WO2011022656A2 - Recombinant avian paramyxovirus vaccine and method for making and using thereof - Google Patents
Recombinant avian paramyxovirus vaccine and method for making and using thereof Download PDFInfo
- Publication number
- WO2011022656A2 WO2011022656A2 PCT/US2010/046179 US2010046179W WO2011022656A2 WO 2011022656 A2 WO2011022656 A2 WO 2011022656A2 US 2010046179 W US2010046179 W US 2010046179W WO 2011022656 A2 WO2011022656 A2 WO 2011022656A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polynucleotide
- sequence
- apmv
- seq
- set forth
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/155—Paramyxoviridae, e.g. parainfluenza virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
- A61K47/42—Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/06—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations
- A61K49/08—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by the carrier
- A61K49/10—Organic compounds
- A61K49/14—Peptides, e.g. proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
- A61P31/22—Antivirals for DNA viruses for herpes viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
- C12N15/68—Stabilisation of the vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16111—Influenzavirus A, i.e. influenza A virus
- C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
- C12N2760/18121—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
- C12N2760/18122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
- C12N2760/18134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
- C12N2760/18141—Use of virus, viral particle or viral elements as a vector
- C12N2760/18143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18111—Avulavirus, e.g. Newcastle disease virus
- C12N2760/18151—Methods of production or purification of viral material
- C12N2760/18152—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2999/00—Further aspects of viruses or vectors not covered by groups C12N2710/00 - C12N2796/00 or C12N2800/00
- C12N2999/007—Technological advancements, e.g. new system for producing known virus, cre-lox system for production of transgenic animals
Definitions
- the invention relates to avian paramyxoviruses (APMV) and APMV sequences.
- the invention relates to viral vectors for the insertion and expression of foreign genes for use as safe immunization vehicles to protect against a variety of pathogens. It relates to vector vaccine in a reverse genetics system for the production of live attenuated vaccines. It also relates to polynucleotides which can be used for the production of subunits in an in vitro expression vector or as sequences to be integrated into a viral or plasmid type in vivo expression vector.
- the present invention relates to unmodified and modified APMV virus, to methods of making and using the same, and to certain DNA and protein sequences. More in particular, the invention relates to APMV virus in which the naturally occurring genome of the virus has been altered ("APMV mutants" or "recombinant APMV”) and to methods of making and using such APMV mutants or recombinant APMV.
- APMV mutants or "recombinant APMV”
- Viral vector vaccines represent one of the most rapidly growing areas in vaccine development. Many vaccines in clinical development for major global infectious diseases, HIV, tuberculosis and malaria, are based on viral vectors. Viral vector vaccines for animals are already on the market, e.g. avipox vector vaccines for companion animals and poultry, avian herpesviruses vectored vaccines for poultry, and vaccinia virus vectored vaccines for wildlife. But other livestock vector vaccines are in development.
- the advantage of viral vector vaccines is that they can be administered safely due to the use of a vector backbone which is strongly attenuated and does not cause disease in the animal itself.
- the disadvantage of currently used viral vectors is the existence of maternally derived or antibodies acquired due to a past infection.
- vector vaccines One major impetus for the development of vector vaccines was the occurrence of highly pathogenic influenza virus H5N1 occurring first in Asia and later in Europe and Africa.
- vector vaccine candidates have been developed including fowl poxvirus (Taylor et al, 1988), vaccinia virus (Chambers et al., 1988), Rous sarcoma virus (Hunt et al, 1988), adenoviruses (Tang et al., 2002 , Gao et al, 2006), Venezuelan equine encephalitis virus (Schultz-Cherry et al, 2000), Newcastle disease virus (US6,719,979, Veits et al., 2006, Swayne et al, 2002, Park et al, 2006), herpesvirus of infectious laryngotracheitis (Veits et al.
- herpesvirus of turkey (Darteil et al., 1995), and adenovirus based vector vaccines (Hoelscher et al, 2008, Toro et al, 2007).
- the efficacy of these vector vaccines have been tested in naive birds, but so far no reports have been published on the efficacy of these vector vaccines in birds with a preexisting immunity to the viral vector and/or to the protein coded by the insert.
- the virus family Paramyxoviridae includes both human (measles, mumps, parainfluenza and respiratory syncytial virus) and animal pathogens (Newcastle disease virus and rinderpest virus) that cause significant impact on public health as well as the global economy ( Lamb et al., 2007).
- Members of this virus family are defined by having a monopartite, negative sense, single-stranded RNA genome.
- the Paramyxoviridae family consists of two subfamilies namely Paramyxovirinae and Pneumovirinae. Owing to recent reclassification, the subfamily Paramyxovirinae includes five genera, i.e Morbillivirus, Henipavirus, Rubulavirus, Respirovirus and Avulavirus while
- Pneumovirinae includes Pneumovirus and Metapneumovirus (Mayo, 2002).
- Avian paramyxoviruses APMV are classified in the genus Avulavirus and comprise nine antigenically distinct serotypes that have been defined using hemagglutination inhibition (HI) tests ( Alexander, 1988).
- HI hemagglutination inhibition
- isolates belonging to the APMV-I subtype can cause a devastating disease in commercial poultry and are classified as velogenic Newcastle disease virus (NDV).
- Milder forms of NDV are designated as mesogenic and lentogenic isolates, wherein the latter form is mostly asymptomatic in domestic poultry.
- Isolates belonging to the APMV-2, 3, 6 and 7 have also been associated with disease in domestic poultry.
- infections by isolates of APMV-2 and 3 can cause mild respiratory disease and problems in egg quality and quantity (Bankowski et al, 1981; Redmann et al, 1991; Tumova et al, 1979; Zhang et al, 2007).
- Isolates of APMV-6 and 7 have been known to infect turkeys, ducks and migratory birds and can induce respiratory disease that may be complicated by secondary infection (Saif et al., 1997; Shortridge et al., 1980).
- isolates of APMV-4, 5, 8 and 9 have been isolated from ducks, waterfowl and other wild birds but the birds rarely show clinical signs after viral infection ( Alexander et al., 1983; Capua et al., 2004; Gough et al., 1984; Maldonado et al., 1995; Shortridge et al., 1980).
- APMV-2 was first isolated as a secondary pathogen in 1956 from chickens affected by acute laryngotracheitis in Southern California
- APMV-8 (Goose/Delaware/ 1053/76) was first isolated in the USA from a hunter-killed Canada goose (Branta canadensis) (Rosenberger et al., 1974).
- a serological survey (from 1990 to 1992) of wildfowl in southern Spain showed a notable prevalence of APMV-8 antibodies in up to 43% of the tested sera (Maldonado et al., 1995).
- Another serological study to determine the status of live, healthy mallard ducks in New Zealand for APMV infection revealed the presence of APMV-8 antibodies in 56% of the tested sera (Stanislawek et al., 2002).
- Warke et al (2008) described that between 16% to 31% of investigated chicken sera might have had APMV-8 antibodies. But due to existing high titers against APMVl the probability of a false positive HI test is possible since the sera do not react very specifically in the HI assay. With the exception of a few waterfowl isolates of APMV-8 isolated while the populations were being surveyed for avian influenza viruses (Stallknecht et al., 1991), there has been a dearth of information about the prevalence and pathogenicity of this virus.
- NDV vectors expressing foreign viral proteins such as the HA protein of the Hl subtype of influenza A virus (Nakaya et al., 2001), VP2 protein of infectious bursal disease virus (IBDV) (Huang et al., 2004), avian influenza virus hemagglutinin of subtype H5 (Veits et al., 2006; Ge et al., 2007) and subtype H7 (Park et al., 2006) have been reported.
- IBDV infectious bursal disease virus
- the present invention relates to a vaccine or composition
- a vaccine or composition comprising (i) a recombinant APMV and (ii) a pharmaceutically or veterinarily acceptable carrier.
- the present invention encompasses methods for modifying the genome of APMV to produce recombinant APMV virus or APMV rival vector; modified APMV prepared by such methods; DNA and protein sequences; and methods for infecting cells and host animals with such recombinant APMV to provoke the amplification of exogenous DNA and proteins encoded by the exogenous DNA, including antigenic proteins, by said cells and host animals.
- One aspect of the invention relates to APMV virus, DNA and protein sequences involved in making modified or recombinant virus.
- One embodiment of the invention relates to the genomic and protein sequence of APMV-2, 4, 6, or 8.
- Another aspect of the invention relates to a modified recombinant APMV virus, which viruses have enhanced safety, strong humoral immune response, and a method of making such recombinant viruses.
- Another aspect of the invention relates to a recombinant APMV virus vaccine or composition having an increased level of safety compared to known APMV or other recombinant vaccines.
- the present invention provides unmodified and modified
- APMV viral vector for expressing a gene product in a host.
- Another aspect of the invention is directed to a recombinant APMV virus modified by the insertion therein of DNA from any source into the intergenic region or the nonessential region of the APMV genome.
- Synthetically modified APMV virus recombinants carrying heterologous genes coding for and expressing an antigen, are used according to the invention to create novel compositions or vaccines.
- Another aspect of the invention relates to an APMV viral vector which provides a reverse genetics system, wherein the vector can be used as a backbone for recombinant vaccines or compositions in different host animals.
- the present invention relates to a pharmaceutical composition or vaccine for inducing an immunological response in a host animal inoculated with the composition or vaccine, the composition or vaccine including a pharmaceutical acceptable carrier and a modified APMV recombinant virus or viral vector.
- the recombinant APMV virus or viral vector includes, within a non-essential region of the virus genome, a heterologous DNA which encodes an antigenic protein derived from a pathogen wherein the composition or vaccine when administered to a host, is capable of inducing an immunological response specific to the protein encoded by the pathogen.
- Another aspect of the invention relates to a method for inducing an
- immunological response in an animal to an antigen which method comprises inoculating the animal with a vaccine or a pharmaceutical composition containing modified recombinant APMV virus or viral vector which comprises and expresses the antigenic determinant of a pathogen for said animal.
- a vaccine or a pharmaceutical composition containing modified recombinant APMV virus or viral vector which comprises and expresses the antigenic determinant of a pathogen for said animal.
- Yet another aspect of the invention relates to a method for inducing an immunological response in an animal to an antigen in a prime- boost regime.
- Another aspect of the invention relates to a method of expressing a gene product in a cell culture in vitro by introducing into the cell a modified recombinant APMV virus, wherein the gene may be an antigenic protein derived from a pathogen.
- Figure 1 is a table showing virus isolation from several organs of chickens after experimental infection with APMV -2, 4, 6 in embryonated chicken eggs.
- Figure 2 is a table showing the histology results of several organs of chickens after experimental infection with APMV-2, 4, 6.
- Figure 3 depicts HI antibody titers in SPF chickens experimentally inoculated with APMV-2, 4 or 6. Chicken sera samples collected at day 2, 4, 7, 14 and 28 post infection were subject to the HI test to analyze the presence of HI antibodies.
- FIG. 4 shows HI antibody titers in SPF chickens and ducks experimentally infected with APMV-8. Chickens and ducks were oro-nasal infected with a dose of 10" EID50 of APMV-8. Sera samples were collected at day 2, 4, 7, 14, and 28 p. i. and analyzed by the HI test with the APMV-8 antigen. The HI serum titers (in Iog2) are shown on the left axis
- Figure 5 shows the development of HI antibody titers in SPF chickens during a prime/boost vaccination scheme with APMV-8.
- One-day old SPF chickens were infected at day 1 (prime) and day 14 (boost) with a dose of 10 ⁇ EID50 of APMV-8.
- Serum samples were obtained at day 7 and 14 p.i. after the first infection and day 7 and 14 p.i. after the second infection.
- the sera were subjected to the HI test.
- the HI serum titers (in Iog2) are shown on the left axis.
- Figure 6 shows the analysis of RT-PCR products by agarose gel
- Figure 7 is a table showing virus isolation from chicken and ducks
- APMV-8 experimentally infected with APMV-8.
- the virus isolation from chicken tissue was performed in embryonated chicken eggs and the detection of viral RNA from duck tissue by RT-PCR.
- Figure 8 is a table showing the results of the histological examination of several organs after infection of chicken and Pekin ducks with APMV-8.
- FIG. 9 shows the development of HI antibody titers in SPF chickens after infection with different doses of APMV-8.
- One-day old SPF chickens were infected at day 1 with different infectious doses (ID) of APMV-8 or mock-infected with virus transport medium (VTM).
- ID infectious doses
- VTM virus transport medium
- Blood was taken at day 7 and 14 p.i. and the obtained serum samples were analyzed by the HI test.
- the HI serum titers (in Iog2) are shown on the left axis.
- the geometric mean titer (GMT) of the serum samples are shown in the lowest row.
- FIG 10 shows the development of HI antibody titers in Pekin ducks after infection with different doses of APMV-8.
- One-day old SPF Pekin ducks were infected at day 1 with different infectious doses (ID) of APMV-8 or mock-infected with virus transport medium (VTM).
- ID infectious doses
- VTM virus transport medium
- Blood was taken at day 7 and 14 p.i. and the obtained serum samples were analyzed by the HI test.
- the HI serum titers (in Iog2) are shown on the left axis.
- the geometric mean titer (GMT) of the serum samples are shown in the lowest row.
- Figure 11 is a table showing the SEQ ID NOs of the corresponding DNA and protein sequences.
- Figure 12 depicts the full length genome sequence of APMV-8 strain (APMV- 8: SCWDS ID: MA-7, isolated from a mallard) and a genetic map of the full length APMV-8 genome.
- Figure 12 depicts the DNA sequence (SEQ ID NO:2) encoding APMV-8 Nucleoprotein (NP) and the NP protein sequence (SEQ ID NO:3).
- Figure 13 depicts the DNA sequence (SEQ ID NO:4) encoding APMV-8
- Phospho Protein and the P protein sequence (SEQ ID NO:5).
- Figure 14 depicts the DNA sequence (SEQ ID NO:6) encoding APMV-8
- Matrixprotein (M) and the M protein sequence (SEQ ID NO:7).
- Figure 15 depicts the DNA sequence (SEQ ID NO: 8) encoding APMV-8
- Fusionprotein F and the F protein sequence (SEQ ID NO: 9).
- Figure 16 depicts the DNA sequence (SEQ ID NO: 10) encoding APMV-8
- HN Hemagglutinin/ neuraminidase
- SEQ ID NO:11 the HN protein sequence
- Figure 17 depicts the DNA sequence (SEQ ID NO: 12) encoding APMV-8
- L Polymerase (L) and the L protein sequence (SEQ ID NO: 13). This APMV-8 L(I) protein is translated from the ATG codon located at positions 8273-8275 of SEQ ID NO:1.
- Figure 18 depicts the protein sequence (2) of APMV-8 Polymerase (L) (SEQ ID NO:
- SEQ ID NO: 14 This APMV-8 L(2) protein is translated from the ATG codon located at positions 8297-8299 of SEQ ID NO:1. SEQ ID NO: 14 does not contain the first 8 amino acids of SEQ ID NO:13.
- Figure 19A is a flow diagram of the APMV-8 reverse genetics system.
- 19B depicts the result of replication of APMV-8 virus in MDCK cells.
- Figure 20 depicts the HI test result of commercial broiler chickens 2 weeks after APMV-8 vaccination.
- Figure 21 depicts the HI test result of commercial broiler chickens 4 weeks after APMV-8 vaccination.
- Figure 22 shows the HI test results after the in ovo vaccination at day 18
- Figure 23 depicts the HI test results after the in ovo vaccination at day 19
- Figure 24 shows the HI test results after the in ovo vaccination at day 18
- Figure 25 depicts 5 '-full length genome (5'-FLG) and 3 '-full length genome
- (3'-FLG) sequences including the franking sequences.
- Figure 26 depicts plasmid maps of pcNDA-NP, pcNDA-P, pcDNA-L, and pcDNA3-T7.
- Figure 27 depicts plasmid maps of pUC 18-MG-APMV-8 and pCITE4A-
- Figure 28 depicts plasmid map of pUC57-FL-APMV-8.
- Figure 29 depicts minigenome APMV-8 sequence.
- Figure 30 shows the NP protein sequence alignment and the sequence identity at the DNA and protein levels.
- Figure 31 shows the P protein sequence alignment and the sequence identity at the DNA and protein levels.
- Figure 32 shows the M protein sequence alignment and the sequence identity at the DNA and protein levels.
- Figure 33 shows the F protein sequence alignment and the sequence identity at the DNA and protein levels.
- Figure 34 shows the FIN protein sequence alignment and the sequence identity at the DNA and protein levels.
- Figure 35 shows the L protein sequence alignment and the sequence identity at the DNA and protein levels.
- APMV vian Paramyxoviruses
- APMV refers to and includes APMV-I, APMV-2, APMV-3, APMV-4, APMV-5, APMV-6, APMV-7, APMV-8, and APMV-9.
- animal is used herein to include all mammals, birds and fish.
- the animal as used herein may be selected from the group consisting of equine (e.g., horse), canine (e.g., dogs, wolves, foxes, coyotes, jackals), feline (e.g., lions, tigers, domestic cats, wild cats, other big cats, and other felines including cheetahs and lynx), bovine (e.g., cattle), porcine (e.g., pig), ovine (e.g., sheep, goats, lamas, bisons), avian (e.g., chicken, duck, goose, turkey, quail, pheasant, parrot, finches, hawk, crow, ostrich, emu and cassowary), primate (e.g., prosimian, tarsier, monkey, gibbon, ape), humans, and fish.
- equine e.g.,
- polypeptide and “protein” are used interchangeably herein to refer to a polymer of consecutive amino acid residues.
- nucleic acid refers to RNA, DNA, cDNA (complementary DNA), or cRNA (complementary RNA) and derivatives thereof, such as those containing modified backbones. It should be appreciated that the invention provides polynucleotides comprising sequences complementary to those described herein.
- the "polynucleotide” contemplated in the present invention includes both the forward strand (5' to 3') and reverse complementary strand (3' to 5').
- Polynucleotides according to the invention can be prepared in different ways (e.g. by chemical synthesis, by gene cloning etc.) and can take various forms (e.g.
- genomic DNA or “genome” is used interchangeably and refers to the heritable genetic information of a host organism.
- the genomic DNA comprises the DNA of the nucleus (also referred to as chromosomal DNA) but also the DNA of the plastids (e.g., chloroplasts) and other cellular organelles (e.g., mitochondria).
- the genomic DNA or genome contemplated in the present invention also refers to the RNA of a virus.
- the RNA may be a positive strand or a negative strand RNA.
- genomic DNA contemplated in the present invention includes the genomic DNA containing sequences complementary to those described herein.
- genomic DNA also refers to messenger RNA (mRNA), complementary DNA (cDNA), and complementary RNA (cRNA).
- mRNA messenger RNA
- cDNA complementary DNA
- cRNA complementary RNA
- genomic RA nucleic acid
- genes or polynucleotides include introns and exons as in genomic sequence, or just the coding sequences as in cDNAs , such as an open reading frame (ORF), starting from the start codon (methionine codon) and ending with a termination signal (stop codon). Genes and polynucleotides can also include regions that regulate their expression, such as transcription initiation, translation and transcription termination.
- ORF open reading frame
- promoters and ribosome binding regions in general these regulatory elements lie approximately between 60 and 250 nucleotides upstream of the start codon of the coding sequence or gene; Doree S M et al.; Pandher K et al.; Chung J Y et al.), transcription terminators (in general the terminator is located within approximately 50 nucleotides downstream of the stop codon of the coding sequence or gene; Ward C K et al.).
- Gene or polynucleotide also refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences.
- heterologous DNA refers to the DNA derived from a different organism, such as a different cell type or a different species from the recipient. The term also refers a DNA or fragment thereof on the same genome of the host DNA wherein the heterologous DNA is inserted into a region of the genome which is different from its original location.
- antigen or “immunogen” means a substance that induces a specific immune response in a host animal.
- the antigen may comprise a whole organism, killed, attenuated or live; a subunit or portion of an organism; a recombinant vector containing an insert with immunogenic properties; a piece or fragment of DNA capable of inducing an immune response upon presentation to a host animal; a polypeptide, an epitope, a hapten, or any combination thereof.
- the immunogen or antigen may comprise a toxin or antitoxin.
- immunogenic protein or peptide includes polypeptides that are immunologically active in the sense that once administered to the host, it is able to evoke an immune response of the humoral and/or cellular type directed against the protein.
- the protein fragment is such that it has substantially the same immunological activity as the total protein.
- a protein fragment according to the invention comprises or consists essentially of or consists of at least one epitope or antigenic determinant.
- An "immunogenic" protein or polypeptide, as used herein, includes the full-length sequence of the protein, analogs thereof, or immunogenic fragments thereof.
- immunological fragment is meant a fragment of a protein which includes one or more epitopes and thus elicits the immunological response described above.
- Such fragments can be identified using any number of epitope mapping techniques well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996).
- linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports.
- immunological response denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue.
- conservative substitutions will generally be conservative in nature, i.e., those substitutions that take place within a family of amino acids.
- amino acids are generally divided into four families: (1) acidic—aspartate and glutamate; (2) basic— lysine, arginine, histidine; (3) non-polar— alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar— glycine, asparagine, glutamine, cystine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids.
- conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another hydrophobic residue, or the substitution of one polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like; or a similar conservative replacement of an amino acid with a structurally related amino acid that will not have a major effect on the biological activity.
- Proteins having substantially the same amino acid sequence as the reference molecule but possessing minor amino acid substitutions that do not substantially affect the immunogenicity of the protein are, therefore, within the definition of the reference polypeptide. All of the polypeptides produced by these modifications are included herein.
- the term "conservative variation” also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.
- a "host cell” denotes a prokaryotic or eukaryotic cell that has been genetically altered, or is capable of being genetically altered by administration of an exogenous polynucleotide, such as a recombinant plasmid or vector.
- an exogenous polynucleotide such as a recombinant plasmid or vector.
- the term refers both to the originally altered cell and to the progeny thereof.
- Polynucleotides comprising a desired sequence can be inserted into a suitable cloning or expression vector, and the vector in turn can be introduced into a suitable host cell for replication and amplification. Polynucleotides can be introduced into host cells by any means known in the art.
- the vectors containing the polynucleotides of interest can be introduced into the host cell by any of a number of appropriate means, including direct uptake, endocytosis, transfection, f-mating, electroporation, transfection employing calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances; microprojectile bombardment; lipofection; and infection (where the vector is infectious, for instance, a retroviral vector).
- the choice of introducing vectors or polynucleotides will often depend on features of the host cell.
- an "immunological response" to a composition or vaccine is the development in the host of a cellular and/or antibody-mediated immune response to a composition or vaccine of interest.
- an "immunological response” includes but is not limited to one or more of the following effects: the production of antibodies, B cells, helper T cells, and/or cytotoxic T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest.
- the host will display either a therapeutic or protective immunological response such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction or lack of symptoms normally displayed by an infected host, a quicker recovery time and/or a lowered viral titer in the infected host.
- One embodiment of the invention provides the genomic DNA sequence and encoded protein sequences of APMV-8.
- the complementary genomic DNA(cDNA) sequence of APMV-8 strain of the present invention has a polynucleotide sequence as set forth in SEQ ID NO:1.
- the APMV-8 genomic cDNA sequence (SEQ ID NO:1) has 48% sequence identity to APMV-I genomic DNA (SEQ ID NO: 15), 61% sequence identity to APMV-2 genomic DNA (SEQ ID NO: 16), 47.2% sequence identity to APMV-3 genomic DNA (SEQ ID NO: 17), 47.6 % sequence identity to APMV-4 genomic DNA (SEQ ID NO: 18), 52% sequence identity to APMV-6 genomic DNA (SEQ ID NO: 19), 53% sequence identity to APMV-7 genomic DNA (SEQ ID NO:20), 99.1% sequence identity to APMV-8 genomic DNA (SEQ ID NO: 37), 96.5% sequence identity to APMV-8 genomic DNA (SEQ ID NO:38), 96.4% sequence identity to APMV-8 genomic DNA (SEQ ID NO:39), 48% sequence identity to APMV-9 genomic DNA (SEQ ID NO:40).
- the invention provides a polynucleotide having a sequence as set forth in SEQ ID NO:1, 2, 4, 6, 8, 10 or 12, and variant or fragment thereof.
- the invention further comprises a complementary strand to a polynucleotide described herein.
- the invention provides a polypeptide having a sequence as set forth in SEQ ID NO:3, 5, 1, 9, 11, 13 or 14, and variant or fragment thereof.
- homo logs of polynucleotides or polypeptides from APMV for example APMV-8, APMV-2, APMV-4, APMV-6 strains are intended to be within the scope of the present invention.
- the term “homo logs” includes orthologs, analogs and paralogs.
- the term “analogs” refers to two polynucleotides or polypeptides that have the same or similar function, but that have evolved separately in unrelated organisms.
- the term “orthologs” refers to two polynucleotides or polypeptides from different species, but that have evolved from a common ancestral gene by speciation. Normally, orthologs encode polypeptides having the same or similar functions.
- paralogs refers to two polynucleotides or polypeptides that are related by duplication within a genome. Paralogs usually have different functions, but these functions may be related. Analogs, orthologs, and paralogs of a wild-type APMV polypeptide can differ from the wild-type APMV polypeptide by post-translational modifications, by amino acid sequence differences, or by both. In particular, homo logs of the invention will generally exhibit at least 80-85%, 85-90%, 90-95%, or 95%, 96%, 97%, 98% , 99% sequence identity with all or part of the polynucleotide or polypeptide sequences of APMV-8, and will exhibit a similar function.
- the present invention provides a genomic cDNA of APMV- 8 having the sequence as set forth in SEQ ID NO: 1.
- the polynucleotide is a reverse complementary strand of the polynucleotide having the sequence as set forth in SEQ ID NO:1.
- the polynucleotide or a reverse complementary strand of a polynucleotide of the present invention has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO:1.
- the present invention provides a fragment of
- polynucleotide encoding an AMPV-8 polypeptide such as a polynucleotide encoding a polypeptide having a sequence as set forth in SEQ ID NO: 3, 5, 7, 9, 11, 13 or 14.
- the present invention provides a polynucleotide encoding a polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO: 3, 5, 7, 9, 11, 13 or 14, or a conservative variant, an allelic variant, a homolog or an immunogenic fragment comprising at least eight or at east ten consecutive amino acids of one of these polypeptides, or a combination of these polypeptides.
- the present invention provides a polynucleotide having a nucleotide sequence as set forth in SEQ ID NO:1, 2, 4, 6, 8, 10, or 12, or a variant thereof.
- the polynucleotide is a reverse complementary strand of the polynucleotide having the sequence as set forth in SEQ ID N0:l.
- the present invention provides a polynucleotide or a reverse complementary strand of a polynucleotide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to one of a
- polynucleotide having a sequence as set forth in SEQ ID NO:1, 2, 4, 6, 8, 10, or 12, or a variant thereof.
- the present invention provides a polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98% or 99% sequence identity to a polypeptide having a sequence as set forth in SEQ ID NO:3, 5, 7, 9, 11, 13 or 14.
- the present invention provides fragments and variants of the APMV polypeptides identified above (SEQ ID NO: 3, 5, 7, 9, 11, 13 or 14) which may readily be prepared by one of skill in the art using well- known molecular biology techniques.
- Variants are homologous polypeptides having an amino acid sequence at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence as set forth in SEQ ID NO: 3, 5, 7, 9, 11, 13 or 14.
- Variants include allelic variants.
- allelic variant refers to a polynucleotide or a polypeptide containing polymorphisms that lead to changes in the amino acid sequences of a protein and that exist within a natural population (e.g., a virus species or variety). Such natural allelic variations can typically result in 1- 5% variance in a polynucleotide or a polypeptide.
- Allelic variants can be identified by sequencing the nucleic acid sequence of interest in a number of different species, which can be readily carried out by using hybridization probes to identify the same genetic locus in those species. Any and all such nucleic acid variations and resulting amino acid polymorphisms or variations that are the result of natural allelic variation and that do not alter the functional activity of gene of interest, are intended to be within the scope of the invention.
- sequence identity with respect to sequences can refer to, for example, the number of positions with identical nucleotides or amino acids divided by the number of nucleotides or amino acids in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm (Wilbur and Lipman).
- the sequence identity or sequence similarity of two amino acid sequences, or the sequence identity between two nucleotide sequences can be determined using Vector NTI software package (Invitrogen, 1600 Faraday Ave., Carlsbad, CA).
- RNA sequences are said to be similar, or have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence.
- RNA sequences are within the scope of the invention and can be derived from DNA sequences, by thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences.
- the present invention relates to a pharmaceutical composition or vaccine for inducing an immunological response in a host animal inoculated with the vaccine or composition, the vaccine or composition including a pharmaceutical acceptable carrier and a modified APMV recombinant virus or viral vector.
- the recombinant APMV virus or viral vector includes, within a non-essential region of the virus genome, a heterologous DNA sequence which encodes an antigenic protein derived from a pathogen wherein the composition or vaccine when administered to a host, is capable of inducing an immunological response specific to the protein encoded by the pathogen.
- a "vector” refers to a recombinant DNA or RNA plasmid, bacteriophage, or virus that comprises a heterologous polynucleotide to be delivered to a target cell, either in vitro or in vivo.
- the heterologous polynucleotide may comprise a sequence of interest for purposes of prevention or therapy, and may optionally be in the form of an expression cassette.
- a vector needs not be capable of replication in the ultimate target cell or subject. The term includes vectors for cloning as well as viral vectors.
- engineered or “recombinant” means a polynucleotide of semisynthetic, or synthetic origin that either does not occur in nature or is linked to another polynucleotide in an arrangement not found in nature.
- nonessential region refers to a region of a virus genome which is not essential for replication and propagation of the virus in tissue culture and whose deletion or inactivation may reduce virulence in a variety of animal systems. Any nonessential region or portion thereof can be deleted from the APMV genome or a foreign sequence can be inserted in it, and the viability and stability of the recombinant APMV resulting from the deletion or insertion can be used to ascertain whether a deleted region or portion thereof is indeed nonessential.
- the nonessential region of the APMV genome is any region on the APMV-2, 4, 6, or 8 genome that does not encode Polymerase (L).
- the nonessential region comprises an open reading frame encoding a nonessential protein. In this aspect, the open reading frame is selected from the group consisting of nucleoprotein (NP),
- P phosphoprotein
- M matrixprotein
- F fusionprotein
- the nonessential region is located upstream of the NP gene. In another embodiment, the nonessential region is located downstream of the L gene. In yet another embodiment, the nonessential region is a non-coding or intergenic region. In this aspect, the non-coding or intergenic region may be a region between NP and P genes, between P and M genes, between M and F genes, or between F and HN genes on the APMV-2, 4, 6, or 8 genome.
- the nonessential region may be in the region of nucleotide positions 1 - 140, 1526 - 1692, 2910 - 3085, 4195 - 4498, 6130 - 6382, 8116 - 8272, 8116 - 8289, or 15013 - 15342 of SEQ ID NO: 1.
- the invention includes APMV chimeras in which one part or the full gene or several parts or full genes of the APMV vector are replaced by similar genes from other viruses, in particular those belonging to the paramyxoviridae family.
- the vaccine or pharmaceutical composition comprises an antigen selected from the group of avian pathogens including, but not limited to, Salmonella typhimurium, Salmonella enteritidis, Infectious Bronchitis virus (IBV), Newcastle Disease virus (NDV), egg drop syndrome virus (EDS), or Infectious Bursal Disease virus (IBDV), Infectious Laryngotracheitis virus (ILTV), avian adenoviruses, Marek's disease virus (MDV), fowlpox virus, duck enteritis virus (DEV), duck parvoviruses, avian influenza virus, APMV, such as APMV-I, and the like, and combinations thereof.
- avian pathogens including, but not limited to, Salmonella typhimurium, Salmonella enteritidis, Infectious Bronchitis virus (IBV), Newcastle Disease virus (NDV), egg drop syndrome virus (EDS), or Infectious Bursal Disease virus (IBDV), Infectious Laryngotracheitis virus (
- the vaccine or pharmaceutical composition comprises an antigen selected from a feline pathogen such as, but not limited to, feline herpesvirus (FHV), feline calicivirus (FCV), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), feline parvovirus (FPV), feline infectious peritonitis virus (FIPV), rabies virus, and the like, and combinations thereof.
- a feline pathogen such as, but not limited to, feline herpesvirus (FHV), feline calicivirus (FCV), feline leukemia virus (FeLV), feline immunodeficiency virus (FIV), feline parvovirus (FPV), feline infectious peritonitis virus (FIPV), rabies virus, and the like, and combinations thereof.
- a feline pathogen such as, but not limited to, feline herpesvirus (FHV), feline calicivirus (FCV), feline leukemia virus (FeLV), feline immunodefic
- the vaccine or pharmaceutical composition of the present invention comprises an antigen selected from a canine pathogen including, but not limited to, rabies virus, canine herpesvirus (CHV), canine parvovirus (CPV), canine distemper virus (CDV), canine parainfluenza 2 (CPI2), canine coronavirus, Leptospira canicola, Leptospira icterohaemorragiae, Leptospira grippotyphosa, Borrelia burgdorferi, Bordetella bronchiseptica and the like, and combinations thereof.
- rabies virus canine herpesvirus (CHV), canine parvovirus (CPV), canine distemper virus (CDV), canine parainfluenza 2 (CPI2)
- canine coronavirus canine coronavirus
- Leptospira canicola canine herpesvirus
- CPV canine parvovirus
- CDV canine distemper virus
- CDV canine
- the vaccine or pharmaceutical composition comprises an antigen selected from an equine pathogen, such as equine herpesvirus (type 1 or type 4), equine influenza virus, tetanus, west nile virus, equine arterivirus and the like or combinations thereof.
- an equine pathogen such as equine herpesvirus (type 1 or type 4), equine influenza virus, tetanus, west nile virus, equine arterivirus and the like or combinations thereof.
- the vaccine or pharmaceutical composition comprises an antigen selected from a bovine, ovine or caprine pathogen, such as rabies virus, bovine rotavirus, bovine parainfluenza virus type 3 (bPIV-3), bovine coronavirus, bovine viral diarrhea virus (BVDV), foot and mouth disease virus (FMDV), Rinderpest virus (RPV), Peste des Petits Ruminants virus (PPRV), malignant catarrhal fever viruses, bovine respiratory syncytial virus (BRSV), Infectious Bovine Rhinotracheitis virus (IBR), Escherichia coli, Pasteurella multocida, Pasteurella haemolytica and the like, and combinations thereof.
- a bovine, ovine or caprine pathogen such as rabies virus, bovine rotavirus, bovine parainfluenza virus type 3 (bPIV-3), bovine coronavirus, bovine viral diarrhea virus (BVDV), foot and mouth disease virus (FMDV), Rinderpest virus (RPV), Pest
- the vaccine or pharmaceutical composition comprises an antigen selected from a porcine pathogen such as, but not limited to, swine influenza virus (SIV), porcine circovirus type 2 (PCV -2), porcine reproductive respiratory syndrome virus (PRRS), pseudorabies virus (PRV), porcine parvovirus (PPV), FMDV, Mycoplasma hyopneumoniae, Erysipelothrix rhusiopathiae, Pasteurella multocida, Bordetella bronchiseptica, Escherichia coli and the like, and combinations thereof.
- a porcine pathogen such as, but not limited to, swine influenza virus (SIV), porcine circovirus type 2 (PCV -2), porcine reproductive respiratory syndrome virus (PRRS), pseudorabies virus (PRV), porcine parvovirus (PPV), FMDV, Mycoplasma hyopneumoniae, Erysipelothrix rhusiopathiae, Pasteurella multo
- a recombinant APMV virus may be constructed in two steps. First, the gene of interest to be inserted into the virus, such as an open reading frame of an antigen from an APMV-I (NDV) or avian influenza virus or other organism, is placed into an E. coli plasmid construct into which the cDNA homologous to a section of cDNA of the APMV is inserted.
- NDV APMV-I
- avian influenza virus or other organism is placed into an E. coli plasmid construct into which the cDNA homologous to a section of cDNA of the APMV is inserted.
- the cDNA gene sequence to be inserted is preceded by a promoter region (gene start region) and followed by a gene end region which is specific for the APMV vector.
- the gene start/foreign antigen/gene end DNA fragment is flanked by cDNA fragment homologous of APMV-8 cDNA containing unique restriction enzyme cleavage sites.
- the resulting plasmid construct is then amplified by growing in E. coli bacteria and isolated.
- the recombinant plasmid is used in a restriction enzyme digest to cut out the gene start/foreign antigen/gene end DNA fragment that is flanked by cDNA homologous of APMV-8 cDNA and this fragment is ligated into the appropriately cleaved full length construct of APMV-8.
- the full length construct containing the gene of interest is transfected into cells along with plasmids containing polynucleotides for expression of the APMV nucleoprotein (NP), the APMV phosphoprotein (P) and the APMV RNA polymerase (L) as well as the T7 RNA polymerase. All APMV cDNA constructs are under the control of the T7 polymerase promoter. The rescue of infectious virus is performed as described in R ⁇ mer-Oberd ⁇ rfer et al., 1999 and as shown in Figure 19A.
- the expression of the T7 RNA polymerase in transfected cells can be obtained by different means including transfection of plasmid DNA containing an expression cassette of the T7 RNA
- the polymerase recombinant virus (such as fowlpox or canarypox virus) expressing the T7 RNA polymerase or in cells that express the T7 RNA polymerase.
- the polynucleotides for expression of the APMV nucleoprotein (NP), the APMV phosphoprotein (P) and the APMV RNA polymerase (L) and the full length viral cRNA are under the control of the immediate early promoter of the human cytomegalovirus. The rescue of the virus is performed as described in Inoue K, et al., 2003.
- inserted cDNA of interest foreign cDNA or heterologous cDNA
- the second condition for expression of inserted cDNA is the presence of a regulatory sequences allowing expression of the gene in the viral background (for instance: gene start, gene stop, promoter, enhancer, polyadenylation signals, intergenic and untranslated regions).
- the promoter used for the transcription of viral mRNA by the viral RNA polymerase is the "gene start sequence".
- the "gene start sequence” is the binding site for the L protein to bind and to transcribe the downstream located viral RNA into viral mRNA.
- the invention provides for the administration of a therapeutically effective amount of an APMV vaccine for the delivery and expression of an antigen, epitope or immunogen in a target cell. Determination of the therapeutically effective amount is routine experimentation for one of ordinary skill in the art.
- the APMV vaccine formulation comprises an expression vector comprising a polynucleotide that encodes an antigen, epitope or immunogen and a pharmaceutically or veterinarily acceptable carrier, vehicle or excipient.
- the pharmaceutically or veterinarily acceptable carrier, vehicle or excipient facilitates transfection and/or improves preservation of the vector or protein.
- a pharmaceutically or veterinarily acceptable carrier or vehicle or excipient can be a 0.9% NaCl (e.g., saline) solution or a phosphate buffer.
- Other pharmaceutically or veterinarily acceptable carrier or vehicle or excipients that can be used for methods of this invention include, but are not limited to, poly-(L-glutamate) or polyvinylpyrrolidone.
- the pharmaceutically or veterinarily acceptable carrier or vehicle or excipients may be any compound or combination of compounds facilitating the administration of the vector (or protein expressed from an inventive vector in vitro), or facilitating transfection and/or improve preservation of the vector (or protein). Doses and dose volumes are herein discussed in the general description and can also be determined by the skilled artisan from this disclosure read in conjunction with the knowledge in the art, without any undue experimentation.
- pharmaceutically or veterinarily acceptable carrier, excipient, or vehicle may be a water-in-oil emulsion.
- suitable water-in-oil emulsions include oil-based water-in-oil vaccinal emulsions which are stable and fluid at 4°C containing: from 6 to 50 v/v % of an antigen-containing aqueous phase, from 12 to 25 v/v %, from 50 to 94 v/v % of an oil phase containing in total or in part a non- metabolizable oil (e.g., mineral oil such as paraffin oil) and/or metabolizable oil (e.g., vegetable oil, or fatty acid, polyol or alcohol esters), from 0.2 to 20 p/v % of surfactants, from 3 to 8 p/v %, the latter being in total or in part, or in a mixture either polyglycerol esters, said polyglycerol esters being polyg
- surfactants examples include ethoxylated sorbitan esters (e.g., polyoxyethylene (20) sorbitan monooleate (TWEEN 80 ® ), available from AppliChem, Inc., Cheshire, CT) and sorbitan esters (e.g., sorbitan monooleate (SPAN 80 ® ), available from Sigma Aldrich, St. Louis, MO).
- ethoxylated sorbitan esters e.g., polyoxyethylene (20) sorbitan monooleate (TWEEN 80 ® ), available from AppliChem, Inc., Cheshire, CT
- sorbitan esters e.g., sorbitan monooleate (SPAN 80 ® ), available from Sigma Aldrich, St. Louis, MO.
- the antigen-containing aqueous phase comprises a saline solution comprising one or more buffering agents.
- the water-in-oil emulsion may be a water/oil/water (W/O/W) triple emulsion (see, e.g., U.S. Patent No. 6,358,500). Examples of other suitable emulsions are described in U.S. Patent No. 7,371,395.
- compositions and vaccines according to the invention may comprise or consist essentially of one or more adjuvants.
- Suitable adjuvants for use in the practice of the present invention are (1) polymers of acrylic or methacrylic acid, maleic anhydride and alkenyl derivative polymers, (2) immuno stimulating sequences (ISS), such as oligodeoxyribonucleotide sequences having one or more non-methylated CpG units (Klinman et al, 1996; WO98/16247), (3) an oil in water emulsion, such as the SPT emulsion described on p 147 of "Vaccine Design, The Subunit and Adjuvant Approach" published by M. Powell, M.
- cation lipids containing a quaternary ammonium salt e.g., DDA (5) cytokines, (6) aluminum hydroxide or aluminum phosphate, (7) saponin or (8) other adjuvants discussed in any document cited and incorporated by reference into the instant application, or (9) any combinations or mixtures thereof.
- a quaternary ammonium salt e.g., DDA (5) cytokines, (6) aluminum hydroxide or aluminum phosphate, (7) saponin or (8) other adjuvants discussed in any document cited and incorporated by reference into the instant application, or (9) any combinations or mixtures thereof.
- the oil in water emulsion (3) which is especially appropriate for viral vectors, can be based on: light liquid paraffin oil (European pharmacopoeia type), isoprenoid oil such as squalane, squalene, oil resulting from the oligomerization of alkenes, e.g.
- esters of acids or alcohols having a straight-chain alkyl group such as vegetable oils, ethyl oleate, propylene glycol, di(caprylate/caprate), glycerol tri(caprylate/caprate) and propylene glycol dioleate, or esters of branched, fatty alcohols or acids, especially isostearic acid esters.
- the oil is used in combination with emulsifiers to form an emulsion.
- the emulsif ⁇ ers may be nonionic surfactants, such as: esters of on the one hand sorbitan, mannide (e.g.
- anhydromannitol oleate glycerol, polyglycerol or propylene glycol and on the other hand oleic, isostearic, ricinoleic or hydroxystearic acids, said esters being optionally ethoxylated, or polyoxypropylene- polyoxyethylene copolymer blocks, such as Pluronic, e.g., L121.
- type (1) adjuvant polymers preference is given to polymers of crosslinked acrylic or methacrylic acid, especially crosslinked by polyalkenyl ethers of sugars or polyalcohols. These compounds are known under the name carbomer (Pharmeuropa, vol. 8, no. 2, June 1996).
- carbomer Pharmeuropa, vol. 8, no. 2, June 1996.
- One skilled in the art can also refer to U.S.
- Patent No. 2,909,462 which provides such acrylic polymers crosslinked by a polyhydroxyl compound having at least three hydroxyl groups, preferably no more than eight such groups, the hydrogen atoms of at least three hydroxyl groups being replaced by unsaturated, aliphatic radicals having at least two carbon atoms.
- the preferred radicals are those containing 2 to 4 carbon atoms, e.g.
- the unsaturated radicals can also contain other substituents, such as methyl.
- Products sold under the name Carbopol are especially suitable. They are crosslinked by allyl saccharose or by allyl pentaerythritol. Among them, reference is made to Carbopol 974P, 934P and 971P.
- EMA Monsanto
- EMA straight-chain or crosslinked ethylene-maleic anhydride copolymers and they are, for example, crosslinked by divinyl ether.
- acrylic or methacrylic acid polymers and EMA are preferably formed by basic units having the following formula:
- -Rl and R2 which can be the same or different, represent H or CH3
- polymers are soluble in water or physiological salt solution (20 g/1 NaCl) and the pH can be adjusted to 7.3 to 7.4, e.g., by soda (NaOH), to provide the adjuvant solution in which the expression vector(s) can be incorporated.
- the polymer concentration in the final immunological or vaccine composition can range between 0.01 and 1.5% w/v, between 0.05 and 1% w/v, and between 0.1 and 0.4% w/v.
- Another aspect of the invention relates to a method for inducing an immunological response in an animal to an antigen, which method comprises inoculating the animal with a vaccine or a pharmaceutical composition including modified recombinant APMV virus which comprises and encodes the antigen of a pathogen for said animal.
- Yet another aspect of the invention relates to a method for inducing an immunological response in an animal to an antigen in a prime-boost administration regimen, which is comprised of at least one primary administration and at least one booster administration using at least one common polypeptide, antigen, epitope or immunogen.
- the immunological composition or vaccine used in primary administration may be same, may be different in nature from those used as a booster.
- a composition or vaccine comprising the recombinant APMV virus (viral vector) of the present invention is administered followed by the administration of an inactivated viral vaccine or composition comprising an antigen, or a vaccine or composition comprising a subunit (protein, antigen), or a DNA plasmid vaccine or composition that contains or expresses an antigen.
- a prime- boost protocol may comprise the administration of an inactivated viral vaccine or composition comprising an antigen, or a vaccine or composition comprising a subunit (protein, antigen), or a DNA plasmid vaccine or composition that contains or expresses an antigen, followed by the administration of a composition or vaccine comprising the recombinant APMV virus (viral vector) of the present invention.
- both the primary and the secondary administrations may comprise the composition or vaccine comprising the recombinant APMV virus (viral vector) of the present invention.
- the primary administration may comprise one or more administrations of the same viral vector-based immunological compositions of vaccines.
- the booster administration may comprise one or more administrations of the same viral vector-based or immunological composition of vaccine.
- the administration route of the prime and the boost may be the same or different.
- the origin of the protective gene present in the prime and the boost may be the same or different (e.g. different strain).
- the various administrations are preferably carried out 1 to 6 weeks apart, and more particularly about 3 weeks apart.
- an annual booster preferably using the viral vector-based immunological composition of vaccine, is also envisaged.
- the animals are preferably at least one day old at the time of the first administration.
- a variety of administration routes may be used such as subcutaneously or intramuscularly, intradermally, transdermally, spray, drinking water, eye drop, intranasal, oral, oral baits, in ovo or a combination (e.g. oculonasal, oronasal).
- SPF specific pathogen free chickens
- APMV-2, 4, and 6 used for experimental studies were isolated from wild birds and classified by the National Veterinary Service Laboratory (NVSL, Ames Iowa, USA). Viruses were propagated in 9-day-old embryonated SPF chicken eggs (SunRise Farms, Catskill, NY, USA) by inoculation via the allantoic route. The allantoic fluid was harvested at day 3 after inoculation, aliquoted, and stored at -8O 0 C.
- the APMV subtype was confirmed by the HI test using standard sera (NVSL, Ames, Iowa, USA).
- EID50 egg infectious dose
- the 50% egg infectious dose (EID50) for each isolate was determined by inoculating 10-fold serial dilutions of allantoic fluid in embryonated SPF eggs.
- the titer was calculated following the method as described by Reed andMuench (Reed, LJ et al, 1938, Am. J. Epidemiol. 27:493-497).
- tissue sample was placed in a Lysing Matrix D tube (MP Biomedicals, Solon, OH) containing viral transport medium (IX minimal essential medium, 7.5% sodium bicarbonate, 15 mM HEPES, 1% fetal bovine serum, 4,000 U/ml penicillin, 400 ⁇ g/ml gentamycin, 8 ⁇ g/ml amphotericin B, 4,000 ⁇ g/ml streptomycin, 1000 ⁇ g/ml kanamycin sulfate).
- the second half of the tissue sample was fixed in 10% buffered formalin and embedded in paraffin wax. Sections of the paraffin-embedded tissues were stained with Mayer's hematoxylin and eosin (H&E).
- HA hemagglutination
- HI hemagglutination-inhibition
- HI antibody titers were investigated at day 2, 4, 7, 14, and 28 p.i. Positive HI titers (> 1 :16) were observed in serum samples of APMV-2 infected birds at day 7 (1/5), day 14 (5/5), and day 28 p.i. (5/5). Interestingly, only one chicken infected with APMV -4 developed an HI titer which has been considered as positive during the course of the experiment at day 14 p.i. Similarly for APMV-6, two chickens out of five developed a HI titer of 1 :16, only on day 28 p.i.. Mock inoculated birds remained negative for HI antibodies to all three APMV used in this experiment. In addition, to exclude cross contamination all sera were tested for HI antibodies against the other two antigens and remained negative.
- tissue samples collected in the Lysing Matrix D tubes were homogenized twice using the Fastprep ® -24 (MP Biomedicals, Solon, OH) at a setting of 4.0 M/S for 20 seconds. Following incubation for 15 min at room temperature, the homogenized samples were centrifuged for 20 min at 2000 g at 4°C.
- Sterility was tested after inoculation of 50 ⁇ l of the obtained supernatant in 2 ml tryptose phosphate broth (TPB) (DIFCO, Becton Dickenson, Sparks, MD, USA) supplemented with 10% hydrolactalbumin by incubation at 37°C in an orbital shaker overnight.
- TPB tryptose phosphate broth
- Non-sterile samples were filtered with 0.45 ⁇ m syringe filters (Whatman Inc., Florham Park, NJ, USA). Samples were stored at -80 0 C.
- Virus isolation was performed by inoculation of 0.1 ml into the allantoic cavity of 9-day-old embryonated SPF chicken eggs.
- APMV-2 was isolated from a single gut sample
- APMV-4 was isolated from the pancreas
- APMV-6 was isolated from lung and pancreas samples.
- no virus was isolated whereas at day 28 p.i. APMV-2, 4 and 6 could be isolated from the pancreas.
- No virus was isolated from mock inoculated birds. The identity of the back isolated virus was confirmed by HI test using standard sera as provided by NVSL.
- microscopical lesions in the obtained organs were analyzed ( Figure 2).
- Figure 2 At day 2 p.i., a catarrhal tracheitis in addition to ciliary loss on the respiratory epithelium and mild enteritis was observed in all infected chickens.
- day 4 p.i., APMV-2 infected chickens showed an increased number of hypertrophic mucous glands in the trachea and focal ulcerations of the respiratory epithelium.
- APMV-4 infected birds showed changes highly suggestive of a respiratory infection such as mild tracheitis, mild to moderate multifocal lymphocytic pancreatitis and also a focal BALT (Bronchus-Associated Lymphoid Tissue) hyperplasia at day 4 p.i.
- APMV-6 infected chickens revealed tracheal changes such as catarrhal and ulcerative tracheitis and a focal pancreatitis that are consistent with a viral stimulation.
- APMV-2 infected chickens showed focal tracheal attenuation or replacement of respiratory epithelium as indicative of healing.
- Birds infected with APMV-4 showed mild BALT hyperplasia while APMV-6 infected birds showed cystic enteropathy, focal enteritis and lymphocytic infiltrates in the pancreas.
- APMV-2 infected birds also showed healing changes such as tracheal attenuation at day 14 p.i.
- Organ samples from chicken infected with APMV-4 or 6 showed changes suggestive of viral infection such as mild interstitial pneumonia, catarrhal tracheitis and BALT or GALT hyperplasia at day 14 p.i.
- All investigated samples obtained from infected chicken showed lesions such as GALT hyperplasia, lymphocytic pancreatitis and lymphocytic bronchitis at day 28 p.i.
- birds of the control group showed a mild catarrhal tracheitis which could be attributed to
- Figure 3 shows low HI titers (up to 1 :32 at day 14) from SPF chickens infected with APMV-4 or APMV-6 indicating that only APMV-2 infection elicited an HI response that could be characterized as seropositive. Nevertheless, all three viruses were recovered from the infected birds' trachea, lungs, gut and pancreas up to day 7 p.i. and from the pancreas up to day 28 p.i.. Infection with APMV-2, 4, or 6 showed characteristic histopathological lesions (summarized in figure 2) in all the infected birds, indicative of stimulation with a viral antigen.
- the viral isolation and histological profiles of the infected birds clearly depicted the tropism of the viruses in the infected birds (trachea and lungs from day 2 to day 7 and gut, lung and pancreas from day 7 onwards). All isolates were detected in the pancreas up to 28 days p.i. but virus isolation was not possible at day 14 p.i.. This indicated that the investigated APMV can probably persist and later become reactivated. Thus virus carriers can be present in infected flocks. Only APMV-2 induced HI antibodies while HI antibodies of chickens infected with APMV-4 and 6 were not detected.
- APMV-8 virus (APMV-8: SCWDS ID: MA-7) used for experimental studies was isolated from a mallard and classified by the National Veterinary Service Laboratory (NVSL, Ames Iowa, USA). The virus was propagated in 9-day-old embryonated SPF chicken eggs by inoculation via the allantoic route.
- Allantoic fluids were harvested at day 3 after inoculation, pooled, aliquoted and stored at -80 0 C.
- the APMV-8 subtype was confirmed by HI testing using standard sera as provided by the National Veterinary Service Laboratory (Ames, IA, USA).
- the EID 50 was determined by inoculating 10-fold serial dilutions of allantoic fluid in embryonated SPF eggs. The titer was calculated following the method as described by Reed and Muench (Reed &
- VTM viral transport medium
- IX minimal essential medium
- sodium bicarbonate 7.5% sodium bicarbonate
- 15 mM HEPES 1% fetal bovine serum
- 4,000 U/ml penicillin 400 ⁇ g/ml gentamycin
- 8 ⁇ g/ml amphotericin B 4,000 ⁇ g/ml streptomycin
- 1000 ⁇ g/ml kanamycin sulfate 1000 ⁇ g/ml kanamycin sulfate.
- H &E hematoxylin and eosin
- tissue samples collected in the Lysing Matrix D tubes were homogenized twice using the FastPrep-24 (MP Biomedicals) at a setting of 4.0 M/S for 20 seconds.
- the homogenized samples were incubated for 15 min at room temperature and then centrifuged for 20 min at 2000xg at 4°C. 50 ⁇ l of the obtained supernatant was inoculated in 2 ml sterile TFB supplemented with 10% hydrolactalbumin followed by incubation at 37°C in an orbital shaker overnight to test for sterility.
- Non-sterile samples were filtered with 0.45 ⁇ m syringe filters (Whatman Inc.). Samples were stored at -8O 0 C.
- Virus isolation was performed by inoculation of 0.1 ml into the allantoic cavity of 9-day-old embryonated SPF chicken eggs. After incubation for three days at 37.5°C, the allantoic fluid was harvested and tested for the presence of hemagluttinating activity by HA.
- HA hemagglutination
- HI hemagglutination-inhibition
- Figure 4 shows HI antibody titers in SPF chickens and ducks infected with
- APMV-8 Sera samples were collected at day 2, 4, 7, 14, and 28 p.i. and analyzed by the HI test with the APMV-8 antigen.
- the HI serum titers (in Iog2) are shown on the left axis.
- ICPI intracerebral pathogenicity index
- APMV-8 from 10 " 1 through 10 "8 .
- MDT mean dead time
- ICPI intracerebral pathogenicity index
- RNA isolation kit (Roche, Mannheim, Germany).
- a primer pair (8NPfI, 8NPr, see table 1) was used in an RT-PCR using the Supercript III One Step RT-PCR kit with Platinum Taq (Invitrogen, Carlsbad, CA, USA) following the instructions of the manufacturer.
- reaction products were analyzed on a 1% agarose gel (Figure 6). Tracheal tissues were taken at day 2 p.i. from non-infected ducks (C1-C5) and APMV-8 infected ducks (11-15). The tissues were homogenized and RNA was prepared for RT-PCR. A water control (W) was prepared in parallel. The reaction products were separated on a
- VTM virus specific antibodies
- the HI titers ranged from 32 to 256 for chickens, while for ducks the range was from 16 to 64. Sham inoculated birds remained negative for HI antibodies to
- APMV-8 was recovered at 2 d p.i. from trachea, lung, and duodenum. At 4 d p.i., APMV-8 was isolated from all the analyzed organs; while at 7 d p.i., APMV-8 was isolated only from the pancreas. At 14 and 28 d p.i. no virus was isolated from any organ. No virus was isolated from sham inoculated birds.
- RT-PCR primers were designed based on the APMV-8 sequence information available to detect the presence of viral RNA in the collected tissue samples (Figure 7). At 2 d p.i viral RNA was detected in the trachea ( Figure 6), gut and pancreas while at 4 d p.i viral RNA was detected in all the organs analyzed. At 7, 14, and 28 d p.i, viral RNA was detected only in the trachea and lung. RT-PCR using RNA obtained from organs of mock inoculated birds did not result in the amplification of an RT-PCR fragment which indicates the absence of APMV-8 in these birds.
- tracheal changes such as catarrhal tracheitis and multifocal lymphocytic pancreatitis.
- lymphocytic tracheitis lung changes (interstitial pneumonia) and intestinal changes (lymphocytic enteritis) were observed at 2 d p.i while tracheal changes consistent with respiratory infection were seen at 4 d.p.i..
- infected ducks showed lymphocytic tracheitis and pancreatitis consistent with viral infection whereas the observed catarrhal tracheitis was a suggestive of healing at 14 d p.i..
- infected ducks showed a lymphocytic pancreatitis at 14 d p.i..
- EID50 of 10 5 and 10 6 induced an HI titer of >16 at day 14 p.i. in all birds with a GMT of 73 and 137, respectively.
- EID50 of 10 ⁇ /bird and 7/8 ducks infected with an EID50 of lO ⁇ /birds developed significant titers (>16) with a GMT of 17 and 23, respectively.
- APMV-8 For the determination of the full length sequence of APMV-8, viral RNA sequence information is initially needed. To this end, the 3 '-end of the viral genome was cloned by using a primer (APMV-polyT, see table 1) which contained a degenerated sequence based on available 3'- sequences of APMVl (Genbank accession No.
- the obtained nucleotide sequences were analyzed in an nblast search against the NC 1 Bl database which resulted in no similarities, A tblastx search against the NCBI database showed similarities Lo the nuclcoprotcin of 83% similarity of an Avian paramyxovirus 2 (APMV-2/Chicken/California/Yucaipa/56, Genbank accession No. EU338414) and of 56% similarity of an Avian paramyxovirus 6 strain (APMV- 6/Goose/FarEast/4440/2003, Genbank accession No. EF569970). Using this primer, the primer walking method was employed using the 5 ' RACE System for Rapid
- the 5'-RACE produced an approximately 800 bp fragment.
- new sequence information was obtained based on sequence information from the previous sequence which has been used for the delineation of new oligonucleotides.
- the 5 '-end of the viral genome was also determined by the 5'-RACE method.
- the 3 '-end of the viral genome was obtained after ligation of the RNA with T4 RNA ligasel (New England Biolabs).
- the ligation reaction was purified again with High Pure RNA isolation kit (Roche) and an RT-PCR was performed using Superscript III One Step RT-PCR kit with Platinum Taq (Invitrogen).
- the obtained cDNA fragment was cloned into the pCR2.1 vector (Invitrogen) and sequenced. Three plasmids from each cloned fragment were sequenced in both directions, thus resulting in sequence 6x-coverage of per nucleotide.
- the full length genome sequence of the analyzed APMV-8 strain is 15342 nucleotides, this is in accordance to the rule of six (Calain, P. & Roux, L., 1993) for Paramyxovirinae.
- Six open reading frames (ORF) have been detected and are encoding for proteins.
- the order of the proteins was determined as 3' -NP-P-M -F-HN-L-5' (the genome sequence SEQ ID NO:1 is in the 5' to 3' orientation antigenomic) using similarities of the protein sequence to proteins of other avian paramyxoviruses.
- the putative start and stop codons of the ORF 's and the theoretical molecular weight (Swiss Institute of Bioinformatics ExPASy website) of the proteins are shown in table 2.
- the putative genomic leader and trailer sequences were determined by determination of the putative gene start sequence of the NP gene (leader) and putative gene end sequence of the L protein (trailer).
- the leader sequence is located from nucleotide 1 to nucleotide 55.
- the putative gene start sequence (nt 56-63) of the NP gene ends the leader sequence.
- the trailer sequence is localized behind the last gene end sequence in the viral genome. Due to the presence of two putative gene end sequences for the RNA polymerase gene (nt 15161-15171 or 15288 -15297) two putative trailer sequences have been identified (nt 15172-15342 or nt 15289-15342).
- the location of the putative gene start sequence (poly G containing sequences) and gene end sequences (signal sequence for a polyadenylation) and the intergenic sequences were summarized in table 3.
- Phosphoprotein 1628-1635 2991-3001 3002-3031
- the putative gene start sequences for APMV-8 were conserved containing a poly (C)5 sequence followed by a 3'-GCU-5' sequence. The only exception is the putative gene start sequence for the viral RNA polymerase (3'-CUCCCGCU-5'). The putative gene end sequences were also conserved and contain a poly (U) ⁇ sequence at the genomic viral 5' sequence (Table 5).
- APMV-8 The genome of APMV-8 is 15342 nt long. This is larger than APMV-I (SQ ID NO: 15, 15186 nt, de Leeuw & Peeters, 1999), APMV-2 (SEQ ID NO: 16, 14,904 nt, Subbiah et al., 2008), and APMV-4 (SEQ ID NO:18, 15054 nt, Nayak et al., 2008), and smaller than APMV-3 (SEQ ID NO: 17, 16,272 nt, Kumar et al., 2008) and APMV-9 (SEQ ID NO:20, 15,438 nt, Samuel et al., 2009).
- APMV-I SQ ID NO: 15, 15186 nt, de Leeuw & Peeters, 1999
- APMV-2 SEQ ID NO: 16, 14,904 nt, Subbiah et al., 2008
- APMV-4 SEQ ID NO:18, 15054 nt, Nayak et
- the length of 55 nt of the leader sequence seemed to be conserved between all APMV (Krishnamurthy & Samal, 1998, de Leeuw & Peeters, 1999, Subbiah et al., 2008, Nayak et al., 2008, Kumar et al., 2008, Samuel et al., 2009) whereas the trailer sequence seemed to be variable in length.
- the gene start and gene end sequences of the viral genes were also highly conserved for APMV-8 (as shown in Table 5).
- the percent sequence identity between two nucleic acid or polypeptide sequences is determined using Vector NTI 11.0 (PC) software package (Invitrogen, 1600 Faraday Ave., Carlsbad, CA). A gap opening penalty of 15 and a gap extension penalty of 6.66 are used for determining the percent identity of two nucleic acids. A gap opening penalty of 10 and a gap extension penalty of 0.1 are used for determining the percent identity of two polypeptides. The percent identity was calculated based on the shorter sequence.
- PC Vector NTI 11.0
- the one-day-old chickens were bled to determine the antibody status directed against Newcastle disease virus (NDV) and APMV-8 using the hemagglutination inhibition assay (HI test).
- the test was performed using allantoic fluid from either NDV strain Lasota or APMV-8 infected SPF eggs.
- Four HA units of NDV strain Lasota or APMV-8 and 1% chicken red blood cells were used for the HI test.
- the resulting HI titers show that the serum of the chickens contained HI antibodies directed against NDV but no detectable antibodies against APMV-8 virus.
- group 1 of 10 chickens were infected with via the nasal route with 10 6 EID50 of APMV-8 strain, group 2 of 10 chickens were not infected serving as control.
- the serum titers showed that a first vaccination at day 14 (group 2-1) did induce APMV-8 specific antibody titers ranging from 32 to 512. In chickens vaccinated only at day 1 (group 1-2), the antibody titers declined to titers in a range from 128 to 512. In chickens which have been vaccinated at day 1 and day 14 (group 1-1), the APMV-8 specific antibody titer did not increase, sugesting that the virus used for the second infection was neutralized by APMV-8 specific antibodies induced by the first infection. The serum of the non- vaccinated controls (group 2-2) did not contain APMV-8 specific HI antibodies. At day 28, the NDV antibodies declined further, only 11 chickens out of the 20 chickens showed any HI titers with the NDV antigen whereas at day 14 fourteen chickens showed low antibody titers against NDV.
- the control group did not show any HI titer specific for APMV-8.
- the group subcutaneously vaccinated with APMV-8 showed a seroconversion with a titer ranging from 64 to 4096.
- the chickens were bled again at day 28 after hatch and tested for the presence of APMV-8 specific HI antibodies.
- the HI titer at four weeks after hatch decreased and ranged between 512 and 4096.
- the control group did not show any HI titer specific for APMV- 8.
- the HI titer in the group which was subcutaneously vaccinated showed HI titers ranging between 32 and 256.
- RNA of allantoic fluid containing APMV-8 was purified using the High Pure RNA Isolation Kit (Roche, Basel, Switzerland). The purified RNA was used for reverse transcription polymerase chain reaction (RT-PCR) using the Titan One Tube RT-PCR Kit (Roche).
- the ORFs of the proteins were amplified using the appropriate primer pairs: [NP (NP-FP, NP-RP), P (P-FP, P-RP), L (L-FP, L-RP), see table 9].
- the reactions products were separated on a 0.7% agarose gel and eluted from the gel using the
- Plasmids containing DNA fragments were sequenced.
- a The primer sequence contains the restriction enzyme
- cleavage sites used for cloning.
- the restriction sites are bold and
- the cDNA genome of the virus was synthesized (Genscript, New York, USA) based on the generated consensus sequence in two different parts (5'-FLG, 3'-FLG, see Figure 25).
- the 5 '-part (5'-FLG, SEQ ID NO:47) of the viral sequence was synthesized from nucleotide 1-5564.
- Preceding the APMV-8 sequence is a sequence cassette consisting of the CMV-IE promoter, followed by a restriction enzyme cleavage sequence for Xmal (for possible subsequent cloning procedures) and the hammerhead ribozyme sequence.
- restriction enzyme cleavage sites for Not I and SacII were added, respectively.
- the synthesized 3 '-part (3'-FLG, SEQ ID NO:48) of the sequence (nucleotide 5503-15342) is followed by the hepatitis delta ribozyme sequence and poly-A signal sequence of the bovine growth hormone.
- the sequence for the Not I restriction enzyme was added at the 5'- end of 3'-FLG and the sequence for the Sac II restriction enzyme was added at the 3 '-end of the sequence.
- pUC57/3'-FLG was cleaved with the same enzymes and the fragment 3'-FLG was eluted.
- the 3'-FLG was subsequently ligated into 5'-FLG-containing plasmid to obtain a plasmid which contains the full length cDNA sequence of the APMV-8 genome under the control of the CMV-IE promoter (pUC57-FL-APMV-8).
- Plasmid pMG- APMV-8 contains the trailer and leader region of the APMV-8 genome which is flanked by the T7 promoter and the antigenome hepatitis delta virus ribozyme sequence (Collins, et al, PNAS USA 88:9663-9667, 1991).
- the antigenome hepatitis delta virus ribozyme sequence is followed by a T7 transcription terminator sequence.
- the coding sequence of the enhanced green fluorescent protein in antisense orientation is located. Preceding the trailer sequence and immediate after the T7 promoter three additional G residues are located.
- the insert is flanked by the restriction enzyme cleavage sites Eco RI and Not I and was cloned blunt end into the plasmid pUC57. This construct was subcloned into the plasmid pUC18. To this end, plasmid pMG-APMV-8 then was cleaved with Eco RI and Hind III and the appropriate fragment was gel eluted and ligated into the appropriately cleaved plasmid pUC18 to obtained puC18-MG-APMV-8. The presence of the insert was confirmed by sequencing.
- the T7 polymerase sequence (SEQ ID NO:49) was modified for optimization of the codon usage for expression in a eukaryotic system and to remove possible splice donor/acceptor sites in the sequence.
- the T7 polymerase encoding sequence was flanked by an EcoRI (5') and Notl (3') site.
- the synthesized fragment was cloned blunt end into the vector pUC57 (pCU57-T7).
- This plasmid was cleaved with EcoRI/Notl and the T7 polymerase-encoding fragment was gel eluted.
- the fragment was then cloned into the eukaryotic expressions vector pcDNA3 (Invitrogen) to obtain pcDNA3-T7.
- the presence of the fragment in the vector pcDNA3- T7 was verified by sequencing.
- EGFP enhanced green fluorescent protein
- EGFP-FP (CCGGATCCATGGTGAGCAAGGGCGAGGAGCTG) SEQ ID NO:50 and EGFP-RP (CCGCGGCCGCTTACTTGTACAGCTCGTCCATGCCG) SEQ ID NO:51 [0160]
- the obtained PCR fragment was gel eluted and incubated with the restriction enzymes BamHI and Notl.
- the reaction product was gel eluted and ligated into the appropriately cleaved vector pCITE 4A (Novagen).
- the obtained plasmid (pCITE4A- EGFP) was used for subsequent experiments.
- Plasmids pCITE4 A-EGFP and pcDNA3- T7 were transfected alone or in combination into the chicken cell line DFl grown in 24- well-plates using Lipofectin 2000 (Invitrogen). Twenty four hours after transfection, the medium was removed and sterile phosphate buffered saline (PBS) was added. The cells were evaluated using the inverted fluorescence microscope Axiovert 40 CFL (Zeiss, Jena, Germany). Green fluorescence was only observed in wells of the tissue culture plate which was co-transfected with both plasmids. This result indicates that both plasmids, pCITE4A-EGFP and pcDNA3-T7, were functional.
- DFl cells were co-transfected with pcDNA3-T7, pUC18-MG-APMV-8, pcDNA-NP, pcDNA-P, and pcDNA-L to validate the functionality of the expressed NP, P and L proteins. Twenty four hours after transfection, the medium was removed and sterile phosphate buffered saline (PBS) was added. The cells were evaluated using the inverted fluorescence microscope Axiovert 40 CFL (Zeiss, Jena, Germany). Green fluorescence was only observed in wells of the tissue culture plate which was co- transfected with the 5 plasmids. This result indicates that the expressed viral proteins NP, P and L were functional to transcribe the APMV-8 minigenome into mRNA and express the EGFP protein encoded by pUC18-MG-APMV-8.
- PBS sterile phosphate buffered saline
- DF 1 cells were co-transfected with pUC57-FL-APMV-8. pcDNA-NP, pcDNA-P, and pcDNA-L. After 48 to 96 hours, the supernatants of the DFl cells were inoculated in 10-day-old embryonated eggs to propagate the virus. After 3 to 5 days, the allantoic fluid was harvested and tested for hemagglutination activity (HA) using 1% chicken red blood cells. Allantoic fluid tested positive for HA activity was used for three procedures. 1) DFl cells were infected with the allantoic fluid and tested 36 hours after infection with an APMV-8 specific antiserum for the presence of APMV-8 protein expression in an indirect immunofluorescence assay.
- HA hemagglutination activity
- the allantoic fluid was tested for APMV-8 specificity using an APMV-8 specific chicken serum (provided by the National Central Veterinary Laboratory, Ames, Iowa, USA) by an hemagglutination inhibition assay. 3) The rescue virus was identified by RT-PCR using APMV-8 specific oligonucleotides. The absence of viral cDNA was verified by omitting the RT step during the reaction. Samples tested positive in all three assays were further propagated in embryonated SPF chicken eggs.
- Cells from different species [hamster (Baby hamster kidney cells, BHK-21 cells), monkey (Vero cells, cell line with the origin of the kidney of an African green monkey), and canine (Madin-Darby canine kidney cells, MDCK), and quail (Quail muscle cell line QM7)] were grown in 24 well tissue culture plates and infected with a multiplicity of infection of 0.01. The cells were fixed with ice cold ethanol 24 hours after infection and analyzed for the presence of APMV-8 specific proteins by indirect immunofluorescence using an APMV-8 specific antiserum from an APMV-8 infected SPF chicken. The binding of the antibodies was visualized by using a goat anti-chicken IgY specific FITC conjugate. Non-infected cells were used as negative control. Only in the APMV-8 infected cells was green fluorescence observed. This indicated that APMV- 8 was able to infect cells from species other than chicken.
- APMV-8 The replication of APMV-8 was increased in presence of trypsin.
- MDCK cells were infected with APMV-8 as described above. After infection the cells were rinsed with serum-free medium and either overlaid with trypzin-containing serum- free medium in a concentration of lug/ml or with serum-free medium only. Twenty four, forty eight, and ninety six hours after infection the cell supernatants were removed and the TCID50 was determined on DFl cells using indirect immunofluorescence as described above. The obtained data indicated that in presence of trypsin APMV-8 replicated to a higher titer than in absence of this enzyme (Figure 19B).
- the results of this example showed that, like AMPV-I, APMV-8 is able to penetrate into cells of different species and to initiate its replication cycle. It is therefore a suitable vector for multiple species.
- the coding sequence for the HA gene of HPAI of the H5 or H7 subtype virus is inserted in the nonessential regions, for example, between the M and F genes or between the P and M genes of the APMV-8 genome in the plasmid containing the full length APMV-8 genome.
- the coding sequence of the hemagglutinin open reading frame is flanked by all the necessary regulatory sequences of the F gene which includes the gene start sequence, the 5' non-coding sequence, the 3' non-coding sequence and the gene stop sequence.
- the construct is synthesized in a way that the restriction enzyme cleavage sites Bsu 361 and Nhe I are used for the ligation of the appropriate fragment into the existing plasmid containing full length APMV-8 genome due to their uniqueness in the plasmid construct.
- the resulting plasmid is designated transcription plasmid which contains the
- hemagglutinin gene in the nonessential region of the full length APMV-8 genome.
- the coding sequences of a variety of viral and bacterial antigen can be cloned into the backbone of the APMV-8 sequence.
- Other possible antigens which could be inserted into the APMV-8 genome are the fusion protein of the Newcastle disease virus, the S protein of avian bronchitis virus, other hemagglutinin genes from non-H5 and non-H7 avian influenza virus, the chicken anemia virus structural protein gene VPl, glycoprotein genes from infectious laryngotracheitis virus.
- the animals are vaccinated with one, two administrations or a prime-boost regime of the composition or vaccine containing the recombinant APMV-8 virus (viral vector) as described in example 6.
- various administrations are performed, for example, in ovo administration at Dl 8 or D 19, subcutaneous (SC) at one- day-old, or mucosal administration (spray, drinking water, eye drop) at different ages.
- the dose is between 3 and 7 log 10 (preferably 4-6 log 10 EID50).
- mucosal route intra-nasal, intra-ocular, oral
- parenteral IM, SC, needle-free, trans-dermal or intra-dermal
- the dose ranges from 5 to 9 log (preferably 6-8 log).
- Two administrations are usually performed at 3-4 weeks interval. Heterologous prime-boost (for instance, boost with proteins) would be also advantageous.
- the protective efficacy induced by the composition or vaccine is evaluated against the specific pathogen challenge in the animals.
- the protective effect is evaluated by clinical observations and/or viral load of the specific pathogen in tissues, blood or mucosal swabs.
- the blood samples from the vaccinated animals are taken at various stages and tested for serology. The results show that the composition or vaccine of the present invention is immunogenic and provides protection in the vaccinated animals.
- Herpesvirus of turkey recombinant viruses expressing infectious bursal disease virus (IBDV) VP2 immunogen induce protection against an IBDV virulent challenge in chickens.
- Newcastle disease virus-based live attenuated vaccine completely protects chickens and mice from lethal challenge of homologous and heterologous H5N1 avian influenza viruses. Journal of Virology, 81(1), 150-158.
- NDV Newcastle Disease Virus
- IBDV Infectious Bursal Disease Virus
- laryngotracheitis (ILT) virus leads to attenuation in chickens, and ULO mutants expressing influenza virus haemagglutinin (H7) protect against ILT and fowl plague.
- Newcastle disease virus expressing H5 hemagglutinin gene protects chickens against Newcastle disease and avian influenza. Proceedings of the National Academy of Sciences, 103(21), 8197-8202.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Pulmonology (AREA)
- Tropical Medicine & Parasitology (AREA)
- AIDS & HIV (AREA)
- Crystallography & Structural Chemistry (AREA)
- Radiology & Medical Imaging (AREA)
Priority Applications (14)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR112012003837A BR112012003837B8 (pt) | 2009-08-21 | 2010-08-20 | Vacina de paramyxovírus aviária recombinante e método para fazer e usar a mesma |
| JP2012525730A JP6221167B2 (ja) | 2009-08-21 | 2010-08-20 | 組換えトリパラミクソウイルスワクチン並びに前記の製造および使用方法 |
| ES10747133T ES2622087T3 (es) | 2009-08-21 | 2010-08-20 | Vacuna recombinante contra paramyxovirus aviar y procedimiento de fabricación y utilización de la misma |
| SG2012011912A SG178523A1 (en) | 2009-08-21 | 2010-08-20 | Recombinant avian paramyxovirus vaccine and method for making and using thereof |
| EP10747133.6A EP2467158B1 (en) | 2009-08-21 | 2010-08-20 | Recombinant avian paramyxovirus vaccine and method for making and using thereof |
| RU2012110576/10A RU2592544C2 (ru) | 2009-08-21 | 2010-08-20 | Способ получения рекомбинантного вирусного вектора apmv-8 |
| EP16204538.9A EP3210622B1 (en) | 2009-08-21 | 2010-08-20 | Recombinant avian paramyxovirus vaccine and method for making and using thereof |
| CN201080045564.7A CN102573901B (zh) | 2009-08-21 | 2010-08-20 | 重组禽副粘病毒疫苗及其制备和使用方法 |
| UAA201203242A UA110328C2 (en) | 2009-08-21 | 2010-08-20 | Recombinant vaccine based on avian paramixoviruses and method for its preparation and administration |
| PL16204538T PL3210622T3 (pl) | 2009-08-21 | 2010-08-20 | Szczepionka z rekombinowanym paramyksowirusem ptaków oraz sposób jej wytwarzania i zastosowania |
| KR1020127007373A KR101745029B1 (ko) | 2009-08-21 | 2010-08-20 | 재조합 조류 파라믹소바이러스 백신 및 이의 제조 및 사용 방법 |
| CA2771540A CA2771540C (en) | 2009-08-21 | 2010-08-20 | Recombinant avian paramyxovirus vaccine and method for making and using thereof |
| MX2012002114A MX2012002114A (es) | 2009-08-21 | 2010-08-20 | Vacuna de paramixovirus aviar recombinante y metodo para hacerla y usarla. |
| ZA2012/01245A ZA201201245B (en) | 2009-08-21 | 2012-02-20 | Recombinant avian paramyxovirus vaccine and method for making and using thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US23591209P | 2009-08-21 | 2009-08-21 | |
| US61/235,912 | 2009-08-21 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2011022656A2 true WO2011022656A2 (en) | 2011-02-24 |
| WO2011022656A3 WO2011022656A3 (en) | 2011-05-05 |
Family
ID=43027613
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/046179 Ceased WO2011022656A2 (en) | 2009-08-21 | 2010-08-20 | Recombinant avian paramyxovirus vaccine and method for making and using thereof |
Country Status (19)
| Country | Link |
|---|---|
| US (1) | US8486418B2 (enExample) |
| EP (2) | EP2467158B1 (enExample) |
| JP (2) | JP6221167B2 (enExample) |
| KR (1) | KR101745029B1 (enExample) |
| CN (2) | CN102573901B (enExample) |
| BR (1) | BR112012003837B8 (enExample) |
| CA (1) | CA2771540C (enExample) |
| CL (2) | CL2012000447A1 (enExample) |
| CO (1) | CO6511253A2 (enExample) |
| ES (2) | ES2867457T3 (enExample) |
| HU (2) | HUE033886T2 (enExample) |
| MX (1) | MX2012002114A (enExample) |
| PL (2) | PL3210622T3 (enExample) |
| PT (2) | PT3210622T (enExample) |
| RU (2) | RU2592544C2 (enExample) |
| SG (2) | SG178523A1 (enExample) |
| UA (1) | UA110328C2 (enExample) |
| WO (1) | WO2011022656A2 (enExample) |
| ZA (1) | ZA201201245B (enExample) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104195116A (zh) * | 2014-08-13 | 2014-12-10 | 吉林大学 | 一种表达鹅细小病毒vp3基因的重组新城疫病毒及其构建方法 |
| WO2018209194A3 (en) * | 2017-05-12 | 2018-12-20 | Icahn School Of Medicine At Mount Sinai | Newcastle disease viruses and uses thereof |
| US10251922B2 (en) | 2013-03-14 | 2019-04-09 | Icahn School Of Medicine At Mount Sinai | Newcastle disease viruses and uses thereof |
| US11389495B2 (en) | 2014-02-27 | 2022-07-19 | Merck Sharp & Dohme Llc | Combination method for treatment of cancer |
| US12391957B2 (en) | 2018-08-17 | 2025-08-19 | Icahn School Of Medicine At Mount Sinai | Recombinant Newcastle disease viruses and uses thereof for the prevention of RSV disease or human metapneumovirus disease |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140341950A1 (en) * | 2013-05-15 | 2014-11-20 | University Of Georgia Research Foundation, Inc. | Recombinant avian paramyxovirus vaccine and method for making and using thereof |
| CA2956291A1 (en) * | 2014-08-22 | 2016-02-25 | Investigacion Aplicada, S.A. De C.V. | Emulsified vaccine to obtain formulations of concentrated igy immunoglobulins; processes and uses for the same |
| WO2016073410A1 (en) | 2014-11-03 | 2016-05-12 | Merial, Inc. | Methods of using microneedle vaccine formulations to elicit in animals protective immunity against rabies virus |
| CN107254450A (zh) * | 2017-07-20 | 2017-10-17 | 扬州大学 | 克服鸡新城疫母源抗体影响的嵌合新城疫病毒疫苗载体候选株及构建方法 |
| EP4397757A3 (en) | 2017-08-18 | 2024-10-23 | ModernaTX, Inc. | Rna polymerase variants |
| CN108315486A (zh) * | 2018-04-11 | 2018-07-24 | 张薇 | 一种用于检测罗湖病毒的环介导等温扩增引物组及试剂盒 |
| WO2020014591A1 (en) * | 2018-07-13 | 2020-01-16 | Icahn School Of Medicine At Mount Sinai | Apmv and uses thereof for the treatment of cancer |
| MA55037A (fr) | 2019-02-20 | 2021-12-29 | Modernatx Inc | Variants d'arn polymérase pour le coiffage co-transcriptionnel |
| CN114390946A (zh) | 2019-11-13 | 2022-04-22 | 株式会社Ihi | 将填充部件插入反应装置中的夹具 |
| CN112111467B (zh) * | 2020-09-27 | 2021-06-22 | 湖北省农业科学院畜牧兽医研究所 | 一种基因vii型新城疫标记疫苗株及其制备方法与应用 |
| CN116068196A (zh) * | 2022-10-26 | 2023-05-05 | 新疆农业大学 | 一种检测禽副黏病毒4型血清抗体的elisa方法 |
Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US2909462A (en) | 1955-12-08 | 1959-10-20 | Bristol Myers Co | Acrylic acid polymer laxative compositions |
| US4603112A (en) | 1981-12-24 | 1986-07-29 | Health Research, Incorporated | Modified vaccinia virus |
| US4708871A (en) | 1983-03-08 | 1987-11-24 | Commonwealth Serum Laboratories Commission | Antigenically active amino acid sequences |
| US4722848A (en) | 1982-12-08 | 1988-02-02 | Health Research, Incorporated | Method for immunizing animals with synthetically modified vaccinia virus |
| US4769330A (en) | 1981-12-24 | 1988-09-06 | Health Research, Incorporated | Modified vaccinia virus and methods for making and using the same |
| US5174993A (en) | 1981-12-24 | 1992-12-29 | Health Research Inc. | Recombinant avipox virus and immunological use thereof |
| WO1998016247A1 (en) | 1996-10-11 | 1998-04-23 | The Regents Of The University Of California | Immunostimulatory polynucleotide/immunomodulatory molecule conjugates |
| US5756103A (en) | 1991-03-07 | 1998-05-26 | Virogenetics Corporation | Alvac canarypox virus recombinants comprising heterlogous inserts |
| US6358500B1 (en) | 1998-05-20 | 2002-03-19 | L'oreal | Stable W/O/W emulsion and its use as cosmetic and/or dermatological composition |
| US6719979B2 (en) | 1998-06-19 | 2004-04-13 | Id-Lelystad, Instituut Voor Dierhouderij En Diergezondheid B.V. | Newcastle disease virus infectious clones, vaccines and diagnostic assays |
| US6919084B2 (en) | 1999-11-26 | 2005-07-19 | Merial | Duck pneumovirus and corresponding vaccines |
| US7371395B2 (en) | 2003-07-24 | 2008-05-13 | Merial Limited | Vaccine formulations |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2162341C1 (ru) * | 2000-03-06 | 2001-01-27 | Открытое акционерное общество "ВЫМПЕЛ КОМПЛЕКС" | Сухая живая вакцина против ньюкаслской болезни и способ ее получения |
| JP4791651B2 (ja) * | 2000-05-18 | 2011-10-12 | 株式会社ディナベック研究所 | 外来遺伝子導入用パラミクソウイルスベクター |
| PL207132B1 (pl) * | 2000-11-02 | 2010-11-30 | Intervet Int Bv | Mutant wirusa choroby Newcastle (NDV), szczepionka, zastosowanie NDV zmutowanego w NP, sposób określania zakażenia NDV u drobiu, zestaw do testu diagnostycznego |
| EP1996610A1 (en) * | 2006-03-15 | 2008-12-03 | Intervet International BV | Recombinant newcastle disease virus expressing h5 hemagglutinin of avian influenza virus |
| RU2441070C2 (ru) * | 2006-03-15 | 2012-01-27 | Интервет Интернэшнл Б.В. | Рекомбинантный вирус болезни ньюкастла, экспрессирующий н5 гемаглютинин вируса птичьего гриппа (avian ineluenza) |
| EP1834651A1 (en) * | 2006-03-15 | 2007-09-19 | Universiteit Gent | Compositions and methods for veterinary vaccination |
| US20090175826A1 (en) * | 2006-06-05 | 2009-07-09 | Elankumaran Subbiah | Genetically-engineered newcastle disease virus as an oncolytic agent, and methods of using same |
| US20090208495A1 (en) * | 2008-02-14 | 2009-08-20 | Bayer Schering Pharma Ag | Anti-tumor effective paramyxovirus |
| JP5797636B2 (ja) * | 2009-04-03 | 2015-10-21 | メリアル リミテッド | ニューカッスル病ウイルスをベクターとするトリワクチン |
-
2010
- 2010-08-20 RU RU2012110576/10A patent/RU2592544C2/ru active
- 2010-08-20 EP EP10747133.6A patent/EP2467158B1/en active Active
- 2010-08-20 CN CN201080045564.7A patent/CN102573901B/zh active Active
- 2010-08-20 MX MX2012002114A patent/MX2012002114A/es active IP Right Grant
- 2010-08-20 HU HUE10747133A patent/HUE033886T2/en unknown
- 2010-08-20 SG SG2012011912A patent/SG178523A1/en unknown
- 2010-08-20 EP EP16204538.9A patent/EP3210622B1/en active Active
- 2010-08-20 SG SG10201405123WA patent/SG10201405123WA/en unknown
- 2010-08-20 UA UAA201203242A patent/UA110328C2/ru unknown
- 2010-08-20 PT PT162045389T patent/PT3210622T/pt unknown
- 2010-08-20 HU HUE16204538A patent/HUE053237T2/hu unknown
- 2010-08-20 WO PCT/US2010/046179 patent/WO2011022656A2/en not_active Ceased
- 2010-08-20 ES ES16204538T patent/ES2867457T3/es active Active
- 2010-08-20 KR KR1020127007373A patent/KR101745029B1/ko active Active
- 2010-08-20 CA CA2771540A patent/CA2771540C/en active Active
- 2010-08-20 ES ES10747133T patent/ES2622087T3/es active Active
- 2010-08-20 PL PL16204538T patent/PL3210622T3/pl unknown
- 2010-08-20 RU RU2016112465A patent/RU2016112465A/ru not_active Application Discontinuation
- 2010-08-20 CN CN201510564915.XA patent/CN105331633A/zh active Pending
- 2010-08-20 BR BR112012003837A patent/BR112012003837B8/pt active Search and Examination
- 2010-08-20 PL PL10747133T patent/PL2467158T3/pl unknown
- 2010-08-20 US US12/860,589 patent/US8486418B2/en active Active
- 2010-08-20 PT PT107471336T patent/PT2467158T/pt unknown
- 2010-08-20 JP JP2012525730A patent/JP6221167B2/ja active Active
-
2012
- 2012-02-20 ZA ZA2012/01245A patent/ZA201201245B/en unknown
- 2012-02-21 CL CL2012000447A patent/CL2012000447A1/es unknown
- 2012-03-20 CO CO12046741A patent/CO6511253A2/es unknown
-
2015
- 2015-08-04 CL CL2015002175A patent/CL2015002175A1/es unknown
- 2015-12-17 JP JP2015246684A patent/JP2016041079A/ja active Pending
Patent Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US2909462A (en) | 1955-12-08 | 1959-10-20 | Bristol Myers Co | Acrylic acid polymer laxative compositions |
| US4603112A (en) | 1981-12-24 | 1986-07-29 | Health Research, Incorporated | Modified vaccinia virus |
| US4769330A (en) | 1981-12-24 | 1988-09-06 | Health Research, Incorporated | Modified vaccinia virus and methods for making and using the same |
| US5174993A (en) | 1981-12-24 | 1992-12-29 | Health Research Inc. | Recombinant avipox virus and immunological use thereof |
| US4722848A (en) | 1982-12-08 | 1988-02-02 | Health Research, Incorporated | Method for immunizing animals with synthetically modified vaccinia virus |
| US4708871A (en) | 1983-03-08 | 1987-11-24 | Commonwealth Serum Laboratories Commission | Antigenically active amino acid sequences |
| US5756103A (en) | 1991-03-07 | 1998-05-26 | Virogenetics Corporation | Alvac canarypox virus recombinants comprising heterlogous inserts |
| WO1998016247A1 (en) | 1996-10-11 | 1998-04-23 | The Regents Of The University Of California | Immunostimulatory polynucleotide/immunomodulatory molecule conjugates |
| US6358500B1 (en) | 1998-05-20 | 2002-03-19 | L'oreal | Stable W/O/W emulsion and its use as cosmetic and/or dermatological composition |
| US6719979B2 (en) | 1998-06-19 | 2004-04-13 | Id-Lelystad, Instituut Voor Dierhouderij En Diergezondheid B.V. | Newcastle disease virus infectious clones, vaccines and diagnostic assays |
| US6919084B2 (en) | 1999-11-26 | 2005-07-19 | Merial | Duck pneumovirus and corresponding vaccines |
| US7371395B2 (en) | 2003-07-24 | 2008-05-13 | Merial Limited | Vaccine formulations |
Non-Patent Citations (69)
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10251922B2 (en) | 2013-03-14 | 2019-04-09 | Icahn School Of Medicine At Mount Sinai | Newcastle disease viruses and uses thereof |
| US11389495B2 (en) | 2014-02-27 | 2022-07-19 | Merck Sharp & Dohme Llc | Combination method for treatment of cancer |
| CN104195116A (zh) * | 2014-08-13 | 2014-12-10 | 吉林大学 | 一种表达鹅细小病毒vp3基因的重组新城疫病毒及其构建方法 |
| CN104195116B (zh) * | 2014-08-13 | 2018-03-06 | 吉林大学 | 一种表达鹅细小病毒vp3基因的重组新城疫病毒及其构建方法 |
| WO2018209194A3 (en) * | 2017-05-12 | 2018-12-20 | Icahn School Of Medicine At Mount Sinai | Newcastle disease viruses and uses thereof |
| US12042534B2 (en) | 2017-05-12 | 2024-07-23 | Icahn School Of Medicine At Mount Sinai | Newcastle disease viruses and uses thereof |
| US12391957B2 (en) | 2018-08-17 | 2025-08-19 | Icahn School Of Medicine At Mount Sinai | Recombinant Newcastle disease viruses and uses thereof for the prevention of RSV disease or human metapneumovirus disease |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8486418B2 (en) | Recombinant avian paramyxovirus vaccine and method for making and using thereof | |
| CN104159604B (zh) | 表达禽类病原体的抗原的重组hvt载体及其用途 | |
| EP2414386B1 (en) | Newcastle disease virus vectored avian vaccines | |
| EP3391903B1 (en) | Recombinant gallid herpesvirus 3 vaccines encoding heterologous avian pathogen antigens | |
| JP6913747B2 (ja) | イヌアデノウイルスベクター | |
| US9114108B2 (en) | Recombinant HVT vectors expressing antigens of avian pathogens and uses thereof | |
| US20240252624A1 (en) | Recombinant hvt vectors expressing influenza hemagglutinin and immunogenic compositions, and production and uses thereof | |
| CN114828882A (zh) | 多价hvt载体疫苗 | |
| CN104203274B (zh) | 轮状病毒亚单位疫苗及其制备和使用的方法 | |
| US20140341950A1 (en) | Recombinant avian paramyxovirus vaccine and method for making and using thereof | |
| WO2025199518A2 (en) | Enzymes for depletion of glutamine | |
| WO2012153160A1 (es) | Vacuna recombinante contra prrs en vector viral | |
| HK40021345A (en) | Recombinant gallid herpesvirus 3 (mdv serotype 2) vectors expressing antigens of avian pathogens and uses thereof | |
| HK1247832B (en) | Recombinant hvt vectors expressing antigens of avian pathogens and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080045564.7 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10747133 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2771540 Country of ref document: CA Ref document number: MX/A/2012/002114 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012000447 Country of ref document: CL Ref document number: 1201000667 Country of ref document: TH Ref document number: 2012525730 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: A201203242 Country of ref document: UA Ref document number: 2520/CHENP/2012 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14260587 Country of ref document: CO Ref document number: 12046741 Country of ref document: CO |
|
| ENP | Entry into the national phase |
Ref document number: 20127007373 Country of ref document: KR Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2010747133 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012110576 Country of ref document: RU Ref document number: 2010747133 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112012003837 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112012003837 Country of ref document: BR Kind code of ref document: A2 Effective date: 20120222 |