WO2010128464A1 - Modèle de tissu pulmonaire - Google Patents

Modèle de tissu pulmonaire Download PDF

Info

Publication number
WO2010128464A1
WO2010128464A1 PCT/IB2010/051978 IB2010051978W WO2010128464A1 WO 2010128464 A1 WO2010128464 A1 WO 2010128464A1 IB 2010051978 W IB2010051978 W IB 2010051978W WO 2010128464 A1 WO2010128464 A1 WO 2010128464A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
pulmonary
model
tissue
tissue culture
Prior art date
Application number
PCT/IB2010/051978
Other languages
English (en)
Inventor
Judit Erzsébet PONGRÁCZ
Original Assignee
University Of Pécs
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Pécs filed Critical University Of Pécs
Priority to SG2011080223A priority Critical patent/SG175425A1/en
Priority to CA2760768A priority patent/CA2760768C/fr
Priority to CN201080020612.7A priority patent/CN102369277B/zh
Priority to AU2010244121A priority patent/AU2010244121B2/en
Priority to JP2012509145A priority patent/JP2013504303A/ja
Publication of WO2010128464A1 publication Critical patent/WO2010128464A1/fr
Priority to US13/289,097 priority patent/US9151744B2/en

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0688—Cells from the lungs or the respiratory tract
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/02—Atmosphere, e.g. low oxygen conditions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
    • C12N2502/1323—Adult fibroblasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/28—Vascular endothelial cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics
    • C12N2503/04—Screening or testing on artificial tissues

Definitions

  • the present invention provides for an engineered three dimensional pulmonary model tissue culture which is free of any artificial scaffold. Three dimensional models of healthy lung tissue as well as disease tissues are available.
  • the product according to the invention can be marketed e.g. in the form of tissue cultures, plates or arrays comprising such cultures or kits.
  • the invention is applicable in medical and scientific research, for testing compounds for their effect on lung tissue, for screening, testing and/or evaluating drugs, and in certain cases in diagnostics of lung diseases. BACKGROUND ART
  • Tissue engineering is a rapidly developing field of biomedical research that aims to repair, replace or regenerate damaged tissues. Due to the latest events of disastrous phase II clinical drug trials (e.g. TGN1412), further goals of tissue engineering include generation of human tissue models for safety and efficacy testing of pharmaceutical compounds. Tissue engineering in general and our model in particular exploits biological morphogenesis, which is an example of self-assembly.
  • tissue scaffold based and tissue scaffold free systems Two main directions are being developed in tissue engineering research: tissue scaffold based and tissue scaffold free systems. While scaffold based systems use mostly biodegradable scaffold material to provide an artificial 3D structure to facilitate cellular interactions, a scaffold free system allows direct cell to cell interactions, and allows cells to grow on their secreted scaffold material in the model.
  • the system relates to breast and not lung and there is no suggestion to make a lung culture by that method.
  • US 2003/0109920 (,,Engineered animal tissue”) microvascular endothelial cells were obtained from adult lung and placed between two layers of human dermal fibroblasts present in a three dimensional collagen gel. Thus, a sandwich structure was formed.
  • vascular endothelial cells were obtained from human lung, the artificial tissue prepared by this method was similar to human skin, therefore, it can not be actually considered as a pulmonary tissue model.
  • US 2008/0112890 (,,Fetal pulmonary cells and uses thereof) a 3D tissue-like preparation is taught which is based on fetal mouse epithelial, endothelial and mesenchymal cells. The authors used mouse embryonic lung cells to the preparation in order to obtain lung prosthesis and perform screening on the 3D tissue-like preparation.
  • a hydrogel, MATRIGELTM was used to establish appropriate cell-cell interactions. It appears from the description that a fibroblast overgrowth was experienced upon coculturing epithelial cells and fibroblasts.
  • WO2008/100555 (,,Engineered lung tissue construction for high throughput toxicity screening and drug discovery”) relates to a lung tissue model preparation comprising fetal pulmonary cells and a tissue scaffold made of a biocompatible material and preferably a fibroblast growth factor. Fetal pulmonary cells comprise epithelial, endothelial and mesenchymal cells. A number of applicable biocompatible materials are listed.
  • WO2004/046322 (“Replication of biological tissue”) preparation of an artificial 3-D tissue is proposed under microgravity environment. The tissue is based on human breast cancer cells and is useful as a breast cancer model.
  • tissue scaffold based three dimensional models and no simple, tissue scaffold free lung tissue model, comprising at least epithelial cells and fibroblasts, is disclosed in the prior art.
  • the present Inventors have surprisingly found that by simple biochemical methods a tissue scaffold free lung tissue model system can be rapidly created which is in several aspects more favorable than two dimensional systems or systems based on a matrix.
  • the present invention provides a model tissue which is ready for use in various tests.
  • the model is suitable to study cell-cell interactions in various lung tissues to mimic normal function and disease development.
  • the invention provides for an engineered three dimensional pulmonary model tissue culture, said model tissue culture a) being free of any artificial tissue scaffold, b) being composed of cultured cells or having a cultured cellular material wherein the cells are in direct cell-cell interaction with cells of one or more other cell types of the tissue material, c) comprising at least pulmonary epithelial and mesenchymal cells, preferably pulmonary mesenchymal cells, preferably fibroblasts.
  • the ratio of the pulmonary epithelial cells and the mesenchymal cells in the model tissue is at least 1:6, preferably at least 1:3, and at most 6: 1, preferably at most 3: 1, d) having a morphology of one ore more cellular aggregate(s) wherein the surface of the aggregates is enriched in the pulmonary epithelial cells, or wherein the pulmonary epithelial cells and the mesenchymal cells, preferably fibroblasts are at least partially segregated in said aggregates, and e) wherein the epithelial cells express epithelial differentiation markers.
  • said model tissue culture is free of an artificial matrix material for providing a three dimensional environment to the cells.
  • model tissue culture is free of any artificial tissue scaffold material, either biodegradable or non-biodegradable tissue scaffold material, e.g. a porous three dimensional matrix; a three dimensional gel matrix.
  • said model tissue culture is free of or does not comprise a microporous membrane support.
  • said model tissue culture also comprises an extracellular matrix, the extracellular matrix proteins of which are secreted by at least one of the cell types comprising the tissue, preferably by fibroblasts.
  • the pulmonary epithelial cells comprise at least one of the following cell types: - type I pneumocytes, [alveolar type I cells (ATI)]
  • ATII alveolar type II cells
  • said type II pneumocytes express one or more of the following markers: TTFl transcription factor, surfactant protein A (SFPA), surfactant protein C (SFPC) and aquaporin 3 (AQP 3).
  • said type I pneumocytes express one or more of the following markers: TTFl transcription factor, aquaporin 3 (AQP 3), aquaporin 4 (AQP 4) and aquaporin 5 (AQP 5).
  • At least one of pulmonary epithelial cells and pulmonary mesenchymal cells are present in the model.
  • the cells are amphibian, reptilian, avian or, more preferably mammalian cells.
  • Preferred avian cells are poultry pulmonary cells.
  • Preferred mammalian cells are cells of herbivorous animals, preferably livestock animals like cells of e.g. sheep, goat, bovine cells, or rodent cells, e.g. rabbit or murine cells. Further preferred mammalian cells are those of omnivorous animals like pig cells. Highly preferred cells are human cells.
  • the pulmonary epithelial cells and/or the mesenchymal cells are obtained from - established cell lines, preferably from commercial sources,
  • the cells are primary cells. In a preferred embodiment the cells are not de-differentiated cells or only partially de -differentiated cells. In a further preferred embodiment the cells are de-differentiated cells or the cells are de-differentiated before culturing them to 3D model tissue culture.
  • the pulmonary epithelial cells comprise small airways epithelial cells, preferably small airways epithelial cells with ATII characteristics.
  • model tissue culture of the invention also comprises endothelial cells.
  • endothelial cells are HMVEC or HUVEC cells.
  • the model tissue culture of the invention may further comprise cells of further type selected from macrophages, mast cells, smooth muscle cells.
  • the average diameter or the typical diameter of the aggregate is at least 10 ⁇ m, 40 ⁇ m, 60 ⁇ m. 80 ⁇ m, 100 ⁇ m or 120 ⁇ m and the average diameter or typical diameter of the aggregate is at most 1000 ⁇ m, 800 ⁇ m, 600 ⁇ m, 500 ⁇ m, 400 ⁇ m or 300 ⁇ m.
  • the average diameter or typical diameter of the aggregate is 100-300 ⁇ m, in a preferred embodiment it is about 200 ⁇ m.
  • Average size of the aggregates can be assessed and calculated or estimated by any experimentally and mathematically correct means. While the aggregates are essentially spherical in shape, it is evident that diameters for each aggregate multiple diameters can be determined due to a deviation from the exact sphere and depending on the position of the aggregate during measurement and on the measurement method. For example, smallest and largest diameter can be measured directly in the microscope measuring the size of several aggregates and averaged. Expediently, a microscope is used for this purpose.
  • the majority of the aggregates preferably at least the 60%, 70%, 80% or 90% of the aggregates has a diameter of at least 10 ⁇ m, 40 ⁇ m, 60 ⁇ m. 80 ⁇ m, 100 ⁇ m or 120 ⁇ m and a diameter of at most 1000 ⁇ m, 800 ⁇ m, 600 ⁇ m, 500 ⁇ m, 400 ⁇ m or 300 ⁇ m, highly advantageously the diameter of the above ratio of the aggregates is 100-300 ⁇ m, in a preferred embodiment it is about 200 ⁇ m.
  • the culture samples in each aggregate or each container of a kit comprise cells in an amount of at least 10 3 , preferably at least 10 4 , more preferably at least 2*10 4 , 3*10 4 , 4*10 4 , 5*10 4 cells, and at most 10 6 , more preferably at most 5*10 5 , 4*10 5 , 3*10 5 , 2*10 5 or at most 10 5 cells.
  • the pulmonary epithelial cells and the fibroblasts are segregated based on a difference in their surface tension.
  • the majority of the pulmonary epithelial cells are located on the surface of the aggregate.
  • the majority of the pulmonary epithelial cells form a pulmonary epithelial cell lining on the surface of the aggregate, preferably said pulmonary epithelial cell lining covering, at least partly, the surface of the aggregate.
  • the aggregates also comprise endothelial cells.
  • the ratio of the endothelial cells, in comparison with the epithelial and fibroblast cells is higher in the center or central region of the aggregates that in the surface of the aggregates, or the ratio of the endothelial cells is increasing from the surface of the aggregates towards the center of the aggregates.
  • the aggregates have a layered structure wherein the core or central region of the aggregates comprises the maximum ratio of endothelial cells, the intermediate layer or region of the aggregates comprises the maximum ratio of fibroblasts and the outer layer or surface layer of the aggregates comprises the maximum layer of epithelial cells.
  • the epithelial differentiation markers expressed by the tissue cells of the engineered three dimensional pulmonary model tissue are at least one or more markers selected from the following group: - ATII type differentiation markers, preferably TTFl transcription factor, cytokeratin 7, (KRT7), surfactant protein A (SFPA), surfactant protein C (SFPC) and aquaporin 3 (AQP 3). and/or markers - ATI type differentiation markers, preferably aquaporin 4 (AQP 4) and aquaporin 5 (AQP 5).
  • the markers expressed also depend on the cell type used in the tissue culture. The level of any of the markers can be detected at mRNA or a protein level. Thus, the level of the marker may be mRNA level and/or protein level.
  • the model tissue culture of the present invention at least one of the level of AQP3 and SFTPA is increased, i.e. they are up-reguated in comparison with a control 2D culture.
  • the model tissue culture of the present invention at least one inflammatory marker selected from ILIb, IL6 and CXCL8 is down-regulated, i.e. their level is decreased in 3D culture conditions in comparison with a control 2D culture.
  • the model tissue culture of the present invention the level of at least one of de -differentiation markers S100A4 and N-cadherin is decreased in comparison with purified primary cells in 2D culture conditions or in a control 2D tissue culture.
  • At least one of pulmonary epithelial cells and pulmonary mesenchymal cells are present in the model and, in analogy with embryonic lung development,
  • - pulmonary epithelial cells secrete one or more fibroblast growth factors selected from FGF4, FGF8, FGF9.
  • - pulmonary epithelial cells express on the cell surface FGFR2b receptors.
  • fibroblasts secrete FGF7 and FGFlO and expresses FGFRIc and FGFR2c receptors.
  • the ATII type differentiation markers and/or ATI type differentiation markers are expressed at a level higher, more preferably at a level of at least 10%, at least 20%, or at least 30% higher than that measured in a two dimensional tissue culture used as a reference.
  • mRNA level(s) and/or protein level(s) of said epithelial marker(s) in the model tissue is higher than one or more or each of the following reference cultures
  • - a culture of only pulmonary epithelial cells
  • - a culture of only primary fibroblast cells, preferably human fibroblast cells.
  • the level of at least two of said markers is elevated.
  • small airways epithelial cells are applied.
  • small airways epithelial cells showing at least some ATII type characteristics are applied.
  • the model tissue shows increased mRNA level(s) and/or protein level(s) of at least one or more markers selected from the following group of ATII type differentiation markers, e.g. those listed above.
  • the engineered three dimensional pulmonary model tissue of the invention preferably shows a reduced expression of one or more pro-inflammatory cytokine and or one or more EMT markers.
  • mRNA level(s) and/or protein level(s) of said on or more pro-inflammatory cytokine in the model tissue is lower than one or more or each of the following reference cultures - a two dimensional culture of the same composition of cells,
  • the pro-inflammatory cytokine(s) are selected from the following group: CXCL-8 pro-inflammatory cytokine, IL6, ILIa, ILIb, TNFalpha.
  • the pro-inflammatory chemokine is CXCL-8 chemoattractant.
  • the model tissue culture comprises pulmonary epithelial cells and pulmonary mesenchymal cells and does not comprise endothelial cells, wherein
  • the level of one or more of the following markers is increased relative to a control comprising non-cultured cells: E-cad, IL-Ib and/or IL6, - the level of E-cad is increased relative to a control 2 dimensional culture,
  • the level of one or more of the following markers is decreased relative to a control 2 dimensional culture: IL-Ib, CXCL8, IL6.
  • the model tissue culture comprises pulmonary epithelial cells, pulmonary mesenchymal cells and endothelial cells, wherein the level of one or more of the following markers is decreased relative to a control comprising non-cultured cells: E- cad, N-cad.
  • the level of E-cad is increased relative to a control 2 dimensional culture
  • the level of one or more of the following markers is decreased relative to a control 2 dimensional culture: N-cad, S100A4.
  • the three dimensional pulmonary model tissue culture further comprises cells selected from the following group: - endothelial cells, e.g. to mimic vasculature, macrophages, mast cells.
  • the model can be extended using cell types: smooth muscle cells, - nerve cells.
  • the invention also relates to an engineered three dimensional pulmonary model tissue culture as defined above wherein said epithelial and/or fibroblast cells comprise affected cells having a pathologic feature of a diseased lung tissue so that said model tissue culture is a pulmonary disease model tissue culture.
  • the disease involves a condition selected from inflammation, tumor, fibrosis, injury of a tissue and the model tissue culture is to be considered as an inflammatory model, a tumor model, a fibrosis model or a regeneration model, respectively.
  • Affected cells of the disease model can be but are not limited to cells obtained from patients (patient cells), cell lines which have a disease feature, e.g. tumor cell lines; cells exposed to an environmental effect, e.g. pro -inflammatory material, causing a disease feature; cells exposed to the effect of a mutagen and selected for a disease feature; or genetically modified cells transformed to express a protein or in which a gene is silenced so as to have a diseased feature.
  • the cells are obtained from healthy subjects and disease state is induced therein.
  • signaling of tumor induction or potential drug targets can be determined.
  • tumor model tissue is prepared from immortal cells, e.g. from malignously transformed or tumorous cells or cell lines. While in this embodiment no "healthy" control is present, this system is useful in drug testing as a sample contacted with a placebo drug provides a control for drug treatment samples.
  • tumorous cells are obtained from a patient, and efficiency of a projected therapy can be tested.
  • the model tissue culture can be used for establishing personalized therapy.
  • the invention also provides for a method for the preparation of the engineered three dimensional pulmonary model tissue culture as defined herein, said method comprising the steps of
  • model tissue for a) expression of one or more epithelial differentiation markers characteristic to lung tissue, and an increased expression level as compared to a suitable reference culture e.g. as disclosed herein, is considered as indicative of the formation of a three dimensional pulmonary model tissue culture; and/or b) expression of one or more pro-inflammatory cytokine, and a decreased expression level as compared to any suitable reference culture e.g. as disclosed herein, is considered as indicative of the formation of a three dimensional pulmonary model tissue culture.
  • the container is a non-tissue culture treated container.
  • multiple aliquots are placed into multiple containers,
  • the containers are wells of a plate, e.g. a 96 well plate or a 384 well plate,
  • pelleting is carried out at 20Og to 60Og, 1 to 20 minutes, preferably 2 to 10 minutes.
  • the cells are supplied with a reporter molecule, e.g. are stained with a biocompatible dye to report on cellular features as disclosed herein.
  • the containers can be V-bottom, flat-bottom or U-bottom containers, depending on the purpose they are used for.
  • one or more type of cells are added to a container within 18 hours, preferably within 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours, more preferably within 4 hours, 3 hours,
  • each type of cell used is added within the period defined above.
  • the pelleted suspension is incubated in the presence of CO 2 for a period not longer than
  • the pelleted suspension is incubated in the presence of CO 2 for a period not less than 2 hours,
  • further type of cells are added to the mixed suspension of the cells.
  • further type of cells are at least endothelial cells.
  • further type of cells are selected from endothelial cells, smooth muscle cells, nerve cells, granulocytes, dendritic cells, mast cells, T/B lymphocytes, macrophages. Granulocytes, dendritic cells, mast cells, T/B lymphocytes and macrophages can be added to the cultures either in inactive or in immunologically active state.
  • the method according to the invention comprises de -differentiation of one or more type of cells prior to preparation of a mixed suspension.
  • the method according to the invention comprises a propagation of one or more type of cells prior to preparation of a mixed suspension. This step is particularly required if parallel testing of a large number of samples are required, for example in HTS (High Throughput Screening) solutions.
  • HTS High Throughput Screening
  • the invention also relates to a method for screening of a drug for its effect on lung tissue, said method comprising the steps of
  • the model tissue culture is the model of a healthy lung tissue and an adverse effect of a drug is tested, wherein alteration or modification which is detrimental to the cells of test sample is considered as a toxic or adverse effect of said drug.
  • the model tissue culture is a pulmonary disease model tissue culture comprising affected cells having a pathologic feature and the beneficial effect of a drug is tested, wherein - an assay to measure or assess said pathologic feature is provided for said model tissue culture to obtain a measure of disease,
  • a reference sample of a healthy lung tissue (healthy reference sample) and/or a reference sample of a diseased lung tissue (diseased reference sample) is provided,
  • the pathologic feature is measured or assessed in the healthy reference sample and/or in the diseased reference sample and in said at least one test sample before and after contacting it with the drug, wherein any alteration or modification in the test sample which shifts the measure of disease in the test sample towards the measure of disease in the healthy reference sample and or away from the measure of disease in the diseased reference sample is considered as a beneficial effect of said drug. In other words, it is more similar to the state of the healthy reference sample than to the diseased reference sample.
  • primary cells obtained from a patient are applied.
  • primary cells from a given patient are not or only partly de -differentiated and used within 5, 4, 3.
  • Kits 2 or 1 day(s) or within 12, 10, 8, 6, 4, 3, 2, 1 hour(s) after obtaining them from said patient to prepare the mixed suspension of the cells.
  • features of the disease state of the given patient can be studied and therapeutic drugs and/or regimens can be tested. Kits
  • the invention also relates to an engineered three dimensional pulmonary model tissue kit comprising a test plate having an array of containers wherein at least two containers contain
  • control samples can be pure cultures of certain cell types, e.g. cultures of epithelium and fibroblasts only, and/or two dimensional (2D) cultures.
  • controls can be cultures of healthy cells.
  • the engineered three dimensional pulmonary model tissue kit has one or more of the following characteristics:
  • the plate is a 96 well plate.
  • the plate is a V-bottom plate or a flat bottom plate or a plate comprising both V-bottom and flat-bottom wells.
  • U- bottom plates also can be applied.
  • the culture samples in each container comprise cells in an amount of at least 10 3 , preferably at least 10 4 , more preferably at least 2*10 4 , 3*10 4 , 4*10 4 , 5*10 4 cells, and at most 10 6 , preferably at most 5*10 5 , 4*10 5 , 3*10 5 , 2*10 5 , or at most 10 5 cells,
  • the containers are sealed, either separately or together and contain a CO 2 enriched environment or atmosphere suitable for a lung tissue culture.
  • the CO 2 enriched environment or atmosphere comprises at least 2%, 3%, 4% CO 2 environment, at most 10%, 9%, 8% or 7% CO 2 environment, highly preferably about 5% CO 2 .
  • the samples comprise test sample(s) and corresponding control sample(s).
  • test samples are present on a V-bottom plate or in V-bottom wells on a plate and the control samples are present on a flat-bottom plate or in flat-bottom wells on a plate.
  • an "artificial tissue scaffold” in the context of the present description is a solid support material having a structure specially designed for and useful for cell attachment and/or for assisting the structural three dimensional arrangement of cells, in tissue or cell culture.
  • said artificial tissue scaffold is manufactured prior to culturing of the tissue or cells and contacted with the tissue or the cells before or during culturing said tissue or cells.
  • an artificial tissue scaffold is typically a cell growth support structure or material which contributes to the structure, e.g. the three dimensional structure of the tissue or cell culture by affecting at least a part of cellular interactions (e.g. the cell-cell interactions) or the cellular environment itself.
  • the tissue or cell culture will disintegrate or become disorganized.
  • the artificial tissue scaffold is made of a biodegradable material and it is degraded gradually, allowing cell-cell interactions to be formed, this is not to be considered as a removal of the tissue scaffold and in this process the tissue or cell culture may not become disintegrated or disorganized.
  • the artificial tissue scaffold is a three dimensional matrix, preferably a three dimensional gel matrix or a porous three dimensional matrix, said matrix preferably having microspaces or pores in which the cells are located.
  • the artificial tissue scaffold itself is a support on the surface of which the cells are attached, preferably a porous membrane support.
  • the scaffold has a structure specially designed for and useful for cell attachment, e.g. a porous or curved or engrailed or grooved surface to which the cells are attached so that this facilitates the formation of a 3 dimensional structure.
  • an artificial tissue scaffold is a support on the surface of which the cells are attached, preferably a porous membrane support.
  • a structure specially designed for and useful for cell attachment e.g. a porous or curved or engrailed or grooved surface to which the cells are attached so that this facilitates the formation of a 3 dimensional structure.
  • - has a defined three dimensional structure - is a porous, preferably a highly porous material or matrix,
  • - is made of a biocompatible material, and/or
  • the "artificial tissue scaffold” is a polysaccharide -based matrix, e.g. it is a cellulose -based matrix, e.g. a methyl-cellulose matrix.
  • the "artificial tissue scaffold” has a bead structure, e.g. it is a cytodex bead.
  • a "three dimensional tissue culture free of any artificial tissue scaffold” is understood herein as a tissue culture having a three dimensional structure wherein the three dimensional structure of said tissue culture is formed or contributed by inherent cell-cell interactions and is not assisted by an artificial tissue scaffold.
  • a three dimensional tissue culture free of any artificial tissue scaffold does not disintegrate or become disorganized in lack of an artificial tissue scaffold but maintains its three dimensional structure. Even if said three dimensional tissue culture free of any artificial tissue scaffold is cultured and formed on a solid support material, the formation of the three dimensional structure is not assisted by and is not due to attachment of cells to this solid support and it can be separated without destruction of the three dimensional structure.
  • “Segregation of cells” relates to the spatial separation of at least two types of cells of a tissue or cell culture, whereby after this spatial separation i.e. segregation, a region of the culture, e.g. a (partial) volume or surface, can be defined or found in which the ratio of the two types of cells is different from both the ratio of the same types of cells in the same region of the culture before segregation and the ratio of the same types of cells in an other region of the culture.
  • a difference in the surface tension of at least two types of cells significantly contributes to their segregation in vitro.
  • a volume or partial volume or surface or partial surface of a culture in a certain cell type is to be understood as a phenomenon when the ratio of a certain cell type is higher in that region than in a reference region, e.g. an other region of said culture.
  • a reference region e.g. an other region of said culture.
  • enrichment of a region of a culture is the result of segregation of cells.
  • Inflammation is an adaptive response that is triggered by noxious stimuli and conditions, such as infection and tissue injury.
  • pro-inflammatory cytokines A number of cytokines, known collectively as "pro-inflammatory cytokines " because they accelerate inflammation, also regulate inflammatory reactions either directly or by their ability to induce the synthesis of cellular adhesion molecules or other cytokines in certain cell types.
  • the major pro -inflammatory cytokines that are responsible for early responses are ILl -alpha, ILl -beta, IL6, and TNF-alpha.
  • Other pro-inflammatory mediators include IFN- gamma, CNTF, TGF-beta, IL12, IL17, IL18, IL8 (CXCL8) and a variety of other chemokines that chemoattract inflammatory cells, and various neuromodulatory factors.
  • the net effect of an inflammatory response is determined by the balance between pro-inflammatory cytokines and anti -inflammatory cytokines (for example IL4, ILlO, and IL13, IL16, IFN-alpha, TGF-beta, ILlra, G-CSF, soluble receptors for TNF or IL6).
  • cytokines for example IL4, ILlO, and IL13, IL16, IFN-alpha, TGF-beta, ILlra, G-CSF, soluble receptors for TNF or IL6
  • ILl-beta Activation of ILl-beta by various caspases proceeds in a large multiprotein complex that has been termed inflammasome.
  • LIF, GM-CSF, ILl 1 and OSM are further cytokines affecting inflammation processes and which are possibly useful in the preparation of disease models of the invention.
  • anti-inflammatory cytokines like ILlO, regulate inflammation processes so that they are inhibited or alleviated.
  • the "average diameter" of three dimensional tissues is taken as the aritmetic mean of several measurements of three dimensional tissue diameters generated by the above described method.
  • the "typical diameter” is the diameter which marks the division of a given sediment sample into two equal parts by weight, one part containing all aggregates larger than that diameter and the other part containing all aggregates smaller.
  • An “array " of containers is to be understood as an arrangement of multiple containers of the same size, shape and material. The arrangement can be for example a sequence of container, or a two dimensional matrix of the containers.
  • Viruses are obligate intra-cellular pathogens that infect cells, often with great specificity to a particular cell type.
  • genes that are needed for the replication phase of the viral life cycle are deleted and genes of interest added to the viral genome.
  • the recombinant viral vectors can transduce the cell type it would normally infect.
  • the non-essential genes are provided in trans, either integrated into the genome of the packaging cell line or on a plasmid.
  • retroviruses including lentiviruses
  • adenoviruses adeno-associated viruses & herpes simplex virus type 1.
  • Cancer is a class of diseases in which a group of cells display uncontrolled growth, invasion (intrusion on and destruction of adjacent tissues), and sometimes metastasis (spread to other locations in the body via lymph or blood). These three malignant properties of cancers differentiate them from benign tumors, which are self-limited, do not invade or metastasize. 95% of lung tumors are bronchogenic carcinoma; also bronchial carcinoids, mesenchymal, miscellaneous neoplasms.
  • Fibrosis is the formation or development of excess fibrous connective tissue in an organ or tissue as a reparative or reactive process, as opposed to a formation of fibrous tissue as a normal constituent of an organ or tissue.
  • Pulmonary fibrosis is a severe chronic disease characterized by a loss of elasticity and lung epithelial cells, replaced by interstitial myofibroblasts and deposition of extracellular matrix proteins in the lung interstitium leading to pulmonary structural remodelling.
  • FIG. 1 Structure of 3D two-cell type microcultures. SAEC and NHLF cells were stained with the vital dyes of CFSE or DiI, respectively. Cell populations either pure or mixed at various ratios were pelleted and aggregates were formed after 24 hour incubation, then transferred into 24 well cell culture plates for imaging. Top row: phase contrast microscopic images; Middle row: fluorescent microscopic images; Bottom row: confocal images. SAEC: green channel; NHLF: red channel.
  • FIG. 4a mRNA levels of TTF-I in 3D human lung micro-tissues.
  • TTFl transcription factor is a characteristic marker of alveolar epithelial cells. While 3D fibroblast cultures show no TTFl expression, TTFl is present in 3D SAEC monocultures and increased in 2D SAEC/NHLF co-cultures indicating the beneficial effect of fibroblasts. The highest level of TTl expression was reached in 3D SAEC/NHLF tissues.
  • Figure 4b mRNA levels of AQP-3 water transporter in 3D human lung micro-tissues.
  • AQ3 is an ATII epithelial type marker in the lung. While 3D fibroblast cultures show no AQ3 expression, AQ3 is present in 3D SAEC monocultures and increased in 2D SAEC/NHLF co-cultures indicating the beneficial effect of fibroblasts, but the highest level of AQ3 was still observed in 3D SAEC/NHLF tissue cultures.
  • FIG. 5 Gene expression changes in SAEC differentiation markers.
  • Panel A Relative mRNA levels of AQP3 water transporter in 2D and 3D human lung micro-tissues. Relative AQP3 expression levels increased in mixed cell cultures to that of SAEC-only cultures while no difference was detectable between 2D and 3D culture conditions.
  • Panel C RT-PCR analysis of SFTPAl and beta-actin expression in 2D and 3D cultures. SFTPAl expression was only detected in SAEC+NHLF co-cultures. The expression of SFTPAl were consistently higher in 3D cultures than in 2D cultures.
  • Panel D After 72h 2D or 3D co-culturing with NHLF cells, gene expression changes in FACS-sorted SAEC were examined. The levels of differentiation markers AQP3 and TTF-I in re -purified SAEC were significantly up- regulated in 3D co-cultures compared to 2D co-cultures. Data shown are means of two independent experiments. (Purified primary lung cells used in all our experiments originated from random donors).
  • FIG. 6 EMT markers in the 3D lung tissue model.
  • Panel A Relative mRNA levels of S100A4 in 2D and 3D co- cultures. The presence of fibroblasts significantly decreased the level of S100A4 in SAEC-NHLF co-cultures compared to SAEC-only cultures while 2D or 3D culture conditions did not alter S100A4 expression significantly.
  • Panel B Relative mRNA levels of E-cadherin (E-cad) is increased in 3D cultures in the presence of NHLF.
  • Panel C Relative mRNA levels of N-cadherin (N-cad) in 2D and 3D human lung micro-tissues.
  • Panel D After 72h 2D or 3D co-culturing with NHLF cells, gene expression changes in FACS-sorted SAEC were examined. The levels of EMT markers S100A4 and E-cad in sorted lung epithelial cells were increased in 3D two-cell co-cultures compared to 2D co-cultures, while N-cad was expressed at much lower levels in 3D mixed cultures.
  • Purified primary lung cells used in our experiments originated from random donors. Data shown are means of three (Panels A-C) or two (Panel D) independent experiments. Purified primary lung cells used in all our experiments originated from random donors. Figure 7. Inflammatory cytokine and chemokine secretion in human primary lung cell cultures.
  • Panel A CXCL-8 secretion of 2D and 3D NHLF monocultures was barely detectable in cell culture supernatants. 3D SAEC cultures still produced CXCL8, although to a lesser degree than 2D SAEC cultures. 2D co-cultures didn't significantly alter CXCL-8 expression, indicating, that the presence of fibroblasts cannot influence cytokine expression. CXCL-8 expression levels were significantly reduced in 3D tissue systems in both pure SAEC and SAEC-NHLF co-cultures.
  • Panel A and B Expression levels of IL-Ib and IL-6 mRNA in human primary lung cell cultures, respectively. Compared to 2D cultures, inflammatory mRNA levels of inflammatory cytokines IL-Ib and IL-6 are consistently lower in 3D cultures.
  • Panel D Similarly to mixed cell culture samples, inflammatory cytokines IL-Ib and IL-6 levels also decreased markedly in SAEC purified from 3D cultures, than that of 2D cultures. Data shown are means of three (Panels A-C) or two (Panel D) independent experiments. Purified primary lung cells used in all our experiments originated from random donors. Figure 8. Structure of 3D three-cell type microcultures consisting of SAEC, NHLF, and HMVECs.
  • SAEC, NHLF and HMVECs were stained with the vital dyes CFSE, DiI, or DiD, respectively, then aggregated. After 24 hour incubation, the spontaneously rearranged two- or three-cell type microcultures were carefully transferred into 24 well cell culture plates for imaging.
  • Panel A two-cell type cultures; Panel B: three-cell type cultures. Top row: phase contrast microscopic images; Middle row: fluorescent microscopic images; Bottom row: confocal images.
  • SAEC green channel; NHLF: red channel; HMVEC: blue channel.
  • Figure 9 Gene expression changes in three-cell type cultures.
  • Panel A The expression levels of AQP3 and KRT7 increased, S100A4 and N-cad decreased in 3D cultures compared to 2D cultures.
  • Panel B Comparison of expression changes of molecular markers in 3D SAEC-NHLF two-cell type cultures and SAEC-NHLF-HMVEC three-cell type cultures. AQP3 and E-cad mRNA levels are increased, S100A4 and N-cad are decreased in indicating that differentiation of the tissue was maintained in the three-cell type model. Purified primary lung cells used in all our experiments originated from random donors.
  • Figure 10. Flow chart of the preparation of a test-ready lung tissue kit delivered in a 96 well plate. Figrue 11. Adenoviral gene delivery into SAEC in the two-cell type model.
  • Panel A SAEC appear green in the surface of the 3D tissue model due to GFP expression. Fibroblasts were pre- stained red with a physiological dye prior to the aggregation.
  • Panel B RT-PCR reaction proves effective GFP gene delivery into the model. GFP can be detected in adenovirally transduced model cultures.
  • the present inventors created a simple engineered three dimensional pulmonary model tissue culture, useful as a lung tissue model and ready for use in various test methods.
  • tissue characteristics including main characteristics of tissue types of the lung, interaction of cell types during embryonic lung development and technological advances in tissue engineering were considered.
  • Hitherto developed lung tissue models used specialized scaffold materials and were kept in culture lengthily [Nichols, J.E. and Cortiella J. 2008].
  • the model presented herein allows easy handling, uses a simple experimental setup and a relatively short culturing time. Moreover, no special laboratory equipment is required.
  • the present system is appropriate for use with human cells, including human primary cells and non-transformed human cells.
  • the scaffold e.g. a matrix is biodegradable.
  • these systems are not be considered as scaffold free systems even after the scaffold is degraded because and if the scaffold affected or defined the structure or shape of the tissue culture.
  • in in vitro systems like in the present invention generally it can not be expected that a degradable membrane will be dissolved.
  • dissolution of a biodegradable scaffold takes a long time, much longer that the time for preparation and usage of the tissue culture of the present invention.
  • Cell which are not de -differentiated cells can also be applied in the present invention, however, the number of cells will be small. Therefore, this embodiment is useful mainly in cases when a small number of cells is sufficient to a projected test, e.g. when the test is sensitive enough.
  • a rapid test it is possible to start the preparation of the model tissue culture of the invention from purified, differentiated cells. Such cells can be freshly prepared from a subject.
  • This version of the method is particularly useful e.g. in patient-specific testing of drugs or compounds or if the effect of an active agent is to be tested in a specific disease setting (for example for a potential manufacturer).
  • Primary cells can be obtained from commercial sources, too. For example Lonza Venders, S.p.r.l.
  • the model tissue culture preparation is started from de-differentiated cells.
  • Dedifferentiation markers include S100A4, N-cadherin and inflammatory markers. Thereby a larger number of cells can be applied.
  • Pluripotent or undifferentiated cells can be rendered capable of differentiation after addition of tissue component and/or factors.
  • tissue specific progenitor cells can undergo directed steps of tissue specific differentiation and therefore represent an ideal source for generating organ specific tissue culture material.
  • both cell types are only available in limited numbers in differentiated tissues.
  • tissue specific differentiated cells represent a better source of primary material, simply as there are more of them.
  • the present model system utilizes, at least in part, the phenomenon that differentiated cells in two dimensional culture conditions can de-differentiate and can be forced to re -differentiate using the right culture conditions.
  • Lung development, as well as epithelial injury repair, is tightly coordinated by a fine balance between stimulatory versus inhibitory genes that appear to co-regulate the function of stem and adult progenitor cells in the lung.
  • FGF receptor tyrosine kinase signaling is essential for respiratory organogenesis and is negatively regulated by a family of inducible FGF pathway inhibitors (Zhang, Stappenbeck et al. 2005).
  • FGF signaling is required for formation of new alveoli, protection of alveolar epithelial cells from injury, as well as migration and proliferation of putative alveolar stem/progenitor cells during lung repair.
  • TGF beta receptor serine-threonine kinase signaling via Smads 2, 3 and 4 inhibits lung morphogenesis and can inhibit postnatal alveolar development, while excessive TGF beta signaling via Smad3 causes interstitial fibrosis.
  • a basic lung model can be created by using a mix of purified alveolar epithelium and fibroblasts. Therefore, initially only two cell types were used: primary human fibroblasts (NHLF) and small airways epithelial cells (SAEC with ATII characteristics) that are both commercially available (Lonza). It has been surprisingly found that this two cell type sufficiently provides the necessary factors to form a three dimensional pulmonary tissue model. The skilled person will understand that by addition of further cell types, for example of cell types listed herein, the model can be further developed.
  • the present two-cell type co-culture system consisting of human small airway epithelial cells (SAEC) and normal human lung fibroblasts (NHLF) did not require the presence of externally added ECM for the formation and maintenance of 3D structure (Figure 3).
  • SAEC human small airway epithelial cells
  • NHLF normal human lung fibroblasts
  • FIG 3 Morphologic examinations of 3D micro-tissues revealed that segregation of the two cell types in mixed cultures was a feature of 3D micro-tissues, fibroblasts forming the inner, core part, while epithelial cells were covering the outer layer (Figure 3).
  • the phenomenon of segregation or “sorting” is based on different adhesive energy characteristics of cell types and has not been described for primary human pulmonary tissue before.
  • the spontaneous cell “sorting” is based upon the disparity of the cohesive forces between different cell types: the most cohesive core or central region of the pulmonary micro-tissue is formed by the NHLF population being surrounded by the less cohesive SAEC.
  • the process of segregation in primary, differentiated human pulmonary tissues is particularly interesting, as underlies the notion that even differentiated, human adult cells maintain their ability to actively explore their own microenvironment.
  • the cells in the 3D co- cultures are capable of exchanging position with adjacent cells thus structurally reorganizing the tissue. This process also requires reorganization of the extracellular matrix.
  • Any cell would actively explore its own microenvironment, are able to exchange position with adjacent cells or to reorganize the extracellular matrix in their vicinity.
  • the latter process is known to involve both mechanical traction forces and enzymatic activity by matrix metalloproteases (MMPs).
  • MMPs matrix metalloproteases
  • Small aggregates have several advantages, for example, no special reaction vessels are needed, their size and ratio of different cell types are reproducible and thereby interactions are more easyly controlled. In small aggregates practically no necrotization of the inner parts of the tissue aggregates can be expected. Furthermore, a surprisingly uniform size distribution can be achieved which renders them quite appropriate for parallel testing.
  • the size of the aggregates should be kept small provided that tissue features appear and thereby interactions can be examined. If the aggregates are too small, a correct morphology as disclosed herein may not take form and the aggregate may not have a tissue like characteristic. If the aggregates are too large, their size may largely deviate from the average.
  • necrotization may occur inside the aggregates, due to a longer culturing time and less perfusion of the aggregates.
  • the size depends, however, on the number of cells in an aggregate.
  • the skilled person will understand that the size and cell number of the aggregates can vary within the limits given herein provided that the above -described requirements are met.
  • Fibroblasts are the most versatile of the connective tissue cell family and they are in fact the most ubiquitous cell type. Fibroblasts are important structural elements of tissue integrity. They participate in repair and regenerative processes in almost every human tissue and organ, including the lung. Their primary function is to secrete extra cellular matrix (ECM) proteins that provide a tissue scaffold for normal repair events such as epithelial cell migration. Fibroblasts, or distinct subpopulations thereof, perform tissue-specific functions as immunoregulatory cell, secrete chemokines and cytokines, which are able to trigger immune responses by attracting inflammatory cells and immune cells.
  • ECM extra cellular matrix
  • Fibroblasts from different anatomical locations show an array of common phenotypic attributes. Fibroblasts, however, show distinct phenotypes in different anatomical locations. Characteristic expression of fibroblast growth factors and receptors are also a feature of pulmonary fibroblasts [De Moerlooze, Spencer-Dene et al (2000)].
  • the present inventors have found that it is possible to rely on fibroblast physiology to create an artificial tissue scaffold-free tissue system to mimic some aspects of distal pulmonary tissue and an artificial matrix based model not necessarily the only way to create three dimensional pulmonary cultures. Without being bound by theory, the present inventors assume that the fact that fibroblasts in the lung secrete ECM significantly contributes to this result.
  • Pulmonary epithelial cells Pneuomocytes
  • Pneumocytes pulmonary or alveolar epithelial cells or AECs
  • AECs alveolar epithelial cells
  • Type 1 pneumocytes are complex branched cells with multiple cytoplasmic plates that represent the gas exchange surface in the alveolus of the lung. These cells are metabolically active and harbour cell surface receptors for a variety of substances, including extracellular matrix (ECM) proteins, growth factors, and cytokines. About ninety-five per cent of the alveolar surface is covered with type I pneumocytes.
  • Type 2 pneumocytes are complex branched cells with multiple cytoplasmic plates that represent the gas exchange surface in the alveolus of the lung. These cells are metabolically active and harbour cell surface receptors for a variety of substances, including extracellular matrix (ECM) proteins, growth factors, and cytokines. About ninety-five per cent of the alveolar surface is covered with type I pneumocytes.
  • ECM extracellular matrix
  • Type 2 pneumocytes are cuboidal epithelial cells also being referred to as type 2 alveolar epithelial cells (abbr. AEC, also EPII cells), type 2 granular pneumocytes, type 2 cells, type 2 alveolocytes, septal cells, or great alveolar cells, large alveolar cells, or granular pneumocytes. These cells arise from immature epithelial cell progenitors. Alveolar type 2 pneumocytes are thought to be progenitor cells of the alveolar epithelium.
  • Type II cells are cuboidal cell, which comprise only 4 % of the alveolar surface area, but constitute 60 % of alveolar epithelial cells and 10-15 % of all lung cells (Crapo et al, 1982).
  • Type 3 alveolar epithelial cells differ from flat type 1 cells and cuboidal type 2 cells by the presence of an apical tuft of microvilli and the absence of lamellar type secretory granules. These cells are being referred to also as alveolar brush cells.
  • Endothelial cells are oblong shaped cells that line the lumen of all blood vessels as a single squamous epithelial cell layer. They are derived from angioblasts and hemangioblasts.
  • Macrophages are cells derived from bone marrow-derived monocytes (bone marrow-derived macrophages) that have homed in to tissues.
  • the differentiation of macrophages from uni- and bipotential progenitor cells in the bone marrow is controlled by a variety of cytokines. Further differentiation takes place in tissues and the resulting macrophage populations are being referred to as resident macrophages.
  • Mast cells arise from a multipotent CD34(+) precursor in the bone marrow (Nakahata and Toru 2002; Austen and
  • mast cells also express Fc-epsilon Rl and stop expressing CD34 and Fc-gamma R2.
  • Most mast cells in the lung and intestinal mucosa produce only tryptase (designated MCT) or only chymase.
  • Mast cells play a central role in immediate allergic reactions by releasing potent mediators.
  • Smooth muscle cells are highly specialized multifunctional contractile cells that regulate the lumen of hollow organs transiently (reversible contraction), or chronically (due to fibrosis and muscle hypertrophy). Smooth muscle cells play an important role in vasculogenesis and shape the wall of blood vessels and maintain vascular tone.
  • endothelial cells resulted in stable aggregates comprising differentiated cells.
  • the degree of differentiation is not reduced if endothelial cells are included into the model tissue culture, as found based on the markers expressed. It appears that these aggregates maintain a layered structure, wherein the endothelial cells are located inside.
  • At least pulmonary epithelial cells and mesenchymal cells preferably fibroblasts are used.
  • the cells are cultured separately in order to obtain viable cultures, then mixed in an appropriate ratio and cocultured in the presence of CO 2 under appropriate conditions as will be understood based on the present disclosure and art methods. By setting ratio of the cells and selecting conditions overgrowth of one cell type by another can be avoided.
  • said cells are obtained from human subject as primary cells and either de-differentiated or used immediately.
  • De -differentiation can be carried out e.g. by known methods (passages, removing other type of cells, addition of growth factors). If the cells are capable of confluence, they are considered as dedifferentiated.
  • Pelleting the cocultured cell mixture is an important step to establish cell-cell contacts and to result in an appropriate distance between the cells.
  • the most convenient way to pellet the cells is to apply centrifugation.
  • suitable means for pelleting is well within the skills of a skilled person based on the teaching provided herein.
  • any of the cells listed above can be used to obtain a lung model tissue close to a native lung tissue.
  • Each cell type applied have to be capable of growth under conditions useful to obtain the three dimensional model tissue as disclosed herein and being capable of association with other cell types of the model. These factors should be tested in preliminary experiments. Expediently a relatively small ratio of further cells should be initially applied then the ratio of the further cell type can be increased, typically till a ratio similar to in vivo ratios is achieved.
  • additional cell types that can be included in the model are e.g. endothelial cells and smooth muscle cells.
  • the above system is easily adaptable to study genetic changes during pulmonary diseases that can lead to identification of novel drug targets and development of novel therapies: wherein the disease involves inflammation, the affected cells, preferably the epithelial cells, express inflammatory cytokines (above normal level) and the model is an inflammatory model, wherein the disease is a tumor, the cells are transformed, e.g. malignantly transformed or immortal cells and the model is a tumor model, wherein the disease involves fibrosis and the model is a fibrosis model, wherein the disease involves injury of the tissue and the model is a regeneration model.
  • the disease involves inflammation
  • the affected cells preferably the epithelial cells
  • the disease is a tumor
  • the cells are transformed, e.g. malignantly transformed or immortal cells and the model is a tumor model
  • the disease involves fibrosis and the model is a fibrosis model
  • the disease involves injury of the tissue and the model
  • Disease models can be utilized in drug testing.
  • pulmonary cells are obtained from patients and cultured in accordance with the present invention.
  • this embodiment preferably no or only partial de -differentiation is allowed.
  • 3D model tissue culture is formed and drugs proposed for treating said patient are tested or a projected therapeutic regime can be tested.
  • the advantage of this embodiment among others is that pure and parallel sample cultures with uniform composition and size can be prepared. Said samples are also free of any pathogens and may be purified as needed.
  • disease models are prepared by starting from healthy cells and factors effecting disease features (symptoms) in the cells are added later.
  • tumor models are prepared from healthy cells and factors effecting malignous transformation are added and/or genes causing malignous transformation are expressed therein.
  • Wnt proteins e.g. Wnt5
  • tumor models can be prepared by addition of tumorogenic factors, like EGF (epithelial growth factor), IGF (insulin-like growth factor), insulin, Wnt factors e.g. Wnt5 or a cocktail thereof to the cell mixture or culture of the invention.
  • tumorous cells are added to the medium in which the model culture according to the invention is present but are separated by a semi-permeable membrane. Thereby the factors produced by the tumorous cell induce tumorous (malignus) transition of the cultured cells of the invention.
  • Lung tumor models can be prepared from lung tumor cell lines. Such cell lines are readily available at the American Type Culture Collection (ATCC; Rockville, MD), upon searching for tumor cell lines.
  • ATCC American Type Culture Collection
  • experiments are to be performed to find appropriate conditions for culturing the cells and optimize the ratio of the cell types used in a cell mixture.
  • monocytes and/or macrophages can be added to the model culture of the invention preferably during the preparation process. In this model pretreatment with LPS or WNT5A is advisable.
  • Cytokine production of activated macrophages as well as production of other factors like Wnt5 affects the tissue culture and enable an inflammation model.
  • neutrophyl cells can be provided separated from the pulmonary aggregates by a membrane in an appropriate chamber. In this case neutrophyl migration and MMP production can be measured as well.
  • disease model pulmonary cell lines a cultured in accordance with the invention.
  • drugs can be tested for efficiency against said disease.
  • native three dimensional pulmonary cell aggregates can be treated with various materials eliciting inflammatory reactions.
  • Such materials are for example: chemical substances causing acute inflammation, such as vasoactive amines, eicosanoids, etc. proinflammatory polypeptides, such as growth factors, hydrolytic enzymes etc. reactive oxygen species, proinflammatory cytokines, e.g. IFN- ⁇ and other cytokines, bacterial cell wall extracts.
  • Inflammatory conditions are tested by detecting cytokine expression e.g. by biochemical assays, immunological assays, such as ELISA, by a PCR-based method, e.g. real time PCR, or by expression analysis e.g. by applying a gene chip.
  • Both epithelial and mesenchymal cells can be genetically modified using recombinant viral delivery vectors
  • rAdenoviral and rLentiviral vectors do not harm the ability of cells to aggregate.
  • Characteristic genes for inflammation, tumor, fibrosis and regeneration can be constitutively or inducibly overexpressed or silenced and tissue morphology, cellular responses, gene and protein expression changes can be studied in a three dimensional microenvironment.
  • one or more genes known to promote tumor formation can be introduced into a pulmonary cell line, e.g. an alveolar type I or type II cell line, preferably type II cell line or into a fibroblast cell line.
  • a gene can be e.g. an oncogene, e.g. a ras gene or a gene or a set of genes typical of expression pattern of a tumor, e.g. a COX-2 gene It may happen that the expression of a ras gene alone is insufficient to transform the cells, preferably immortal cells, but proliferation is likely to be increased [Wang, XQ, Li, H et al. (2009)], which may provide a disease feature for the model. Modification of secreted factor composition in primary cell aggregates using genetically modified and sub-lethally irradiated cell lines
  • Cellular composition of the aggregates contains sub-lethally irradiated cells (5-10% of total cell number of the aggregate), either fibroblast (WI-38) or alveolar epithelial (A549) cell lines or both, that are genetically modified and produce secreted factors (Wnt-s, Bone Morphogenic Protein (BMP)-s, inflammatory and pro-inflammatory cytokines, growth factors, etc) that modify the cellular microenvironment within the aggregates.
  • Sub-lethal irradiation can reduce propagation of cells and prevent overgrowth of one cell type by the other.
  • the invention also provides for a kit comprising multiple samples of a 3D model tissue culture.
  • the containers are wells of a plate, e.g. a 96 well plate or a 384 well plate.
  • the 3D model tissue can be a model of a healthy tissue or a disease model (disease model kit).
  • the plate expediently comprises an array of containers or wells wherein a multiplicity of containers contain samples of one or more types of engineered three dimensional pulmonary model tissue cultures in an appropriate medium.
  • the container can be e.g. flat bottom, an U-bottom or, preferably, a V-bottom container, on a plate allowing parallel testing of multiple samples.
  • the containers are non-tissue culture treated containers so as to avoid sticking of the cells to the container wall.
  • each container comprises a single aggregate.
  • the culture samples in each container comprise cells in an amount as defined in the brief description of the invention.
  • the containers are sealed, either separately or together and contain a CO 2 enriched environment or atmosphere suitable for a lung tissue culture as defined in the brief description of the invention.
  • a CO 2 enriched environment or atmosphere suitable for a lung tissue culture as defined in the brief description of the invention.
  • disease models require the same environment.
  • the cells are stained with a biocompatible dye suitable to report on one or more of the following cellular features: cellular state for example cell phase, cellular viability, apoptosis or moribund state of the cell; cell type; cell location; malignous transformation; inflammation.
  • cellular state for example cell phase, cellular viability, apoptosis or moribund state of the cell
  • cell type for example cell phase, cellular viability, apoptosis or moribund state of the cell
  • cell type for example cell phase, cellular viability, apoptosis or moribund state of the cell
  • cell type for example cell phase, cellular viability, apoptosis or moribund state of the cell
  • cell type for example cell phase, cellular viability, apoptosis or moribund state of the cell
  • cell type for example cell phase, cellular viability, apoptosis or moribund state of the cell
  • cell type for example cell type
  • cell location for example cell location
  • the kit contains cultures of epithelium and fibroblasts only. On a plate, preferably at least 3-3 wells of controls (epithelium and fibroblasts, respectively) are present.
  • a further control which is a 2D lung tissue is used to identify or assess features specific to the 3D tissue.
  • a 2D control plate (preferably a flat-bottom, adhesive tissue culture plate) can be included to accompany the 3D tissue.
  • the plate may also contains wells of 2D lung tissue as a control, preferably in a flat bottom wells.
  • a plate which contains both V-bottom wells for 3D tissue and flat or
  • HMVEC cells For two and three-cell cultures containing HMVEC cells, the appropriate growth factor supplements for HMVEC cells were added to the 50-50% mixture of SAGM and DMEM.
  • the compositions of cell culture media were prepared in accordance with instructions of the manufacturer.
  • cells were mixed at the indicated ratios and dispensed onto flat-bottom 6 well plates or 96-well V-bottom plates (Sarstedt), respectively. V-bottom plates were immediately centrifuged after cell seeding at 600xg for 10 minutes at room temperature.
  • SAECs and NHLFs were stained with the following fluorescent physiological dyes: DiI [Honig, M. G. and R. I. Hume (1989)] and CFSE [Wang, X. Q., X. M.
  • A549 line was initiated in 1972 by D. J. Giard et al. (1973) through explant culture of lung carcinomatous tissue from a 58-year-old male.
  • A549 cells are adenocarcinomic human alveolar basal epithelial cells.
  • A549 cells fall under the squamous subdivision of epithelial cells. Cells seeded at a concentration of 2x10 4 cells/cm 2 in the above culture medium will be 100% confluent in 5 days. A549 cells are available at the American Type Culture Collection (ATCC; Rockville, MD) as CCL-185 and can be grown in Ham's F-12 medium (GIBCO BRL, Grand Island, NY) with 10% fetal calf serum (FCS; GIBCO BRL) or according to recommendations of the supplier.
  • ATCC American Type Culture Collection
  • FCS fetal calf serum
  • the WI-38 cell line was developed in 1962 from lung tissue taken from a therapeutically aborted fetus of about 3 months gestational age. Cells released by trypsin digestion of the lung tissue were used for the primary culture. The cell morphology is fibroblast-like. The karyotype is 46,XX; normal diploid female. A maximum lifespan of 50 population doublings for this culture was obtained at the Repository. A thymidine labelling index of 86% was obtained after recovery. G6PD is isoenzyme type B. This culture of WI-38 is an expansion from passage 9 frozen cells obtained from the submitter.
  • Human cells are preferably maintained at 37°C in a humid atmosphere containing CO 2 as needed. Fluorescent and confocal microscopy Prior to 2D and 3D culturing, SAECs, NHLFs and HMVECs were stained with fluorescent physiological dyes CFSE, DiI and DiD, respectively (all from Molecular Probes). Cells were washed twice in PBS and incubated with CFSE, DiI or DiD at the concentration of 0,5 ⁇ g/ml at 37 0 C for 10 minutes. The excess dyes were removed by washing the cells with DMEM+10%FCS. 2D and 3D cultures were prepared using the fluorescent-labeled cells, as indicated before.
  • CFSE fluorescent physiological dyes
  • RNA was prepared from 2D and 3D cell cultures using NucleoSpin RNAII kit (Machery-Nagel) with on- column DNase digestion.
  • Messenger RNA was prepared from sorted SAEC samples with ⁇ MACS mRNA isolation system (Miltenyi Biotech).
  • cDNA was prepared from RNA samples with a MMuLV reverse transcriptase kit (Thermo Scientific). Real-time quantitative PCR examinations were carried out using ABsolute QPCR SYBR Green Low ROX master mix (ABGene) and an Applied Biosystems 7500 thermal cycler system. Primers are listed in Table 1.
  • Recombinant adenoviral vectors The full gene-of-interest or GFP only sequence was amplified by PCR reaction using Forward (5'): 5'- -3', Reverse (3'): 5'- -3' primer sequences and cloned into the Shuttle vector, then by homologous recombination into the adenoviral vector.
  • Adenovirus was produced by transfecting the linearised plasmid DNA into the 293 packaging cell line (American Type Culture Collection, Rockville, MD) using Lipofectamine 2000 (Invitrogen). The resulting plaques were amplified, the adenovirus purified and concentrated using the adenoviral purification kit (BD Biosciences). Adenoviral Infection of epithelial cells
  • Adenovirus containing GFP or gene-of-interest-GFP were added to SAEC in 2D or 3D.
  • IxIO 6 cells were resuspended in 250 ⁇ l of cell culture medium and 50 ⁇ l of virus for 90 minutes at 37 0 C.
  • IL-Ib Homo sapiens interleukin 1 , beta NM_000576 TCAGCCAATCTTCATTGCTCAA TGGCGAGCTCAGGTACTTCTG 62
  • KRT7 Homo sapiens keratin 7 NM_005556 CCACCCACAATCACAAGAAGATT TCACTTTCCAGACTGTCTCACTGTCT 78
  • S100A4 Homo sapiens SlOO calcium binding protein A4 NM_002961 TGGAGAAGGCCCTG CCCTCTTTGCCCGAGTACTTG 58
  • SFTPAl Homo sapiens surfactant protein Al NM_005411 CCCCTTGTCTGCAGGATTT ATCCCTGGAGAGTGTGGAGA 128
  • NK2 homeobox 1 (NKX2.1), NM_003317 CATGTCGATGAGTCCAAAGCA GCCCACTTTCTTGTAGCTTTCC 85
  • CXCL-8 (IL-8) content of 2D and 3D cell culture supernatants was measured with Quantikine CXCL-8/IL-8 ELISA kit (R&D Systems).
  • the sandwich ELISA assay was performed according to the manufacturer's instructions. Briefly, identically diluted cell culture supernatant samples and CXCL-8 standards were dispensed onto the wells pre-coated with anti-CXCL-8 monoclonal antibody. After 2 hours incubation at room temperature, the plate was washed 4 times with the provided washing buffer. Then HRPO-conjugated polyclonal anti-CXCL-8 antibody was added for one hour. After a final washing step, TMB substrate solution was added to the wells. The optical density was determined with an iEMS Reader MF (Thermo Labsystems) at 450 and 570nm and data were analyzed using Ascent software. Data quantitation
  • CXCL-8 content of the cell culture supernatants were determinded by comparing the OD to a standard curve calculated from 7 different concentrations in the range of 31.2 - 2000 pg/ml CXCL-8. Samples were dispensed in duplicates and the means were used for further data analysis.
  • SAEC epithelial cells
  • NHLF fibroblasts
  • Cells prior to mixed culturing were stained using 1:1000 dilutions in PBS (phosphate buffer saline pH 7.2) of physiological fluorescent dyes of DiI (lmg/ml stock in DMSO) and CFSE (lmg/ml stock in DMSO).
  • PBS phosphate buffer saline pH 7.2
  • physiological fluorescent dyes of DiI lmg/ml stock in DMSO
  • CFSE lmg/ml stock in DMSO
  • the ratio of SAEC and NHLF cells was systematically changed and cultures were prepared using the following SAEC:NHLF ratios, respectively: 0/100%; 25/75%, 50/50%, 75/25, 100/0%, otherwise as described above.
  • Figure 3 the pelleted micro-tissue cultures containing different ratios of SAEC and NHLF are shown.
  • EXAMPLE 4 Characterization of the two cell type tissue scaffold-free 3D pulmonary tissue model Differentiation markers Molecular characterization of the model was based on epithelial differentiation markers using real-time PCR analysis. mRNA was purified from the cell aggregates and cDNA was generated. Using TTFl ( Figure 4a), AQ3 ( Figure 4b) and AQ5 specific primers, results were analysed relative to beta-actin as internal control. On Figure 4 a. mRNA levels of TTF-I in 3D human lung micro-tissues are indicated. TTFl transcription factor is a characteristic marker of alveolar epithelial cells.
  • TTFl is present in 3D SAEC monocultures and increased in 2D SAEC/NHLF co-cultures indicating the beneficial effect of fibroblasts.
  • the highest level of TTl expression was reached in 3D SAEC/NHLF tissues.
  • Figure 4b shows mRNA levels of AQP-3 water transporter in 3D human lung micro-tissues.
  • AQ3 is an ATII epithelial type marker in the lung. While 3D fibroblast cultures show no AQ3 expression, AQ3 is present in 3D SAEC monocultures and increased in 2D SAEC/NHLF co-cultures indicating the beneficial effect of fibroblasts, but the highest level of AQ3 was still observed in 3D SAEC/NHLF tissue cultures. Thus, the above markers indicated an inducible increase in ATII type differentiation that was further supported by no increase in ATI type marker expressions.
  • the purified differentiated cell types we used in the experiments were obtained from commercial sources. Although these cell types originated from differentiated tissues, once they were purified and kept in 2D culture conditions the cells have shown almost immediate signs of dedifferentiation indicated by increased level of S100A4 ( Figure 6 and Table 2).
  • S100A4 and N-cadherin levels decreased significantly, while the E-cadherin levels increased.
  • the "cadherin-switch" [Zeisberg M and E.G. Neilson (2009)]was more prominent in 3D than in 2D culture conditions ( Figure 6) indicating that apart from the presence of NHLF, the 3D structure was also necessary to decrease dedifferentiation of SAEC.
  • EMT epithelial-mesenchymal transition
  • pro-inflammatory cytokines are produced by the alveolar epithelium to attract inflammatory cells, including neutrophils.
  • CXCL-8 pro-inflammatory cytokine expression CXCL-8 protein levels were tested from cellular supernatants of 2D mono and co-cultures and 3D tissue co-cultures, set up as seen in Figure 3.
  • ELISA test kit R&D Laboratories
  • CXCL-8 expression levels were significantly reduced in 3D tissue system where 75/25 % was the epithelial-fibroblast ratio, where epithelial cells essentially fully covered the fibroblast sphere, implicating that CXCL-8 expression can be triggered by discontinuation in the alveolar epithelial cell layer. This reduction in CXCL-8 expression was somewhat less pronounced at a ration of 50/50% and 25/75%. Inflammatory cytokines IL-lbeta and IL-6 mRNA levels were also investigated using quantitative real time RT- PCR analysis.
  • EXAMPLE 5 Three-cell type model with epithelial, endothelial and fibroblast components
  • HMVEC human lung-derived microvascular endothelial cells
  • N.A. data are not available, expression level was not determined.
  • N.D. No specific PCR product was detected with real-time QPCR.
  • N.D.* No specific P product was detected with conventional PCR.
  • N.C Specific expression levels were not consequent in parallel wells or samples with real-time QPCR. Low*: Relatively l expression levels were detected by conventional PCR. High*: Relatively high expression levels were detected with conventional PCR.
  • TTFl transcription factor is a characteristic general marker of alveolar epithelial cells during embryonic development and after birth in ATII cells.
  • Cytokeratins are components of the intermediate filaments of the cytoskeleton and their expression patterns are important in cell lineage identification.
  • lung epithelial markers TTF-I and cytokeratin 7 KRT7 showed elevated expression levels in 3D co-cultures.
  • Type II pneumocytes facilitate transepithelial movement of water (via members of the aquaporin protein (AQP) family).
  • ATII marker Aquaporin 3 show elevated levels in the presence of fibroblasts ( Figure 5)
  • Secretion of surfactant proteins is a unique feature of ATII lung epithelial cells.
  • differentiation markers AQP3, KRT7, TTFl and SFPA were up-regulated in the presence of fibroblasts.
  • Levels of AQP3 and SFTPA but not KRT7 or TTFl differentiation markers were further increased in 3D culture conditions.
  • S100A4 is a well-known molecular marker for epithelial-mesenchymal transition and the level of its expression is often high in metastatic carcinomas [Sherbet, G.V et al. 2009] as well as in lung fibrosis [Guarino, M. et al., 2009].
  • Up-regulation of S100A4 and N-cadherin and parallel down-regulation of E-cadherin [Zeisberg, M. and E.G.
  • the above de -differentiation markers decreased in the presence of fibroblasts and further decreased in 3D conditions.
  • SAEC epithelial cells
  • tumor cells are used.
  • Cellular composition of the aggregates however contains sub-lethally irradiated cells (5-10% of total cell number of the aggregate) -either fibroblast (WI-38) or alveolar epithelial (A549) cell lines that are genetically modified and produce secreted factors (Wnt-s, Bone Morphogenic Protein (BMP)-s, inflammatory and pro-inflammatory cytokines, growth factors, etc) that modify the cellular microenvironment within the aggregates.
  • WI-38 fibroblast
  • A549 alveolar epithelial cell lines that are genetically modified and produce secreted factors (Wnt-s, Bone Morphogenic Protein (BMP)-s, inflammatory and pro-inflammatory cytokines, growth factors, etc) that modify the cellular microenvironment within the aggregates.
  • BMP Bone Morphogenic Protein
  • Cytokine production is determined using cytokine specific ELISA techniques from tissue culture media, gene expression changes both in epithelial and fibroblasts can be quantified by real-time PCR reactions.
  • test-ready 3C lung tissue kit of the following features is prepared:
  • Test-ready lung tissue is delivered in 96 well plates.
  • Each tissue consists of a mixed culture of human primary alveolar epithelium and fibroblasts (25, 50 and 75 % epithelium respectively).
  • the plate contains 3-3 wells of controls (epithelium and fibroblasts only). 5.
  • the plates are sealed with a transparent, preferably adhesive, plastic foil, e.g. with Saranrap.
  • the quality of tissue is guaranteed for three days, including delivery.
  • the plate itself is a 96, V-bottom well, non-adhesive tissue culture plate.
  • the model tissue is prepared as described in EXAMPLE 3. Each tissue is submerged in 200 1 of tissue culture medium, optimal for lung culture in 5% CO 2 environment, sealed and delivered at room temperature or on ice. Quality control: one tissue is taken from each well and viability is tested. The differentiation markers are tested by real-time PCR.
  • a 2D control plate tissue grown in 96-well, flat-bottom, adhesive tissue culture plate
  • tissue grown in 96-well, flat-bottom, adhesive tissue culture plate can be included to accompany the 3D tissue.
  • the model allows easy handling and genetic manipulation of complex tissue systems in both theoretical and applied research and in pharmaceutical testing.
  • the model is also easily expanded by additional cell types to include endothelial cell for vascularization and even smooth muscle cells, where further reciprocal tissue and cellular interactions can be studied.
  • the scaffold-free 3D culturing allows trouble-free genetic manipulation of simple or more complex tissue systems in either theoretical or applied research and in pharmaceutical testing.
  • This pulmonary tissue model is especially suitable for studying spontaneous self-assembly of cells and cellular interactions.
  • our 3D human pulmonary micro-tissue model system is easily adaptable to study genetic changes during pulmonary diseases that can lead to identification of novel drug targets and development of novel therapies.
  • These disease models may include inflammatory models, tumor model, lung fibrosis model, or a regeneration model.
  • Three dimensional models of healthy lung tissue as well as disease tissues are available.
  • the product according to the invention can be marketed e.g. in the form of tissue cultures, plates or arrays comprising such cultures or kits.
  • TTF-I The transcription factor, TTF-I, is expressed at the onset of thyroid and lung morphogenesis and in restricted regions of the foetal brain. Development 113: 1093-1104.
  • TTF-1/TAP26 complex differentially modulates surfactant protein-B
  • SP-B and -C (SP-C) promoters in lung cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Pulmonology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

L'invention concerne une culture tissulaire d'un modèle pulmonaire tridimensionnel dépourvu de structure tissulaire mise au point par génie tissulaire, qui est exempte de toute structure artificielle; des modèles tridimensionnels de tissu pulmonaire sain ainsi que des tissus pathologiques. Le produit de l'invention peut être commercialisé, p. ex. sous la forme de cultures tissulaires, de plaques ou de réseaux comprenant ces cultures ou de trousses. L'invention peut être appliquée dans la recherche médicale et scientifique pour tester l'effet de composés sur un tissu pulmonaire, à des fins de criblage, d'essai et/ou d'évaluation de médicaments, et dans certains cas pour diagnostiquer des maladies pulmonaires.
PCT/IB2010/051978 2009-05-05 2010-05-05 Modèle de tissu pulmonaire WO2010128464A1 (fr)

Priority Applications (6)

Application Number Priority Date Filing Date Title
SG2011080223A SG175425A1 (en) 2009-05-05 2010-05-05 Lung tissue model
CA2760768A CA2760768C (fr) 2009-05-05 2010-05-05 Modele de tissu pulmonaire
CN201080020612.7A CN102369277B (zh) 2009-05-05 2010-05-05 肺组织模型
AU2010244121A AU2010244121B2 (en) 2009-05-05 2010-05-05 Lung tissue model
JP2012509145A JP2013504303A (ja) 2009-05-05 2010-05-05 肺組織モデル
US13/289,097 US9151744B2 (en) 2009-05-05 2011-11-04 Lung tissue model

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
HU0900819A HUP0900819A2 (en) 2009-05-05 2009-05-05 Lung tissue culture
HUP0900819 2009-05-05

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/289,097 Continuation-In-Part US9151744B2 (en) 2009-05-05 2011-11-04 Lung tissue model

Publications (1)

Publication Number Publication Date
WO2010128464A1 true WO2010128464A1 (fr) 2010-11-11

Family

ID=89989476

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2010/051978 WO2010128464A1 (fr) 2009-05-05 2010-05-05 Modèle de tissu pulmonaire

Country Status (7)

Country Link
JP (1) JP2013504303A (fr)
CN (1) CN102369277B (fr)
AU (1) AU2010244121B2 (fr)
CA (1) CA2760768C (fr)
HU (1) HUP0900819A2 (fr)
SG (1) SG175425A1 (fr)
WO (1) WO2010128464A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2450707A1 (fr) * 2010-11-04 2012-05-09 University of Pécs Modèle de tissu de poumon
JP2012115155A (ja) * 2010-11-29 2012-06-21 Kao Corp Ｃｇｒｐ応答調節剤の評価又は選択方法
US20130149234A1 (en) * 2011-12-08 2013-06-13 Chung Yuan Christian University Continuous Hydrogen Production Device And Method Thereof
JP2015523142A (ja) * 2012-06-19 2015-08-13 オルガノボ，インク． 操作した三次元の結合組織構成物およびそれを製造する方法
JP2016505264A (ja) * 2013-01-08 2016-02-25 イエール ユニバーシティ ヒトおよび大型哺乳動物の肺のバイオリアクター
US10221394B2 (en) 2013-10-21 2019-03-05 Hemoshear, Llc In vitro model for a tumor microenvironment
GB2595357B (en) * 2020-04-07 2024-02-07 Univ Of Hertfordshire Higher Education Corporation Method and model

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104316661B (zh) * 2014-10-08 2016-03-23 清华大学 用于生物毒性检测的肺组织模型及生物毒性检测方法
JPWO2016104627A1 (ja) * 2014-12-24 2017-10-05 宇部興産株式会社 肺組織由来の細胞培養上清液
US20190128870A1 (en) * 2016-04-04 2019-05-02 Humeltis Diagnostic Methods For Patient Specific Therapeutic Decision Making In Cancer Care
CN106754669B (zh) * 2016-11-23 2020-04-17 河海大学常州校区 基于反应-扩散模型的多细胞结构的制备方法及制备系统
CN107267439A (zh) * 2017-05-16 2017-10-20 苏州大学 三维肺微组织模型的构建方法及应用
CN108660076A (zh) * 2018-05-21 2018-10-16 中国科学院苏州生物医学工程技术研究所 一种仿真肺芯片模型
CN109161531A (zh) * 2018-10-16 2019-01-08 首都医科大学附属北京胸科医院 一种基于类器官技术个体化肺癌原代细胞培养的方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010055804A1 (en) * 2000-01-13 2001-12-27 Shekhar Malathy P.V. Three-dimensional in vitro model of human preneoplastic breast disease
US20080112890A1 (en) * 2006-10-11 2008-05-15 Lelkes Peter I Fetal pulmonary cells and uses thereof
WO2008100555A2 (fr) * 2007-02-14 2008-08-21 Drexel University Construction de tissu pulmonaire de synthèse pour le dépistage de toxicité et la découverte de médicament à efficacité élevée

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1428871B1 (fr) * 2001-07-26 2008-08-27 Transparent Inc. Construction cellulaire cultivee contenant des spheroides de cellules animales cultivees et utilisation correspondante
WO2007083504A1 (fr) * 2003-08-01 2007-07-26 Norimasa Nakamura Tissu synthétique en 3d auto-organisé sans échafaudage
US7709256B2 (en) * 2004-04-28 2010-05-04 Vaxdesign Corp. Disease model incorporation into an artificial immune system (AIS)

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010055804A1 (en) * 2000-01-13 2001-12-27 Shekhar Malathy P.V. Three-dimensional in vitro model of human preneoplastic breast disease
US20080112890A1 (en) * 2006-10-11 2008-05-15 Lelkes Peter I Fetal pulmonary cells and uses thereof
WO2008100555A2 (fr) * 2007-02-14 2008-08-21 Drexel University Construction de tissu pulmonaire de synthèse pour le dépistage de toxicité et la découverte de médicament à efficacité élevée

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ANDERSON G ET AL: "MHC class II-positive epithelium and mesenchyme cells are both required for T-cell development in the thymus.", NATURE, vol. 362, no. 6415, 4 March 1993 (1993-03-04), pages 70 - 73, XP002597445, ISSN: 0028-0836 *
INNOVATIVE MEDICINE RESEARCH INITIATIVE STRATEGIC RESEARCH AGENDA, 2008
MOLNAR T F & PONGRACZ J E: "Tissue engineering and biotechnology in general thoracic surgery.", EUROPEAN JOURNAL OF CARDIO-THORACIC SURGERY, vol. 37, no. 6, June 2010 (2010-06-01), pages 1402 - 1410, XP002597444, ISSN: 1873-734X *
NICHOLS J E & CORTELLA J: "Engineering of a complex organ: progress toward development of a tissue-engineered lung.", PROCEEDINGS OF THE AMERICAN THORACIC SOCIETY, vol. 5, no. 6, 15 August 2008 (2008-08-15), pages 723 - 730, XP002597443, ISSN: 1546-3222 *
WARDLAW ET AL., MOLECULAR PHARMACOLOGY, vol. 62, 2002, pages 326 - 333

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9151744B2 (en) 2009-05-05 2015-10-06 Pécsi Tudományegyetem Lung tissue model
EP2450707A1 (fr) * 2010-11-04 2012-05-09 University of Pécs Modèle de tissu de poumon
WO2012059777A1 (fr) * 2010-11-04 2012-05-10 University Of Pécs Modèle de tissu pulmonaire
JP2012115155A (ja) * 2010-11-29 2012-06-21 Kao Corp Ｃｇｒｐ応答調節剤の評価又は選択方法
US20130149234A1 (en) * 2011-12-08 2013-06-13 Chung Yuan Christian University Continuous Hydrogen Production Device And Method Thereof
JP2015523142A (ja) * 2012-06-19 2015-08-13 オルガノボ，インク． 操作した三次元の結合組織構成物およびそれを製造する方法
JP2016505264A (ja) * 2013-01-08 2016-02-25 イエール ユニバーシティ ヒトおよび大型哺乳動物の肺のバイオリアクター
US9986734B2 (en) 2013-01-08 2018-06-05 Yale University Human and large-mammal lung bioreactor
JP2019106992A (ja) * 2013-01-08 2019-07-04 イエール ユニバーシティ ヒトおよび大型哺乳動物の肺のバイオリアクター
US10221394B2 (en) 2013-10-21 2019-03-05 Hemoshear, Llc In vitro model for a tumor microenvironment
US11008549B2 (en) 2013-10-21 2021-05-18 Hemoshear, Llc In vitro model for a tumor microenvironment
GB2595357B (en) * 2020-04-07 2024-02-07 Univ Of Hertfordshire Higher Education Corporation Method and model

Also Published As

Publication number Publication date
AU2010244121B2 (en) 2015-07-16
CA2760768C (fr) 2019-10-29
HUP0900819A2 (en) 2011-01-28
HU0900819D0 (en) 2010-07-28
JP2013504303A (ja) 2013-02-07
CN102369277A (zh) 2012-03-07
CN102369277B (zh) 2014-12-17
CA2760768A1 (fr) 2010-11-11
AU2010244121A1 (en) 2011-12-15
SG175425A1 (en) 2011-12-29

Similar Documents

Publication Publication Date Title
AU2010244121B2 (en) Lung tissue model
US9151744B2 (en) Lung tissue model
AU2018390960B2 (en) Immune cell organoid co-cultures
Deugnier et al. Isolation of mouse mammary epithelial progenitor cells with basal characteristics from the Comma-Dβ cell line
Zhou et al. In vitro evaluation of endothelial progenitor cells from adipose tissue as potential angiogenic cell sources for bladder angiogenesis
EP3699275A1 (fr) Organoïde d'organe et procédé de production associé
TWI772790B (zh) 前驅調節滋胚內層細胞及其用途
TW202200786A (zh) 自肺上皮細胞或肺癌細胞製造類器官之方法
JP2023026662A (ja) 血管形成の調節
CN111876371A (zh) 心脏细胞培养材料
Clause et al. A Three-Dimensional Gel Bioreactor for Assessment of Cardiomyocyte Induction in Skeletal Muscle–Derived Stem Cells
Zhang et al. Differentiation induction of cardiac c-kit positive cells from rat heart into sinus node-like cells by 5-azacytidine
US9687512B2 (en) Isolated cardiac stem cells and methods of their use
KR101760239B1 (ko) 세포배양 삽입체를 이용한 인간 배아줄기세포 유래 중간엽 세포의 분리방법
US20230357724A1 (en) Human umbilical cord mesenchymal stem cell sheets and methods for their production
WO2024168161A1 (fr) Test d'activité et méthode de fabrication
Meireles Refining thymic epithelial cell differentiation: from progenitor cell isolation to the identification of discrete mature lineages
CN114317398A (zh) Gli1和EpCAM基因共同标记的肝祖细胞群及其应用
HU229196B1 (en) Lung tissue model
Costa Adipose stromal vascular fraction cell sheets as vascular strategies for tissue engineering and regenerative medicine applications

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080020612.7

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10723334

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2012509145

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2760768

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2010244121

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2010244121

Country of ref document: AU

Date of ref document: 20100505

Kind code of ref document: A

122 Ep: pct application non-entry in european phase

Ref document number: 10723334

Country of ref document: EP

Kind code of ref document: A1