서열을 알 수 있을 것이다.
또한, 발현 벡터는 재조합 벡터 작제물을 함유하는 세포의 부차집단을 선택할 수 있는 선택 마커를 포함할 수 있다. 마커는 본원에 개시된 융합서열을 함유하는 동일 벡터에 함유될 수 있거나, 별도의 벡터상에 존재할 수도 있다. 선택성 마커는 발현되었을 때, 선택성 마커를 포함하지 않는 세로로부터 세포의 용이한 확인, 분리 선별을 할수 있도록 세포에 확인가능한 특징을 부여하는 핵산 서열을 말한다. 당분야에 공지된 임의 선택성 마커도 본 발명의 핵산에서 선택성 마커로 사용될 수 있다.
특히, 본 발명의 상기 재조합벡터를 이용하여 PCV2 항원 유전자를 발현함에 있어서, Lac 오페론에서 베타 갈락토시다아제가 만들어질때 유도물질로 작용하는 IPTG(Isopropyl-β-D-Thiogalactopyranoside)를 이용하는 것이 바람직하다.
IPTG는 β-galactosidase의 활성의 유도물질로서, lac 프로모터나 tac 프로모터를 갖는 발현 벡터의 발현 유도제로써 사용할 수 있다. 즉, IPTG로 PCV2 항원 유전자 발현을 on/off 시킬 수 있으며, 이를 이용하여 IPTG로 PCV2 항원 생산시 효율성을 조절할 수 있다.
즉, 본 발명의 재조합벡터는 이하와 같은 장점을 가진다.
ㆍ살모넬라 유래 OmpA를 표면 발현 모체로 사용하여 PCV 항원 유전자의 세포표면 발현율을 높임
ㆍ박테리아성(예를 들어, E. coli) 벡터를 사용하는 경우 IPTG(Isopropyl-β-D-Thiogalactopyranoside)를 이용하여 PCV 항원 유전자의 과발현이 가능함
ㆍ약 20kda 정도의 다소 큰 분자량을 가지는 PCV2 ORF2 바이러스성 단백질을 살모넬라의 표면에 발현시킬 수 있음.
또한, 본 발명은 다른 관점에서 상기 재조합 벡터로 형질전환된, PCV2 항원 유전자(예를 들어, PCV2 ORF2)을 발현하는 살모넬라 균주; 및 살모넬라 또는 PCV2 감염에 따른 질환의 치료 또는 예방용 백신으로서의 이의 용도에 관한 것이다.
살모넬라 균주는 장관계의 Peyer's patch의 M 세포를 통과해 Peyer's patch내 또는 림프절에서 사이토카인을 발현함으로써 paracrine(인접 세포에 작용) 또는 endocrine (먼거리에 존재하는 세포에 작용) 형태의 효력을 발휘할 수 있으므로, 살모넬라는 이와 같이 M 세포를 통과해 숙주 전체에 효과를 발휘할 수 있는 사이토카인 유전자를 발현할 수 있다
본 발명에 있어서 살모넬라 균주(숙주)는 살모넬라 티피뮤리움, 살모넬라 더비, 살모넬라 스크와젠그론드, 살모넬라 브렌더럽, 살모넬라 엠반다카, 살모넬라 뉴우포터, 살모넬라 엔테라이티디스, 살모넬라 갈리나룸, 살모넬라 풀로룸 등이 있으며, 바람직하게는 축종에 관계없이 감염되고 병원성이 강한 균종인 살모넬라 티피뮤리움, 살모넬라 브렌더럽 또는 살모넬라 엔테라이티디스를 사용하는 것이 바람직하다. 가장 바람직하게는 살모넬라 티피무리움일 수 있다. 상기 본 발명에 사용가능한 균주들은 국립수의과학검역원에서 자유로이 분양받을 수 있다. 본 발명의 일 실시예에서는 살모넬라 typhimurium H683 Δasd 균주를 사용하였다.
상기 균주들을 이용하여 세포 표면에 PCV2 항원 유전자(예를 들어, PCV2 ORF2)를 발현하는 재조합 살모넬라 균주는 당업계에서 통상적으로 사용하는 형질전환방법에 의하여 제조 가능하다. 당분야의 기술적 범주에서 통상의 분자 생물학, 미생물학, 면역학 및 재조합 DNA 기술 등을 사용할 수 있다. 본 발명의 일 구체예로써 제조된 재조합 살모넬라 균주는 기탁번호 KCCM 11099P의 재조합 살모넬라 균주이다.
상기 제작된 재조합 살모넬라 균주는 경구 투여방법으로 다양한 재조합 단백질의 강력한 생리 활성들을 숙주의 장 관계뿐만 아니라 몸 전체에 미치게 할 수 있다.
특히, 비병원성의 살모넬라 균주 표면에 외래 면역원인 PCV2 유전자(예를 들어, PCV2 ORF2)을 발현시켜 살아있는 상태(live)로 경구투여할 경우 종래의 약독화된 병원성 세균이나 바이러스를 이용한 백신들보다 더 지속적이고 강한 면역반응을 유도할 수 있다. 이러한 면역반응 유도는 살아있는 상태의 살모넬라 균주에 대한 체내의 면역 반응에 의한 것으로, 살모넬라의 표면 구조물들이 표면 발현된 외래단백질 PCV2 ORF2의 항원성(antigenicity)을 증가시키는 보조제(adjuvant)로서 작용하기 때문이다. 따라서, 이러한 표면발현 시스템을 이용한 비병원성 살모넬라 균주의 재조합 생백신은 기존의 PCV2 감염의 치료 또는 예방용 백신보다 더욱 효과적이다.
본 발명은 또 다른 관점에서, (a) 상기 재조합 살모넬라를 배양하여 PCV2, 바람직하게는 PCV2 ORF2 단백질을 살모넬라 표면에 발현하는 단계; 및 (b) 상기 PCV2, 바람직하게는 PCV2 ORF2 단백질이 표면발현된 살모넬라를 회수하는 단계를 포함하는, PCV2 ORF2 단백질이 표면발현된 재조합 살모넬라를 제조하는 방법에 관한 것이다.
본 발명의 PCV2 단백질은 발현벡터에 함유된 살모넬라 티피무리움 유래의 OmpA 단백질에 의하여 미생물의 표면으로 이동하여 위치하게 된다.
상기 PCV2 단백질은 그 기능을 잃지 않으면서, 미생물의 표면에 발현되기 때문에, 미생물에 표면발현된 상태로 사용될 수 있으며, 미생물에 표면발현된 채로 동물에 투여되어 동물 체내에서 PCV2에 대한 면역반응을 유도할 수도 있다.
이처럼, 본 발명의 주요한 특징은 살모넬라 균주 유래의 세포외막 단백질, 가장 바람직하게는 OmpA를, PCV2 유전자, 특히 PCV2 ORF2의 새로운 표면발현 모체로 활용하여, 외래단백질 PCV2 ORF2를 살모넬라 균주의 표면에 효과적으로 발현시키는 것이다.
본 발명의 상기 시스템은 하기와 같은 장점을 가진다.
ㆍ살모넬라 또는 PCV2 감염 예방에 필수적인 세포성 면역과 체액성 면역을 동시에 자극할 수 있어 효능이 뛰어남.
ㆍ항원이 발현된 살모넬라 균주만을 이용할 수 있기 때문에 생산비가 절감되어 경제적인 백신 상용화가 가능함
ㆍ재조합 살모넬라 균주만을 이용하여 과량의 항원이 필요 없어 백신으로 인한 부작용을 감소시킬 수 있음
ㆍ비병원성 살모넬라를 이용하여 경구투여 백신 개발의 기초기술로 응용 가능함
ㆍ비병원성 또는 섭취 가능한 미생물(GRAS)을 이용한 백신 개발에 응용 가능함.
한편, 본 발명의 또 다른 관점에서, 본 발명은 상기에서 설명한 살모넬라 균주를 함유하는 것을 특징으로 하는 면역증강용 약학조성물에 관한 것이다. 상기 면역증강 활성은 PCV2 유전자가 발현되거나 살모넬라 감염으로 인해 생기는 것이다.
"약학 조성물"은 생리적으로 적합한 담체 및 부형제와 같은 다른 화학적 성분을 가지는, 본 명세서에서 설명된 하나 이상의 활성 성분이나 제제의 제조물을 칭한다. 약학 조성물의 목적은 화합물을 유기체에 투여하는 것을 용이하게 하는 것이다.
바람직한 형태로서, 조성물은 당업자에게 공지된 추가 성분을 포함할 수 있고, 하나 이상의 수의학적으로 허용되는 담체를 포함할 수 있다. "수의학적으로 허용되는 담체"는 임의의 모든 용매, 분산 매질, 코팅제, 보강제, 안정제, 희석제, 보존제, 항균제 및 항진균제, 등장제, 흡수지연제 등을 포함한다.
상기 조성물은 예를 들어, 상기 PCV2 ORF2 단백질을 발현하는 살모넬라 균주를 포함하는 조성물을 의미한다. 또한 세포 배양물 상청액의 일부를 포함할 수 있다.
본 발명의 약학적 조성물은 경구 혹은 비경구적으로 투여할 수 있다. 바람직하게는 경구로 투여한다.
경구제로서는 과립제, 산제, 정제, 캡슐제, 용제, 유제 혹은 현탁제 등의 제형으로 할 수 있다. 비경구제로서는 주사제, 점적제, 외용약제 혹은 좌제(座劑) 등의 제형을 선택할 수 있다. 주사제에는 피하 주사제, 근육 주사제 혹은 복강내 주사제 등을 나타낼 수 있다. 외용약제에는 경비 투여제 혹은 연고제 등을 나타낼 수 있다. 주성분인 본 발명의 약제를 포함하도록 상기 제형으로 하는 제제 기술은 공지되어 있다.
예를 들면, 경구 투여용 정제는 본 발명의 약제에 부형제, 붕해제, 결합제 및 활택제 등을 추가하여 혼합하고 압축 성형함으로써 제조할 수 있다. 부형제에는 유당, 전분 혹은 만니톨 등이 일반적으로 사용된다. 붕해제로서 는 탄산칼슘이나 카르복시메틸셀룰로오스칼슘 등이 일반적으로 사용된다. 결합제에는 아라비아 고무, 카르복시 메틸셀룰로오스 혹은 폴리비닐피롤리돈이 사용된다. 활택제로서는 탈크나 스테아린산 마그네슘 등이 공지의 것이다.
상기 조성물에 함유된 살모넬라 균주는 경구 투여에 의하여 재조합 단백질의 생산을 편리하게 유도할 수 있으므로, 상기 살모넬라 균주를 함유하는 조성물은 경구투여용 사료첨가제인 것이 가장 바람직하다.
또한, 당업자는 본 발명에 사용된 조성물이 공지된 주사성 생리학적으로 허용되는 멸균 용액을 포함할 수 있음을 이해할 것이다. 비경구 주사 또는 주입을 위한 즉석제조 용액(ready-to-use solution)의 제조 시에는, 식염수 또는 대응하는 혈장 단백질 용액과 같은 등장성 수용액을 쉽게 이용할 수 있다. 또한, 본 발명의 면역원성 및 백신조성물은 희석제, 등장제, 안정제 또는 보강제를 포함할 수 있다. 희석제는 물, 식염수, 덱스트로스, 에탄올, 글리세롤 등을 포함할 수 있다. 등장제는 특히 염화나트륨, 덱스트로스, 만니톨, 소르비톨 및 락토스를 포함할 수 있다. 안정제는 특히 알부민 및 에틸렌디아민테트라아세트산의 알칼리 염을 포함한다
또한, 본 발명의 약학적 조성물을 고형, 액상 혹은 반고형상 조성물로 함으로써 외용제로 할 수 있다. 고형 혹은 액상의 조성물에 관해서는 상기에 설명한 바와 같은 조성물로 함으로써 외용제로 할 수 있다. 반고형상 조성물은 적당한 용제에 필요에 따라 증점제를 추가하여 제조할 수 있다. 용제에는 물, 에틸알코올 혹은 폴리에틸렌글리콜 등을 사용할 수 있다. 증점제에는 일반적으로 벤토나이트, 폴리비닐알코올, 아크릴산, 메타크릴산 혹은 폴리비닐 피롤리돈 등이 사용된다. 이 조성물에는 염화벤잘코늄 등의 보존제를 추가할 수 있다. 또한, 담체로서 카카오유지와 같은 유성 기제, 혹은 셀룰로오스 유도체와 같은 수성 겔 기제를 조합함으로써 좌제로 할 수도 있다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 대상 동물의 연령, 체중, 성, 질병 증상의 정도, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 목적하는 치료에효과적인 투여량을 용이하게 결정 및 처방할 수 있다.
"PCV2 항원의 유효량"이란 PCV2 항원이 면역 반응을 유도하거나 유도할 수 있는 항원의 양을 의미하지만, 이에 국한되는 것은 아니다. 유효량은 적어도 10주, 바람직하게는 적어도 12주, 더욱 바람직하게는 적어도 15주, 가장 바람직하게는 적어도 20주의 면역 지속기간(DOI)을 부여하는 항원의 양으로서 정의되는 것이 바람직하다.
일반적으로, 상기 조성물에 포함되는 살모넬라 균주는 필요에 따라 적정의 농도로 동물에게 접종될 수 있다. 예를 들어, OD 600에서 OD값을 측정 후 대상 동물에 약 0.5 ~ 1.5 1x10^10 CFU/ml 값으로 접종시킬 수 있고, 본 발명의 일 실시예에서는 1x10^10 CFU/ml 의 값으로 접종하였습니다.
그러나, 투여량은 이에 한정되지 않고, 제형의 종류, 투여 방법, 연령이나 체중, 증상 등을 고려하여 최종적으로는 수의사의 판단에 의해 적절히 결정할 수 있다
또 다른 관점에서, 본 발명은 살모넬라 감염 또는 PCV2 감염과 관련이 있거나 이들의 감염에 의한 임상 증상을 감소시키기 위한 치료 또는 예방하는 방법에 관한 것으로서, 이러한 치료를 필요로 하는 동물에게 전술한 PCV2 항원 유전자를 표면에 발현하고 있는 재조합 살모넬라 균주 백신 또는 이를 함유하는 조성물의 유효량을 투여하는 단계를 포함한다.
특히, 본 발명은 "어린 동물"에서 효과적인데, 이는 1 내지 35일령의 동물을 의미하고, 일령이 적을수록 바람직하다. 따라서 가장 바람직하게는 1 또는 2일령의 동물을 의미한다. 그리고 본 명세서에 사용된 "동물"은 돼지(swine), 돼지(pig) 또는 새끼돼지를 의미한다.
PCV2의 감염은 주로 접촉감염에 의해 전파되고 태반감염에 의해 전파되는것으로 알려져 있다.
PCV2 감염에 의한 임상 증상은 (1) 소엽사이 부종이 있는 간질성 폐렴, (2) 창백한 피부 또는 황달, (3) 얼룩덜룩한 위축성 간, (4) 위궤양, (5) 신장염,(6) 생식기 장애, 예컨대 유산, 사산, 미라 등, (7) 일반적으로 로소니아 인트라셀룰라리스 감염(회장염)과 관련이 있는 것으로 알려진 연막계 병변, (8) 림프절병증, (9) 림프구 부족 및/또는 (10) 다핵/거대 조직구, (11)돼지 피부염 및 신장병 증후군(PDNS), (12) PCVAD 관련 사망률, (13) PCVAD 관련 체중 감소, (14) 감퇴된 성장변동성, (15) 감소된 빈도의 '왜소병' 및 (16) 감소된 돼지 생식기 및 호흡기 질환 합병증(PRRSV)으로의 공동감염을 포함하지만, 이에 국한되는 것은 아니다.
PCV2 감염에 따른 질환은 대표적으로 이유후 전신성 소모성 증후군(Postweaning Multi-systemic Wasting Syndrome; PMWS)을 들 수 있다. 이유성 전신성 소모성 증후군은 자돈에서 모체이행항체가 떨어지는 6주에서 16주령 사이에 발생하는데 특히 8-12주령의 돼지에서 집중적으로 발생한다. 특히, 상기 이유후 전신성 소모성 증후군(PMWS)의 경우 체중손실, 수척, 전형적인 위축증상, 호흡곤란, 황달, 설사, 기침, 중추신경계 불안 등의 임상증상을 보인다.
한편, 살모넬라 감염에 따른 질환은 대표적으로 살모넬라증(Salmonellosis)을 들 수 있다. 살모넬라증(Salmonellosis)은 살모넬라 감염에 의한 돼지의 급성 또는 만성의 소화기전염병으로 일명 돼지 파라타이포이드(paratyphoid)라 불리우며 위장염 및 패혈증을 특징으로 하고 주로 비육기에 많이 발생한다. 특히 써코와 복합 감염되어 폐사율을 30~50%까지 올리는 주범이기도 하다.
살모넬라증은 전 세계적으로 발생되며, 돼지에서 질병을 일으키는 중요한 Salmonella의 혈청형은 S. choleraesuis 와 S. typhimurium 이다. 어린돼지의 급성패혈증을 일으키는 S. choleraesuis 및 S. typhisuis는 돼지에서만 병을 일으키는 특성이 있다. 국내의 경우 S. typhimurium에 의한 경우가 흔한 것으로 알려져 있다. 특히, 급성패혈증형은 2-4개월령의 어린 돼지에서 흔히 발생하며, 주된 증상은 체온상승(41-42℃), 원기소실과 식욕감퇴, 귀주위와 다리부위에 청색증(cyanosis)이 생기며, 발병 2-4일 이내에 대부분 폐사된다. 급성 장염형은 비육기 가축에 주로 발생되며 식욕이 일정하지 않고 심한 수양성 설사와 고열, 원기쇠약, 폐염 및 신경증상을 동반하며 중증의 경우 피부변색이 나타난다. 만성 장염의 경우는 계속적인 설사로 인하여 심하게 여위여 있고 초기 황백색 또는 회백색의 연변에서 점차적으로 젤라틴 양의 점액성 설사로 변하고 설사변은 장점막상피세포의 괴사편을 함유하고 있으며 간혹 혈액이 섞여 있는 경우도 있다.
본 발명의 재조합 살모넬라 균주는 이러한 살모넬라뿐만 아니라 PCV2 바이러스에 의해 발생하는 질병예방에 효과적인 다가 백신으로 매우 유용하다.
(실시예)
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다.
이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
재료준비
사용된 salmonella strain은typhimurium H683 Δasd cell line(제주대학교 수의과대학)로서, 세포 배양시 TSB 배지에 2,6 Diaminopimelic acid (DAP)를 50 ug/ml 로 사용하였고, 37℃ 및 160 rpm의 조건하에서 배양하였다.
실시예 1 : PCV2 표면 발현용 벡터 제작
우선 준비된 비병원성의 salmonella typhimurium H683 Δasd 세포주로부터 OmpA 부분 유전자(a.a -21 to 159)의 클로닝을 진행하였다.
표 1
Oligonucleotide Sequence (5' -> 3') 특징
OmpA-21 atgaaaaagacagctatcgcg (서열번호 4)
OmpA+324 ttaagcctgcggctgagttac (서열번호 5)
sdv1 F' CCTATACTAGGATGAAAAAGACAGCTATCGCG (서열번호 6) EcoNI
sdv1 R' GGATCCGGTGCCGATGGTGTTGGCATCACCG (서열번호 7) BamHI
PCV2-TA F' cgccATGACGTATCCAAGGAGGCG(서열번호 8) ATG
PCV2-TA R' TTAAGGGTTAAGTGGGGGGTCTTTAAG(서열번호 9) stop
PCV2-S F' GTCGACATATGACGTATCCAAGGAGG(서열번호 10) Sal I & ATG
PCV2-S R' GCGGCCGCATGATGATGATGATGATGAGGGTTAAGTGGGGGGTC(서열번호 11) Not I & his taq
DNA sol kit을 사용하여 배양된 salmonella typhimurium H683 Δasd으로부터 genomic DNA를 준비하고, 표 1에 기재되어 있는 대로, 상기 Genomic DNA을 주형으로 사용하여 하기 sdv1 F', sdv1 R' 프라이머로 OmpA(-21 to 159 a.a.)를 PCR 수행 후 도 1에 나타낸 TA vector(pcr2.1, invitogen)로 클로닝 하였다. 한편, PCV2 ORF2는 recombinant baculovirus seed(PRO-VAC®CIRCOMASTER, 코미팜)로부터 PCV2-TA F’, PCV2-TA R’ 프라이머를 사용하여 TA vector로 cloning을 하였다. 이러한 OmpA 및 PCV2 ORF2의 TA 클로닝 원리를 도 2에 나타내었다.그리고, 도 3에 나타낸 pGEX 4T-1 vector(연세대학교, 기탁번호?)를 surface display vector의 기본 벡터로 사용했다. 상기 pGEX-4T-1의 대부분의 system은 그대로 유지를 하면서 EcoNI 과 BamHI을 처리하여 GST taq 부분을 제거하였다. 그리고 동일 제한효소 EcoNI 와 BamHI을 이용하여 클로닝한 ompA partial gene(a.a -21 to 159)을 삽입하여 표면발현 벡터(sdv1 으로 명명)로서의 기본 vector를 완성하였다(도 4). 그리고, 상기 클로닝한 PCV ORF2 gene을 sdv1 vector와 클로닝하기 위해서 다시 PCV2-S F' 와 PCV2-S R' primer를 사용하여 클로닝을 진행하였다. 이 때 5’end에는 Sal I site를 넣었고, 3’end에는 Not I site 와 his taq을 클로닝하였다. 이렇게 만들어진 PCV2 ORF2 gene을 Sal I과 Not I enzyme site를 이용하여 sdv1 vector로 cloning 진행하였다. 즉, sdv1 vector와 PCV2 ORF2 gene을 ligation 하여 sdv1PCV2 vector를 완성하였다.(도 5) 상기 sdv1PCV2 vector의 개열지도를 도 13에 나타내었다.그 결과, tac promoter에 의하여 GST 대신 ompA(a.a -21 to 159)와 PCV2 ORF2가 융합 되어 발현하였다. 또한 amp+ 있어서 selection에 용이하였다.실시예 2 : 형질전환 및 PCR에 의한 확인 salmonella 표면에 외부 단백질인 PCV2 ORF2 단백질을 발현시키기 위하여 sdv1PCV2 vector를 제작하였고, salmonella typhimurium H683 Δasd cell line에 이 벡터를 형질전환(transfection) 하는데 있어서 CaCl2을 이용한 화학적 형질전환(chemical transfection) 방법을 사용하였다. 우선 얼음에서 30 min간 인큐베이션 후 42℃에서 90 초 동안 열 충격(heat shock)을 가한 후, 다시 얼음에서 10분간 인큐베이션하였다. 형질전환 후 2 hr 동안 LB(amp-)에서 전-배양(pre-culture) 후 LA(amp+)에 도말 하였다. 이렇게 만들어진 세포주 Sal-sdv1PCV2를 기탁하고(KCCM 11099P), PCR 방법을 이용하여 확인하였다. Sal-sdv1PCV2를 배양 후에, 플라스미드를 준비하여 주형으로 사용하고, OmpA(a.a -21 to 159) 와 PCV2 ORF2의 유전자를 PCR 방법으로 확인하였다. DNA : 1 ul primer 1 : 1 ulprimer 2 : 1 ul*A.DW : 17 ul 사용한 PCR 조건은 아래와 같다.[표2] PCR cycle temperature℃ Time
initial denatureation 94 5분
33 cycle denaturation annealing extension 95 40초
55 40초
72 45초
final extension 72 5분
end 4
그 결과를 도 6에 나타내었다.
PCV2 ORF2 gene : PCV2-S F' & PCV2-S R' primer를 이용하여 PCV2의 ORF2 gene 확인하였고, OmpA(-21_159) : sdv1 F' & sdv1 R'primer를 이용하여 OmpA gene 을 확인하였다.
실시예 3 : 단백질발현에 따른 SDS-PAGE 및 웨스턴 블럿 확인
IPTG에 의하여 PCV2 ORF2를 표면에 과발현시켰다.즉, 50 ug/ml 농도의 DAP, TSB 배지에서 37℃에서 160 rpm으로 세포배양 후 OD 600 0.5 ~ 0.6에서 IPTG 0.15 mM을 사용하여 PCV2 ORF2의 표면 과발현을 유도하였다. 상기 유도 후 3시간 동안 배양 (약 OD 600 1.3 ~1.5)하여 수득하였다.
그리고, IPTG에 의해서 과 발현된 PCV2 ORF2 단백질은 SDS-PAGE와 western blot 방법으로 확인하였다.
OmpA 와 PCV2 ORF2가 fusion된 단백질은 약 48 kda 정도의 크기를 가지며 fusion 단백질 c-term에 his tag이 있어 his taq을 인지하는 antibody를 이용하여 western blot 실험을 진행했다. western blot 실험시 샘플은 과발현한 whole cell을 PBS washing 하여 사용하였다. 1차, 2차 antibody로 his-mouse 와 mouse-HRP antibody를 각각 1 : 1000 , 1 : 5000으로 희석하여 사용해서 western blot 실험을 했다.
융합된 단백질이 표면에 발현되었는지 확인하기 위하여 트립신과 PCV2 ORF2 gene에 있는 트립신 사이트(trypsin site)를 이용하였다. Salmonella에서 fusion 단백질을 과발현 시켜서 culture 후 trypsin을 처리하여 37’c에서 15 min incubation하였다. PBS buffer를 사용하여 3번 washing을 한 다음에 SDS-PAGE와 western blot 방법을 이용하여 확인하였다.
그 결과를 하기 표 3 및 도 7에 나타내었다. 이 실험 결과를 통해 많은 단백질이 세포표면에서 발현되는 것을 확인할 수 있었다.
[표3]
salmonella typhimurium H683 Δasd 의 cell line에 sdv1PCV2 vecto를 transformation 한 sal-sdv1PCV2 와 transformation전의 salmonella typhimurium H683 Δasd cell line 의 단백질 발현 유무 확인결과, 기존 cell line에서는 IPTG 유/무와 관계없이 단백질이 발현이 안되었지만, sdv1PCV2 vector가 transformation 된 cell line에서는 IPTG 의 유/무에 따른 단백질 차이를 보였다.
특히, 상기 3번과 4번을 비교해 보면 확실하게 4번에서 IPTG에 의하여 단백질이 발현되는 것을 확인할 수 있었다. 즉, PCV2 ORF2의 C-term에 his taq 이 결합되어 있어서 단백질 발현 유/무를 확인 할 수 있는 것이다.
한편, 실험 결과 5, 6, 7번 결과를 비교해 보면 시간에 따른 특별한 상관관계는 파악할 수 없으나 8번 trypsin을 처리하지 않은 결과와 대조적으로 단백질이 trypsin에 제거되는 것을 볼 수 있었다. 이는 PCV2의 ORF2의 유전자 안에 trypsin site가 존재하기 때문에 trypsin을 처리시 salmonella surface에 발현된 PCV2 의 ORF2 단백질은 제거되고 내부에 발현된 단백질은 cell wall에 보호를 받아 영향을 받지 않기 때문이다.
실시예 4 : 기니 피그(guinea pig)에서의 동물실험 항체가 확인
(1) PCV2 항체형성
sal-sdv1PCV2의 IPTG에 의한 induction 유/무에 따른 기니피그에서의 PCV2 항체 형성을 비교해 보았다.
우선, 실험은 sal-sdv1PCV2를 IPTG를 사용해서 induction 유/무로 크게 2 그룹으로 나눌 수 있고, 항체가 확인을 위해서 sal-sdv1PCV2를 기니피그에 접종시 불활화한 것과 live 상태로 다시 2 그룹으로 나누어 총 4가지 그룹으로 실험을 진행했다.
각 그룹은 모두 1x10^10 CFU로 동일한 양을 사용했으며, 모두 PBS buffer로 3회씩 washing 해서 배지의 영향을 최소화하였다. 또한 불활화 그룹의 경우 포름알데히드 0.2% 을 첨가하여 37℃에서 overnight 하여 충분하게 불활화시켰다. 또한 불활화 시킨 A 와 B 그룹은 2주후 2차 접종을 시켰고, C 와 D 그룹은 1차 접종만 하여 항체가 변화를 지켜 보았다.
그 결과를 도 8 내지 도 11에 나타내었다.
실험결과 A, B, C, D 그룹을 보면 확실히 B 와 D 그룹에서는 시간이 지나면서 Positive Control(PC) 까지 항체가가 증가하는 것을 볼 수 있다. 또한 불활화 시킨 B 그룹에서는 2차 접종 후인 3주차부터 항체가가 증가하는 것이 뚜렷하게 보이며(도 9), live 그룹인 D 에서는 1주차부터 4주차까지 꾸준히 항체가가 증가하는 것을 볼 수 있다(도 11). 반면 IPTG를 넣지 않은 A(도 8) 와 C 그룹(도 10)은 모두 불활화와 생균주에 상관없이 항체 생성되지 않았다.
이러한 결과는 sal-sdv1PCV2의 IPTG에 의한 induction에 따른 기니피그에서의 PCV2 항체 형성이 효과적임을 보여준다.
(2) salmonella 항체가 확인
한편 상기 재조합균주 sal-sdv1PCV2를 IPTG 조건 하에서 배양한 후 1x10^10 CFU를 기니피그에게 근육주사 하였다.
그리고, 1차 접종후 2주, 2차 접종 후 1주, 2주, 3주 각각 채혈하여 salmonella 의 항체가를 확인하였다. 항체생성 유무를 확인하기 위해서 swine salmonella antibody test kit을 사용하였고, 접종한 동물이 기니피그이므로 2차 항체를 기니피그-HRP 항체를 1:500으로 희석해서 사용하였다.
즉, 혈청을 분리한 후 플레이트에서 1차 항체와 결합시키고(100 ul, 1hr, RT), 3회 세척한 후(300 ul) 다시 2차 항체를 결합시켰다(100 ul 1hr, RT). 다시 3회 세척하고(300 ul) 발색시킨 후 이를 OD 450에서 확인하였다.
그 결과를 도 12에 나타내었다. 즉, 시간이 지나면서 살모넬라에 대한 항체가도 증가하는 것을 볼 수 있다.
이처럼, 본 발명의 재조합 살모넬라 균주는 PCV2 감염에 대해 항체생성 효율이 우수할 뿐만 아니라 살모넬라 감염에 대해서도 항체생성 효과를 나타내는 다가 백신으로서, 살모넬라 또는 PCV2에 의해 발생하는 질병 예방에도 효과적이다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
(수탁번호)
기탁기관명 : 한국미생물보존센터(국외)
수탁번호 : KCCM11099P
수탁일자 : 20100907

Claims (28)

  1. 돼지 써코바이러스2(PCV2) ORF2 유전자를 암호화하는 DNA서열이,
    살로넬라 티피뮤리움 균주 유래의 세포외막 단백질A(OmpA)을 암호화하는 유전자 서열 중 서열번호 2로 표시되는 염기서열로 이루어진 TM 도메인(OmpA -21 에서 159까지의 아미노산을 코딩하는 서열)과 융합되어 있는 것을 특징으로 하는, 세포표면 발현용 재조합벡터.
  2. 삭제
  3. 삭제
  4. 제1항에 있어서, 상기 살모넬라 티피뮤리움 균주 유래의 OmpA 단백질은 서열번호 1로 표시되는 염기서열로 이루어진 것을 특징으로 하는 세포표면 발현용 재조합벡터.
  5. 삭제
  6. 삭제
  7. 삭제
  8. 삭제
  9. 제1항에 있어서, 상기 PCV2 ORF2는 서열번호 3으로 표시되는 염기서열을 포함하는 것을 특징으로 하는 세포표면 발현용 재조합벡터.
  10. 제1항에 있어서, 상기 재조합벡터는 기본벡터가 대장균의 것을 특징으로 하는 세포표면 발현용 재조합벡터.
  11. 제1항에 있어서, 상기 세포표면 발현용 재조합벡터는 도 13의 개열지도를 가지는 것을 특징으로 하는 세포표면 발현용 재조합벡터.
  12. 제1항, 제4항, 제9항, 제10항 및 제11항 중 어느 한 항에 따른 세포표면 발현용 재조합벡터로 형질전환된 재조합 살모넬라 티피뮤리움 균주.
  13. 삭제
  14. 삭제
  15. 제12항에 있어서, 상기 돼지 써코바이러스2(PCV2) ORF2 유전자는 재조합 살모넬라 티피뮤리움 균주 표면에 발현되는 것을 특징으로 하는 재조합 살모넬라 균주.
  16. 삭제
  17. 제12항에 있어서, 상기 살모넬라 티피뮤리움 균주는 수탁번호 KCCM 11099P의 균주인 것을 특징으로 하는 재조합 살모넬라 티피뮤리움 균주.
  18. 제12항에 있어서, 상기 재조합 살모넬라 티피뮤리움 균주는 살모넬라 감염 또는 PCV2 감염에 따른 질환의 치료 또는 예방용 생백신인 것을 특징으로 하는 재조합 살모넬라 티피뮤리움 균주.
  19. 제12항에 따른 살모넬라 티피뮤리움 균주에 의해 발현되어 포유류에서 체액성 면역반응을 유도할 수 있는 재조합 융합 단백질.
  20. 제12항의 재조합 살모넬라 티피뮤리움 균주를 함유하는 것을 특징으로 하는 살모넬라 감염 또는 PCV2 감염에 따른 질환의 치료 또는 예방 백신용 조성물.
  21. 제20항에 있어서, 상기 백신 조성물은 IPTG(Isopropyl-β-D-Thiogalactopyranoside)을 함유하는 것을 특징으로 하는 조성물.
  22. 제20항에 있어서, 상기 살모넬라 티피뮤리움 균주가 0.5 ~ 1.5 x 10^10 CFU/ml으로 함유되어 있는 것을 특징으로 하는 조성물.
  23. 제20항에 있어서, 상기 조성물은 경구 투여용 사료첨가제인 것을 특징으로 하는 조성물.
  24. 인간을 제외한 동물에게 제20항의 백신 조성물의 면역학적 유효량을 투여하는 단계를 포함하는, 살모넬라 감염 또는 PCV2 감염에 따른 질환의 치료 또는 예방방법.
  25. 제24항에 있어서, 상기 백신 조성물은 IPTG(Isopropyl-β-D-Thiogalactopyranoside)을 함유하는 것을 특징으로 하는 방법.
  26. 제24항에 있어서, 상기 동물은 돼지인 방법.
  27. 제24항에 있어서, 상기 PCV2 감염에 따른 질환은 이유후 전신 소모성 증후군(Postweaning Multi-systemic Wasting Syndrome; PMWS)인 방법.
  28. 제24항에 있어서, 상기 살모넬라 감염에 따른 질환은 살모넬라증(Salmonellosis)인 방법.
PCT/KR2011/006359 2010-09-16 2011-08-29 돼지 써코바이러스２(ｐｃｖ２) 유전자의 표면발현용 벡터 및 이로 형질전환된 살모넬라 백신 균주 WO2012036391A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2010-0091251 2010-09-16
KR1020100091251A KR101030792B1 (ko) 2010-09-16 2010-09-16 돼지 써코바이러스２(ｐｃｖ２) 유전자의 표면발현용 벡터 및 이로 형질전환된 살모넬라 백신 균주

Publications (2)

Publication Number Publication Date
WO2012036391A2 true WO2012036391A2 (ko) 2012-03-22
WO2012036391A3 WO2012036391A3 (ko) 2012-06-28

Family

ID=44050499

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/006359 WO2012036391A2 (ko) 2010-09-16 2011-08-29 돼지 써코바이러스２(ｐｃｖ２) 유전자의 표면발현용 벡터 및 이로 형질전환된 살모넬라 백신 균주

Country Status (2)

Country Link
KR (1) KR101030792B1 (ko)
WO (1) WO2012036391A2 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103087121A (zh) * 2013-01-12 2013-05-08 江西师范大学 异丙基-β-D硫代半乳糖苷的合成方法
GB2552441A (en) * 2015-10-22 2018-01-31 Royal Veterinary College Methods
CN113563465A (zh) * 2021-06-11 2021-10-29 扬州大学 沙门菌PhoN蛋白抗体及其检测方法和应用

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101438542B1 (ko) 2012-10-16 2014-09-12 고려대학교 산학협력단 돼지 서코바이러스 제2형의 orf3를 이용하는 면역증강제
KR102217387B1 (ko) * 2013-03-11 2021-02-19 주식회사 중앙백신연구소 재조합 효모 전세포(yeast whole cell)을 이용한 돼지 써코바이러스(PCV2) 서브유닛 백신과 그의 제조 방법
KR101670469B1 (ko) 2014-10-23 2016-10-28 고려대학교 산학협력단 마이크로ｒｎａ를 유효성분으로 포함하는 돼지 서코바이러스 제2형 감염의 예방 또는 치료용 조성물

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070031248A (ko) * 2005-09-14 2007-03-19 주식회사 바이오리더스 마이오스타틴을 발현하는 세포표면 발현벡터 및 상기벡터에 의해 형질전환된 미생물
US20100136060A1 (en) * 2006-11-22 2010-06-03 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing porcine circovirus-associated disease outbreaks
KR20100094587A (ko) * 2007-12-21 2010-08-26 와이어쓰 엘엘씨 돼지 써코바이러스에 대해 돼지를 면역시키는 방법 및 조성물

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070031248A (ko) * 2005-09-14 2007-03-19 주식회사 바이오리더스 마이오스타틴을 발현하는 세포표면 발현벡터 및 상기벡터에 의해 형질전환된 미생물
US20100136060A1 (en) * 2006-11-22 2010-06-03 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing porcine circovirus-associated disease outbreaks
KR20100094587A (ko) * 2007-12-21 2010-08-26 와이어쓰 엘엘씨 돼지 써코바이러스에 대해 돼지를 면역시키는 방법 및 조성물

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI [Online] 16 August 2007 Database accession no. DQ856568 *
DATABASE NCBI 22 May 2007 Database accession no. EF553333.1 *
SANG-RAE LEE ET AL.: 'Multi-immunogenic outer membrane vesicles derived from a MsbB- deficient Salmonella enterica Serovar Typhimurium mutant' J. MICROBIOL. BITECHNOL. vol. 19, no. 10, 01 June 2009, pages 1271 - 1279 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103087121A (zh) * 2013-01-12 2013-05-08 江西师范大学 异丙基-β-D硫代半乳糖苷的合成方法
CN103087121B (zh) * 2013-01-12 2018-01-30 江西师范大学 异丙基‑β‑D硫代半乳糖苷的合成方法
GB2552441A (en) * 2015-10-22 2018-01-31 Royal Veterinary College Methods
CN113563465A (zh) * 2021-06-11 2021-10-29 扬州大学 沙门菌PhoN蛋白抗体及其检测方法和应用
CN113563465B (zh) * 2021-06-11 2023-02-03 扬州大学 沙门菌PhoN蛋白抗体及其检测方法和应用

Also Published As

Publication number Publication date
KR101030792B1 (ko) 2011-04-27
WO2012036391A3 (ko) 2012-06-28

Similar Documents

Publication Publication Date Title
WO2012036391A2 (ko) 돼지 써코바이러스２(ｐｃｖ２) 유전자의 표면발현용 벡터 및 이로 형질전환된 살모넬라 백신 균주
WO2011025310A9 (ko) 돼지의 병원성 대장균의 부착인자가 형질전환된 약독화 살모넬라균 변이주 및 이를 포함하는 돼지의 병원성 대장균증 및 살모넬라균증의 예방 및 치료용 백신 조성물
WO2021221486A1 (en) Vaccine composition for preventing or treating infection of sars-cov-2
US10308927B2 (en) Processing of a modified foot-and-mouth disease virus P1 polypeptide by an alternative protease
WO2013169077A1 (ko) 악액질 예방 또는 치료용 조성물
Liu et al. Surface-displayed porcine IFN-λ3 in Lactobacillus plantarum inhibits porcine enteric coronavirus infection of porcine intestinal epithelial cells
WO2017195919A1 (ko) 식물 유래의 돼지 열병 백신용 조성물 및 이의 제조방법
CN1267553C (zh) 嗜血杆菌属转铁蛋白受体基因
Wang et al. Expression of the capsid protein of porcine circovirus type 2 in Lactococcus lactis for oral vaccination
WO2020060117A1 (ko) 돼지 열병 백신용 조성물 및 이의 제조 방법
WO2011025344A2 (ko) 소의 병원성 대장균의 부착인자가 형질전환된 약독화 살모넬라균 변이주 및 이를 포함하는 소의 대장균증 및 살모넬라균증의 예방 및 치료용 백신조성물
WO2022045827A1 (ko) 신규한 코로나바이러스 재조합 스파이크 단백질, 이를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 벡터 및 상기 벡터를 포함하는 코로나바이러스감염증 예방 또는 치료용 백신
WO2012141540A2 (ko) 바이러스 감염 억제 활성을 갖는 신규 분리한 락토바실러스 퍼멘텀 균주
Tang et al. High-level expression, purification and antibacterial activity of bovine lactoferricin and lactoferrampin in Photorhabdus luminescens
KR101765394B1 (ko) 돼지 유행성설사 바이러스의 에피토프 단백질, 이를 암호화하는 유전자를 포함하는 재조합 벡터, 이를 발현하는 형질전환체 및 이를 포함하는 돼지 유행성설사 바이러스 예방 또는 치료용 조성물
WO2019212312A1 (ko) 키메라 지카바이러스 백신
KR20190045128A (ko) 신규한 Stx2e 에피토프 단백질 및 이를 포함하는 백신 조성물
WO2021215857A1 (ko) 삼량체를 형성하는 코로나-19 바이러스 (covid-19, coronavirus disease 2019)의 재조합 스파이크 단백질 및 식물에서의 상기 재조합 스파이크 단백질의 대량 생산 방법과 이를 기반으로하는 백신조성물 제조 방법
WO2020101187A1 (ko) 식물체에서 바이러스-유사 입자를 발현하는 재조합 벡터 및 이를 이용한 써코바이러스-유사 입자를 포함하는 백신 조성물의 제조방법
WO2021153873A1 (ko) 돼지유행성설사병바이러스 약독화 생백신주, 이를 포함하는 조성물, 및 이의 제조방법
WO2020263062A1 (ko) 구제역 바이러스 백신 조성물
WO2014046410A1 (ko) 노다바이러스의 바이러스 유사입자의 생산방법, 이를 발현하는 효모 세포주 및 이를 포함하는 백신 조성물
WO2023113094A1 (ko) 면역원성이 증가된 코로나바이러스감염증-19 백신 조성물
WO2020111885A1 (ko) Stx2ea-c-말단 단편-stx2eb-오량체 재조합 단백질을 항원으로 포함하는 돼지 부종병의 예방 또는 치료용 백신 조성물
WO2023048532A1 (ko) 레오바이러스 기반 신규한 백신플랫폼 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11825351

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11825351

Country of ref document: EP

Kind code of ref document: A2