WO2010126614A2 - Methods and compositions for evaluating genetic markers - Google Patents
Methods and compositions for evaluating genetic markers Download PDFInfo
- Publication number
- WO2010126614A2 WO2010126614A2 PCT/US2010/001293 US2010001293W WO2010126614A2 WO 2010126614 A2 WO2010126614 A2 WO 2010126614A2 US 2010001293 W US2010001293 W US 2010001293W WO 2010126614 A2 WO2010126614 A2 WO 2010126614A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- target nucleic
- sequence
- target
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
Definitions
- the invention relates to methods and compositions for determining genotypes in patient samples.
- Information about the genotype of a subject is becoming more important and relevant for a range of healthcare decisions as the genetic basis for many diseases, disorders, and physiological characteristics is further elucidated. Medical advice is increasingly personalized, with individual decisions and recommendations being based on specific genetic information. Information about the type and number of alleles at one or more genetic loci impacts disease risk, prognosis, therapeutic options, and genetic counseling amongst other healthcare considerations.
- aspects of the invention relate to preparative and analytical methods and compositions for evaluating genotypes, and in particular, for determining the allelic identity (or identities in a diploid organism) of one or more genetic loci in a subject.
- aspects of the invention are based, in part, on the identification of different sources of ambiguity and error in genetic analyses, and, in part, on the identification of one or more approaches to avoid, reduce, recognize, and/or resolve these errors and ambiguities at different stages in a genetic analysis.
- certain types of genetic information can be under-represented or over-represented in a genetic analysis due to a combination of stochastic variation and systematic bias in any of the preparative stages (e.g., capture, amplification, etc.), determining stages (e.g., allele-specific detection, sequencing, etc.), data interpretation stages (e.g., determining whether the assay information is sufficient to identify a subject as homozygous or heterozygous), and/or other stages.
- the preparative stages e.g., capture, amplification, etc.
- determining stages e.g., allele-specific detection, sequencing, etc.
- data interpretation stages e.g., determining whether the assay information is sufficient to identify a subject as homozygous or heterozygous
- error or ambiguity may be apparent in a genetic analysis, but not readily resolved without running additional samples or more expensive assays (e.g., array-based assays may report no-calls due to noisy/low signal).
- error or ambiguity may not be accounted for in a genetic analysis and incorrect base calls may be made even when the evidence for them is limited and/or not statistically significant (e.g., next-generation sequencing technologies may report base calls even if the evidence for them is not statistically significant).
- error or ambiguity may be problematic for a multi-step genetic analysis because it is apparent but not readily resolved in one or more steps of the analysis and not apparent or accounted for in other steps of the analysis.
- sources of error and ambiguity in one or more steps can be addressed by capturing and/or interrogating each target locus of interest with one or more sets of overlapping probes that are designed to overcome any systematic bias or stochastic effects that may impact the complexity and/or fidelity of the genetic information that is generated.
- sources of error and ambiguity in one or more steps can be addressed by capturing and/or interrogating each target locus of interest with at least one set of probes, wherein different probes are labeled with different identifiers that can be used to track the assay reactions and determine whether certain types of genetic information are under-represented or over-represented in the information that is generated.
- errors and ambiguities associated with the analysis of regions containing large numbers of sequence repeats are addressed by systematically analyzing frequencies of certain nucleic acids at particular stages in an assay (e.g., at a capture, sequencing, or detection stage). It should be appreciated that such techniques may be particularly useful in the context of a standardized protocol that is designed to allow many different loci to be evaluated in parallel without requiring different assay procedures for each locus.
- the use of a single detection modality (e.g., sequencing) to assay multiple types of genetic lesions is advantageous in the clinical setting.
- methods are provided that facilitate the use of multiple sample preparation steps in parallel, coupled with multiple analytical processes following sequence detection.
- an improved workflow is provided that reduces error and uncertainty when simultaneously assaying different types of genetic lesions across multiple loci in multiple patients.
- aspects of the invention provide methods for overcoming preparative and/or analytical bias by combining two or more techniques, each having a different bias (e.g., a known bias towards under-representation or over-representation of one or more types of sequences), and using the resulting data to determine a genetic call for a subject with greater confidence.
- a different bias e.g., a known bias towards under-representation or over-representation of one or more types of sequences
- multiplex diagnostic methods comprise capturing a plurality of genetic loci in parallel (e.g., one or more genetic loci from Table 1).
- the genetic loci possess one or more polymorphisms (e.g., one or more polymorphisms from Table 2) the genotypes of which correspond to disease causing alleles.
- the disclosure provides methods for assessing multiple heritable disorders in parallel.
- methods are provided for diagnosing multiple heritable disorders in parallel at a pre-implantation, prenatal, perinatal, or postnatal stage.
- the disclosure provides methods for analyzing multiple genetic loci (e.g., a plurality of target nucleic acids selected from Table 1 ) from a patient sample, such as a blood, pre-implantation embryo, chorionic villus or amniotic fluid sample, or other sample (e.g., other biological fluid or tissue sample such as a biopsy sample) as aspects of the invention are not limited in this respect.
- a patient sample such as a blood, pre-implantation embryo, chorionic villus or amniotic fluid sample, or other sample (e.g., other biological fluid or tissue sample such as a biopsy sample) as aspects of the invention are not limited in this respect.
- a patient sample e.g., a tumor tissue or cell sample
- a sample comprises cells from a non- host organism (e.g., bacterial or viral infections in a human subject) or a sample for environmental monitoring (e.g., bacterial, viral, fungal composition of a soil, water, or air sample).
- a sample for environmental monitoring e.g., bacterial, viral, fungal composition of a soil, water, or air sample.
- the genotyping may comprise determining that one or more alleles of the target nucleic acid are heterozygous or homozygous. In further embodiments, the genotyping may comprise determining the sequence of a polymorphism and comparing that sequence to a control sequence that is indicative of a disease risk. In some embodiments, the polymorphism is selected from a locus in Table 1 or Table 2. However, it should be appreciated that any locus associated with a disease or condition of interest may be used.
- a diagnosis, prognosis, or disease risk assessment is provided to a subject based on a genotype determined for that subject at one or more genetic loci (e.g., based on the analysis of a biological sample obtained from that subject).
- an assessment is provided to a couple, based on their respective genotypes at one or more genetic loci, of the risk of their having one or more children having a genotype associated with a disease or condition (e.g., a homozygous or heterozygous genotype associated with a disease or condition).
- a subject or a couple may seek genetic or reproductive counseling in connection with a genotype determined according to embodiments of the invention.
- genetic information from a tumor or circulating tumor cells is used to determine prognosis and guide selection of appropriate drugs/treatments. It should be appreciated that any of the methods or compositions described herein may be used in combination with any of the medical evaluations associated with one or more genetic loci as described herein.
- aspects of the invention provide effective methods for overcoming challenges associated with systematic errors (bias) and/or stochastic effects in multiplex genomic capture and/or analysis (including sequencing analysis).
- aspects of the invention are useful to avoid, reduce and/or account for variability in one or more sampling and/or analytical steps. For example, in some embodiments, variability in target nucleic acid representation and unequal sampling of heterozygous alleles in pools of captured target nucleic acids can be overcome.
- the disclosure provides methods that reduce variability in the detection of target nucleic acids in multiplex capture methods.
- methods improve allelic representation in a capture pool and, thus, improve variant detection outcomes.
- the disclosure provides preparative methods for capturing target nucleic acids (e.g., genetic loci) that involve the use of different sets of multiple probes (e.g., molecular inversion probes MIPs) that capture overlapping regions of a target nucleic acid to achieve a more uniform representation of the target nucleic acids in a capture pool compared with methods of the prior art.
- methods reduce bias, or the risk of bias, associated with large scale parallel capture of genetic loci, e.g., for diagnostic purposes.
- methods are provided for increasing reproducibility (e.g., by reducing the effect of polymorphisms on target nucleic acid capture) in the detection of a plurality of genetic loci in parallel.
- methods are provided for reducing the effect of probe synthesis and/or probe amplification variability on the analysis of a plurality of genetic loci in parallel.
- methods of analyzing a plurality of genetic loci comprise contacting each of a plurality of target nucleic acids with a probe set, wherein each probe set comprises a plurality of different probes, each probe having a central region flanked by a 5' region and a 3' region that are complementary to nucleic acids flanking the same strand of one of a plurality of subregions of the target nucleic acid, wherein the subregions of the target nucleic acid are different, and wherein each subregion overlaps with at least one other subregion, isolating a plurality of nucleic acids each having a nucleic acid sequence of a different subregion for each of the plurality of target nucleic acids, and analyzing the isolated nucleic acids.
- methods comprise contacting each of a plurality of target nucleic acids with a probe set, wherein each probe set comprises a plurality of different probes, each probe having a central region flanked by a 5' region and a 3' region that are complementary to nucleic acids flanking the same strand of one of a plurality of subregions of the target nucleic acid, wherein the subregions of the target nucleic acid are different, and wherein a portion of the 5' region and a portion of the 3' region of a probe have, respectively, the sequence of the 5' region and the sequence of the 3' region of a different probe, isolating a plurality of nucleic acids each having a nucleic acid sequence of a different subregion for each of the plurality of target nucleic acids, and analyzing the isolated nucleic acids.
- aspects of the disclosure are based, in part, on the discovery of methods for overcoming problems associated with systematic and random errors (bias) in genome capture, amplification and sequencing methods, namely high variability in the capture and amplification of nucleic acids and disproportionate representation of heterozygous alleles in sequencing libraries. Accordingly, in some embodiments, the disclosure provides methods that reduce errors associated with the variability in the capture and amplification of nucleic acids. In other embodiments, the methods improve allelic representation in sequencing libraries and, thus, improve variant detection outcomes. In certain embodiments, the disclosure provides preparative methods for capturing target nucleic acids (e.g., genetic loci) that involve the use of differentiator tag sequences to uniquely tag individual nucleic acid molecules.
- target nucleic acids e.g., genetic loci
- the differentiator tag sequence permit the detection of bias based on the occurrence of combinations of differentiator tag and target sequences observed in a sequencing reaction.
- the methods reduce errors caused by bias, or the risk of bias, associated with the capture, amplification and sequencing of genetic loci, e.g., for diagnostic purposes.
- aspects of the invention relate to providing sequence tags (referred to as differentiator tags) that are useful to determine whether target nucleic acid sequences identified in an assay are from independently isolated target nucleic acids or from multiple copies of the same target nucleic acid molecule (e.g., due to bias in a preparative step, for example, amplification).
- This information can be used to help analyze a threshold number of independently isolated target nucleic acids from a biological sample in order to obtain sequence information that is reliable and can be used to make a genotype conclusion (e.g., call) with a desired degree of confidence.
- This information also can be used to detect bias in one or more nucleic acid preparative steps.
- the methods disclosed herein are useful for any application where reduction of bias, e.g., associated with genomic isolation, amplification, sequencing, is important. For example, detection of cancer mutations in a heterogeneous tissue sample, detection of mutations in maternally-circulating fetal DNA, and detection of mutations in cells isolated during a preimplantation genetic diagnostic procedure.
- methods of genotyping a subject comprise determining the sequence of at least a threshold number of independently isolated nucleic acids, wherein the sequence of each isolated nucleic acid comprises a target nucleic acid sequence and a differentiator tag sequence, wherein the threshold number is a number of unique combinations of target nucleic acid and differentiator tag sequences, wherein the isolated nucleic acids are identified as independently isolated if they comprise unique combinations of target nucleic acid and differentiator tag sequences, and wherein the target nucleic acid sequence is the sequence of a genomic locus of a subject.
- the isolated nucleic acids are products of a circularization selection-based preparative method, e.g., molecular inversion probe capture products.
- the isolated nucleic acids are products of an amplification-based preparative methods.
- the isolated nucleic acids are products of hybridization-based preparative methods.
- Circularization selection-based preparative methods selectively convert regions of interest (target nucleic acids) into a covalently-closed circular molecule which is then isolated typically by removal (usually enzymatic, e.g. with exonuclease) of any non- circularized linear nucleic acid.
- Oligonucleotide probes e.g., molecular inversion probes
- the probes are allowed to hybridize to the genomic target, and enzymes are used to first (optionally) fill in any gap between probe ends and second ligate the probe closed. Following circularization, any remaining (non-target) linear nucleic acid is typically removed, resulting in isolation (capture) of target nucleic acid.
- Circularization selection-based preparative methods include molecular inversion probe capture reactions and 'selector' capture reactions.
- molecular inversion probe capture of a target nucleic acid is indicative of the presence of a polymorphism in the target nucleic acid.
- genomic loci target nucleic acids
- ligase chain reaction or other amplification method
- primers will be sufficiently complementary to the target sequence to hybridize with and prime amplification of the target nucleic acid. Any one of a variety of art known methods may be utilized for primer design and synthesis.
- primers may be perfectly complementary to the target sequence.
- Degenerate primers may also be used.
- Primers may also include additional nucleic acids that are not complementary to target sequences but that facilitate downstream applications, including for example restriction sites and differentiator tag sequences.
- Amplification-based methods include amplification of a single target nucleic acid and multiplex amplification (amplification of multiple target nucleic acids in parallel).
- Hybridization-based preparative methods involve selectively immobilizing target nucleic acids for further manipulation.
- one or more oligonucleotides which comprise differentiator tag sequences, and which may be from 15 to 170 nucleotides in length, are used which hybridize along the length of a target region of a genetic locus to immobilize it.
- immobilization oligonucleotides are either immobilized before hybridization is performed (e.g., Roche/Nimblegen 'sequence capture'), or are prepared such that they include a moiety (e.g. biotin) which can be used to selectively immobilize the target nucleic acid after hybridization by binding to e.g., streptavidin-coated microbeads (e.g. Agilent 'SureSelect').
- any of the circularization, amplification, and/or hybridization based methods described herein may be used in connection with one or more of the tiling/staggering, tagging, size-detection, and/or sensitivity enhancing algorithms described herein.
- the methods disclosed herein comprise determining the sequence of molecular inversion probe capture products, each comprising a molecular inversion probe and a target nucleic acid, wherein the sequence of the molecular inversion probe comprises a differentiator tag sequence and, optionally, a primer sequence, and wherein the target nucleic acid is a captured genomic locus of a subject, and genotyping the subject at the captured genomic locus based on the sequence of at least a threshold number of unique combinations of target nucleic acid and differentiator tag sequences of molecular inversion probe capture products.
- the methods disclosed herein comprise obtaining molecular inversion probe capture products, each comprising a molecular inversion probe and a target nucleic acid, wherein the sequence of the molecular inversion probe comprises a differentiator tag sequence and, optionally, a primer sequence, wherein the target nucleic acid is a captured genomic locus of the subject, amplifying the molecular inversion probe capture products, and genotyping the subject by determining, for each target nucleic acid, the sequence of at least a threshold number of unique combinations of target nucleic acid and differentiator tag sequence of molecular inversion probe capture products.
- obtaining comprises capturing target nucleic acids from a genomic sample of the subject with molecular inversion probes, each comprising a unique differentiator tag sequence.
- capturing is performed under conditions wherein the likelihood of obtaining two or more molecular inversion probe capture products with identical combinations of target and differentiator tag sequences is equal to or less than a predetermined value, optionally wherein the predetermined value is about 0.05.
- the threshold number for a specific target nucleic acid sequence is selected based on a desired statistical confidence for the genotype. In some embodiments, the methods further comprising determining a statistical confidence for the genotype based on the number of unique combinations of target nucleic acid and differentiator tag sequences.
- the methods comprise obtaining a plurality of molecular inversion probe capture products each comprising a molecular inversion probe and a target nucleic acid, wherein the sequence of the molecular inversion probe comprises a differentiator tag sequence and, optionally, a primer sequence (e.g., a sequence that is complementary to the sequence of a nucleic acid that is used as a primer for sequencing or other extension reaction), amplifying the plurality of molecular inversion probe capture products, determining numbers of occurrence of combinations of target nucleic acid and differentiator tag sequence of molecular inversion probe capture products in the amplified plurality, and if the number of occurrence of a specific combination of target nucleic acid sequence and differentiator tag sequence exceeds a predetermined value, detecting bias in the amplification of the molecular inversion probe comprising the specific combination.
- the methods further comprise genotyping target sequences in the plurality
- the target nucleic acid is a gene (or portion thereof) selected from Table 1.
- the genotyping comprises determining the sequence of a target nucleic acid (e.g., a polymorphic sequence) at one or more (both) alleles of a genome (a diploid genome) of a subject.
- the genotyping comprises determining the sequence of a target nucleic acid at both alleles of a diploid genome of a subject, wherein in the target nucleic acid comprises, or consists of, a sequence of Table 1 , Table 2, or other locus of interest.
- aspects of the invention provide methods and compositions for identifying nucleic acid insertions or deletions in genomic regions of interest without determining the nucleotide sequences of these regions. Aspects of the invention are particularly useful for detecting nucleic acid insertions or deletions in genomic regions containing nucleic acid sequence repeats (e.g., di- or tri-nucleotide repeats). However, the invention is not limited to analyzing nucleic acid repeats and may be used to detect insertions or deletions in any target nucleic acid of interest. Aspects of the invention are particularly useful for analyzing multiple loci in a multiplex assay.
- aspects of the invention relate to determining whether an amount of target nucleic acid that is captured in a genomic capture assay is higher or lower than expected. In some embodiments, a statistically significant deviation from an expected amount (e.g., higher or lower) is indicative of the presence of a nucleic acid insertion or deletion in the genomic region of interest. In some embodiments, the amount is a number of nucleic acid molecules that are captured. In some embodiments, the amount is a number of independently captured nucleic acid molecules in a sample. It should be appreciated that the captured nucleic acids may be literally captured from a sample, or their sequences may be captured without actually capturing the original nucleic acids in the sample. For example, nucleic acid sequences may be captured in an assay that involves a template-based extension of nucleic acids having the region of interest, in the sample.
- aspects of the invention are based on the recognition that the efficiency of certain capture techniques is affected by the length of the nucleic acid being captured. Accordingly, an increase or decrease in the length of a target nucleic acid (e.g., due to an insertion or deletion of a repeated sequence) can alter the capture efficiency of that nucleic acid. In some embodiments, a difference in the capture efficiency (e.g., a statistically significant difference in the capture efficiency) of a target nucleic acid is indicative of an insertion or deletion in the target nucleic acid.
- the capture efficiency for a target nucleic acid may be evaluated based on an amount of captured nucleic acid (e.g., number of captured nucleic acid molecules) relative to a control amount (e.g., based on an amount of control nucleic acid that is captured).
- an amount of captured nucleic acid e.g., number of captured nucleic acid molecules
- a control amount e.g., based on an amount of control nucleic acid that is captured.
- the invention is not limited in this respect and other techniques for evaluating capture efficiency also may be used. According to aspects of the invention, evaluating the capture efficiency as opposed to determining the sequence of the entire repeat region reduces errors associated with sequencing through repeat regions. Repeat sequences often give rise to stutters or skips in sequencing reactions that make it very difficult to accurately determine the number of repeats in a target region without running multiple sequencing reactions under different conditions and carefully analyzing the results.
- repeat regions may be longer than the length of the individual sequence read, making length determination on the basis of a single read impossible.
- the repeat regions may be longer than the length of the individual sequence read, making length determination on the basis of a single read impossible. Accordingly, aspects of the invention are useful to increase the sensitivity of detecting insertions or deletions in target regions, particularly target regions containing repeated sequences.
- aspects of the invention relate to capturing genomic nucleic acid sequences using a molecular inversion probe (e.g., MIP or Padlock probe) technique, and determining whether the amount (e.g., number) of captured sequences is higher or lower than expected. In some embodiments, the amount (e.g., number) of captured sequences is compared to an amount (e.g., number) of sequences captured in a control assay.
- the control assay may involve analyzing a control sample that contains a nucleic acid from the same genetic locus having a known sequence length (e.g., a known number of nucleic acid repeats).
- a control may involve analyzing a second (e.g., different) genetic locus that is not expected to contain any insertions or deletions.
- the second genetic locus may be analyzed in the same sample as the locus being interrogated or in a different sample where its length has been previously determined.
- the second genetic locus may be a locus that is not characterized by the presence of nucleic acid repeats (and thus not expected to contain insertions or deletions of the repeat sequence).
- a target nucleic acid region that is being evaluated may be determined by the identity of the targeting arms of a probe that is designed to capture the target region (or sequence thereof).
- the targeting arms of a MIP probe may be designed to be complementary (e.g., sufficiently complementary for selective hybridization and//or polymerase extension and/or ligation) to genomic regions flanking a target region suspected of containing an insertion or deletion.
- two targeting arms may be designed to be complementary (e.g., sufficiently complementary for selective hybridization and/or polymerase extension and/or ligation) to the two flanking regions that are immediately adjacent (e.g., immediately 5' and 3', respectively) to a region of a sequence repeat on one strand of a genomic nucleic acid.
- one or both targeting arms may be designed to hybridize several bases (e.g., 1- 5, 5-10, 10-25, 25-50, or more) upstream or downstream from the repeat region in such a way that the captured sequence includes a region of unique genomic sequence that on one or both sides of the repeat region. This unique region can then be used to identify the captured target (e.g., based on sequence or hybridization information).
- two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) different loci may be interrogated in parallel in a single assay (e.g., in a multiplex assay).
- the ratio of captured nucleic acids for each locus may be used to determine whether a nucleic acid insertion or deletion is present in one locus relative to the other. For example, the ratio may be compared to a control ratio that is representative of the two loci when neither one has an insertion or deletion relative to control sequences (e.g., sequences that are normal or known to be associated with healthy phenotypes for those loci). However, the amount of captured nucleic acids may be compared to any suitable control as discussed herein.
- the locus of a captured sequence may be identified by determining a portion of unique sequence 5' and/or 3' to the repeat region in the target nucleic acid suspected of containing a deletion or insertion. This does not require sequencing the captured repeat region itself. However, some or all of the repeat region also could be sequenced as aspects of the invention are not limited in this respect.
- aspects of the invention may be combined with one or more sequence-based assays (e.g., SNP detection assays), for example in a multiplex format, to determine the genotype of one or more regions of a subject.
- sequence-based assays e.g., SNP detection assays
- methods of detecting a polymorphism in a nucleic acid in a biological sample comprise evaluating the efficiency of capture at one or more loci and determining whether one or both alleles at that locus contain an insertion or deletion relative to a control locus (e.g., a locus indicative of a length of repeat sequence that is associated with a healthy phenotype).
- a control locus e.g., a locus indicative of a length of repeat sequence that is associated with a healthy phenotype.
- aspects of the invention relate to methods for determining whether a target nucleic acid has an abnormal length by evaluating the capture efficiency of a target nucleic acid in a biological sample from a subject, wherein a capture efficiency that is different from a reference capture efficiency is indicative of the presence, in the biological sample, of a target nucleic acid having an abnormal length.
- a normal length is a length that is associated with a normal (e.g., healthy or non-carrier phenotype).
- an abnormal length is a length that is either shorter or longer than the normal length.
- the presence of an abnormal length is indicative of an increased risk that the locus is associated with a disease or a disease carrier phenotype.
- the abnormal length is indicative that the subject is either has a disease or condition or is a carrier of a disease or condition (e.g., associated with the locus).
- the description of embodiments relating to detecting the presence of an abnormal length also support detecting the presence of a length that is different from an expected or control length.
- aspects of the invention relate to estimating the length of a target nucleic acid (e.g., of a sub-target region within a target nucleic acid).
- aspects of the invention relate to methods for estimating the length of a target nucleic acid by contacting the target nucleic acid with a plurality of detection probes under conditions that permit hybridization of the detection probes to the target nucleic acid, wherein each detection probe is a polynucleotide that comprises a first arm that hybridizes to a first region of the target nucleic acid and a second arm that hybridizes to a second region of the target nucleic acid, wherein the first and second regions are on a common strand of the target nucleic acid, and wherein the nucleotide sequence of the target between the 5' end of the first region and the 3' end of the second region is the nucleotide sequence of a sub-target nucleic acid; and capturing a plurality of sub-target nucleic acids that are
- methods for estimating a nucleic acid length may involve comparing a capture efficiency for a target nucleic acid region to two or more reference efficiencies for known nucleic acid lengths in order to determine whether the target nucleic acid region is smaller, intermediate, or larger in size than the known control lengths.
- a series of nucleic acids of known different lengths may be used to provide a calibration curve for evaluating the length of a target nucleic acid region of interest.
- the capture efficiency of a target region suspected of having a deletion or insertion is determined by comparing the capture efficiency to a reference indicative of a normal capture efficiency. In some embodiments, the capture efficiency is lower than the reference capture efficiency.
- the subject is identified as having an insertion in the target region. In some embodiments, the capture efficiency is higher than the reference capture efficiency. In some embodiments, the subject is identified as having a deletion in the target region. In some embodiments, the subject is identified as being heterozygous for the insertion. In some embodiments, the subject is identified as being heterozygous for the deletion. In some embodiments of any of the methods described herein (e.g., tiling/staggering, tagging, size-detection, and/or sensitivity enhancement) aspects of the invention relate to capturing a sub-target nucleic acid (or a sequence of a sub-target nucleic acid). In some embodiments, a molecular inversion probe technique is used.
- a molecular inversion probe is a single linear strand of nucleic acid that comprises a first targeting arm at its 5' end and a second targeting arm at its 3' end, wherein the first targeting arm is capable of specifically hybridizing to a first region flanking one end of the sub-target nucleic acid, and wherein the second targeting arm is capable of specifically hybridizing to a second region flanking the other end of the sub- target nucleic acid on the same strand of the target nucleic acid.
- the first and second targeting arms are between about 10 and about 100 nucleotides long. In some embodiments, the first and second targeting arms are about 10-20, 20-30, 30-40, or 40-50 nucleotides long.
- the first and second targeting arms are about 20 nucleotides long. In some embodiments, the first and second targeting arms have the same length. In some embodiments, the first and second targeting arms have different lengths. In some embodiments, each pair of first and second targeting arms in a set of probes has the same length. Accordingly, if one of the targeting arms is longer, the other one is correspondingly shorter. This allows for a quality control step in some embodiments to confirm that all captured probe/target sequence products have the same length after a multiplexed plurality of capture reactions. In some embodiments, a set of probes may be designed to have the same length if the intervening region is varied to accommodate any differences in the length of either one or both of the first and second targeting arms.
- the hybridization Tms of the first and second targeting arms are similar. In some embodiments, the hybridization Tms of the first and second targeting arms are within 2-5 0 C of each other. In some embodiments, the hybridization Tms of the first and second targeting arms are identical. In some embodiments, the hybridization Tms of the first and second targeting arms are close to empirically- determined optima but not necessarily identical. In some embodiments, the first and second targeting arms of a molecular inversion probe have different Tms. For example, the Tm of the first targeting arm (at the 5' end of the molecular inversion probe) may be higher than the Tm of the second targeting arm (at the 3' end of the molecular inversion probe).
- a relatively high Tm for the first targeting arm may help avoid or prevent the first targeting arm from being displaced after hybridization by the extension product of the 3' end of the second targeting arm.
- a reference to the Tm of a targeting arm as used herein relates to the Tm of hybridization of the targeting arm to a nucleic acid having the complementary sequence (e.g., the region of the target nucleic acid that has a sequence that is complementary to the sequence of the targeting arm).
- the Tms of the targeting arms described herein may be calculated using any appropriate method.
- an experimental method e.g., a gel shift assay, a hybridization assay, a melting curve analysis, for example in a PCR machine with a SYBR dye by stepping through a temperature ramp while monitoring signal level from an intercalating dye, for example, bound to a double- stranded DNA, etc.
- an optimal Tm may be determined by evaluating the number of products formed (e.g., for each of a plurality of MIP probes), and determining the optimal Tm as the center point in a histogram of Tm for all targeting arms.
- a predictive algorithm may be used to determine a Tm theoretically.
- a relatively simple predictive algorithm may be used based on the number of G/C and AJT base pairs when the sequence is hybridized to its target and/or the length of the hybridized product (e.g., for example, 64.9 + 41 * ([G+C] - 16.4) / (A + T + G + C), see for example, Wallace,R.B., Shaffer,J., Murphy,R.F., Bonner,J., Hirose,T., and Itakura,K. (1979) Nucleic Acids Res 6:3543-3557).
- a more complex algorithm may be used to account for the effects of base stacking entropy and enthalpy, ion concentration, and primer concentration (see, for example, SantaLucia J ( 1998), Proc Natl Acad Sci USA, 95: 1460-5).
- an algorithm may use modified parameters (e.g., nearest-neighbor parameters for basepair entropy/enthalpy values). It should be appreciated that any suitable algorithm may be used as aspects of the invention are not limited in this respect. However, it also should be appreciated that different methodologies may results in different calculated or predicted Tms for the same sequences.
- the same empirical and/or theoretical method is used to determine the Tms of different sequences for a set of probes to avoid a negative impact of any systematic difference in the Tm determination or prediction when designing a set of probes with predetermined similarities or differences for different Tms.
- the Tm of the first targeting arm may be about 1 0 C, about
- each probe in a plurality of probes e.g., each probe in a set of 5-10, each probe in a set of at least 10, each probe in a set of 10-50, each probe in a set of 50-100, each probe in a set of 100-500, each probe in a set of 500-1 ,000, each probe in a set of 1,000-1,500, each probe in a set of 1,500-2,000, each probe in a set of 2,000-3,000, 3,000-5,000, 5,000-10,000 or each probe in a set of at least 5,000 different probes
- has a unique first targeting arm e.g., they all have different sequences
- a unique second targeting arm e.g., they all have different sequences
- the first targeting arm has a Tm for its complementary sequence that is higher (e.g., about 1 0 C, about 2 0 C, about 3 0 C, about 4 0 C, about 5 0 C, or more than about 5 0 C higher) than the Tm of the second targeting arm for its complementary sequence.
- each of the first targeting arms have similar or identical Tms for their respective complementary sequences and each of the second targeting arms have similar or identical Tms for their respective complementary sequences (and the first targeting arms have higher Tms than the second targeting arms).
- the Tm of the first arm(s) may be about 58 0 C and the Tm of the second arm(s) may be about 56 0 C. In some embodiments, the Tm of the first arm(s) may be about 68 0 C, and the Tm of the second arm(s) may be about 65 0 C.
- the similarity e.g., within a range of 1 0 C, 2 0 C, 3 0 C, 4 0 C, 5 0 C
- identity of the Tms for the different targeting arms should be based either on empirical data for each arm or based on the same predictive algorithm for each arm (e.g., Wallace,R.B., Shaffer,J., Murphy,R.F., Bonner,J., Hirose,T., and Itakura,K. (1979) Nucleic Acids Res 6:3543- 3557, SantaLucia J (1998), Proc Natl Acad Sci USA, 95: 1460-5, or other algorithm).
- the Tm of the first targeting arm of a molecular inversion probe (at the 5' end of the molecular inversion probe) is selected to be sufficiently stable to prevent displacement of the first targeting arm from its complementary sequence on a target nucleic acid.
- the Tm of the first targeting arm is 50-55 0 C, at least 55 0 C, 55-60 0 C, at least 60 0 C, 60-65 0 C, at least 65 0 C, at least 70 0 C, at least 75 0 C, or at least 80 0 C.
- the for a particular targeting arm may be determined empirically or theoretically.
- each probe in a plurality of probes e.g., each probe in a set of 5-10, each probe in a set of at least 10, each probe in a set of 10-50, each probe in a set of 50-100, each probe in a set of 100-500, or each probe in a set of at least 500 different probes
- each probe in a plurality of probes has a different first targeting arm (e.g., different sequences) but each different first targeting arm has a similar or identical Tm for its complementary sequence on a target nucleic acid.
- the similarity (e.g., within a range of 1 C, 2 C, 3 C, 4 C, 5 C) or identity of the Tms for the different targeting arms should be based either on empirical data for each arm or based on the same predictive algorithm for each arm (e.g., Wallace,R.B., Shaffer,J., Murphy,R.F., Bonner,J., Hirose,T., and Itakura,K. (1979) Nucleic Acids Res 6:3543- 3557, SantaLucia J (1998), Proc Natl Acad Sci USA, 95: 1460-5, or other algorithm).
- the sub-target nucleic acid contains a nucleic acid repeat.
- the nucleic acid repeat is a dinucleotide or trinucleotide repeat.
- the sub-target nucleic acid contains 10- 100 copies of the nucleic acid repeat in the absence of an abnormal increase or decrease in nucleic acid repeats.
- the sub-target nucleic acid is a region of the Fragile-X locus that contains a nucleic acid repeat.
- one or both targeting arms hybridize to a region on the target nucleic acid that is immediately adjacent to a region of nucleic acid repeats.
- one or both targeting arms hybridize to a region on the target nucleic acid that is separated from a region of nucleic acid repeats by a region that does not contain any nucleic acid repeats.
- the molecular inversion probe further comprises a primer-binding region that can be used to sequence the captured sub-target nucleic acid and optionally the first and/or second targeting arm.
- aspects of the invention relate to evaluating the length of a plurality of different target nucleic acids in a biological sample.
- the plurality of target nucleic acids are analyzed using a plurality of different molecular inversion probes.
- each different molecular inversion probe comprises a different pair of first and second targeting arms at each of the 3' and 5' ends.
- each different molecular inversion probe comprises the same primer-binding sequence.
- aspects of the invention relate to analyzing nucleic acid from a biological sample obtained from a subject.
- the biological sample is a blood sample.
- the biological sample is a tissue sample, specific cell population, tumor sample, circulating tumor cells, or environmental sample. In some embodiments, the biological sample is a single cell.
- nucleic acids are analyzed in biological samples obtained from a plurality of different subjects. In some embodiments, nucleic acids from a biological sample are analyzed in multiplex reactions. It should be appreciated that a biological sample contains a plurality of copies of a genome derived from a plurality of cells in the sample. Accordingly, a sample may contain a plurality of independent copies of a target nucleic acid region of interest, the capture efficiency of which can be used to evaluate its size as described herein.
- aspects of the invention relate to evaluating a nucleic acid capture efficiency by determining an amount of target nucleic acid that is captured (e.g., an amount of sub-target nucleic acid sequences that are captured).
- the amount of target nucleic acid that is captured is determined by determining a number of independently captured target nucleic acid molecules (e.g., the amount of independently captured molecules that have the sequence of the sub-target region).
- the amount of target nucleic acid that is captured is compared to a reference amount of captured nucleic acid.
- the reference amount is determined by determining a number of independently captured molecules of a reference nucleic acid.
- the reference nucleic acid is a nucleic acid of a different locus in the biological sample that is not suspected of containing a deletion or insertion. In some embodiments, the reference nucleic acid is a nucleic acid of known size and amount that is added to the capture reaction. As described herein, a number of independently captured nucleic acid sequences can be determined by contacting a nucleic acid sample with a preparation of a probe (e.g., a MIP probe as described herein). It should be appreciated that the preparation may comprise a plurality of copies of the same probe and accordingly a plurality of independent copies of the target region may be captured by different probe molecules.
- a probe e.g., a MIP probe as described herein
- the number of probe molecules that actually capture a sequence can be evaluated by determining an amount or number of captured molecules using any suitable technique. This number is a reflection of both the number of target molecules in the sample and the efficiency of capture of those target molecules, which in turn is related to the size of the target molecules as described herein. Accordingly, the capture efficiency can be evaluated by controlling for the abundance of the target nucleic acid, for example by comparing the number or amount of captured target molecules to an appropriate control (e.g., a known size and amount of control nucleic acid, or a different locus that should be present in the same amount in the biological sample and is not expected to contain any insertions or deletions).
- an appropriate control e.g., a known size and amount of control nucleic acid, or a different locus that should be present in the same amount in the biological sample and is not expected to contain any insertions or deletions.
- aspects of the invention relate to identifying a subject as having an insertion or deletion in one or more alleles of a genetic locus if the capture efficiency for that genetic locus is statistically significantly different than a reference capture efficiency.
- hybridization conditions used for any of the capture techniques described herein can be based on known hybridization buffers and conditions.
- the methods disclosed herein are useful for any application where the detection of deletions or insertions is important.
- aspects of the invention relate to basing a nucleic acid sequence analysis on results from two or more different nucleic acid preparatory techniques that have different systematic biases in the types of nucleic acids that they sample.
- different techniques have different sequence biases that are systematic and not simply due to stochastic effects during nucleic acid capture or amplification.
- the degree of oversampling required to overcome variations in nucleic acid preparation needs to be sufficient to overcome the biases (e.g., an oversampling of 2-5 fold, 5-10 fold, 5-15 fold, 15-20 fold, 20-30 fold, 30-50 fold, or intermediate to higher fold).
- different techniques have different characteristic or systematic biases. For example, one technique may bias a sample analysis towards one particular allele at a genetic locus of interest, whereas a different technique would bias the sample analysis towards a different allele at the same locus. Accordingly, the same sample may be identified as being different depending on the type of technique that is used to prepare nucleic acid for sequence analysis. This effectively represents a sensitivity limitation, because each technique has different relative sensitivities for polymorphic sequences of interest.
- the sensitivity of a nucleic acid analysis can be increased by combining the sequences from different nucleic acid preparative steps and using the combined sequence information for a diagnostic assay (e.g., for a making a call as to whether a subject is homozygous or heterozygous at a genetic locus of interest).
- a diagnostic assay e.g., for a making a call as to whether a subject is homozygous or heterozygous at a genetic locus of interest.
- the invention provides a method of increasing the sensitivity of a nucleic acid detection assay by obtaining a first preparation of a target nucleic acid using a first preparative method on a biological sample, obtaining a second preparation of a target nucleic acid using a second preparative method on the biological sample, assaying the sequences obtained in both first and second nucleic acid preparations, and using the sequence information from both first and second nucleic acid preparations to determine the genotype of the target nucleic acid in the biological sample, wherein the first and second preparative methods have different systematic sequence biases.
- the first and second nucleic acid preparations are combined prior to performing a sequence assay.
- the first preparative method is an amplification-based, a hybridization-based, or a circular probe-based preparative method.
- the second method is an amplification- based, a hybridization-based, or a circular probe-based preparative method.
- the first and second methods are of different types (e.g., only one of them is an amplification-based, a hybridization-based, or a circular probe-based preparative method, and the other one is one or the other two types of method).
- the second preparative method is an amplification-based, a hybridization-based, or a circular probe-based preparative method, provided that the second method is different from the first method.
- both methods may be of the same type, provided they are different methods (e.g., both are amplification based or hybridization-based, but are different types of amplification or hybridization methods, e.g., with different relative biases).
- genomic loci target nucleic acids
- a polymerase chain reaction or ligase chain reaction or other amplification method
- primers will be sufficiently complementary to the target sequence to hybridize with and prime amplification of the target nucleic acid. Any one of a variety of art known methods may be utilized for primer design and synthesis. One or both of the primers may be perfectly complementary to the target sequence. Degenerate primers may also be used.
- Primers may also include additional nucleic acids that are not complementary to target sequences but that facilitate downstream applications, including for example restriction sites and identifier sequences (e.g., source sequences).
- PCR based methods may include amplification of a single target nucleic acid and multiplex amplification (amplification of multiple target nucleic acids in parallel).
- Hybridization-based preparative may methods involve selectively immobilizing target nucleic acids for further manipulation. It is to be understood that one or more oligonucleotides (immobilization oligonucleotides), which in some embodiments may be from 10 to 200 nucleotides in length, are used which hybridize along the length of a target region of a genetic locus to immobilize it.
- immobilization oligonucleotides which in some embodiments may be from 10 to 200 nucleotides in length, are used which hybridize along the length of a target region of a genetic locus to immobilize it.
- immobilization oligonucleotides are either immobilized before hybridization is performed (e.g., Roche/Nimblegen 'sequence capture'), or are prepared such that they include a moiety (e.g., biotin) which can be used to selectively immobilize the target nucleic acid after hybridization by binding to e.g., streptavidin-coated microbeads (e.g., Agilent 'SureSelect').
- a moiety e.g., biotin
- Circularization selection-based preparative methods selectively convert each region of interest into a covalently-closed circular molecule which is then isolated by removal (usually enzymatic, e.g., with exonuclease) of any non-circularized linear nucleic acid.
- Oligonucleotide probes are designed which have ends that flank the region of interest. The probes are allowed to hybridize to the genomic target, and enzymes are used to first (optionally) fill in any gap between probe ends and second ligate the probe closed.
- any remaining (non-target) linear nucleic acid can be removed, resulting in isolation (capture) of target nucleic acid.
- Circularization selection-based preparative methods include molecular inversion probe capture reactions and 'selector' capture reactions. However, other techniques may be used as aspects of the invention are not limited in this respect.
- molecular inversion probe capture of a target nucleic acid is indicative of the presence of a polymorphism in the target nucleic acid.
- a variety of methods may be used to evaluate and compare bias profiles of each preparative technique.
- Next-generation sequencing may be used to quantitatively measure the abundance of each isolated target nucleic acid obtained from a certain preparative method. This abundance may be compared to a control abundance value (e.g., a known starting abundance of the target nucleic acid) and/or with an abundance determined through the use of an alternative preparative method.
- a control abundance value e.g., a known starting abundance of the target nucleic acid
- a set of target nucleic acids may be isolated by one or more of the three preparative methods; the target nucleic acid may be observed x times using the amplification technique, y times using the hybridization enrichment technique, and z times using the circularization selection technique.
- a pairwise correlation coefficient may be computed between each abundance value (e.g., x and y, x and z, and y and z) to assess bias in nucleic acid isolation between pairs of preparative methods. Since the mechanisms of isolation are different in each approach, the abundances will usually be different and largely uncorrelated with each other.
- the invention provides a method of obtaining a nucleic acid preparation that is representative of a target nucleic acid in a biological sample by obtaining a first preparation of a target nucleic acid using a first preparative method on a biological sample, obtaining a second preparation of a target nucleic acid using a second preparative method on the biological sample, and combining the first and second nucleic acid preparations to obtain a combined preparation that is representative of the target nucleic acid in the biological sample.
- a third preparation of the target nucleic acid is obtained using a third preparative method that is different from the first and second preparative methods, wherein the first, second, and third preparative methods all have different systematic sequence biases.
- the different preparative methods are used for a plurality of different loci in the biological sample to increase the sensitivity of a multiplex nucleic acid analysis.
- the target nucleic acid has a sequence of a gene selected from Table 1.
- a genotyping method of the invention may include several steps, each of which independently may involve one or more different preparative techniques described herein.
- a nucleic acid preparation may be obtained using one or more (e.g., 2, 3, 4, 5, or more) different techniques described herein (e.g., amplification, hybridization capture, circular probe capture, etc., or any combination thereof) and the nucleic acid preparation may be analyzed using one or more different techniques (e.g., amplification, hybridization capture, circular probe capture, etc., or any combination thereof) that are selected independently of the techniques used for the initial preparation.
- aspects of the invention also provide compositions, kits, devices, and analytical methods for increasing the sensitivity of nucleic acid assays. Aspects of the invention are particularly useful for increasing the confidence level of genotyping analyses. However, aspects of the invention may be used in the context of any suitable nucleic acid analysis, for example, but not limited to, a nucleic acid analysis that is designed to determine whether more than one sequence variant is present in a sample.
- aspects of the invention relate to a plurality of nucleic acid probes (e.g., 10-50, 50-100, 100-250, 250-500, 500-1 ,000, 1,000-2,000, 2,000-5,000, 5,000-7,500, 7,500-10,000, or lower, higher, or intermediate number of different probes).
- each probe or each of a subset of probes e.g., 10-25%, 25-50%, 50-75%, 75-90%, or 90-99%
- each probe or each probe of a subset of probes e.g., 10-25%, 25-50%, 50-75%, 75-90%, or 90-99%
- the first and second targeting arms are separated by the same intervening sequence.
- the first and second targeting arms are complementary to target nucleic acid sequences that are separated by the same or a similar length (e.g., number of nucleic acids, for example, 0-25, 25-50, 50-100, 100-250, 250-500, 500-1 ,000, 1,000-2,500 or longer or intermediate number of nucleotides) on their respective target nucleic acids (e.g., genomic loci).
- each probe or a subset of probes e.g., 10- 25%, 25-50%, 50-75%, 75-90%, or 90-99%
- each probe or a subset of probes includes a unique identifier sequence tag (e.g., that is predetermined and can be used to distinguish each probe).
- the methods disclosed herein are useful for any application where sensitivity is important. For example, detection of cancer mutations in a heterogenous tissue sample, detection of mutations in maternally-circulating fetal DNA, and detection of mutations in cells isolated during a preimplantation genetic diagnostic procedure.
- the methods comprise obtaining a nucleic acid preparation using a preparative method (e.g., any of the preparative methods disclosed herein) on a biological sample, and performing a molecular inversion probe capture reaction on the nucleic acid preparation, wherein a molecular inversion probe capture (e.g., using a mutation-detection MIP) of a target nucleic acid of the nucleic acid preparation is indicative of the presence of a mutation (polymorphism) in the target nucleic acid, optionally wherein the polymorphism is selected from Table 2.
- a preparative method e.g., any of the preparative methods disclosed herein
- a molecular inversion probe capture reaction e.g., using a mutation-detection MIP
- methods of genotyping a nucleic acid in a biological sample comprise obtaining a nucleic acid preparation using a preparative method on a biological sample, sequencing a target nucleic acid of the nucleic acid preparation, and performing a molecular inversion probe capture reaction on the biological sample, wherein a molecular inversion probe capture of the target nucleic acid in the biological sample is indicative of the presence of a polymorphism in the target nucleic acid, genotyping the target nucleic acid based on the results of the sequencing and the capture reaction.
- the target nucleic acid has a sequence of a gene selected from Table 1.
- any one or more embodiments described herein may be used for evaluating multiple genetic markers in parallel. Accordingly, in some embodiments, aspects of the invention relate to determining the presence of one or more markers (e.g., one or more alleles) at multiple different genetic loci in parallel. Accordingly, the risk or presence of multiple heritable disorders may be evaluated in parallel. In some embodiments, the risk of having offspring with one or more heritable disorders may be evaluated. In some embodiments, an evaluation may be performed on a biological sample of a parent or a child (e.g., at a pre-implantation, prenatal, perinatal, or postnatal stage).
- the disclosure provides methods for analyzing multiple genetic loci (e.g., a plurality of target nucleic acids selected from Table 1 or 2) from a patient sample, such as a blood, pre-implantation embryo, chorionic villus or amniotic fluid sample.
- a patient or subject may be a human.
- aspects of the invention are not limited to humans and may be applied to other species (e.g., mammals, birds, reptiles, other vertebrates or invertebrates) as aspects of the invention are not limited in this respect.
- a subject or patient may be male or female.
- samples from a male and female member of a couple may be analyzed.
- samples from a plurality of male and female subjects may be analyzed to determine compatible or optimal breeding partners or strategies for particular traits or to avoid one or more diseases or conditions. Accordingly, reproductive risks may be determined and/or reproductive recommendations may be provided based on information derived from one or more embodiments of the invention.
- aspects of the invention may be used in connection with any medical evaluation where the presence of one or more alleles at a genetic locus of interest is relevant to a medical determination (e.g., risk or detection of disease, disease prognosis, therapy selection, therapy monitoring, etc.). Further aspects of the invention may be used in connection with detection, in tumor tissue or circulating tumor cells, of mutations in cellular pathways that cause cancer or predict efficacy of treatment regimens, or with detection and identification of pathogenic organisms in the environment or a sample obtained from a subject, e.g., a human subject.
- FIG. 1 illustrates a non-limiting embodiment of a tiled probe layout
- FIG. 2 illustrates a non-limiting embodiment of a staggered probe layout
- FlG. 3 illustrates a non-limiting embodiment of an alternating staggered probe layout
- FIGs. 4A, B, and C depict various non-limiting methods for combining differentiator tag sequence and target sequences (NNNN depicts a differentiator tag sequence);
- FIG. 5 depicts a non-limiting method for genotyping based on target and differentiator tag sequences
- FIG. 6 depicts non-limiting results of a simulation of a MIP capture reaction
- FIG. 7 depicts a non-limiting graph of sequencing coverage
- FIG. 8 illustrates that shorter sequences are captured with higher efficiency that longer sequences using MIPs
- FIG. 9 illustrates a non-limiting scheme of padlock (MEP) capture of a region that includes both repetitive regions (thick wavy line) and the adjacent unique sequence (thick strait line);
- FIG. 10 illustrates a non-limiting hypothetical relationship between target gap size and the relative number of reads of the repetitive region
- FIG. 1 IA depicts MIP capture of FMRl repeat regions from a diploid genome
- FIG. 1 IB depicts preparative methods for biallelic resolution of FMRl repeat region lengths in a diploid genome using MIP capture probes and unique differentiator tags;
- FIG. 1 1C depicts an analysis of FMRl repeat region lengths in a diploid genome
- FIG. 12 is a schematic of an embodiment of an algorithm of the invention
- FIG. 13 illustrates a non-limiting example of a graph of per-target abundance with MIP capture
- FIG. 14 shows a non-limiting a graph of correlation between two MIP capture reactions.
- aspects of the invention relate to preparative and analytical methods and compositions for evaluating genotypes, and in particular, for determining the allelic identity (or identities in a diploid organism) of one or more genetic loci in a subject. Aspects of the invention are based, in part, on the identification of different sources of ambiguity and error in genetic analyses, and, in part, on the identification of one or more approaches to avoid, reduce, recognize, and/or resolve these errors and ambiguities at different stages in a genetic analysis. Aspects of the invention relate to methods and compositions for addressing bias and/or stochastic variation associated with one or more preparative and/or analytical steps of a nucleic acid evaluation technology.
- preparative methods can be adapted to avoid or reduce the risk of bias skewing the results of a genetic analysis.
- analytical methods can be adapted to recognize and correct for data variations that may give rise to misinterpretation (e.g., incorrect calls such as homozygous when the subject is actually heterozygous or heterozygous when the subject is actually homozygous).
- Methods of the invention may be used for any type of mutation, for example a single base change (e.g., insertion, deletion, transversion or transition, etc.), a multiple base insertion, deletion, duplication, inversion, and/or any other change or combination thereof.
- additional or alternative techniques may be used to address loci characterized by multiple repeats of a core sequence where the length of the repeat is longer than a typical sequencing read thereby making it difficult to determine whether a deletion or duplication of one or more core sequence units has occurred based solely on a sequence read.
- increased confidence in an assay result may be obtained by i) selecting two or more different preparative and/or analytical techniques that have different biases (e.g., known to have different biases), ii) evaluating a patient sample using the two or more different techniques, iii) comparing the results from the two or more different techniques, and/or iv) determining whether the results are consistent for the two or more different techniques. In some embodiments, if determining in step (iv) indicates that the results are consistent (e.g., the same) then increased confidence in the assay result is obtained.
- step (iv) indicates that the results are consistent (e.g., the same) then increased confidence in the assay result is obtained.
- step (iv) if determining in step (iv) indicates that the results are inconsistent (e.g., that the results are ambiguous) then one or more additional preparative and/or analytical techniques, which have a different bias (e.g., known to have a different bias) compared with the two or more different preparative and/or analytical techniques selected in step (i), are used to evaluate the patient sample, and the results of the one or more additional preparative and/or analytical techniques are compared with the results from step (ii) to resolve the inconsistency.
- two or more independent samples may be obtained from a subject and independently analyzed. In some embodiments, two or more independent samples are obtained at approximately the same time point. In some embodiments, two or more independent samples are obtained at multiple different time points.
- two or more independent sample facilitates the elimination, normalization, and/or quantification of stochastic measurement noise. It is to be appreciated that two or more independent samples may be obtained in connection with any of the methods disclosed herein, including, for example, methods for pathogen profiling in a human or other animal subjects, monitoring tumor progression/regression, analyzing circulating tumor cells, analyzing fetal cells in maternal circulation, and analyzing/monitoring/profiling of environmental pathogens.
- one or more of the techniques described herein may be combined in a single assay protocol for evaluating multiple patient samples in parallel. It should be appreciated that aspects of the invention may be useful for high throughput, cost-effective, yet reliable, genotyping of multiple patient samples (e.g., in parallel, for example in multiplex reactions). In some embodiments, aspects of the invention are useful to reduce the error frequency in a multiplex analysis. Certain embodiments may be particularly useful where multiple reactions (e.g., multiple loci and/or multiple patient samples) are being processed.
- 10-25, 25-50, 50-75, 75-100 or more loci may be evaluated for each subject out of any number of subject samples that may be processed in parallel (e.g., 1-25, 25-50, 50-100, 100-500, 500-1,000, 1 ,000-2,500, 2,500-5,000 or more or intermediate numbers of patient samples).
- different embodiments of the invention may involve conducting two or more target capture reactions and/or two or more patient sample analyses in parallel in a single multiplex reaction.
- a plurality of capture reactions e.g., using different capture probes for different target loci
- a plurality of captured nucleic acids from each one of a plurality of patient samples may be combined in a single multiplex analysis reaction.
- samples from different subjects are tagged with subject-specific (e.g., patient-specific) tags (e.g., unique sequence tags) so that the information from each product can be assigned to an identified subject.
- each of the different capture probes used for each patient sample have a common patient-specific tag.
- the capture probes do not have patient-specific tags, but the captured products from each subject may be amplified using one or a pair of amplification primers that are labeled with a patient-specific tag.
- patient-specific tags as used herein may refer to unique tags that are assigned to identified patients in a particular assay. The same tags may be used in a separate multiplex analysis with a different set of patient samples (e.g., from different patients) each of which is assigned one of the tags. In some embodiments, different sets of unique tags may be used in sequential (e.g., alternating) multiplex reactions in order to reduce the risk of contamination from one assay to the next and allow contamination to be detected on the basis of the presence of tags that are not expected to be present in a particular assay.
- Embodiments of the invention may be used for any of a number of different settings: reproductive settings, disease screening, identifying subjects having cancer, identifying subjects having increased risk for a disease, stratifying a population of subjects according to one or more of a number of factors, for example responsiveness to a particular drug, lack or not of an adverse reaction (or risk therefore) to a particular drug, and/or providing information for medical records (e.g., homozygosity, heterozygosity at one or more loci).
- the invention is not limited to genomic analysis of patient samples.
- aspects of the invention may be useful for high throughput genetic analysis of environment samples to detect pathogens.
- a heritable disorder that may be diagnosed with the methods disclosed herein is a genetic disorder that is prevalent in the Ashkenazi Jewish population.
- the heritable disorders are selected from: 21-Hydroxylase-Defiocient Congenital Adrenal Hyperplasia; ABCC8-Related Hyperinsulinism; Alpha-Thalassemia, includes Constant Spring, & MR associated; Arylsulfatase A Deficiency-Metyachromatic Leukodystrophy; Biotinidase Deficiency- Holocarboxylase Synthetase Deficiency; Bloom's Syndrome; Canavan Disease; CFTR- Related Disorders-cystic fibrosis; Citrullinemia Type I; Combined MMA & Homocystinuria-dblC; Dystrophinopathies (DMD & BMD);
- multiplex diagnostic methods comprise capturing a plurality of genetic loci in parallel (e.g., a genetic locus of Table 1).
- genetic loci possess one or more polymorphisms (e.g., a polymorphism of Table 2) the genotypes of which correspond to disease causing alleles.
- the disclosure provides methods for assessing multiple heritable disorders in parallel.
- methods are provided for diagnosing multiple heritable disorders in parallel at a pre-implantation, prenatal, perinatal, or postnatal stage.
- the disclosure provides methods for analyzing multiple genetic loci (e.g., a plurality of target nucleic acids selected from Table 1) from a patient sample, such as a blood, pre-implantation embryo, chorionic villus or amniotic fluid sample.
- a patient sample such as a blood, pre-implantation embryo, chorionic villus or amniotic fluid sample.
- a patient or subject may be a human.
- aspects of the invention are not limited to humans and may be applied to other species (e.g., mammals, birds, reptiles, other vertebrates or invertebrates) as aspects of the invention are not limited in this respect.
- a subject or patient may be male or female.
- samples from a male and female member of a couple may be analyzed.
- samples from a plurality of male and female subjects may be analyzed to determine compatible or optimal breeding partners or strategies for particular traits or to avoid one or more diseases or conditions.
- any other diseases may be studied and/or risk factors for diseases or disorders including, but not limited to allergies, responsiveness to treatment, cancer tumor profiling for treatment and prognosis, monitoring and identification of patient infections, and monitoring of environmental pathogens.
- aspects of the invention relate to methods that reduce bias and increase reproducibility in multiplex detection of genetic loci, e.g., for diagnostic purposes.
- Molecular inversion probe technology is used to detect or amplify particular nucleic acid sequences in potentially complex mixtures. Use of molecular inversion probes has been demonstrated for detection of single nucleotide polymorphisms
- aspects of the disclosure are based, in part, on the discovery of effective methods for overcoming challenges associated with systematic errors (bias) in multiplex genomic capture and sequencing methods, namely high variability in target nucleic acid representation and unequal sampling of heterozygous alleles in pools of captured target nucleic acids (e.g., isolated from a biological sample). Accordingly, in some embodiments, the disclosure provides methods that reduce variability in the detection of target nucleic acids in multiplex capture methods. In other embodiments, methods improve allelic representation in a capture pool and, thus, improve variant detection outcomes.
- the disclosure provides preparative methods for capturing target nucleic acids (e.g., genetic loci) that involve the use of different sets of multiple probes (e.g., molecular inversion probes MIPs) that capture overlapping regions of a target nucleic acid to achieve a more uniform representation of the target nucleic acids in a capture pool compared with methods of the prior art.
- methods reduce bias, or the risk of bias, associated with large scale parallel capture of genetic loci, e.g., for diagnostic purposes.
- methods are provided for increasing reproducibility (e.g., by reducing the effect of polymorphisms on target nucleic acid capture) in the detection of a plurality of genetic loci in parallel.
- a 'probe' is a nucleic acid having a central region flanked by a 5' region and a 3' region that are complementary to nucleic acids flanking the same strand of a target nucleic acid or subregion thereof.
- An exemplary probe is a molecular inversion probe (MIP).
- MIP molecular inversion probe
- a 'target nucleic acid' may be a genetic locus. Exemplary genetic loci are disclosed herein in Table 1 (RefSeqGene Column).
- probes have been typically designed to meet certain constraints (e.g. melting temperature, G/C content, etc.) known to partially affect capture/amplification efficiency (Ball et al (2009) Nat Biotech 27:361-8 AND Deng et al (2009) Nat Biotech 27:353-60), a set of constraints which is sufficient to ensure either largely uniform or highly reproducible capture/amplification efficiency has not previously been achieved.
- uniformity and reproducibility can be increased by designing multiple probes per target, such that each base in the target is captured by more than one probe.
- the disclosure provides multiple MIPs per target to be captured, where each MIP in a set designed for a given target nucleic acid has a central region and a 5' region and 3' region ('targeting arms') which hybridize to (at least partially) different nucleic acids in the target nucleic acid (immediately flanking a subregion of the target nucleic acid).
- a target can be as small as a single base or as large as a kilobase or more of contiguous sequence.
- probes to capture molecules e.g., target nucleic acids or subregions thereof
- a bp refers to a base pair on a double-stranded nucleic acid - however, where lengths are indicated in bps
- probe design is not so limited.
- probes can be designed to capture targets having lengths in the range of up to 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 1000, or more bps, in some cases.
- the length of a capture molecule is selected based upon multiple considerations. For example, where analysis of a target involves sequencing, e.g., with a next-generation sequencer, the target length should typically match the sequencing read-length so that shotgun library construction is not necessary.
- captured nucleic acids may be sequenced using any suitable sequencing technique as aspects of the invention are not limited in this respect.
- target nucleic acids are too large to be captured with one probe. Consequently, it may be necessary to capture multiple subregions of a target nucleic acid in order to analyze the full target.
- a subregion of a target nucleic acid is at least 1 bp. In other embodiments, a subregion of a target nucleic acid is at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 bp or more. In other embodiments, a subregion of a target nucleic acid has a length that is up to 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more percent of a target nucleic acid length. The skilled artisan will also appreciate that consideration is made, in the design of
- MIPs for the relationship between probe length and target length.
- MIPs are designed such that they are several hundred basepairs (e.g., up to 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 bp or more) longer than corresponding target (e.g., subregion of a target nucleic acid, target nucleic acid).
- target e.g., subregion of a target nucleic acid, target nucleic acid.
- lengths of subregions of a target nucleic acid may differ.
- a target nucleic acid contains regions for which probe hybridization is not possible or inefficient, it may be necessary to use probes that capture subregions of one or more different lengths in order to avoid hybridization with problematic nucleic acids and capture nucleic acids that encompass a complete target nucleic acid.
- the set of probes for a given target can be designed to 'tile' across the target, capturing the target as a series of shorter sub- targets.
- some probes in the set capture flanking non-target sequence).
- the set can be designed to 'stagger' the exact positions of the hybridization regions flanking the target, capturing the full target (and in some cases capturing flanking non-target sequence) with multiple probes having different targeting arms, obviating the need for tiling.
- the particular approach chosen will depend on the nature of the target set. For example, if small regions are to be captured, a staggered-end approach might be appropriate, whereas if longer regions are desired, tiling might be chosen. In all cases, the amount of bias-tolerance for probes targeting pathological loci can be adjusted ('dialed in') by changing the number of different MEPs used to capture a given molecule. In some embodiments, the 'coverage factor', or number of probes used to capture a basepair in a molecule, is an important parameter to specify. Different numbers of probes per target are indicated depending on whether one is using the tiling approach (see, e.g., FIG.
- FIG. 1 illustrates a non-limiting embodiment of a tiled probe layout showing ten captured sub-targets tiled across a single target. Each position in the target is covered by three sub-targets such that MIP performance per base pair is averaged across three probes.
- FIG. 2 illustrates a non-limiting embodiment of a staggered probe layout showing the targets captured by a set of three MIPs.
- Each MEP captures the full target, shown in black, plus (in some cases) additional extra-target sequence, shown in gray, such that the targeting arms of each MIP fall on different sequence.
- Each position in the target is covered by three sub-targets such that MIP performance per basepair is averaged across three probes.
- Targeting arms land immediately adjacent to the black or gray regions shown. It should be appreciated that in some embodiments, the targeting arms (not shown) can be designed so that they do not overlap with each other.
- FIG. 3 illustrates a non-limiting embodiment of an alternating staggered probe layout showing the targets captured by a set of three MIPs.
- Each MIP captures the full target, shown in black, plus (in some cases) additional extra-target sequence, shown in gray, such that the targeting arms of each MlP fall on different sequence.
- Each position in the target is covered by three sub-targets such that MIP performance per basepair is averaged across three probes. Targeting arms land immediately adjacent to the black or gray regions shown.
- the targeting arms on adjacent tiled or staggered probes may be designed to either overlap, not overlap, or overlap for only a subset of the probes.
- a coverage factor of about 3 to about 10 is used.
- the methods are not so limited and coverage factors of up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or more may be used. It is to be appreciated that the coverage factor selected may depend the probe layout being employed.
- the number of probes per target is typically a function of target length, sub-target length, and spacing between adjacent sub-target start locations (step size).
- a desired coverage factor of 3 a 200 bp target with a start-site separation of 20 bp and sub-target length of 60 bp may be encompassed with 12 MlPs (FIG. 1).
- a specific coverage factor may be achieved by varying the number of probes per target nucleic acid and the length of the molecules captured.
- a fixed-length target nucleic acid is captured as several subregions or as 'super-targets', which are molecules comprising the target nucleic acid and additional flanking nucleic acids, which may be of varying lengths.
- a target of 50 bp can be captured at a coverage factor of 3 with 3 probes in either a 'staggered' (FIG. 2) or 'alternating staggered' configuration (FIG. 3).
- the coverage factor will be driven by the extent to which detection bias is tolerable. In some cases, where the bias tolerance is small, it may be desirable to target more subregions of target nucleic acid with, perhaps, higher coverage factors. In some embodiments, the coverage factor is up to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.
- probe number T/(S/C) + (C-I).
- the disclosure provides methods to increase the uniformity of amplification efficiency when multiple molecules are amplified in parallel; methods to increase the reproducibility of amplification efficiency; methods to reduce the contribution of targeting probe variability to amplification efficiency; methods to reduce the effect on a given target nucleic acid of polymorphisms in probe hybridization regions; and/or methods to simplify downstream workflows when multiplex amplification by MIPs is used as a preparative step for analysis by nucleic acid sequencing.
- Polymorphisms in the target nucleic acid under the regions flanking a target can interfere with hybridization, polymerase fill-in, and/or ligation. Furthermore, this may occur for only one allele, resulting in allelic drop-out, which ultimately decreases downstream sequencing accuracy.
- the probability of loss from polymorphism is substantially decreased because not all targeting arms in the set of MIPs will cover the location of the mutation.
- Probes for MIP capture reactions may be synthesized on programmable microarrays because of the large number of sequences required. Because of the low synthesis yields of these methods, a subsequent amplification step is required to produce sufficient probe for the MIP amplification reaction. The combination of multiplex oligonucleotide synthesis and pooled amplification results in uneven synthesis error rates and representational biases. By synthesizing multiple probes for each target, variation from these sources may be averaged out because not all probes for a given target will have the same error rates and biases.
- Multiplex amplification strategies disclosed herein may be used analytically, as in detection of SNPs, or preparatively, often for next-generation sequencing or other sequencing techniques.
- the output of an amplification reaction is generally the input to a shotgun library protocol, which then becomes the input to the sequencing platform.
- the shotgun library is necessary in part because next-generation sequencing yields reads significantly shorter than amplicons such as exons.
- tiling also obviates the need for shotgun library preparation. Since the length of the capture molecule can be specified when the probes, e.g., MIPs, are designed, it can be chosen to match the readlength of the sequencer. In this way, reads can 'walk' across an exon by virtue of the start position of each capture molecule in the probe set for that exon.
- aspects of the invention relate to preparative steps in DNA sequencing-related technologies that reduce bias and increase the reliability and accuracy of downstream quantitative applications.
- genomics assays that utilize next-generation (polony- based) sequencing to generate data, including genome resequencing, RNA-seq for gene expression, bisulphite sequencing for methylation, and Immune-seq, among others.
- next-generation sequencing including genome resequencing, RNA-seq for gene expression, bisulphite sequencing for methylation, and Immune-seq, among others.
- these methods utilize the counts of sequencing reads of a given genomic locus as a proxy for the representation of that sequence in the original sample of nucleic acids.
- the majority of these techniques require a preparative step to construct a high-complexity library of DNA molecules that is representative of a sample of interest.
- genomic sequencing library may contain an over- or under-representation of particular sequences from a source genome as a result of errors (bias) in the library construction process. Such bias can be particularly problematic when it results in target sequences from a genome being absent or undetectable in the sequencing libraries.
- bias errors
- an under- representation of particular allelic sequences e.g., heterozygotic alleles
- allelic sequences e.g., heterozygotic alleles
- sequencing library quantification techniques depend on stochastic counting processes, these problems have typically been addressed by sampling enough (over-sampling) to obtain a minimum number of observations necessary to make statistically significant decisions.
- the strategy of oversampling is generally limited to elimination of low-count Poisson noise, and the approach wastes resources and increases the expense required to perform such experiments.
- oversampling can result in a reduced statistical confidence in certain conclusions (e.g., diagnostic calls) based on the data. Accordingly, new approaches are needed for overcoming bias in sequencing library preparatory methods.
- aspects of the disclosure are based, in part, on the discovery of methods for overcoming problems associated with systematic and random errors (bias) in genome capture, amplification and sequencing methods, namely high variability in the capture and amplification of nucleic acids and disproportionate representation of heterozygous alleles in sequencing libraries. Accordingly, in some embodiments, the disclosure provides methods that reduce variability in the capture and amplification of nucleic acids. In other embodiments, the methods improve allelic representation in sequencing libraries and, thus, improve variant detection outcomes. In certain embodiments, the disclosure provides preparative methods for capturing target nucleic acids (e.g., genetic loci) that involve the use of differentiator tag sequences to uniquely tag individual nucleic acid molecules.
- target nucleic acids e.g., genetic loci
- the differentiator tag sequence permits the detection of bias based on the frequency with which pairs of differentiator tag and target sequences are observed in a sequencing reaction.
- the methods reduce errors caused by bias, or the risk of bias, associated with the capture, amplification and sequencing of genetic loci, e.g., for diagnostic purposes.
- aspects of the invention relate to associating unique sequence tags (referred to as differentiator tag sequences) with individual target molecules that are independently captured and/or analyzed (e.g., prior to amplification or other process that may introduce bias). These tags are useful to distinguish independent target molecules from each other thereby allowing an analysis to be based on a known number of individual target molecules. For example, if each of a plurality of target molecule sequences obtained in an assay is associated with a different differentiator tag, then the target sequences can be considered to be independent of each other and a genotype likelihood can be determined based on this information.
- unique sequence tags referred to as differentiator tag sequences
- each of the plurality of target molecule sequences obtained in the assay is associated with the same differentiator tag, then they probably all originated from the same target molecule due to over-representation (e.g., due to biased amplification) of this target molecule in the assay.
- This provides less information than the situation where each nucleic acid was associated with a different differentiator tag.
- a threshold number of independently isolated molecules e.g., unique combinations of differentiator tag and target sequences is analyzed to determine the genotype of a subject.
- the invention relates to compositions comprising pools (libraries) of preparative nucleic acids that each comprise "differentiator tag sequences" for detecting and reducing the effects of bias, and for genotyping target nucleic acid sequences.
- a "differentiator tag sequence” is a sequence of a nucleic acid (a preparative nucleic acid), which in the context of a plurality of different isolated nucleic acids, identifies a unique, independently isolated nucleic acid.
- differentiator tag sequences are used to identify the origin of a target nucleic acid at one or more stages of a nucleic acid preparative method.
- differentiator tag sequences provide a basis for differentiating between multiple independent, target nucleic acid capture events.
- differentiator tag sequences provide a basis for differentiating between multiple independent, primary amplicons of a target nucleic acid, for example.
- combinations of target nucleic acid and differentiator tag sequence (targetrdifferentiator tag sequences) of an isolated nucleic acid of a preparative method provide a basis for identifying unique, independently isolated target nucleic acids.
- FIG. 4A-C depict various non-limiting examples of methods for combining differentiator tag sequence and target sequences.
- differentiator tags may be synthesized using any one of a number of different methods known in the art. For example, differentiator tags may be synthesized by random nucleotide addition. Differentiator tag sequences are typically of a predefined length, which is selected to control the likelihood of producing unique target:differentiator tag sequences in a preparative reaction (e.g., amplification-based reaction, a circularization selection-based reaction, e.g., a MIP reaction).
- a preparative reaction e.g., amplification-based reaction, a circularization selection-based reaction, e.g., a MIP reaction.
- Differentiator tag sequences may be, up to 5, up to 6, up to 7 up to 8, up to 9, up to 10 , up to 1 1 , up to 12 , up to 13 , up to 14 , up to 15, up to 16, up to 17, up to 18, up to 19, up to 20, up to 21 , up to 22 , up to 23 , up to 24 , up to 25 , or more nucleotides in length.
- isolated nucleic acids are identified as independently isolated if they comprise unique combinations of target nucleic acid and differentiator tag sequences, and observance of threshold numbers of unique combinations of target nucleic acid and differentiator tag sequences provide a certain statistical confidence in the genotype.
- each nucleic acid molecule may be tagged with a unique differentiator tag sequence in a configuration that permits the differentiator tag sequence to be sequenced along with the target nucleic acid sequence of interest (the nucleic acid sequence for which the library is being prepared, e.g., a polymorphic sequence).
- the target nucleic acid sequence of interest the nucleic acid sequence for which the library is being prepared, e.g., a polymorphic sequence.
- the incorporation of the nucleic acid comprising a differentiator tag sequence at a particular step allows the detection and correction of biases in subsequent steps of the protocol.
- a large library of unique differentiator tag sequences may be created by using degenerate, random-sequence polynucleotides of defined length. The differentiator tag sequences of the polynucleotides may be read at the final stage of the sequencing.
- the observations of the differentiator tag sequences may be used to detect and correct biases in the final sequencing read-out of the library.
- the total possible number of differentiator tag sequences, which may be produced, e.g., randomly, is 4 N , where N is the length of the differentiator tag sequence.
- the length of the differentiator tag sequence may be adjusted such that the size of the population of MIPs having unique differentiator tag sequences is sufficient to produce a library of MIP capture products in which identical independent combinations of target nucleic acid and differentiator tag sequence are rare.
- combinations of target nucleic acid and differentiator tag sequences may also be referred to as "target:differentiator tag sequences".
- each read may have an additional unique differentiator tag sequence.
- all the unique differentiator tag sequences will be observed about an equal number of times. Accordingly, the number of occurrences of a differentiator tag sequence may follow a Poisson distribution.
- overrepresentation of target:differentiator tag sequences in a pool of preparative nucleic acids is indicative of bias in the preparative process (e.g., bias in the amplification process).
- target:differentiator tag sequence combinations that are statistically overrepresented are indicative of bias in the protocol at one or more steps between the incorporation of the differentiator tag sequences into MIPs and the actual sequencing of the MIP capture products.
- the number of reads of a given target:differentiator tag sequence may be indicative (may serve as a proxy) of the amount of that target sequence present in the originating sample.
- the numbers of occurrence of sequences in the originating sample is the quantity of interest.
- the occurrence of differentiator tag sequences in a pool of MIPs may be predetermined (e.g., may be the same for all differentiator tag sequences). Accordingly, changes in the occurrence of differentiator tag sequences after amplification and sequencing may be indicative of bias in the protocol. Bias may be corrected to provide an accurate representation of the composition of the original MIP pool, e.g., for diagnostic purposes.
- a library of preparative nucleic acid molecules may be constructed such that the number of nucleic acid molecules in the library is significantly larger than the number prospective target nucleic acid molecules to be captured using the library. This ensures that products of the preparative methods include only unique target:differentiator tag sequence; e.g., in a MIP reaction the capture step would undersample the total population of unique differentiator tag sequences in the MIP library. For example, an experiment utilizing 1 ⁇ g of genomic DNA will contain about -150,000 copies of a diploid genome.
- each MIP in the library comprising a randomly produced 12-mer differentiator tag sequence (-1.6 million possible unique differentiator tag sequences), there would be more than 100 unique differentiator tag sequences per genomic copy.
- each MIP in the library comprising a randomly produced 15-mer differentiator tag sequence (-1 billion possible unique differentiator tag sequences), there would be more than 7000 unique differentiator tag sequences per genomic copy. Therefore, the probability of the same differentiator tag sequence being incorporated multiple times is incredibly small.
- the length of the differentiator tag sequence is to be selected based on the amount of target sequence in a MIP capture reaction and the desired probability for having multiple, independent occurrences of target:differentiator tag sequence combinations.
- FIG. 5 depicts a non-limiting method for genotyping based on target and differentiator tag sequences. Sequencing reads of target and differentiator tags sequences are collapsed to make diploid genotype calls.
- FlG. 6 depicts non-limiting results of a simulation of a MlP capture reaction in which MIP probes, each having a differentiator tag sequence of 15 nucleotides, are combined with 10000 target sequence copies (e.g., genome equivalents).
- the probability of capturing one or more copies of a target sequence having the same differentiator tag sequence is 0.05.
- the Y axis reflects the number of observations.
- the X axis reflects the number of independent occurrences of target:differentiator tag combinations.
- FIG. 7 depicts a non-limiting graph of sequencing coverage, which can help ensure that alleles are sampled to sufficient depth (e.g., either 10x or 20x minimum sampling per allele, assuming 1000 targets).
- the X axis is total per-target coverage required
- the Y axis is the probability that a given total coverage will result in at least 10x or 2Ox coverage for each allele.
- adapters may be ligated onto the ends of the molecules of interest.
- Adapters often contain PCR primer sites (for amplification or emulsion PCR) and/or sequencing primer sites.
- barcodes may be included, for example, to uniquely identify individual samples (e.g., patient samples) that may be mixed together.
- nucleic acids comprising differentiator tag sequences may be incorporated by ligation. This is a flexible method, because molecules having differentiator tag sequence can be ligated to any blunt-ended nucleic acids.
- the sequencing primers must be incorporated subsequently such that they sequence both the differentiator tag sequence and the target sequence.
- the sequencing adaptors can be synthesized with the random differentiator tag sequences at their 3' end (as degenerate bases), so that only one ligation must be performed.
- Another method is to incorporate the differentiator tag sequence into a PCR primer, such that the primer structure is arranged with the common adaptor sequence followed by the random differentiator tag sequence followed by the PCR priming sequence (in 5' to 3' order).
- a differentiator tag sequence and adaptor sequence (which may contain the sequencing primer site) are incorporated as tags.
- Another method to incorporate the differentiator tag sequences is to synthesize them into a padlock probe prior to performing a gene capture reaction. The differentiator tag sequence is incorporated 3' to the targeting arm but 5' to the amplification primer that will be used downstream in the protocol.
- Another method to incorporate the differentiator tag sequences is as a tag on a gene-specific or poly-dT reverse-transcription primer. This allows the differentiator tag sequence to be incorporated directly at the cDNA level.
- the distribution of differentiator tag sequences can be assumed to be uniform. In this case, bias in any part of the protocol would change the uniformity of this distribution, which can be observed after sequencing. This allows the differentiator tag sequence to be used in any preparative process where the ultimate output is sequencing of many molecules in parallel.
- Differentiator tag sequences may be incorporated into probes (e.g., MIPs) of a plurality when they are synthesized on-chip in parallel, such that degeneracy of the incorporated nucleotides is sufficient to ensure near-uniform distribution in the plurality of probes.
- probes e.g., MIPs
- amplification of a pool of unique differentiator tag sequences may itself introduce bias in the initial pool.
- the scale of synthesis e.g., by column synthesis, chip based synthesis, etc.
- potential bias may be minimized.
- the differentiator tag sequences are used in genome re- sequencing. Considering that the raw accuracy of most next-generation sequencing instruments is relatively low, it is crucial to oversample the genomic loci of interest. Furthermore, since there are two alleles at every locus, it is important to sample enough to ensure that both alleles have been observed a sufficient number of times to determine with a sufficient degree of statistical confidence whether the sample is homozygous or heterozygous. Indeed, the sequencing is performed to sample the composition of molecules in the originating sample. However, after multiple reads have been collected for a given locus, it is possible that due to bias (e.g., caused by PCR amplification steps), a large fraction of the reads are derived from a single originating molecule.
- bias e.g., caused by PCR amplification steps
- the disclosure provides methods for analyzing a plurality of target sequences which are genetic loci or portions of genetic loci (e.g., a genetic locus of Table 1).
- the genetic loci may be analyzed by sequencing to obtain a genotype at one or more polymorphisms (e.g., SNPs).
- Exemplary polymorphisms are disclosed in Table 2.
- SNPs polymorphisms
- Exemplary polymorphisms are disclosed in Table 2.
- Other polymorphisms are known in the art and may be identified, for example, by querying the Entrez Single Nucleotide Polymorphism database, for example, by searching with a GeneID from Table 1.
- the mutations listed in Table 2 are documented polymorphisms in several disease-associated genes (CFTR is mutated in cystic fibrosis, GBA is mutated in Gaucher disease, ASPA is mutated in Canavan disease, HEXA is mutated in Tay Sachs disease).
- the polymorphisms are of several types: insertion/deletion polymorphisms which will cause frameshifts (and thus generally interrupt protein function) unless the insertion/deletion length is a multiple of 3bp, and substitutions which can alter the amino acid sequence of the protein and in some cases cause complete inactivation by introduction of a stop codon.
- aspects of the invention relate to methods for detecting nucleic acid deletions or insertions in regions containing nucleic acid sequence repeats.
- Genomic regions that contain nucleic acid sequence repeats are often the site of genetic instability due to the amplification or contraction of the number of sequence repeats (e.g., the insertion or deletion of one or more units of the repeated sequence). Instability in the length of genomic regions that contain high numbers of repeat sequences has been associated with a number of hereditary and non hereditary diseases and conditions.
- Fragile X syndrome is a genetic syndrome which results in a spectrum of characteristic physical, intellectual, emotional and behavioral features which range from severe to mild in manifestation.
- the syndrome is associated with the expansion of a single trinucleotide gene sequence (CGG) on the X chromosome, and results in a failure to express the FMR-I protein which is required for normal neural development.
- CGG trinucleotide gene sequence
- Fragile X syndrome which relate to the length of the repeated CGG sequence; Normal (29-31 CGG repeats), Premutation (55-200 CGG repeats), Full Mutation (more than 200 CGG repeats), and Intermediate or Gray Zone Alleles (40 - 60 repeats).
- cancer which has been associated with microsatellite instability (MSI) involving an increase or decrease in the genomic copy number of nucleic acid repeats at one or more microsatellite loci (e.g., BAT-25 and/or BAT-26).
- MSI microsatellite instability
- sequencing-based assays for determining the number of nucleic acid sequence repeats at a particular locus and identifying the presence of nucleic acid insertions or deletions.
- such techniques are not useful in a high throughput multiplex analysis where the entire length of a region may not be sequenced.
- aspects of the invention relate to detecting the presence of an insertion or deletion at a genomic locus without requiring the locus to be sequenced (or without requiring the entire locus to be sequenced). Aspects of the invention are particularly useful for detecting an insertion or deletion in a nucleic acid region that contains high levels of sequence repeats.
- the presence of sequence repeats at a genetic locus is often associated with relatively high levels of polymorphism in a population due to insertions or deletions of one or more of the sequence repeats at the locus.
- the polymorphisms can be associated with diseases or predisposition to diseases (e.g., certain polymorphic alleles are recessive alleles associated with a disease or condition).
- the presence of sequence repeats often complicates the analysis of a genetic locus and increases the risk of errors when using sequencing techniques to determine the precise sequence and number of repeats at that locus.
- aspects of the invention relate to determining the size of a genetic locus by evaluating the capture frequency of a portion of that locus suspected of containing an insertion or deletion (e.g., due to the presence of sequence repeats) using a nucleic acid capture technique (e.g., a nucleic acid sequence capture technique based on molecular inversion probe technology).
- a nucleic acid capture technique e.g., a nucleic acid sequence capture technique based on molecular inversion probe technology.
- a statistically significant difference in capture efficiency for a genetic locus of interest in different biological samples is indicative of different relative lengths in those samples. It should be appreciated that the length differences may be at one or both alleles of the genetic locus.
- aspects of the invention may be used to identify polymorphisms regardless of whether biological samples being interrogated at heterozygous or homozygous for the polymorphisms.
- subjects that contain one or more loci with an insertion or deletion can be identified by analyzing capture efficiencies for nucleic acids obtained from one or more biological samples using appropriate controls (e.g., capture efficiencies for known nucleic acid sizes, capture efficiencies for other regions that are not suspected of containing an insertion or deletion in the biological sample(s), or predetermined reference capture efficiencies, or any combination thereof.
- appropriate controls e.g., capture efficiencies for known nucleic acid sizes, capture efficiencies for other regions that are not suspected of containing an insertion or deletion in the biological sample(s), or predetermined reference capture efficiencies, or any combination thereof.
- aspects of the invention are not limited by the nature or presence of the control.
- a subject may be identified as being at risk for a disease or condition associated with insertions or deletions at that genetic locus.
- the subject may be analyzed in greater detail in order to determine the precise nature of the insertion or deletion and whether the subject is heterozygous or homozygous for one or more insertions or deletions.
- gel electrophoresis of an amplification (e.g., PCR) product of the locus, or Southern blotting, or any combination thereof can be used as an orthogonal approach to verify the length of the locus.
- a more exhaustive and detailed sequence analysis of the locus can be performed to identify the number and types of insertions and deletions.
- aspects of the invention relate to detecting abnormal nucleic acid lengths in genomic regions of interest.
- the invention aims to estimate the size of genomic regions that are hard to be accessed, such as repetitive elements.
- methods of the invention do not require that the precise length be estimated.
- it is sufficient to determine that one or more alleles with abnormal lengths are present at a locus of interest e.g., based on the detection of abnormal capture efficiencies).
- fragile X can be used to illustrate aspects of the invention where the size of trinucleotide repeats (genotype) is linked to a symptom (phenotype).
- phenotype a symptom
- fragile X is a non-limiting example and similar analyses may be performed for other genetic loci (e.g., independently or simultaneously in multiplex analyses).
- MIPs molecular inversion probes
- aspects of the invention are based on the recognition that the effect of length on probe capturing efficiency can be used in the context of an assay (e.g., a high throughput and/or multiplex assay) to allow the length of sequences to be determined without requiring sequencing of the entire region being evaluated. This is particularly useful for repeat regions that are prone to changes in size. As illustrated in FIG. 8, which is reproduced from Deng et al., Nature Biotech. 27:353-60, (see
- Supplemental Fig. IG of Deng et al. illustrates that shorter sequences are captured with higher efficiency that longer sequences using MIPs.
- the statistical package R and its effects module were used for this analysis.
- a linear model was used, and each individual factor was assumed to be independent.
- the dashed lines represent a 95% confidence interval. Shorter target sequences were captured with higher efficiency than long target sequences (p ⁇ 2x10 16 ). However, the use of this differential capture efficiency for systematic sequence length analysis was not previously recognized.
- polymerase fill-in and ligation reactions are performed to convert the hybridized probe to a covalently-closed, circular molecule containing the desired target.
- PCR or rolling circle amplification plus exonuclease digestion of non-circularized material is performed to isolate and amplify the circular targets from the starting nucleic acid pool. Since one of the main benefits of the method is the potential for a high degree of multiplexing, generally thousands of targets are captured in a single reaction containing thousands of probes.
- repetitive regions are surrounded by non- repetitive unique sequences, which can be used to amplify the repeat-containing regions using, for example, PCR or padlock (M ⁇ P)-based method.
- a probe e.g., a MIP or padlock probe
- a probe can be designed to include at least a sequence that is sufficient to be uniquely identified in the genome (or target pool). After the probe is circularized and amplified, the amplicon can be end-sequenced so that the unique sequence can be identified and served as the "representative" of the repetitive region as illustrated in FIG. 9.
- FIG. 9 illustrates a non- limiting scheme of padlock (MIP) capture of a region that includes both repetitive regions (thick wavy line) and the adjacent unique sequence (thick strait line).
- the regions of the probe are indicated with the targeting arms shown as regions " 1" and "3.”
- An intervening region that may be, or include, a sequencing primer binding site is shown as "2.”
- the padlock After the padlock is circularized and amplified, it can be end-sequenced to obtain the sequence of the unique sequence, which represents the repetitive region of interest.
- capturing efficiency is overall negatively correlated with target length, different probe sequences may have unique features. Therefore, multiple probes could be designed and tested so that an optimal one is chosen to be sensitive enough to differentiate repetitive sizes of roughly 0-150bp, 150-600bp, and beyond, which represent normal, premutation and full mutation of fragile X syndrome, respectively.
- probe sizes and sequences can be designed, and optionally optimized, to distinguish a range of repeat region size differences (e.g., length differences of about 3-30 bases, about 30-60 bases, about 60-90 bases, about 90- 120 bases, about 120-150 bases, about 150-300 bases, about 300-600 bases, about 600- 900 bases, or any intermediate or longer length difference). It should be appreciated that a length difference may be an increase in size or a decrease in size.
- an initial determination of an unexpected capture frequency is indicative of the presence of size difference.
- an increase in capture frequency is indicative of a deletion.
- a decrease in capture frequency is indicative of an insertion.
- a change in capture frequency can be associated with either an increase or decrease in target region length. In some embodiments, the precise nature of the change can be determined using one or more additional techniques as described herein.
- a MIP probe includes a linear nucleic acid strand that contains two hybridization sequences or targeting arms, one at each end of the linear probe, wherein each of the hybridization sequences is complementary to a separate sequence on a the same strand of a target nucleic acid, and wherein these sequences on the target nucleic acid flank the two ends of the target nucleic acid sequence of interest. It should be appreciated that upon hybridization, the two ends of the probe are inverted with respect to each other in the sense that both 5' and 3' ends of the probe hybridize to the same strand to separate regions flanking the target region (as illustrated in FIG. 9 for example).
- the hybridization sequences are between about 10-100 nucleotides long, for example between about 10-30, about 30-60, about 60-90, or about 20, about 30, about 40, or about 50 nucleotides long. However, other lengths may be used depending on the application.
- the hybridization Tms of both targeting arms of a probe are designed or selected to be similar.
- the hybridization Tms of the targeting arms of a plurality of probes designed to capture different target regions are selected or designed to be similar so that they can be used together in a multiplex reaction. Accordingly, a typical size of a MIP probe prior to fill- in is about 60-80 nucleotides long.
- MIP probes are designed to avoid sequence-dependent secondary structures.
- MIP probes are designed such that the targeting arms do not overlap with known polymorphic regions.
- targeting arms that can be used for capturing the repeat region of the Fragile X locus can have the following sequences or complementary to these sequences depending on the strand that is captured. left: CTCCGTTTCGGTTTCACTTC (SEQ ID NO: 181) right: ATCTTCTCTTCAGCCCTGCT (SEQ ID NO: 182)
- the typical captured size using these targeting arms is about 100 nucleotides in length (e.g., about 30 repeats of a tri-nucleotide repeat).
- the number of reads obtained for the "representative" of the repetitive region is not informative to estimate the target length because it is dependent on the total number of reads obtained. To overcome this, it is useful to include one or more probes that target other "control" regions where no or minimal polymorphism exists among populations. Because of the systematic consistency of capturing efficiency (see, e.g., FIG. 9), the ratio of reads obtained for the repetitive "representative" to reads obtained for the control region(s) will be tuned using DNA with defined numbers of repeats. Ultimately, the ratio can serve as a measure of the repeat length as illustrated in FIG. 10. FIG.
- the whole repetitive region can be sequenced by making a shotgun library (e.g., by making a shotgun library from a captured sequence, for example a sequence captured using a MIP probe).
- a shotgun library e.g., by making a shotgun library from a captured sequence, for example a sequence captured using a MIP probe.
- the expectation is that the number of reads from any given repeat will be a direct function of the number of repeats present.
- a Poisson sampling- induced spread may need to be considered and in some embodiments may be sufficiently large to limit the resolution.
- FIG. 1 IA-C shows the approach. For a given locus, MIPs are synthesized to contain one of a large number differentiator tags in their backbone such that the probability of any two MIPs in a reaction having the same differentiator tag sequence is low.
- the number of each differentiator tag sequence is counted, for example, by next-generation sequencing.
- next-generation sequencing When number of occurrences is plotted against differentiator tag ID, the data will naturally cluster into two groups reflecting the lengths of the two alleles in the diploid sample. The allele lengths can therefore be read directly off this graph, after absolute length calibration using known standards.
- a sequencing technique e.g., a next-generation sequencing technique
- the sequences are used to count the number of different barcodes that are present.
- aspects of the invention relate to a highly-multiplexed qPCR reaction.
- loci at which insertions or deletions or repeat sequences may be associated with a disease or condition are provided in Tables 3 and 4. It should be appreciated that the presence of an abnormal length at any one or more of these loci may be evaluated according to aspects of the invention. In some embodiments, two or more of these loci or other loci may be evaluated in a single multiplex reaction using different probes designed to hybridize under the same reaction conditions to different target nucleic acid in a biological sample.
- aspects of the invention relate to methods for increasing the sensitivity of nucleic acid detection assays.
- genomic assays that utilize next-generation (e.g., polony-based) sequencing to generate data, including genome resequencing, RNA-seq for gene expression, bisulphite sequencing for methylation, and Immune-seq, among others.
- next-generation sequencing e.g., polony-based sequencing to generate data
- genome resequencing RNA-seq for gene expression
- bisulphite sequencing for methylation bisulphite sequencing for methylation
- Immune-seq among others.
- these methods utilize the counts of sequencing reads of a given genomic locus as a proxy for the representation of that sequence in the original sample of nucleic acids.
- the majority of these techniques require a preparative step to construct a high-complexity library of DNA molecules that is representative of a sample of interest.
- nucleic acid preparative techniques e.g., amplification, for example PCR-based amplification; sequence-specific capture, for example, using immobilized capture probes; or target capture into a circularized probe followed by a sequence analysis step.
- amplification for example PCR-based amplification
- sequence-specific capture for example, using immobilized capture probes
- target capture into a circularized probe followed by a sequence analysis step.
- current methods involve oversampling a target nucleic acid preparation in order to increase the likelihood that all sequences that are present in the original nucleic acid sample will be represented in the final sequence data.
- a genomic sequencing library may contain an over- or under-representation of particular sequences from a source nucleic acid sample (e.g., genome preparation) as a result of stochastic variations in the library construction process.
- a source nucleic acid sample e.g., genome preparation
- Such variations can be particularly problematic when they result in target sequences from a genome being absent or undetectable in a sequencing library.
- an under-representation of particular allelic sequences e.g., heterozygotic alleles
- an apparent homozygous representation in a sequencing library can result in an apparent homozygous representation in a sequencing library.
- aspects of the invention relate to basing a nucleic acid sequence analysis on results from two or more different nucleic acid preparatory techniques that have different systematic biases in the types of nucleic acids that they sample rather than simply oversampling the target nucleic acid.
- different techniques have different sequence biases that are systematic and not simply due to stochastic effects during nucleic acid capture or amplification.
- the degree of oversampling required to overcome variations in nucleic acid preparation needs to be sufficient to overcome the biases.
- the invention provides methods that reduce the need for oversampling by combining nucleic acid and/or sequence results obtained from two or more different nucleic acid preparative techniques that have different biases.
- different techniques have different characteristic or systematic biases. For example, one technique may bias a sample analysis towards one particular allele at a genetic locus of interest, whereas a different technique would bias the sample analysis towards a different allele at the same locus. Accordingly, the same sample may be identified as being different depending on the type of technique that is used to prepare nucleic acid for sequence analysis. This effectively represents a sensitivity issue, because each technique has a different relative sensitivities for polymorphic sequences of interest.
- the sensitivity of a nucleic acid analysis can be increased by combining the sequences from different nucleic acid preparative steps and using the combined sequence information for a diagnostic assay (e.g., for a making a call as to whether a subject is homozygous or heterozygous at a genetic locus of interest).
- a diagnostic assay e.g., for a making a call as to whether a subject is homozygous or heterozygous at a genetic locus of interest.
- the ability of DNA sequencing to detect mutations is limited by the ability of the upstream sample isolation (e.g., by amplification, immobilization enrichment, circularization capture, etc.) methods to reliably isolate the locus of interest. If one wishes to make heterozygote base-calls for a diploid genome (e.g. a human sample presented for molecular diagnostic sequencing), it is important in some embodiments that the isolation method produces near- or perfectly- uniform amounts of the two alleles to be sequenced (at least sufficiently uniform to be "called” unambiguously as a heterozygote or a homozygote for a locus of interest).
- Sample preparative methods may fall into three classes: 1 ) single- or several- target amplification (e.g., uniplex PCR, 'multiplex' PCR), 2) multi-target hybridization enrichment (e.g., Agilent SureSelect 'hybrid capture' [Gnirke et al 2009, Nature methods 27: 182-9], Roche/Nimblegen 'sequence capture' [Hodges et al 2007, Nature genetics 39: 1522-7], and 3) multi-target circularization selection (e.g. molecular inversion probes or padlock probes, [Porreca et al 2007, Nature methods 4:931 -6, Turner et al 2009,
- a skewed ratio is a particular issue that decreases the sensitivity of detecting mutations present in a heterogeneous tumor tissue. For example, if only 10% of the cells analyzed in a heterogeneous sample harbored a heterozygous mutation, the mutation would be expected to be present in 5% of sequence reads, not 50%. In this scenario, the need for robust, sensitive detection may be even more acute.
- the methods disclosed herein are based, in part, on the discovery that certain classes of isolation methods have different modes of bias.
- the disclosure provide methods for increasing the sensitivity of the downstream sequencing by using a combination of multiple isolation methods (e.g., one or more from at least two of the classes disclosed herein) for a sample. This is particularly important in molecular diagnostics where high sensitivity is required to minimize the chances of 'missing' a disease-associated mutation. For example, given a nominal false-negative error rate of IxIO '3 for sequencing following circularization selection, and a false-negative error rate of 1x10 "3 for sequencing following hybridization enrichment, one can achieve a final false-negative rate of 1x10 6 by performing both techniques on the sample (assuming failures in each method are fully independent).
- the number of missed carrier diagnoses would decrease from 1000 per million patients tested to 1 per million patients tested. Furthermore, if the testing was used in the context of prenatal carrier screening, the number of affected children born as a result of missing the carrier call in one parent would decrease from 25 per million to 25 per billion born.
- the disclosure provides combinations of preparative methods to effectively increase sequencing coverage in regions containing disease-associated alleles. Since heterozygote error rate is largely tied to both deviations from 50:50 allele representation, and in the case of next-generation DNA sequencing deviations from average abundance (such that less abundant isolated targets are more likely to be undersampled at one or both alleles), selectively increasing coverage in these regions will also selectively increase sensitivity. Furthermore, MIPs that detect presence or absence of specific known disease-associated mutations can be used to increase sensitivity selectively. In some embodiments, these MIPs would have a targeting arm whose 3' -most region is complementary to the expected mutation, and has a fill-in length of 0 or more bp. Thus, the MIP will form only if the mutation is present, and its presence will be detected by sequencing.
- algorithms disclosed herein may be used to determine base identity with varying levels of stringency depending on whether the given position has any known disease-associated alleles. Stringency can be reduced in such positions by decreasing the minimum number of observed mutant reads necessary to make a consensus base-call. This will effectively increase sensitivity for mutant allele detection at the cost of decreased specificity.
- An embodiment of the invention combines MIPs plus hybridization enrichment, plus optionally extra MIPs targeted to specific known, common disease-associated loci, e.g., to detect the presence of a polymorphism in a target nucleic acid.
- FIG. 12 illustrates a schematic using MIPs plus hybridization enrichment, plus optionally extra MIPs targeted to specific known, common disease-associated loci, e.g., to detect the presence of a polymorphism in a target nucleic acid.
- FIGs. 13 and 14 illustrate different capture efficiencies for MIP-based captures.
- FIG. 13 shows a graph of per-target abundance with MIP capture.
- bias largely drives the heterozygote error rate, since targets which are less abundant here are less likely to be covered in sufficient depth during sequencing to adequately sample both alleles. This is from Turner et al 2009, Nature methods 6:315-6.
- Hybridization enrichment results in a qualitatively similar abundance distribution, but the abundance of a given target is likely not correlated between the two methods.
- biases can be detected or overcome by systematically combining different capture and/or analytical techniques in an assay that interrogates a plurality of loci in a plurality of subject samples.
- aspects of the invention involve preparing genomic nucleic acid and/or contacting them with one or more different probes (e.g., capture probes, hybridization probes, MIPs, others etc.).
- the amount of genomic nucleic acid used per subject ranges from 1 ng to 10 micrograms (e.g., 500 ng to 5 micrograms). However, higher or lower amounts (e.g., less than 1 ng, more than 10 micrograms, 10-50 micrograms, 50-100 micrograms or more) may be used.
- the amount of probe used per assay may be optimized for a particular application.
- the ratio (molar ratio, for example measured as a concentration ratio) of probe to genome equivalent (e.g., haploid or diploid genome equivalent, for example for each allele or for both alleles of a nucleic acid target or locus of interest) ranges from 1/100, 1/10, 1/1 , 10/1 , 100/1 , 1000/1. However, lower, higher, or intermediate ratios may be used.
- the amount of target nucleic acid and probe used for each reaction is normalized to avoid any observed differences being caused by differences in concentrations or ratios.
- the genomic DNA concentration is read using a standard spectrophotometer or by fluorescence (e.g., using a fluorescent intercalating dye). The probe concentration may be determined experimentally or using information specified by the probe manufacturer.
- a locus e.g., on a MIP or other probe or in another form
- the amount of primer added for each reaction can range from 0.1 pmol to 1 nmol, 0.15 pmol to 1.5 nmol (for example around 1.5 pmol). However, other amounts (e.g., lower, higher, or intermediate amounts) may be used.
- one or more intervening sequences e.g., sequence between the first and second targeting arms on a MIP capture probe
- identifier or tag sequences e.g., a target sequence
- other probe sequences e.g., other probe sequences that may be in a biological sample.
- these sequences may be designed have a sufficient number of mismatches with any genomic sequence (e.g., at least 5, 10, 15, or more mismatches out of 30 bases) or as having a Tm (e.g., a mismatch Tm) that is lower (e.g., at least 5, 10, 15, 20, or more degrees C lower) than the hybridization reaction temperature.
- a targeting arm as used herein may be designed to hybridize (e.g., be complementary) to either strand of a genetic locus of interest if the nucleic acid being analyzed is DNA (e.g., genomic DNA).
- DNA e.g., genomic DNA
- a targeting arm should be designed to hybridize to the transcribed RNA.
- MIP probes referred to herein as "capturing" a target sequence are actually capturing it by template-based synthesis rather than by capturing the actual target molecule (other than for example in the initial stage when the arms hybridize to it or in the sense that the target molecule can remain bound to the extended MIP product until it is denatured or otherwise removed).
- a targeting arm may include a sequence that is complementary to one allele or mutation (e.g., a SNP or other polymorphism, a mutation, etc.) so that the probe will preferentially hybridize (and capture) target nucleic acids having that allele or mutation.
- each targeting arm is designed to hybridize (e.g., be complementary) to a sequence that is not polymorphic in the subjects of a population that is being evaluated. This allows target sequences to be captured and/or sequenced for all all alleles and then the differences between subjects (e.g., calls of heterozygous or homozygous for one or more loci) can be based on the sequence information and/or the frequency as described herein.
- sequence tags also referred to as barcodes
- sequence tags may be designed to be unique in that they do not appear at other positions within a probe or a family of probes and they also do not appear within the sequences being targeted. Thus they can be used to uniquely identify (e.g., by sequencing or hybridization properties) particular probes having other characteristics (e.g., for particular subjects and/or for particular loci).
- probes or regions of probes or other nucleic acids are described herein as comprising or including certain sequences or sequence characteristics (e.g., length, other properties, etc.). However, it should be appreciated that in some embodiments, any of the probes or regions of probes or other nucleic acids consist of those regions (e.g., arms, central regions, tags, primer sites, etc., or any combination thereof) of consist of those sequences or have sequences with characteristics that consist of one or more characteristics (e.g., length, or other properties, etc.) as described herein in the context of any of the embodiments (e.g., for tiled or staggered probes, tagged probes, length detection, sensitivity enhancing algorithms or any combination thereof).
- nucleic acid refers to multiple linked nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to an exchangeable organic base, which is either a pyrimidine (e.g., cytosine (C), thymidine (T) or uracil (U)) or a purine (e.g., adenine (A) or guanine (G)).
- a pyrimidine e.g., cytosine (C), thymidine (T) or uracil (U)
- purine e.g., adenine (A) or guanine (G)
- Nucleic acid and “nucleic acid molecule” may be used interchangeably and refer to oligoribonucleotides as well as oligodeoxyribonucleotides.
- the terms shall also include polynucleosides (i.e., a polynucleotide minus a phosphate) and any other organic base containing nucleic acid.
- the organic bases include adenine, uracil, guanine, thymine, cytosine and inosine.
- nucleic acids may be single or double stranded.
- the nucleic acid may be naturally or non-naturally occurring.
- Nucleic acids can be obtained from natural sources, or can be synthesized using a nucleic acid synthesizer (i.e., synthetic). Harvest and isolation of nucleic acids are routinely performed in the art and suitable methods can be found in standard molecular biology textbooks. (See, for example, Maniatis' Handbook of Molecular Biology.)
- the nucleic acid may be DNA or RNA, such as genomic DNA, mitochondrial DNA, mRNA, cDNA, rRNA, miRNA, or a combination thereof.
- Non-naturally occurring nucleic acids such as bacterial artificial chromosomes (BACs) and yeast artificial chromosomes (YACs) can also be used.
- nucleic acid derivatives As will be described herein, the use of certain nucleic acid derivatives may increase the stability of the nucleic acids of the invention by preventing their digestion, particularly when they are exposed to biological samples that may contain nucleases.
- a nucleic acid derivative is a non-naturally occurring nucleic acid or a unit thereof. Nucleic acid derivatives may contain non-naturally occurring elements such as non-naturally occurring nucleotides and non-naturally occurring backbone linkages.
- Nucleic acid derivatives may contain backbone modifications such as but not limited to phosphorothioate linkages, phosphodiester modified nucleic acids, phosphorothiolate modifications, combinations of phosphodiester and phosphorothioate nucleic acid, methylphosphonate, alkylphosphonates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, carbonates, phosphate triesters, acetamidates, carboxymethyl esters, methylphosphorothioate, phosphorodithioate, p- ethoxy, and combinations thereof.
- the backbone composition of the nucleic acids may be homogeneous or heterogeneous.
- Nucleic acid derivatives may contain substitutions or modifications in the sugars and/or bases. For example, they include nucleic acids having backbone sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position (e.g., an 2'-O- alkylated ribose group). Nucleic acid derivatives may include non-ribose sugars such as arabinose.
- Nucleic acid derivatives may contain substituted purines and pyrimidines such as C-5 propyne modified bases, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, 2-thiouracil and pseudoisocytosine.
- substitution(s) may include one or more substitutions/modifications in the sugars/bases, groups attached to the base, including biotin, fluorescent groups (fluorescein, cyanine, rhodamine, etc), chemically-reactive groups including carboxyl, NHS, thiol, etc., or any combination thereof.
- a nucleic acid may be a peptide nucleic acid (PNA), locked nucleic acid (LNA), DNA, RNA, or co-nucleic acids of the same such as DNA-LNA co-nucleic acids.
- PNA are DNA analogs having their phosphate backbone replaced with 2-aminoethyl glycine residues linked to nucleotide bases through glycine amino nitrogen and methylenecarbonyl linkers.
- PNA can bind to both DNA and RNA targets by Watson- Crick base pairing, and in so doing form stronger hybrids than would be possible with DNA or RNA based oligonucleotides in some cases.
- PNA are synthesized from monomers connected by a peptide bond (Nielsen, P. E. et al. Peptide Nucleic Acids, Protocols and Applications, Norfolk: Horizon Scientific Press, p. 1-19 (1999)). They can be built with standard solid phase peptide synthesis technology. PNA chemistry and synthesis allows for inclusion of amino acids and polypeptide sequences in the PNA design. For example, lysine residues can be used to introduce positive charges in the PNA backbone. All chemical approaches available for the modifications of amino acid side chains are directly applicable to PNA. Several types of PNA designs exist, and these include single strand PNA (ssPNA), bisPNA and pseudocomplementary PNA (pcPNA).
- ssPNA single strand PNA
- pcPNA pseudocomplementary PNA
- ssPNA binds to single stranded DNA (ssDNA) preferably in antiparallel orientation (i.e., with the N-terminus of the ssPNA aligned with the 3' terminus of the ssDNA) and with a Watson-Crick pairing.
- PNA also can bind to DNA with a Hoogsteen base pairing, and thereby forms triplexes with double stranded DNA (dsDNA) (Wittung, P. et al., Biochemistry 36:7973 (1997)).
- LNA locked nucleic acid
- An LNA form hybrids with DNA, which are at least as stable as PNA/DNA hybrids (Braasch, D.A. et al., Chem & Biol. 8(1): 1-7(2001)). Therefore, LNA can be used just as PNA molecules would be. LNA binding efficiency can be increased in some embodiments by adding positive charges to it. LNAs have been reported to have increased binding affinity inherently.
- Example 1 Design a set of capture probes for a human target exon
- All targets are captured as a set of partially-overlapping subtargets.
- a 200 bp target exon might be captured as a set of 12 subtargets, each 60bp in length (FIG. 1).
- Each subtarget is chosen such that it partially overlaps two or three other targets.
- all probes are composed of three regions: 1 ) a 20 bp 'targeting arm' comprised of sequence which hybridizes immediately upstream from the sub-target, 2) a 30 bp 'constant region' comprised of sequence used as a pair of amplification priming sites, and 3) a second 20 bp 'targeting arm' comprised of sequence which hybridizes immediately downstream from the sub-target.
- Targeting arm sequences will be different for each capture probe in a set, while constant region sequence will be the same for all probes in the set, allowing all captured targets to be amplified with a single set of primers.
- Targeting arm sequences should be designed such that any given pair of 20 bp sequences is unique in the target genome (to prevent spurious capture of undesired sites). Additionally, melting temperatures should be matched for all probes in the set such that hybridization efficiency is uniform for all probes at a constant temperature (e.g., 60 C). Targeting arm sequences should be computationally screened to ensure they do not form strong secondary structure that would impair their ability to basepair with the genomic target.
- DNA should be sheared into fragments several hundred basepairs in length.
- Ligate adapters required for amplification by the sequencing platform used. If necessary, purify ligated product from unligated product and adapters.
- Example 2 Use of differentiator tag sequences to detect and correct bias in a MIP-capture reaction of a set of exon targets
- the first step in performing the detection/correction is to determine how many differentiator tag sequences are necessary for the given sample.
- 1000 genomic targets corresponding to 1000 exons were captured. Since the differentiator tag sequence is part of the probe, it will measure/report biases that occur from the earliest protocol steps. Also, being located in the backbone, the differentiator tag sequence can easily be sequenced from a separate priming site, and therefore not impact the total achievable read-length for the target sequence.
- MIP probes are synthesized using standard column-based oligonucleotide synthesis by any number of vendors (e.g. IDT), and differentiator tag sequences are introduced as 'degenerate' positions in the backbone. Each degenerate position increases the total number of differentiator tag sequences synthesized by a factor of 4, so a 10 nt degenerate region implies a differentiator tag sequence complexity of ⁇ le6 species.
- DNA should be sheared into fragments several hundred basepairs in lenth.
- Ligate adapters required for amplification by the sequencing platform used. If necessary, purify ligated product from unligated product and adapters. Perform sequencing of library according to manufacturer 's directions (e.g. Illumina,ABI, etc), reading both the target sequence and the differentiator tag sequence.
- FIG. 5 depicts a method for making diploid genotype calls in which repeat targetidifferentiator tag combination are collapsed.
- the number of differentiator tag sequences necessary to be confident (within some statistical bounds) that a certain differentiator tag sequence will not be observed more than once by chance in combination with a certain target sequence was determined.
- the total number of unique differentiator tag sequences for a certain differentiator tag sequence length is determined as 4 (Le n gth m nu ci e ot r fes of the d , f r e r e n t , ato r t a g sequence)
- N is the total number of possible unique differentiator tag sequences and M is the number of target sequence copies in the capture reaction.
- a MIP capture reaction in which MIP probes, each having a differentiator tag sequence of 15 nucleotides, are combined with 10000 target sequence copies (e.g., genome equivalents), the probability of capturing one or more copies of a target sequence having the same differentiator tag sequence is 0.05.
- the MIP reaction will produce very few (usually 0, but occasionally 1 or more) targets where multiple copies are tagged with the same differentiator tag sequence.
- FIG. 6 depicts results of a simulation for 100000 capture reactions having 15 nucleotide differentiator tag sequences and 10000 target sequences.
- Example 4 Assessment of the probability for obtaining enough sequencing reads to make accurate base-calls at multiple independent loci, as a function of sequencing coverage.
- Monte Carlo simulations were performed to determine sequencing coverage requirements.
- the simulations assume 10000 genomic copies of a given locus (target) half mom alleles and half dad alleles.
- the simulations further assume 1% efficiency of capture for the MIP reaction.
- the simulation samples from a capture mix 100 times without replacement to create a set of 100 capture products.
- the simulation samples from the set of 100 capture products with replacement (assuming unbiased amplification) to generate 'reads' from either mom or dad.
- the number of reads sampled depends on the coverage.
- the number of independent reads from both mom and dad necessary to make a high-quality base-call (assumed to be 10 or 20 reads) were then determined.
- At least three sets of control loci are captured in parallel that have a priori been shown to serve as proxies for various lengths of target locus. For example, if the target locus is expected to have a length between 50 and 1000 bp, then sets of control loci having lengths of 50, 250, and 1000 bp could be captured (e.g. 20 loci per set should provide adequate protection from outliers), and their abundance digitally measured by sequencing. These loci should be chosen such that minimal variation in efficiency between samples and on multiple runs of the same sample is observed (and are therefore 'efficiency invariant'). These will serve as 'reference' points that define the shape of the curve of abundance-vs-length. Determining the length of the target is then simply a matter of 'reading' the length from the appropriate point on the calibration curve.
- the statistical confidence one has in the estimate of target length from this method is driven largely by three factors: 1) reproducibility / variation of the abundance data used to generate the calibration curve; 2) goodness of fit of the regression to the 'control' datapoints; 3) reproducibility of abundance data for the target locus being measured.
- Statistical bounds on 1) and 2) will be known in advance, having been measured during development of the assay. Additionally, statistical bounds on 3) will be known in general in advance, since assay development should include adequate population sampling and measure of technical reproducibility. Standard statistical methods should be used to combine these three measures into a single P value for any given experimental measure of target abundance.
- the regression can be used to predict the length value for n observations of the target locus whose length is unknown.
- the predicted response value, computed when n observations is substituted into the equation for the regressed line, will have arbitrary precision.
- the confidence interval for a predicted response is calculated as:
- the confidence interval for the predicted value is given by y ⁇ _ t $y , where ⁇ is the fitted value corresponding to x .
- the value t is the upper (1 - C) /2 critical value for the t(n - 2) distribution.
- a technique for analyzing a locus of interest can involve the following steps.
- Example 6 MIP-capture reaction of a set of exon target nucleic acids MEP probes are synthesized using standard column-based oligonucleotide synthesis by any number of vendors (e.g. IDT).
- Hybridize capture probes to human genomic sample Assemble hybridization reaction • l .O ul capture probe mix (-2.5 pmol)
- DNA should be sheared into fragments several hundred basepairs in length.
- Ligate adapters required for amplification by the sequencing platform used If necessary, purify ligated product from unligated product and adapters. Perform sequencing of library according to manufacturer 's directions (e.g.
- Example 7 Use of MIPs, hybridization, and mutation-detection MIPs to genotype a set of 1000 targets
- MIPs, hybridization, and mutation-detection MIPs are used to genotype a set of 1000 targets.
- the protocol permits detection of any of 50 specific known point mutations
- MIP capture reaction is performed essentially as described in Turner et al 2009, Nature methods 6:315-6.
- a set of MIPs is designed such that each probe in the set flanks one of the 1000 targets.
- a hybridization enrichment reaction is performed using the Agilent SureSelect procedure.
- the genomic DNA to be enriched is converted into a shotgun sequencing library using Illumina's 'Fragment Library' kit and protocol.
- Agilent's web interface is used to design a set of probes which will hybridize to the target nucleic acids.
- a set of probes are designed (mutation-detection MIPs) which will form MIPs only if mutations (e.g., specific polymorphisms) are present.
- Each mutation-detection MIP has a 3 '-most base identity that is specific for a single known mutation.
- a reaction with this set of mutation-detection MIPs is performed to selectively detect the presence of any mutant alleles. Once all three reactions have been performed, the two MIP reactions are combined (e.g., at potentially non-equimolar ratios to further increase sensitivity of mutation detection) into a single tube, and run as one sample on the next-generation DNA sequencing instrument. The hybridization-enriched reaction is run as a separate sample on the next-generation DNA sequencing instrument.
- Reads from each 'sample' are combined by a software algorithm which forms a consensus diploid genotype at each position in the target set by evaluating the total coverage at each position, the origin of each read in that total coverage, the quality score of each individual read, and the presence (or absence) of any reads derived from mutation-specific MIPs overlapping the region.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP10770071A EP2425240A4 (en) | 2009-04-30 | 2010-04-30 | METHOD AND COMPOSITION FOR EVALUATING GENETIC MARKERS |
| US13/266,862 US20120165202A1 (en) | 2009-04-30 | 2010-04-30 | Methods and compositions for evaluating genetic markers |
| AU2010242073A AU2010242073C1 (en) | 2009-04-30 | 2010-04-30 | Methods and compositions for evaluating genetic markers |
| CA2760439A CA2760439A1 (en) | 2009-04-30 | 2010-04-30 | Methods and compositions for evaluating genetic markers |
| JP2012508490A JP2012525147A (ja) | 2009-04-30 | 2010-04-30 | 遺伝マーカーを評価するための方法および組成物 |
| IL216054A IL216054A (en) | 2009-04-30 | 2011-10-30 | A method for testing a multiplicity of genetic markers |
| US13/934,093 US12129514B2 (en) | 2009-04-30 | 2013-07-02 | Methods and compositions for evaluating genetic markers |
| US16/952,764 US11840730B1 (en) | 2009-04-30 | 2020-11-19 | Methods and compositions for evaluating genetic markers |
| US18/483,878 US20240327908A1 (en) | 2009-04-30 | 2023-10-10 | Methods and compositions for evaluating genetic markers |
Applications Claiming Priority (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17447009P | 2009-04-30 | 2009-04-30 | |
| US61/174,470 | 2009-04-30 | ||
| US17892309P | 2009-05-15 | 2009-05-15 | |
| US61/178,923 | 2009-05-15 | ||
| US17935809P | 2009-05-18 | 2009-05-18 | |
| US61/179,358 | 2009-05-18 | ||
| US18208909P | 2009-05-28 | 2009-05-28 | |
| US61/182,089 | 2009-05-28 |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/266,862 A-371-Of-International US20120165202A1 (en) | 2009-04-30 | 2010-04-30 | Methods and compositions for evaluating genetic markers |
| US13/934,093 Continuation-In-Part US12129514B2 (en) | 2009-04-30 | 2013-07-02 | Methods and compositions for evaluating genetic markers |
| US201615231687A Continuation | 2009-04-30 | 2016-08-08 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010126614A2 true WO2010126614A2 (en) | 2010-11-04 |
| WO2010126614A3 WO2010126614A3 (en) | 2011-03-17 |
Family
ID=43032733
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/001293 Ceased WO2010126614A2 (en) | 2009-04-30 | 2010-04-30 | Methods and compositions for evaluating genetic markers |
Country Status (7)
| Country | Link |
|---|---|
| US (2) | US11840730B1 (https=) |
| EP (1) | EP2425240A4 (https=) |
| JP (2) | JP2012525147A (https=) |
| AU (1) | AU2010242073C1 (https=) |
| CA (1) | CA2760439A1 (https=) |
| IL (1) | IL216054A (https=) |
| WO (1) | WO2010126614A2 (https=) |
Cited By (112)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013112655A1 (en) * | 2012-01-24 | 2013-08-01 | Gigagen, Inc. | Method for correction of bias in multiplexed amplification |
| WO2013158540A1 (en) * | 2012-04-16 | 2013-10-24 | Good Start Genetics, Inc. | Capture reactions |
| US8778609B1 (en) * | 2013-03-14 | 2014-07-15 | Good Start Genetics, Inc. | Methods for analyzing nucleic acids |
| US8812422B2 (en) | 2012-04-09 | 2014-08-19 | Good Start Genetics, Inc. | Variant database |
| WO2015014962A1 (en) * | 2013-08-02 | 2015-02-05 | F. Hoffmann-La Roche Ag | Sequence capture method using specialized capture probes (heatseq) |
| WO2014143994A3 (en) * | 2013-03-15 | 2015-02-19 | Good Start Genetics, Inc. | Methods and compositions for evaluating genetic markers |
| WO2015057512A1 (en) * | 2013-10-18 | 2015-04-23 | Good Start Genetics, Inc. | Methods for determining carrier status |
| US9228233B2 (en) | 2011-10-17 | 2016-01-05 | Good Start Genetics, Inc. | Analysis methods |
| EP2979168A4 (en) * | 2013-03-29 | 2016-11-23 | Univ Washington Ct Commerciali | SYSTEMS, ALGORITHMS AND SOFTWARE FOR THE DESIGN OF A MOLECULAR INVERSION PROBE (MIP) |
| US9535920B2 (en) | 2013-06-03 | 2017-01-03 | Good Start Genetics, Inc. | Methods and systems for storing sequence read data |
| WO2017020024A3 (en) * | 2015-07-29 | 2017-03-09 | Progenity, Inc. | Systems and methods for genetic analysis |
| EP2697397B1 (en) | 2011-04-15 | 2017-04-05 | The Johns Hopkins University | Safe sequencing system |
| US9695474B2 (en) | 2010-12-16 | 2017-07-04 | Gigagen, Inc. | System and methods for massively parallel analysis of nucleic acids in single cells |
| US9738699B2 (en) | 2015-06-09 | 2017-08-22 | Gigagen, Inc. | Recombinant fusion proteins and libraries from immune cell repertoires |
| EP2814959B1 (en) | 2012-02-17 | 2018-01-17 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
| US10000800B2 (en) | 2009-04-30 | 2018-06-19 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US10066259B2 (en) | 2015-01-06 | 2018-09-04 | Good Start Genetics, Inc. | Screening for structural variants |
| WO2018174821A1 (en) * | 2017-03-20 | 2018-09-27 | Nanyang Technological University | A sequencing method for detecting dna mutation |
| US10308982B2 (en) | 2010-04-05 | 2019-06-04 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10429399B2 (en) | 2014-09-24 | 2019-10-01 | Good Start Genetics, Inc. | Process control for increased robustness of genetic assays |
| US10604799B2 (en) | 2012-04-04 | 2020-03-31 | Molecular Loop Biosolutions, Llc | Sequence assembly |
| US10650912B2 (en) | 2015-01-13 | 2020-05-12 | 10X Genomics, Inc. | Systems and methods for visualizing structural variation and phasing information |
| US10774372B2 (en) | 2013-06-25 | 2020-09-15 | Prognosy s Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US10774374B2 (en) | 2015-04-10 | 2020-09-15 | Spatial Transcriptomics AB and Illumina, Inc. | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US10787701B2 (en) | 2010-04-05 | 2020-09-29 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10839939B2 (en) | 2014-06-26 | 2020-11-17 | 10X Genomics, Inc. | Processes and systems for nucleic acid sequence assembly |
| US10947595B2 (en) | 2015-07-29 | 2021-03-16 | Progenity, Inc. | Nucleic acids and methods for detecting chromosomal abnormalities |
| US10988807B2 (en) | 2011-07-08 | 2021-04-27 | Keygene N.V. | Sequence based genotyping based on oligonucleotide ligation assays |
| US11041851B2 (en) | 2010-12-23 | 2021-06-22 | Molecular Loop Biosciences, Inc. | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
| US11041203B2 (en) | 2013-10-18 | 2021-06-22 | Molecular Loop Biosolutions, Inc. | Methods for assessing a genomic region of a subject |
| US11053548B2 (en) | 2014-05-12 | 2021-07-06 | Good Start Genetics, Inc. | Methods for detecting aneuploidy |
| US11081208B2 (en) | 2016-02-11 | 2021-08-03 | 10X Genomics, Inc. | Systems, methods, and media for de novo assembly of whole genome sequence data |
| EP3889271A1 (en) * | 2014-06-06 | 2021-10-06 | Cornell University | Method for identification and enumeration of nucleic acid sequence, expression, copy, or dna methylation changes, using combined nuclease, ligase, polymerase, and sequencing reactions |
| WO2021216622A1 (en) * | 2020-04-21 | 2021-10-28 | Aspen Neuroscience, Inc. | Gene editing of gba1 in stem cells and method of use of cells differentiated therefrom |
| US11286531B2 (en) | 2015-08-11 | 2022-03-29 | The Johns Hopkins University | Assaying ovarian cyst fluid |
| US11332790B2 (en) | 2019-12-23 | 2022-05-17 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| US11352659B2 (en) | 2011-04-13 | 2022-06-07 | Spatial Transcriptomics Ab | Methods of detecting analytes |
| US11408029B2 (en) | 2020-06-25 | 2022-08-09 | 10X Genomics, Inc. | Spatial analysis of DNA methylation |
| US11408024B2 (en) | 2014-09-10 | 2022-08-09 | Molecular Loop Biosciences, Inc. | Methods for selectively suppressing non-target sequences |
| US11407992B2 (en) | 2020-06-08 | 2022-08-09 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US11421220B2 (en) | 2019-03-21 | 2022-08-23 | Gigamune, Inc. | Engineered cells expressing anti-viral T cell receptors and methods of use thereof |
| US11434524B2 (en) | 2020-06-10 | 2022-09-06 | 10X Genomics, Inc. | Methods for determining a location of an analyte in a biological sample |
| US11512308B2 (en) | 2020-06-02 | 2022-11-29 | 10X Genomics, Inc. | Nucleic acid library methods |
| US11519033B2 (en) | 2018-08-28 | 2022-12-06 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US11525163B2 (en) | 2012-10-29 | 2022-12-13 | The Johns Hopkins University | Papanicolaou test for ovarian and endometrial cancers |
| US11535887B2 (en) | 2020-04-22 | 2022-12-27 | 10X Genomics, Inc. | Methods for spatial analysis using targeted RNA depletion |
| US11560592B2 (en) | 2020-05-26 | 2023-01-24 | 10X Genomics, Inc. | Method for resetting an array |
| US11584958B2 (en) | 2017-03-31 | 2023-02-21 | Grail, Llc | Library preparation and use thereof for sequencing based error correction and/or variant identification |
| US11592447B2 (en) | 2019-11-08 | 2023-02-28 | 10X Genomics, Inc. | Spatially-tagged analyte capture agents for analyte multiplexing |
| US11608520B2 (en) | 2020-05-22 | 2023-03-21 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
| US11618897B2 (en) | 2020-12-21 | 2023-04-04 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US11624086B2 (en) | 2020-05-22 | 2023-04-11 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| US11649485B2 (en) | 2019-01-06 | 2023-05-16 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US11692218B2 (en) | 2020-06-02 | 2023-07-04 | 10X Genomics, Inc. | Spatial transcriptomics for antigen-receptors |
| US11702698B2 (en) | 2019-11-08 | 2023-07-18 | 10X Genomics, Inc. | Enhancing specificity of analyte binding |
| US11702693B2 (en) | 2020-01-21 | 2023-07-18 | 10X Genomics, Inc. | Methods for printing cells and generating arrays of barcoded cells |
| US11733238B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11732300B2 (en) | 2020-02-05 | 2023-08-22 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US11732299B2 (en) | 2020-01-21 | 2023-08-22 | 10X Genomics, Inc. | Spatial assays with perturbed cells |
| US11739381B2 (en) | 2021-03-18 | 2023-08-29 | 10X Genomics, Inc. | Multiplex capture of gene and protein expression from a biological sample |
| US11753673B2 (en) | 2021-09-01 | 2023-09-12 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| US11761038B1 (en) | 2020-07-06 | 2023-09-19 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
| US11768175B1 (en) | 2020-03-04 | 2023-09-26 | 10X Genomics, Inc. | Electrophoretic methods for spatial analysis |
| US11821035B1 (en) | 2020-01-29 | 2023-11-21 | 10X Genomics, Inc. | Compositions and methods of making gene expression libraries |
| US11827935B1 (en) | 2020-11-19 | 2023-11-28 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification and detection probes |
| US11835462B2 (en) | 2020-02-11 | 2023-12-05 | 10X Genomics, Inc. | Methods and compositions for partitioning a biological sample |
| US11840730B1 (en) | 2009-04-30 | 2023-12-12 | Molecular Loop Biosciences, Inc. | Methods and compositions for evaluating genetic markers |
| US11891654B2 (en) | 2020-02-24 | 2024-02-06 | 10X Genomics, Inc. | Methods of making gene expression libraries |
| US11898205B2 (en) | 2020-02-03 | 2024-02-13 | 10X Genomics, Inc. | Increasing capture efficiency of spatial assays |
| US11926863B1 (en) | 2020-02-27 | 2024-03-12 | 10X Genomics, Inc. | Solid state single cell method for analyzing fixed biological cells |
| US11926867B2 (en) | 2019-01-06 | 2024-03-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US11926822B1 (en) | 2020-09-23 | 2024-03-12 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
| US11933957B1 (en) | 2018-12-10 | 2024-03-19 | 10X Genomics, Inc. | Imaging system hardware |
| US11959129B2 (en) | 2019-04-02 | 2024-04-16 | Enumera Molecular, Inc. | Methods, systems, and compositions for counting nucleic acid molecules |
| US11965213B2 (en) | 2019-05-30 | 2024-04-23 | 10X Genomics, Inc. | Methods of detecting spatial heterogeneity of a biological sample |
| US11981958B1 (en) | 2020-08-20 | 2024-05-14 | 10X Genomics, Inc. | Methods for spatial analysis using DNA capture |
| US11981960B1 (en) | 2020-07-06 | 2024-05-14 | 10X Genomics, Inc. | Spatial analysis utilizing degradable hydrogels |
| US12031177B1 (en) | 2020-06-04 | 2024-07-09 | 10X Genomics, Inc. | Methods of enhancing spatial resolution of transcripts |
| USRE50065E1 (en) | 2012-10-17 | 2024-07-30 | 10X Genomics Sweden Ab | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| US12071655B2 (en) | 2021-06-03 | 2024-08-27 | 10X Genomics, Inc. | Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis |
| US12076701B2 (en) | 2020-01-31 | 2024-09-03 | 10X Genomics, Inc. | Capturing oligonucleotides in spatial transcriptomics |
| US12098985B2 (en) | 2021-02-19 | 2024-09-24 | 10X Genomics, Inc. | Modular assay support devices |
| US12110541B2 (en) | 2020-02-03 | 2024-10-08 | 10X Genomics, Inc. | Methods for preparing high-resolution spatial arrays |
| US12117439B2 (en) | 2019-12-23 | 2024-10-15 | 10X Genomics, Inc. | Compositions and methods for using fixed biological samples |
| US12129516B2 (en) | 2020-02-07 | 2024-10-29 | 10X Genomics, Inc. | Quantitative and automated permeabilization performance evaluation for spatial transcriptomics |
| US12129514B2 (en) | 2009-04-30 | 2024-10-29 | Molecular Loop Biosolutions, Llc | Methods and compositions for evaluating genetic markers |
| US12128403B2 (en) | 2020-06-10 | 2024-10-29 | 10X Genomics, Inc. | Fluid delivery methods |
| US12157124B2 (en) | 2019-11-06 | 2024-12-03 | 10X Genomics, Inc. | Imaging system hardware |
| US12195790B2 (en) | 2021-12-01 | 2025-01-14 | 10X Genomics, Inc. | Methods for improved in situ detection of nucleic acids and spatial analysis |
| US12195803B2 (en) | 2017-08-07 | 2025-01-14 | The Johns Hopkins University | Methods and materials for assessing and treating cancer |
| US12203134B2 (en) | 2021-04-14 | 2025-01-21 | 10X Genomics, Inc. | Methods of measuring mislocalization of an analyte |
| US12209280B1 (en) | 2020-07-06 | 2025-01-28 | 10X Genomics, Inc. | Methods of identifying abundance and location of an analyte in a biological sample using second strand synthesis |
| US12223751B2 (en) | 2021-12-20 | 2025-02-11 | 10X Genomics, Inc. | Self-test for imaging device |
| US12249085B2 (en) | 2020-09-18 | 2025-03-11 | 10X Genomics, Inc. | Sample handling apparatus and image registration methods |
| US12265079B1 (en) | 2020-06-02 | 2025-04-01 | 10X Genomics, Inc. | Systems and methods for detecting analytes from captured single biological particles |
| US12275988B2 (en) | 2021-11-10 | 2025-04-15 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of an analyte in a biological sample |
| US12281357B1 (en) | 2020-02-14 | 2025-04-22 | 10X Genomics, Inc. | In situ spatial barcoding |
| US12297486B2 (en) | 2020-01-24 | 2025-05-13 | 10X Genomics, Inc. | Methods for spatial analysis using proximity ligation |
| US12365935B2 (en) | 2021-05-06 | 2025-07-22 | 10X Genomics, Inc. | Methods for increasing resolution of spatial analysis |
| US12365942B2 (en) | 2020-01-13 | 2025-07-22 | 10X Genomics, Inc. | Methods of decreasing background on a spatial array |
| US12386895B2 (en) | 2014-08-15 | 2025-08-12 | Laboratory Corporation Of America Holdings | Systems and methods for genetic analysis |
| US12399123B1 (en) | 2020-02-14 | 2025-08-26 | 10X Genomics, Inc. | Spatial targeting of analytes |
| US12405264B2 (en) | 2020-01-17 | 2025-09-02 | 10X Genomics, Inc. | Electrophoretic system and method for analyte capture |
| US12416603B2 (en) | 2020-05-19 | 2025-09-16 | 10X Genomics, Inc. | Electrophoresis cassettes and instrumentation |
| US12421558B2 (en) | 2020-02-13 | 2025-09-23 | 10X Genomics, Inc. | Systems and methods for joint interactive visualization of gene expression and DNA chromatin accessibility |
| US12435363B1 (en) | 2020-06-10 | 2025-10-07 | 10X Genomics, Inc. | Materials and methods for spatial transcriptomics |
| US12442038B2 (en) | 2020-02-14 | 2025-10-14 | The Johns Hopkins University | Methods and materials for assessing nucleic acids |
| US12529094B2 (en) | 2018-12-10 | 2026-01-20 | 10X Genomics, Inc. | Imaging system hardware |
| US12553805B2 (en) | 2021-08-02 | 2026-02-17 | 10X Genomics, Inc. | Methods of preserving a biological sample |
| US12553898B1 (en) | 2020-08-10 | 2026-02-17 | 10X Genomics, Inc. | Fluorescent hybridization of antibody-oligonucleotide for multiplexing and signal amplification |
| US12566113B2 (en) | 2019-12-23 | 2026-03-03 | 10X Genomics, Inc. | Reversible fixing reagents and methods of use thereof |
| US12571029B1 (en) | 2022-11-09 | 2026-03-10 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of multiple analytes in a biological sample |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4414990A3 (en) | 2013-01-17 | 2024-11-06 | Personalis, Inc. | Methods and systems for genetic analysis |
| HK1219297A1 (zh) * | 2013-03-15 | 2017-03-31 | 莱尔‧J‧阿诺德 | 使用发卡寡核甘酸扩增核酸的方法 |
| US10395758B2 (en) | 2013-08-30 | 2019-08-27 | 10X Genomics, Inc. | Sequencing methods |
| US9824068B2 (en) | 2013-12-16 | 2017-11-21 | 10X Genomics, Inc. | Methods and apparatus for sorting data |
| US10125399B2 (en) | 2014-10-30 | 2018-11-13 | Personalis, Inc. | Methods for using mosaicism in nucleic acids sampled distal to their origin |
| WO2016130578A1 (en) | 2015-02-09 | 2016-08-18 | 10X Genomics, Inc. | Systems and methods for determining structural variation and phasing using variant call data |
| US11299783B2 (en) | 2016-05-27 | 2022-04-12 | Personalis, Inc. | Methods and systems for genetic analysis |
| JP7470787B2 (ja) | 2019-11-05 | 2024-04-18 | パーソナリス,インコーポレイティド | 単一試料からの腫瘍純度の推定 |
| US12024285B1 (en) | 2022-03-10 | 2024-07-02 | Skypad Tech, Inc. | Modular mobility system including thrusters movably connected to a support structure |
Family Cites Families (339)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5242794A (en) | 1984-12-13 | 1993-09-07 | Applied Biosystems, Inc. | Detection of specific sequences in nucleic acids |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US5583024A (en) | 1985-12-02 | 1996-12-10 | The Regents Of The University Of California | Recombinant expression of Coleoptera luciferase |
| US4988617A (en) | 1988-03-25 | 1991-01-29 | California Institute Of Technology | Method of detecting a nucleotide change in nucleic acids |
| US5234809A (en) | 1989-03-23 | 1993-08-10 | Akzo N.V. | Process for isolating nucleic acid |
| US6416952B1 (en) | 1989-06-07 | 2002-07-09 | Affymetrix, Inc. | Photolithographic and other means for manufacturing arrays |
| US5494810A (en) | 1990-05-03 | 1996-02-27 | Cornell Research Foundation, Inc. | Thermostable ligase-mediated DNA amplifications system for the detection of genetic disease |
| CA2039652C (en) | 1990-05-30 | 1996-12-24 | Frank Zdybel, Jr. | Hardcopy lossless data storage and communications for electronic document processing systems |
| US5060980A (en) | 1990-05-30 | 1991-10-29 | Xerox Corporation | Form utilizing encoded indications for form field processing |
| US6716580B2 (en) | 1990-06-11 | 2004-04-06 | Somalogic, Inc. | Method for the automated generation of nucleic acid ligands |
| US5210015A (en) | 1990-08-06 | 1993-05-11 | Hoffman-La Roche Inc. | Homogeneous assay system using the nuclease activity of a nucleic acid polymerase |
| US6197508B1 (en) | 1990-09-12 | 2001-03-06 | Affymetrix, Inc. | Electrochemical denaturation and annealing of nucleic acid |
| US5491224A (en) | 1990-09-20 | 1996-02-13 | Bittner; Michael L. | Direct label transaminated DNA probe compositions for chromosome identification and methods for their manufacture |
| US5994056A (en) | 1991-05-02 | 1999-11-30 | Roche Molecular Systems, Inc. | Homogeneous methods for nucleic acid amplification and detection |
| US6033854A (en) | 1991-12-16 | 2000-03-07 | Biotronics Corporation | Quantitative PCR using blocking oligonucleotides |
| US5348853A (en) | 1991-12-16 | 1994-09-20 | Biotronics Corporation | Method for reducing non-specific priming in DNA amplification |
| US5567583A (en) | 1991-12-16 | 1996-10-22 | Biotronics Corporation | Methods for reducing non-specific priming in DNA detection |
| JPH05236997A (ja) | 1992-02-28 | 1993-09-17 | Hitachi Ltd | ポリヌクレオチド捕捉用チップ |
| US5869252A (en) | 1992-03-31 | 1999-02-09 | Abbott Laboratories | Method of multiplex ligase chain reaction |
| US6100099A (en) | 1994-09-06 | 2000-08-08 | Abbott Laboratories | Test strip having a diagonal array of capture spots |
| WO1995011995A1 (en) | 1993-10-26 | 1995-05-04 | Affymax Technologies N.V. | Arrays of nucleic acid probes on biological chips |
| US5459307A (en) | 1993-11-30 | 1995-10-17 | Xerox Corporation | System for storage and retrieval of digitally encoded information on a medium |
| SE9400522D0 (sv) | 1994-02-16 | 1994-02-16 | Ulf Landegren | Method and reagent for detecting specific nucleotide sequences |
| US5888788A (en) | 1994-05-18 | 1999-03-30 | Union Nationale Des Groupements De Distillateurs D'alcool (Ungda) | Use of ionophoretic polyether antibiotics for controlling bacterial growth in alcoholic fermentation |
| US5942391A (en) | 1994-06-22 | 1999-08-24 | Mount Sinai School Of Medicine | Nucleic acid amplification method: ramification-extension amplification method (RAM) |
| US7008771B1 (en) | 1994-09-30 | 2006-03-07 | Promega Corporation | Multiplex amplification of short tandem repeat loci |
| US5846719A (en) | 1994-10-13 | 1998-12-08 | Lynx Therapeutics, Inc. | Oligonucleotide tags for sorting and identification |
| US5695934A (en) | 1994-10-13 | 1997-12-09 | Lynx Therapeutics, Inc. | Massively parallel sequencing of sorted polynucleotides |
| US5604097A (en) | 1994-10-13 | 1997-02-18 | Spectragen, Inc. | Methods for sorting polynucleotides using oligonucleotide tags |
| US6020127A (en) | 1994-10-18 | 2000-02-01 | The University Of Ottawa | Neuronal apoptosis inhibitor protein, gene sequence and mutations causative of spinal muscular atrophy |
| US5776737A (en) | 1994-12-22 | 1998-07-07 | Visible Genetics Inc. | Method and composition for internal identification of samples |
| US6235501B1 (en) | 1995-02-14 | 2001-05-22 | Bio101, Inc. | Method for isolation DNA |
| US5866337A (en) | 1995-03-24 | 1999-02-02 | The Trustees Of Columbia University In The City Of New York | Method to detect mutations in a nucleic acid using a hybridization-ligation procedure |
| US5750341A (en) | 1995-04-17 | 1998-05-12 | Lynx Therapeutics, Inc. | DNA sequencing by parallel oligonucleotide extensions |
| US5701256A (en) | 1995-05-31 | 1997-12-23 | Cold Spring Harbor Laboratory | Method and apparatus for biological sequence comparison |
| US5636400A (en) | 1995-08-07 | 1997-06-10 | Young; Keenan L. | Automatic infant bottle cleaner |
| US20050026204A1 (en) | 1995-09-08 | 2005-02-03 | Ulf Landegren | Methods and compositions for nucleic acid targeting |
| SE9601676D0 (sv) | 1996-04-30 | 1996-04-30 | Ulf Landegren | Improved probing of specific mucleic acids |
| US5830064A (en) | 1996-06-21 | 1998-11-03 | Pear, Inc. | Apparatus and method for distinguishing events which collectively exceed chance expectations and thereby controlling an output |
| US6361940B1 (en) | 1996-09-24 | 2002-03-26 | Qiagen Genomics, Inc. | Compositions and methods for enhancing hybridization and priming specificity |
| GB9620209D0 (en) | 1996-09-27 | 1996-11-13 | Cemu Bioteknik Ab | Method of sequencing DNA |
| AU735272B2 (en) | 1996-10-04 | 2001-07-05 | Intronn Llc | Sample collection devices and methods using markers and the use of such markers as controls in sample validation, laboratory evaluation and/or accreditation |
| TW491892B (en) | 1996-11-07 | 2002-06-21 | Srl Inc | Apparatus for detecting microorganism |
| EP0848060A3 (en) | 1996-12-11 | 2000-02-02 | Smithkline Beecham Corporation | Novel human 11CB splice variant |
| GB9626815D0 (en) | 1996-12-23 | 1997-02-12 | Cemu Bioteknik Ab | Method of sequencing DNA |
| JP2002503954A (ja) | 1997-04-01 | 2002-02-05 | グラクソ、グループ、リミテッド | 核酸増幅法 |
| GB9716664D0 (en) | 1997-08-06 | 1997-10-15 | Norwegian Inst Of Fisheries & | A method of removing nucleic acid contamination reactions |
| CA2214461A1 (en) | 1997-09-02 | 1999-03-02 | Mcgill University | Screening method for determining individuals at risk of developing diseases associated with different polymorphic forms of wildtype p53 |
| US5869717A (en) | 1997-09-17 | 1999-02-09 | Uop Llc | Process for inhibiting the polymerization of vinyl aromatics |
| AU9317198A (en) | 1997-09-17 | 1999-04-05 | Gentra Systems, Inc. | Apparatuses and methods for isolating nucleic acid |
| US20010046673A1 (en) | 1999-03-16 | 2001-11-29 | Ljl Biosystems, Inc. | Methods and apparatus for detecting nucleic acid polymorphisms |
| US5993611A (en) | 1997-09-24 | 1999-11-30 | Sarnoff Corporation | Capacitive denaturation of nucleic acid |
| US6866996B1 (en) | 1998-01-30 | 2005-03-15 | Evolutionary Genomics, Llc | Methods to identify polynucleotide and polypeptide sequences which may be associated with physiological and medical conditions |
| US6054276A (en) | 1998-02-23 | 2000-04-25 | Macevicz; Stephen C. | DNA restriction site mapping |
| CA2263784A1 (en) | 1998-03-23 | 1999-09-23 | Megabios Corporation | Dual-tagged proteins and their uses |
| AU3601599A (en) | 1998-03-25 | 1999-10-18 | Ulf Landegren | Rolling circle replication of padlock probes |
| US6946291B2 (en) | 1998-04-24 | 2005-09-20 | University Hospitals Of Cleveland | Mixed cell diagnostic systems |
| US5971921A (en) | 1998-06-11 | 1999-10-26 | Advanced Monitoring Devices, Inc. | Medical alarm system and methods |
| US6223128B1 (en) | 1998-06-29 | 2001-04-24 | Dnstar, Inc. | DNA sequence assembly system |
| US6787308B2 (en) | 1998-07-30 | 2004-09-07 | Solexa Ltd. | Arrayed biomolecules and their use in sequencing |
| US20020001800A1 (en) | 1998-08-14 | 2002-01-03 | Stanley N. Lapidus | Diagnostic methods using serial testing of polymorphic loci |
| US6315767B1 (en) | 1998-08-19 | 2001-11-13 | Gambro, Inc. | Cell storage maintenance and monitoring system |
| US6235502B1 (en) | 1998-09-18 | 2001-05-22 | Molecular Staging Inc. | Methods for selectively isolating DNA using rolling circle amplification |
| US6703228B1 (en) | 1998-09-25 | 2004-03-09 | Massachusetts Institute Of Technology | Methods and products related to genotyping and DNA analysis |
| AR021833A1 (es) | 1998-09-30 | 2002-08-07 | Applied Research Systems | Metodos de amplificacion y secuenciacion de acido nucleico |
| US7071324B2 (en) | 1998-10-13 | 2006-07-04 | Brown University Research Foundation | Systems and methods for sequencing by hybridization |
| US7034143B1 (en) | 1998-10-13 | 2006-04-25 | Brown University Research Foundation | Systems and methods for sequencing by hybridization |
| DE69937747T2 (de) | 1998-10-28 | 2008-12-04 | Covaris, Inc., Woburn | Vorrichtung und verfahren zur kontrolle einer akustischen behandlung |
| US6948843B2 (en) | 1998-10-28 | 2005-09-27 | Covaris, Inc. | Method and apparatus for acoustically controlling liquid solutions in microfluidic devices |
| US6927024B2 (en) | 1998-11-30 | 2005-08-09 | Genentech, Inc. | PCR assay |
| US6864052B1 (en) | 1999-01-06 | 2005-03-08 | Callida Genomics, Inc. | Enhanced sequencing by hybridization using pools of probes |
| GB9901475D0 (en) | 1999-01-22 | 1999-03-17 | Pyrosequencing Ab | A method of DNA sequencing |
| CN1264744A (zh) | 1999-02-26 | 2000-08-30 | 上海生元基因开发有限公司 | 一种通过循环差减进行大规模cDNA克隆和测序的方法 |
| US6360235B1 (en) | 1999-03-16 | 2002-03-19 | Webcriteria, Inc. | Objective measurement and graph theory modeling of web sites |
| US7074586B1 (en) | 1999-06-17 | 2006-07-11 | Source Precision Medicine, Inc. | Quantitative assay for low abundance molecules |
| US6818395B1 (en) | 1999-06-28 | 2004-11-16 | California Institute Of Technology | Methods and apparatus for analyzing polynucleotide sequences |
| US7482443B2 (en) | 2000-03-09 | 2009-01-27 | Genetag Technology, Inc. | Systems and methods to quantify and amplify both signaling probes for cDNA chips and genes expression microarrays |
| JP2001041918A (ja) | 1999-08-03 | 2001-02-16 | Honda Motor Co Ltd | オイルの気体濃度検出装置 |
| US6941317B1 (en) | 1999-09-14 | 2005-09-06 | Eragen Biosciences, Inc. | Graphical user interface for display and analysis of biological sequence data |
| US6274320B1 (en) | 1999-09-16 | 2001-08-14 | Curagen Corporation | Method of sequencing a nucleic acid |
| US7211390B2 (en) | 1999-09-16 | 2007-05-01 | 454 Life Sciences Corporation | Method of sequencing a nucleic acid |
| US7244559B2 (en) | 1999-09-16 | 2007-07-17 | 454 Life Sciences Corporation | Method of sequencing a nucleic acid |
| AU7537200A (en) | 1999-09-29 | 2001-04-30 | Solexa Ltd. | Polynucleotide sequencing |
| US7430477B2 (en) | 1999-10-12 | 2008-09-30 | Maxygen, Inc. | Methods of populating data structures for use in evolutionary simulations |
| US6613516B1 (en) | 1999-10-30 | 2003-09-02 | Affymetrix, Inc. | Preparation of nucleic acid samples |
| US6582938B1 (en) | 2001-05-11 | 2003-06-24 | Affymetrix, Inc. | Amplification of nucleic acids |
| US20060276629A9 (en) | 1999-12-17 | 2006-12-07 | Hildebrand William H | Purification and characterization of soluble human HLA proteins |
| US20030166057A1 (en) | 1999-12-17 | 2003-09-04 | Hildebrand William H. | Method and apparatus for the production of soluble MHC antigens and uses thereof |
| US6775622B1 (en) | 2000-01-31 | 2004-08-10 | Zymogenetics, Inc. | Method and system for detecting near identities in large DNA databases |
| US6714874B1 (en) | 2000-03-15 | 2004-03-30 | Applera Corporation | Method and system for the assembly of a whole genome using a shot-gun data set |
| US20030208454A1 (en) | 2000-03-16 | 2003-11-06 | Rienhoff Hugh Y. | Method and system for populating a database for further medical characterization |
| EP1287167A2 (en) | 2000-04-11 | 2003-03-05 | Mats Bo Johan Nilsson | Nucleic acid detection medium |
| US20020091666A1 (en) | 2000-07-07 | 2002-07-11 | Rice John Jeremy | Method and system for modeling biological systems |
| US6913879B1 (en) | 2000-07-10 | 2005-07-05 | Telechem International Inc. | Microarray method of genotyping multiple samples at multiple LOCI |
| US6448717B1 (en) | 2000-07-17 | 2002-09-10 | Micron Technology, Inc. | Method and apparatuses for providing uniform electron beams from field emission displays |
| US20020182609A1 (en) | 2000-08-16 | 2002-12-05 | Luminex Corporation | Microsphere based oligonucleotide ligation assays, kits, and methods of use, including high-throughput genotyping |
| US6569920B1 (en) | 2000-08-16 | 2003-05-27 | Millennium Inorganic Chemicals, Inc. | Titanium dioxide slurries having improved stability |
| WO2002017207A2 (en) | 2000-08-23 | 2002-02-28 | Arexis Ab | System and method of storing genetic information |
| US8501471B2 (en) | 2000-10-18 | 2013-08-06 | Sloan-Kettering Institute For Cancer Research | Uses of monoclonal antibody 8H9 |
| DE60131903T2 (de) | 2000-10-24 | 2008-11-27 | The Board of Trustees of the Leland S. Stanford Junior University, Palo Alto | Direkte multiplex charakterisierung von genomischer dna |
| US7119188B2 (en) | 2001-01-04 | 2006-10-10 | Bristol-Myers Squibb Company | N-carbobenzyloxy (N-CBZ)-deprotecting enzyme and uses therefor |
| JP2004523243A (ja) | 2001-03-12 | 2004-08-05 | カリフォルニア インスティチュート オブ テクノロジー | 非同期性塩基伸長によってポリヌクレオチド配列を分析するための方法および装置 |
| WO2002079502A1 (en) | 2001-03-28 | 2002-10-10 | The University Of Queensland | A method for nucleic acid sequence analysis |
| US20020187483A1 (en) | 2001-04-20 | 2002-12-12 | Cerner Corporation | Computer system for providing information about the risk of an atypical clinical event based upon genetic information |
| US7809509B2 (en) | 2001-05-08 | 2010-10-05 | Ip Genesis, Inc. | Comparative mapping and assembly of nucleic acid sequences |
| AU2002308662A1 (en) | 2001-05-12 | 2002-11-25 | X-Mine, Inc. | Web-based genetic research apparatus |
| GB2378245A (en) | 2001-08-03 | 2003-02-05 | Mats Nilsson | Nucleic acid amplification method |
| US20040142325A1 (en) | 2001-09-14 | 2004-07-22 | Liat Mintz | Methods and systems for annotating biomolecular sequences |
| US7070933B2 (en) | 2001-09-28 | 2006-07-04 | Gen-Probe Incorporated | Inversion probes |
| US20030224384A1 (en) | 2001-11-13 | 2003-12-04 | Khalid Sayood | Divide and conquer system and method of DNA sequence assembly |
| US7208295B2 (en) | 2001-11-19 | 2007-04-24 | Affymetrix, Inc. | Multiplex oligonucleotide addition and target amplification |
| US7057026B2 (en) | 2001-12-04 | 2006-06-06 | Solexa Limited | Labelled nucleotides |
| US20030175709A1 (en) | 2001-12-20 | 2003-09-18 | Murphy George L. | Method and system for depleting rRNA populations |
| DK1321477T3 (da) | 2001-12-22 | 2005-02-14 | 4Antibody Ag | Fremgangsmåde til frembringelsen af genetisk modificerede vertebrate precursor-lymfocytter og anvendelse deraf til fremstillingen af heterologe bindende proteiner |
| US7127436B2 (en) | 2002-03-18 | 2006-10-24 | Motorola, Inc. | Gene expression programming algorithm |
| US20030203370A1 (en) * | 2002-04-30 | 2003-10-30 | Zohar Yakhini | Method and system for partitioning sets of sequence groups with respect to a set of subsequence groups, useful for designing polymorphism-based typing assays |
| US6841384B2 (en) | 2002-08-08 | 2005-01-11 | Becton Dickinson Company | Advanced roller bottle system for cell and tissue culturing |
| WO2004018497A2 (en) | 2002-08-23 | 2004-03-04 | Solexa Limited | Modified nucleotides for polynucleotide sequencing |
| WO2004026892A2 (en) | 2002-09-19 | 2004-04-01 | Applera Corporation | Fragmentation of dna |
| US7865534B2 (en) | 2002-09-30 | 2011-01-04 | Genstruct, Inc. | System, method and apparatus for assembling and mining life science data |
| KR20050073466A (ko) | 2002-09-30 | 2005-07-13 | 칠드런스 머시 호스피탈 | 서브텔로미어 디엔에이 프로브 및 이의 제조 방법 |
| US20050003369A1 (en) | 2002-10-10 | 2005-01-06 | Affymetrix, Inc. | Method for depleting specific nucleic acids from a mixture |
| AU2003298733B2 (en) | 2002-11-27 | 2009-06-18 | Agena Bioscience, Inc. | Fragmentation-based methods and systems for sequence variation detection and discovery |
| US8275554B2 (en) * | 2002-12-20 | 2012-09-25 | Caliper Life Sciences, Inc. | System for differentiating the lengths of nucleic acids of interest in a sample |
| CA2513899C (en) | 2003-01-29 | 2013-03-26 | 454 Corporation | Methods of amplifying and sequencing nucleic acids |
| US20060183132A1 (en) | 2005-02-14 | 2006-08-17 | Perlegen Sciences, Inc. | Selection probe amplification |
| US20040209299A1 (en) | 2003-03-07 | 2004-10-21 | Rubicon Genomics, Inc. | In vitro DNA immortalization and whole genome amplification using libraries generated from randomly fragmented DNA |
| US7041481B2 (en) | 2003-03-14 | 2006-05-09 | The Regents Of The University Of California | Chemical amplification based on fluid partitioning |
| WO2004083819A2 (en) | 2003-03-17 | 2004-09-30 | Trace Genetics, Inc | Molecular forensic specimen marker |
| ITMI20030643A1 (it) | 2003-04-01 | 2004-10-02 | Copan Innovation Ltd | Tampone per il prelievo di campioni biologici |
| EP3261006A1 (en) | 2003-04-09 | 2017-12-27 | Omicia Inc. | Methods of selection, reporting and analysis of genetic markers using broad based genetic profiling applications |
| US7300755B1 (en) | 2003-05-12 | 2007-11-27 | Fred Hutchinson Cancer Research Center | Methods for haplotyping genomic DNA |
| JP2006525814A (ja) | 2003-05-23 | 2006-11-16 | コールド スプリング ハーバー ラボラトリー | ヌクレオチド配列の実質的表示 |
| WO2005003304A2 (en) | 2003-06-20 | 2005-01-13 | Illumina, Inc. | Methods and compositions for whole genome amplification and genotyping |
| SE0301951D0 (sv) | 2003-06-30 | 2003-06-30 | Pyrosequencing Ab | New method |
| US7108979B2 (en) | 2003-09-03 | 2006-09-19 | Agilent Technologies, Inc. | Methods to detect cross-contamination between samples contacted with a multi-array substrate |
| US7537889B2 (en) | 2003-09-30 | 2009-05-26 | Life Genetics Lab, Llc. | Assay for quantitation of human DNA using Alu elements |
| US7729865B2 (en) | 2003-10-06 | 2010-06-01 | Cerner Innovation, Inc. | Computerized method and system for automated correlation of genetic test results |
| CA2544202C (en) | 2003-10-29 | 2012-07-24 | Bioarray Solutions Ltd. | Multiplexed nucleic acid analysis by fragmentation of double-stranded dna |
| US20060024681A1 (en) | 2003-10-31 | 2006-02-02 | Agencourt Bioscience Corporation | Methods for producing a paired tag from a nucleic acid sequence and methods of use thereof |
| WO2005047477A2 (en) | 2003-11-07 | 2005-05-26 | University Of Massachusetts | Interspersed repetitive element rnas as substrates, inhibitors and delivery vehicles for rnai |
| US7169560B2 (en) | 2003-11-12 | 2007-01-30 | Helicos Biosciences Corporation | Short cycle methods for sequencing polynucleotides |
| US20070162983A1 (en) | 2003-11-19 | 2007-07-12 | Evotec Neurosciences Gmbh | Diagnostic and therapeutic use of the human sgpl1 gene and protein for neurodegenerative diseases |
| US20050209787A1 (en) | 2003-12-12 | 2005-09-22 | Waggener Thomas B | Sequencing data analysis |
| US8529744B2 (en) | 2004-02-02 | 2013-09-10 | Boreal Genomics Corp. | Enrichment of nucleic acid targets |
| US7910353B2 (en) | 2004-02-13 | 2011-03-22 | Signature Genomic Laboratories | Methods and apparatuses for achieving precision genetic diagnoses |
| CA2497324A1 (en) | 2004-02-17 | 2005-08-17 | Affymetrix, Inc. | Methods for fragmenting and labelling dna |
| US20060195266A1 (en) | 2005-02-25 | 2006-08-31 | Yeatman Timothy J | Methods for predicting cancer outcome and gene signatures for use therein |
| US20100216151A1 (en) | 2004-02-27 | 2010-08-26 | Helicos Biosciences Corporation | Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities |
| US20100216153A1 (en) | 2004-02-27 | 2010-08-26 | Helicos Biosciences Corporation | Methods for detecting fetal nucleic acids and diagnosing fetal abnormalities |
| WO2005085477A1 (en) | 2004-03-02 | 2005-09-15 | Orion Genomics Llc | Differential enzymatic fragmentation by whole genome amplification |
| US20080176209A1 (en) | 2004-04-08 | 2008-07-24 | Biomatrica, Inc. | Integration of sample storage and sample management for life science |
| WO2005110477A2 (en) | 2004-04-09 | 2005-11-24 | University Of South Florida | Combination therapies for cancer and proliferative angiopathies |
| US20070244675A1 (en) | 2004-04-22 | 2007-10-18 | Ramot At Tel Aviv University Ltd. | Method and Apparatus for Optimizing Multidimensional Systems |
| WO2005111242A2 (en) | 2004-05-10 | 2005-11-24 | Parallele Bioscience, Inc. | Digital profiling of polynucleotide populations |
| SE0401270D0 (sv) | 2004-05-18 | 2004-05-18 | Fredrik Dahl | Method for amplifying specific nucleic acids in parallel |
| US7622281B2 (en) | 2004-05-20 | 2009-11-24 | The Board Of Trustees Of The Leland Stanford Junior University | Methods and compositions for clonal amplification of nucleic acid |
| US20060019304A1 (en) | 2004-07-26 | 2006-01-26 | Paul Hardenbol | Simultaneous analysis of multiple genomes |
| WO2006044017A2 (en) | 2004-08-13 | 2006-04-27 | Jaguar Bioscience Inc. | Systems and methods for identifying diagnostic indicators |
| US8024128B2 (en) | 2004-09-07 | 2011-09-20 | Gene Security Network, Inc. | System and method for improving clinical decisions by aggregating, validating and analysing genetic and phenotypic data |
| US20060078894A1 (en) | 2004-10-12 | 2006-04-13 | Winkler Matthew M | Methods and compositions for analyzing nucleic acids |
| EP2230316A1 (en) | 2005-02-01 | 2010-09-22 | AB Advanced Genetic Analysis Corporation | Nucleic acid sequencing by performing successive cycles of duplex extension |
| US7393665B2 (en) | 2005-02-10 | 2008-07-01 | Population Genetics Technologies Ltd | Methods and compositions for tagging and identifying polynucleotides |
| US7658346B2 (en) | 2005-02-25 | 2010-02-09 | Honeywell International Inc. | Double ducted hovering air-vehicle |
| GB0504184D0 (en) | 2005-03-01 | 2005-04-06 | Lingvitae As | Method |
| EP1877559B1 (en) | 2005-04-18 | 2010-10-13 | Mitomics Inc. | Mitochondrial mutations and rearrangements as a diagnostic tool for the detection of sun exposure, prostate cancer and other cancers |
| US7523117B2 (en) | 2005-05-04 | 2009-04-21 | West Virginia University Research Corporation | Method for data clustering and classification by a graph theory model—network partition into high density subgraphs |
| US20070009925A1 (en) | 2005-05-05 | 2007-01-11 | Applera Corporation | Genomic dna sequencing methods and kits |
| US20060263789A1 (en) | 2005-05-19 | 2006-11-23 | Robert Kincaid | Unique identifiers for indicating properties associated with entities to which they are attached, and methods for using |
| CA2615323A1 (en) | 2005-06-06 | 2007-12-21 | 454 Life Sciences Corporation | Paired end sequencing |
| US7368242B2 (en) | 2005-06-14 | 2008-05-06 | Affymetrix, Inc. | Method and kits for multiplex hybridization assays |
| US20060286577A1 (en) | 2005-06-17 | 2006-12-21 | Xiyu Jia | Methods for detection of methylated DNA |
| US20060292585A1 (en) | 2005-06-24 | 2006-12-28 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
| GB0514936D0 (en) | 2005-07-20 | 2005-08-24 | Solexa Ltd | Preparation of templates for nucleic acid sequencing |
| US20070020640A1 (en) | 2005-07-21 | 2007-01-25 | Mccloskey Megan L | Molecular encoding of nucleic acid templates for PCR and other forms of sequence analysis |
| US7838646B2 (en) | 2005-08-18 | 2010-11-23 | Quest Diagnostics Investments Incorporated | Cystic fibrosis transmembrane conductance regulator gene mutations |
| US7666593B2 (en) | 2005-08-26 | 2010-02-23 | Helicos Biosciences Corporation | Single molecule sequencing of captured nucleic acids |
| CA2623405C (en) | 2005-09-20 | 2014-11-25 | Immunivest Corporation | Methods and composition to generate unique sequence dna probes labeling of dna probes and the use of these probes |
| WO2007038670A2 (en) * | 2005-09-30 | 2007-04-05 | Perlegen Sciences, Inc. | Methods and compositions for screening and treatment of disorders of blood glucose regulation |
| US20070212704A1 (en) | 2005-10-03 | 2007-09-13 | Applera Corporation | Compositions, methods, and kits for amplifying nucleic acids |
| US20070092883A1 (en) | 2005-10-26 | 2007-04-26 | De Luwe Hoek Octrooien B.V. | Methylation specific multiplex ligation-dependent probe amplification (MS-MLPA) |
| GB0522310D0 (en) | 2005-11-01 | 2005-12-07 | Solexa Ltd | Methods of preparing libraries of template polynucleotides |
| EP1969137B1 (en) | 2005-11-22 | 2011-10-05 | Stichting Dienst Landbouwkundig Onderzoek | Multiplex nucleic acid detection |
| US7329860B2 (en) | 2005-11-23 | 2008-02-12 | Illumina, Inc. | Confocal imaging methods and apparatus |
| ES2634665T3 (es) | 2005-11-26 | 2017-09-28 | Natera, Inc. | Método y sistema para detectar anormalidades cromosómicas |
| WO2007081385A2 (en) | 2006-01-11 | 2007-07-19 | Raindance Technologies, Inc. | Microfluidic devices and methods of use in the formation and control of nanoreactors |
| WO2007087312A2 (en) | 2006-01-23 | 2007-08-02 | Population Genetics Technologies Ltd. | Molecular counting |
| WO2007087310A2 (en) | 2006-01-23 | 2007-08-02 | Population Genetics Technologies Ltd. | Nucleic acid analysis using sequence tokens |
| WO2007092538A2 (en) * | 2006-02-07 | 2007-08-16 | President And Fellows Of Harvard College | Methods for making nucleotide probes for sequencing and synthesis |
| ES2546848T3 (es) | 2006-03-10 | 2015-09-29 | Epigenomics Ag | Un método para identificar una muestra biológica para el análisis de la metilación |
| CN101401101B (zh) | 2006-03-10 | 2014-06-04 | 皇家飞利浦电子股份有限公司 | 用于通过谱分析鉴定dna模式的方法和系统 |
| WO2007107717A1 (en) * | 2006-03-21 | 2007-09-27 | Ucl Business Plc | Biomarkers for bisphosphonate-responsive bone disorders |
| WO2007112289A2 (en) | 2006-03-23 | 2007-10-04 | The Regents Of The University Of California | Method for identification and sequencing of proteins |
| CA2648149A1 (en) | 2006-03-31 | 2007-11-01 | Solexa, Inc. | Systems and devices for sequence by synthesis analysis |
| EP2010668A4 (en) | 2006-04-10 | 2009-04-29 | Univ California | SYSTEMS AND METHOD FOR THE EFFICIENT COLLECTION OF INDIVIDUAL CELLS AND CELL COLONIES AND FOR THE QUICK PRODUCTION OF STABILIZED TRANSFECTANTS |
| US7282337B1 (en) | 2006-04-14 | 2007-10-16 | Helicos Biosciences Corporation | Methods for increasing accuracy of nucleic acid sequencing |
| US7702468B2 (en) | 2006-05-03 | 2010-04-20 | Population Diagnostics, Inc. | Evaluating genetic disorders |
| EP2530167A1 (en) | 2006-05-11 | 2012-12-05 | Raindance Technologies, Inc. | Microfluidic Devices |
| USRE49362E1 (en) | 2006-05-18 | 2023-01-10 | Illumina Cambridge Limited | Dye compounds and the use of their labelled conjugates |
| US20080050739A1 (en) | 2006-06-14 | 2008-02-28 | Roland Stoughton | Diagnosis of fetal abnormalities using polymorphisms including short tandem repeats |
| US20080090239A1 (en) | 2006-06-14 | 2008-04-17 | Daniel Shoemaker | Rare cell analysis using sample splitting and dna tags |
| US20100035243A1 (en) | 2006-07-10 | 2010-02-11 | Nanosphere, Inc. | Ultra-sensitive detection of analytes |
| US20080085836A1 (en) | 2006-09-22 | 2008-04-10 | Kearns William G | Method for genetic testing of human embryos for chromosome abnormalities, segregating genetic disorders with or without a known mutation and mitochondrial disorders following in vitro fertilization (IVF), embryo culture and embryo biopsy |
| US7985716B2 (en) | 2006-09-22 | 2011-07-26 | Uchicago Argonne, Llc | Nucleic acid sample purification and enrichment with a thermo-affinity microfluidic sub-circuit |
| US20080081330A1 (en) | 2006-09-28 | 2008-04-03 | Helicos Biosciences Corporation | Method and devices for analyzing small RNA molecules |
| US7754429B2 (en) | 2006-10-06 | 2010-07-13 | Illumina Cambridge Limited | Method for pair-wise sequencing a plurity of target polynucleotides |
| CA2669728C (en) | 2006-11-15 | 2017-04-11 | Biospherex Llc | Multitag sequencing and ecogenomics analysis |
| GB2444410B (en) | 2006-11-30 | 2011-08-24 | Navigenics Inc | Genetic analysis systems and methods |
| US8349167B2 (en) | 2006-12-14 | 2013-01-08 | Life Technologies Corporation | Methods and apparatus for detecting molecular interactions using FET arrays |
| US8262900B2 (en) | 2006-12-14 | 2012-09-11 | Life Technologies Corporation | Methods and apparatus for measuring analytes using large scale FET arrays |
| GB2457851B (en) | 2006-12-14 | 2011-01-05 | Ion Torrent Systems Inc | Methods and apparatus for measuring analytes using large scale fet arrays |
| US7855054B2 (en) | 2007-01-16 | 2010-12-21 | Somalogic, Inc. | Multiplexed analyses of test samples |
| US7862999B2 (en) | 2007-01-17 | 2011-01-04 | Affymetrix, Inc. | Multiplex targeted amplification using flap nuclease |
| EP2126766A2 (en) | 2007-01-26 | 2009-12-02 | Illumina Inc. | Image data efficient genetic sequencing method and system |
| US8165821B2 (en) | 2007-02-05 | 2012-04-24 | Applied Biosystems, Llc | System and methods for indel identification using short read sequencing |
| US20080269068A1 (en) | 2007-02-06 | 2008-10-30 | President And Fellows Of Harvard College | Multiplex decoding of sequence tags in barcodes |
| KR100896987B1 (ko) | 2007-03-14 | 2009-05-14 | 한국과학기술연구원 | 앱타머를 이용한 표적 단백질 검출 방법 및 검출키트 |
| US8533327B2 (en) | 2007-04-04 | 2013-09-10 | Zte Corporation | System and method of providing services via a peer-to-peer-based next generation network |
| US7774962B1 (en) | 2007-04-27 | 2010-08-17 | David Ladd | Removable and reusable tags for identifying bottles, cans, and the like |
| US20080293589A1 (en) | 2007-05-24 | 2008-11-27 | Affymetrix, Inc. | Multiplex locus specific amplification |
| DK2171088T3 (en) | 2007-06-19 | 2016-01-25 | Stratos Genomics Inc | Nucleic acid sequencing in a high yield by expansion |
| US8283116B1 (en) | 2007-06-22 | 2012-10-09 | Ptc Therapeutics, Inc. | Methods of screening for compounds for treating spinal muscular atrophy using SMN mRNA translation regulation |
| JP2009009624A (ja) | 2007-06-26 | 2009-01-15 | Hitachi Global Storage Technologies Netherlands Bv | サーボパターン形成方法および磁気ディスク装置 |
| JP2010534474A (ja) | 2007-07-26 | 2010-11-11 | パシフィック バイオサイエンシーズ オブ カリフォルニア, インコーポレイテッド | 分子冗長配列決定 |
| US20120252020A1 (en) | 2007-08-17 | 2012-10-04 | Predictive Biosciences, Inc. | Screening Assay for Bladder Cancer |
| EP2201143B2 (en) | 2007-09-21 | 2016-08-24 | Katholieke Universiteit Leuven | Tools and methods for genetic tests using next generation sequencing |
| US20100086914A1 (en) | 2008-10-03 | 2010-04-08 | Roche Molecular Systems, Inc. | High resolution, high throughput hla genotyping by clonal sequencing |
| EP2053132A1 (en) | 2007-10-23 | 2009-04-29 | Roche Diagnostics GmbH | Enrichment and sequence analysis of geomic regions |
| US20090119313A1 (en) | 2007-11-02 | 2009-05-07 | Ioactive Inc. | Determining structure of binary data using alignment algorithms |
| US8478544B2 (en) | 2007-11-21 | 2013-07-02 | Cosmosid Inc. | Direct identification and measurement of relative populations of microorganisms with direct DNA sequencing and probabilistic methods |
| US8463895B2 (en) | 2007-11-29 | 2013-06-11 | International Business Machines Corporation | System and computer program product to predict edges in a non-cumulative graph |
| EP2227563B1 (en) | 2007-12-05 | 2012-06-06 | Complete Genomics, Inc. | Efficient base determination in sequencing reactions |
| DE102007060291B4 (de) | 2007-12-12 | 2011-04-28 | Sartorius Stedim Biotech Gmbh | Behälteranordnung mit einem Behälter mit flexibler Wandung |
| US20090156412A1 (en) | 2007-12-17 | 2009-06-18 | Helicos Biosciences Corporation | Surface-capture of target nucleic acids |
| US20090163366A1 (en) | 2007-12-24 | 2009-06-25 | Helicos Biosciences Corporation | Two-primer sequencing for high-throughput expression analysis |
| US8003326B2 (en) | 2008-01-02 | 2011-08-23 | Children's Medical Center Corporation | Method for diagnosing autism spectrum disorder |
| US20090181389A1 (en) | 2008-01-11 | 2009-07-16 | Signosis, Inc., A California Corporation | Quantitative measurement of nucleic acid via ligation-based linear amplification |
| WO2009091934A1 (en) | 2008-01-17 | 2009-07-23 | Sequenom, Inc. | Single molecule nucleic acid sequence analysis processes and compositions |
| EP2250594B1 (en) | 2008-02-12 | 2017-04-19 | Codexis, Inc. | Method of generating an optimized, diverse population of variants |
| WO2009103068A1 (en) | 2008-02-15 | 2009-08-20 | Life Technologies Corporation | Methods and compositions for shearing of polymers by sonication |
| US20090226975A1 (en) | 2008-03-10 | 2009-09-10 | Illumina, Inc. | Constant cluster seeding |
| US9074244B2 (en) | 2008-03-11 | 2015-07-07 | Affymetrix, Inc. | Array-based translocation and rearrangement assays |
| US8271206B2 (en) | 2008-04-21 | 2012-09-18 | Softgenetics Llc | DNA sequence assembly methods of short reads |
| US20090298064A1 (en) | 2008-05-29 | 2009-12-03 | Serafim Batzoglou | Genomic Sequencing |
| AU2009256212B2 (en) | 2008-06-04 | 2015-12-10 | Jp Laboratories Inc. | A monitoring system based on etching of metals |
| EP2332082A1 (en) | 2008-07-23 | 2011-06-15 | Translational Genomics Research Institute | Method of characterizing sequences from genetic material samples |
| US20100035252A1 (en) | 2008-08-08 | 2010-02-11 | Ion Torrent Systems Incorporated | Methods for sequencing individual nucleic acids under tension |
| US8645343B2 (en) | 2008-08-26 | 2014-02-04 | 23Andme, Inc. | Processing data from genotyping chips |
| US20100063742A1 (en) | 2008-09-10 | 2010-03-11 | Hart Christopher E | Multi-scale short read assembly |
| US8383345B2 (en) | 2008-09-12 | 2013-02-26 | University Of Washington | Sequence tag directed subassembly of short sequencing reads into long sequencing reads |
| US8921046B2 (en) | 2008-09-19 | 2014-12-30 | Pacific Biosciences Of California, Inc. | Nucleic acid sequence analysis |
| DK2350648T3 (en) | 2008-09-22 | 2017-05-22 | Ventana Med Syst Inc | SELECTIVE PROCESSING OF BIOLOGICAL MATERIAL ON A MICROARRAY SUBSTRATE |
| US8546128B2 (en) | 2008-10-22 | 2013-10-01 | Life Technologies Corporation | Fluidics system for sequential delivery of reagents |
| US20100137143A1 (en) | 2008-10-22 | 2010-06-03 | Ion Torrent Systems Incorporated | Methods and apparatus for measuring analytes |
| US20100301398A1 (en) | 2009-05-29 | 2010-12-02 | Ion Torrent Systems Incorporated | Methods and apparatus for measuring analytes |
| WO2010056728A1 (en) | 2008-11-11 | 2010-05-20 | Helicos Biosciences Corporation | Nucleic acid encoding for multiplex analysis |
| US8474228B2 (en) | 2009-12-08 | 2013-07-02 | Life Technologies Corporation | Packaging systems and methods for transporting vials |
| US8462161B1 (en) | 2009-01-20 | 2013-06-11 | Kount Inc. | System and method for fast component enumeration in graphs with implicit edges |
| AU2010210666C1 (en) | 2009-02-03 | 2016-01-28 | Ande Corporation | Nucleic acid purification |
| SG174617A1 (en) | 2009-04-02 | 2011-10-28 | Fluidigm Corp | Multi-primer amplification method for barcoding of target nucleic acids |
| EP2425023B1 (en) | 2009-04-27 | 2015-12-23 | Pacific Biosciences of California, Inc. | Real-time sequencing methods and systems |
| EP2511843B1 (en) | 2009-04-29 | 2016-12-21 | Complete Genomics, Inc. | Method and system for calling variations in a sample polynucleotide sequence with respect to a reference polynucleotide sequence |
| US12129514B2 (en) | 2009-04-30 | 2024-10-29 | Molecular Loop Biosolutions, Llc | Methods and compositions for evaluating genetic markers |
| US20120165202A1 (en) | 2009-04-30 | 2012-06-28 | Good Start Genetics, Inc. | Methods and compositions for evaluating genetic markers |
| EP2425240A4 (en) | 2009-04-30 | 2012-12-12 | Good Start Genetics Inc | METHOD AND COMPOSITION FOR EVALUATING GENETIC MARKERS |
| US8673627B2 (en) | 2009-05-29 | 2014-03-18 | Life Technologies Corporation | Apparatus and methods for performing electrochemical reactions |
| US8574835B2 (en) | 2009-05-29 | 2013-11-05 | Life Technologies Corporation | Scaffolded nucleic acid polymer particles and methods of making and using |
| US20110007639A1 (en) | 2009-07-10 | 2011-01-13 | Qualcomm Incorporated | Methods and apparatus for detecting identifiers |
| EP2464738A4 (en) | 2009-08-12 | 2013-05-01 | Nugen Technologies Inc | METHODS, COMPOSITIONS, AND KITS FOR GENERATING NUCLEIC ACID PRODUCTS SUBSTANTIALLY FREE OF MATRIX NUCLEIC ACID |
| CN102918163B (zh) | 2009-09-08 | 2016-10-05 | 美国控股实验室公司 | 用于诊断自闭症谱系障碍的组合物和方法 |
| WO2011030838A1 (ja) | 2009-09-10 | 2011-03-17 | 富士フイルム株式会社 | アレイ比較ゲノムハイブリダイゼーション法による核酸変異解析法 |
| US8975019B2 (en) | 2009-10-19 | 2015-03-10 | University Of Massachusetts | Deducing exon connectivity by RNA-templated DNA ligation/sequencing |
| US20110098193A1 (en) | 2009-10-22 | 2011-04-28 | Kingsmore Stephen F | Methods and Systems for Medical Sequencing Analysis |
| US20120245041A1 (en) | 2009-11-04 | 2012-09-27 | Sydney Brenner | Base-by-base mutation screening |
| JP2013511991A (ja) | 2009-11-25 | 2013-04-11 | クアンタライフ, インコーポレイテッド | 遺伝子材料を検出する方法および組成物 |
| GB0921264D0 (en) | 2009-12-03 | 2010-01-20 | Olink Genomics Ab | Method for amplification of target nucleic acid |
| US20120270739A1 (en) | 2010-01-19 | 2012-10-25 | Verinata Health, Inc. | Method for sample analysis of aneuploidies in maternal samples |
| US20120010085A1 (en) | 2010-01-19 | 2012-01-12 | Rava Richard P | Methods for determining fraction of fetal nucleic acids in maternal samples |
| US20110257889A1 (en) | 2010-02-24 | 2011-10-20 | Pacific Biosciences Of California, Inc. | Sequence assembly and consensus sequence determination |
| CA2793877A1 (en) | 2010-03-22 | 2011-09-29 | Esoterix Genetic Laboratories, Llc | Mutations associated with cystic fibrosis |
| WO2011119115A1 (en) | 2010-03-25 | 2011-09-29 | Agency For Science, Technology And Research | Method of producing recombinant proteins with mannose- terminated n-glycans |
| US20140206552A1 (en) | 2010-05-18 | 2014-07-24 | Natera, Inc. | Methods for preimplantation genetic diagnosis by sequencing |
| WO2011146632A1 (en) | 2010-05-18 | 2011-11-24 | Gene Security Network Inc. | Methods for non-invasive prenatal ploidy calling |
| US9080210B2 (en) | 2010-06-09 | 2015-07-14 | Keygene N.V. | High throughput screening using combinatorial sequence barcodes |
| EP3012329B1 (en) | 2010-06-18 | 2017-10-25 | Myriad Genetics, Inc. | Methods and materials for assessing loss of heterozygosity |
| EP2591433A4 (en) | 2010-07-06 | 2017-05-17 | Life Technologies Corporation | Systems and methods to detect copy number variation |
| WO2012005595A2 (en) | 2010-07-09 | 2012-01-12 | Wouter Leonard De Laat | V3-d genomic region of interest sequencing strategies |
| WO2012018387A2 (en) | 2010-08-02 | 2012-02-09 | Population Diagnotics, Inc. | Compositions and methods for discovery of causative mutations in genetic disorders |
| US20140342940A1 (en) | 2011-01-25 | 2014-11-20 | Ariosa Diagnostics, Inc. | Detection of Target Nucleic Acids using Hybridization |
| US20130332081A1 (en) | 2010-09-09 | 2013-12-12 | Omicia Inc | Variant annotation, analysis and selection tool |
| EP2619329B1 (en) | 2010-09-24 | 2019-05-22 | The Board of Trustees of The Leland Stanford Junior University | Direct capture, amplification and sequencing of target dna using immobilized primers |
| US8715933B2 (en) | 2010-09-27 | 2014-05-06 | Nabsys, Inc. | Assay methods using nicking endonucleases |
| US8430053B2 (en) | 2010-09-30 | 2013-04-30 | Temptime Corporation | Color-changing emulsions for freeze indicators |
| US20120197533A1 (en) | 2010-10-11 | 2012-08-02 | Complete Genomics, Inc. | Identifying rearrangements in a sequenced genome |
| US9163281B2 (en) | 2010-12-23 | 2015-10-20 | Good Start Genetics, Inc. | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
| US11270781B2 (en) | 2011-01-25 | 2022-03-08 | Ariosa Diagnostics, Inc. | Statistical analysis for non-invasive sex chromosome aneuploidy determination |
| AU2012214312A1 (en) | 2011-02-09 | 2013-08-22 | Bio-Rad Laboratories, Inc. | Analysis of nucleic acids |
| RU2671980C2 (ru) | 2011-02-09 | 2018-11-08 | Натера, Инк. | Способы неинвазивного пренатального установления плоидности |
| US8782566B2 (en) | 2011-02-22 | 2014-07-15 | Cisco Technology, Inc. | Using gestures to schedule and manage meetings |
| WO2012122546A2 (en) | 2011-03-09 | 2012-09-13 | Lawrence Ganeshalingam | Biological data networks and methods therefor |
| US20120252686A1 (en) | 2011-03-31 | 2012-10-04 | Good Start Genetics | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
| US8680066B2 (en) | 2011-04-05 | 2014-03-25 | The United States of America as represented by the Development of Veterans Affairs | Methods for determining and inhibiting rheumatoid arthritis associated with the BRAF oncogene in a subject |
| WO2012149171A1 (en) | 2011-04-27 | 2012-11-01 | The Regents Of The University Of California | Designing padlock probes for targeted genomic sequencing |
| ES2605372T3 (es) | 2011-05-31 | 2017-03-14 | Berry Genomics Co., Ltd. | Un dispositivo para detectar el número de copias de cromosomas fetales o cromosomas de células tumorales |
| EP2718466B1 (en) | 2011-06-07 | 2018-08-08 | Icahn School of Medicine at Mount Sinai | Materials and method for identifying spinal muscular atrophy carriers |
| US9733221B2 (en) | 2011-06-09 | 2017-08-15 | Agilent Technologies, Inc. | Injection needle cartridge with integrated sealing force generator |
| US20130178378A1 (en) | 2011-06-09 | 2013-07-11 | Andrew C. Hatch | Multiplex digital pcr |
| WO2013028920A2 (en) | 2011-08-23 | 2013-02-28 | Eagile, Inc. | System for associating rfid tag with upc code, and validating associative encoding of same |
| JP5964432B2 (ja) | 2011-09-21 | 2016-08-03 | ビージーアイ ダイアグノーシス カンパニー リミテッドBgi Diagnosis Co., Ltd. | 単細胞染色体の非整倍数性を確定する方法及びシステム |
| CA2852665A1 (en) | 2011-10-17 | 2013-04-25 | Good Start Genetics, Inc. | Analysis methods |
| EP2814514B1 (en) | 2012-02-16 | 2017-09-13 | Atyr Pharma, Inc. | Histidyl-trna synthetases for treating autoimmune and inflammatory diseases |
| AU2013200876A1 (en) | 2012-02-24 | 2013-09-12 | Callum David Mcdonald | Method of graph processing |
| CA2868836C (en) | 2012-03-26 | 2019-08-06 | The Johns Hopkins University | Rapid aneuploidy detection |
| US8209130B1 (en) | 2012-04-04 | 2012-06-26 | Good Start Genetics, Inc. | Sequence assembly |
| US8812422B2 (en) | 2012-04-09 | 2014-08-19 | Good Start Genetics, Inc. | Variant database |
| US10227635B2 (en) | 2012-04-16 | 2019-03-12 | Molecular Loop Biosolutions, Llc | Capture reactions |
| EP3978621B1 (en) | 2012-05-21 | 2023-08-30 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US9193992B2 (en) | 2012-06-05 | 2015-11-24 | Agilent Technologies, Inc. | Method for determining ploidy of a cell |
| CA2877094A1 (en) | 2012-06-18 | 2013-12-27 | Nugen Technologies, Inc. | Compositions and methods for negative selection of non-desired nucleic acid sequences |
| EP2891099A4 (en) | 2012-08-28 | 2016-04-20 | Broad Inst Inc | DETECTION OF DATA SEQUENCING AND BENCHMARKING VARIANTS |
| CA2885834A1 (en) | 2012-09-27 | 2014-04-03 | The Children's Mercy Hospital | System for genome analysis and genetic disease diagnosis |
| EP2922402A4 (en) | 2012-10-10 | 2016-11-09 | Univ Columbia | DIAGNOSIS AND TREATMENT OF SMA AND SMN LACK |
| CA2888779A1 (en) | 2012-11-07 | 2014-05-15 | Good Start Genetics, Inc. | Validation of genetic tests |
| US20140222349A1 (en) | 2013-01-16 | 2014-08-07 | Assurerx Health, Inc. | System and Methods for Pharmacogenomic Classification |
| WO2014116881A1 (en) | 2013-01-23 | 2014-07-31 | Reproductive Genetics And Technology Solutions, Llc | Compositions and methods for genetic analysis of embryos |
| WO2014165267A2 (en) | 2013-03-12 | 2014-10-09 | Counsyl, Inc. | Systems and methods for prenatal genetic analysis |
| WO2014152990A1 (en) | 2013-03-14 | 2014-09-25 | University Of Rochester | System and method for detecting population variation from nucleic acid sequencing data |
| EP2971159B1 (en) | 2013-03-14 | 2019-05-08 | Molecular Loop Biosolutions, LLC | Methods for analyzing nucleic acids |
| WO2014197377A2 (en) | 2013-06-03 | 2014-12-11 | Good Start Genetics, Inc. | Methods and systems for storing sequence read data |
| US9579656B2 (en) | 2013-06-11 | 2017-02-28 | J. G. Finneran Associates, Inc. | Rotation-limiting well plate assembly |
| US9116866B2 (en) | 2013-08-21 | 2015-08-25 | Seven Bridges Genomics Inc. | Methods and systems for detecting sequence variants |
| EP3058096A1 (en) | 2013-10-18 | 2016-08-24 | Good Start Genetics, Inc. | Methods for assessing a genomic region of a subject |
| WO2015058086A1 (en) | 2013-10-18 | 2015-04-23 | Good Start Genetics, Inc. | Methods for copy number determination |
| ES2833299T3 (es) | 2014-02-04 | 2021-06-14 | Jumpcode Genomics Inc | Fraccionamiento del genoma |
| WO2016040446A1 (en) | 2014-09-10 | 2016-03-17 | Good Start Genetics, Inc. | Methods for selectively suppressing non-target sequences |
| WO2016112073A1 (en) | 2015-01-06 | 2016-07-14 | Good Start Genetics, Inc. | Screening for structural variants |
| JP2018512080A (ja) | 2015-01-15 | 2018-05-10 | グッド スタート ジェネティクス, インコーポレイテッド | 個々のウェルおよび容器にバーコードを付するためのデバイスおよびシステム |
| WO2017020023A2 (en) | 2015-07-29 | 2017-02-02 | Progenity, Inc. | Nucleic acids and methods for detecting chromosomal abnormalities |
-
2010
- 2010-04-30 EP EP10770071A patent/EP2425240A4/en not_active Ceased
- 2010-04-30 JP JP2012508490A patent/JP2012525147A/ja active Pending
- 2010-04-30 WO PCT/US2010/001293 patent/WO2010126614A2/en not_active Ceased
- 2010-04-30 AU AU2010242073A patent/AU2010242073C1/en not_active Ceased
- 2010-04-30 CA CA2760439A patent/CA2760439A1/en not_active Abandoned
-
2011
- 2011-10-30 IL IL216054A patent/IL216054A/en active IP Right Grant
-
2015
- 2015-08-24 JP JP2015164811A patent/JP2016000046A/ja active Pending
-
2020
- 2020-11-19 US US16/952,764 patent/US11840730B1/en active Active
-
2023
- 2023-10-10 US US18/483,878 patent/US20240327908A1/en not_active Abandoned
Non-Patent Citations (1)
| Title |
|---|
| See references of EP2425240A4 * |
Cited By (268)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10000800B2 (en) | 2009-04-30 | 2018-06-19 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US11447822B2 (en) | 2009-04-30 | 2022-09-20 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US10501793B2 (en) | 2009-04-30 | 2019-12-10 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US11840730B1 (en) | 2009-04-30 | 2023-12-12 | Molecular Loop Biosciences, Inc. | Methods and compositions for evaluating genetic markers |
| US10266884B2 (en) | 2009-04-30 | 2019-04-23 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US12129514B2 (en) | 2009-04-30 | 2024-10-29 | Molecular Loop Biosolutions, Llc | Methods and compositions for evaluating genetic markers |
| US10266883B2 (en) | 2009-04-30 | 2019-04-23 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US10119165B2 (en) | 2009-04-30 | 2018-11-06 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US11499187B2 (en) | 2009-04-30 | 2022-11-15 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US11352665B2 (en) | 2009-04-30 | 2022-06-07 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US11339432B2 (en) | 2009-04-30 | 2022-05-24 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US11499188B2 (en) | 2009-04-30 | 2022-11-15 | Prognosys Biosciences, Inc. | Nucleic acid constructs and methods of use |
| US12297487B2 (en) | 2010-04-05 | 2025-05-13 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11384386B2 (en) | 2010-04-05 | 2022-07-12 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11293917B2 (en) | 2010-04-05 | 2022-04-05 | Prognosys Biosciences, Inc. | Systems for analyzing target biological molecules via sample imaging and delivery of probes to substrate wells |
| US11542543B2 (en) | 2010-04-05 | 2023-01-03 | Prognosys Biosciences, Inc. | System for analyzing targets of a tissue section |
| US11208684B2 (en) | 2010-04-05 | 2021-12-28 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11549138B2 (en) | 2010-04-05 | 2023-01-10 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12234505B2 (en) | 2010-04-05 | 2025-02-25 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11560587B2 (en) | 2010-04-05 | 2023-01-24 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11156603B2 (en) | 2010-04-05 | 2021-10-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11634756B2 (en) | 2010-04-05 | 2023-04-25 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11067567B2 (en) | 2010-04-05 | 2021-07-20 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11732292B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays correlating target nucleic acid to tissue section location |
| US11313856B2 (en) | 2010-04-05 | 2022-04-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12297488B2 (en) | 2010-04-05 | 2025-05-13 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10787701B2 (en) | 2010-04-05 | 2020-09-29 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11733238B2 (en) | 2010-04-05 | 2023-08-22 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11365442B2 (en) | 2010-04-05 | 2022-06-21 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11008607B2 (en) | 2010-04-05 | 2021-05-18 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11866770B2 (en) | 2010-04-05 | 2024-01-09 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11001878B1 (en) | 2010-04-05 | 2021-05-11 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11371086B2 (en) | 2010-04-05 | 2022-06-28 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11519022B2 (en) | 2010-04-05 | 2022-12-06 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10308982B2 (en) | 2010-04-05 | 2019-06-04 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11001879B1 (en) | 2010-04-05 | 2021-05-11 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11401545B2 (en) | 2010-04-05 | 2022-08-02 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10996219B2 (en) | 2010-04-05 | 2021-05-04 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10982268B2 (en) | 2010-04-05 | 2021-04-20 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10472669B2 (en) | 2010-04-05 | 2019-11-12 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10480022B2 (en) | 2010-04-05 | 2019-11-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10494667B2 (en) | 2010-04-05 | 2019-12-03 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11479810B1 (en) | 2010-04-05 | 2022-10-25 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10983113B2 (en) | 2010-04-05 | 2021-04-20 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10612079B2 (en) | 2010-04-05 | 2020-04-07 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10619196B1 (en) | 2010-04-05 | 2020-04-14 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10961566B2 (en) | 2010-04-05 | 2021-03-30 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10662467B2 (en) | 2010-04-05 | 2020-05-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10662468B2 (en) | 2010-04-05 | 2020-05-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10962532B2 (en) | 2010-04-05 | 2021-03-30 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12391979B2 (en) | 2010-04-05 | 2025-08-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US12391980B2 (en) | 2010-04-05 | 2025-08-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10914730B2 (en) | 2010-04-05 | 2021-02-09 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11761030B2 (en) | 2010-04-05 | 2023-09-19 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US11767550B2 (en) | 2010-04-05 | 2023-09-26 | Prognosys Biosciences, Inc. | Spatially encoded biological assays |
| US10787706B2 (en) | 2010-12-16 | 2020-09-29 | Gigagen, Inc. | System and methods for massively parallel analysis of nucleic acids in single cells |
| US9695474B2 (en) | 2010-12-16 | 2017-07-04 | Gigagen, Inc. | System and methods for massively parallel analysis of nucleic acids in single cells |
| US11591652B2 (en) | 2010-12-16 | 2023-02-28 | Gigagen, Inc. | System and methods for massively parallel analysis of nucleic acids in single cells |
| US11053543B2 (en) | 2010-12-16 | 2021-07-06 | Gigagen, Inc. | System and methods for massively parallel analysis of nucleic acids in single cells |
| US10465243B2 (en) | 2010-12-16 | 2019-11-05 | Gigagen, Inc. | System and methods for massively parallel analysis of nucleic acids in single cells |
| US10106789B2 (en) | 2010-12-16 | 2018-10-23 | Gigagen, Inc. | System and methods for massively parallel analysis of nucleic acids in single cells |
| US11041851B2 (en) | 2010-12-23 | 2021-06-22 | Molecular Loop Biosciences, Inc. | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
| US11768200B2 (en) | 2010-12-23 | 2023-09-26 | Molecular Loop Biosciences, Inc. | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
| US11041852B2 (en) | 2010-12-23 | 2021-06-22 | Molecular Loop Biosciences, Inc. | Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction |
| US11788122B2 (en) | 2011-04-13 | 2023-10-17 | 10X Genomics Sweden Ab | Methods of detecting analytes |
| US11352659B2 (en) | 2011-04-13 | 2022-06-07 | Spatial Transcriptomics Ab | Methods of detecting analytes |
| US11795498B2 (en) | 2011-04-13 | 2023-10-24 | 10X Genomics Sweden Ab | Methods of detecting analytes |
| US11479809B2 (en) | 2011-04-13 | 2022-10-25 | Spatial Transcriptomics Ab | Methods of detecting analytes |
| US12252743B2 (en) | 2011-04-15 | 2025-03-18 | The Johns Hopkins University | Safe sequencing system |
| EP2697397B1 (en) | 2011-04-15 | 2017-04-05 | The Johns Hopkins University | Safe sequencing system |
| US11180803B2 (en) | 2011-04-15 | 2021-11-23 | The Johns Hopkins University | Safe sequencing system |
| US12209281B2 (en) | 2011-04-15 | 2025-01-28 | The Johns Hopkins University | Safe sequencing system |
| US11773440B2 (en) | 2011-04-15 | 2023-10-03 | The Johns Hopkins University | Safe sequencing system |
| US12534759B2 (en) | 2011-04-15 | 2026-01-27 | The Johns Hopkins University | Safe sequencing system |
| US12006544B2 (en) | 2011-04-15 | 2024-06-11 | The Johns Hopkins University | Safe sequencing system |
| US11459611B2 (en) | 2011-04-15 | 2022-10-04 | The Johns Hopkins University | Safe sequencing system |
| US11453913B2 (en) | 2011-04-15 | 2022-09-27 | The Johns Hopkins University | Safe sequencing system |
| US10988807B2 (en) | 2011-07-08 | 2021-04-27 | Keygene N.V. | Sequence based genotyping based on oligonucleotide ligation assays |
| US11873529B2 (en) | 2011-07-08 | 2024-01-16 | Keygene N.V. | Sequence based genotyping based on oligonucleotide ligation assays |
| US10370710B2 (en) | 2011-10-17 | 2019-08-06 | Good Start Genetics, Inc. | Analysis methods |
| US9822409B2 (en) | 2011-10-17 | 2017-11-21 | Good Start Genetics, Inc. | Analysis methods |
| US9228233B2 (en) | 2011-10-17 | 2016-01-05 | Good Start Genetics, Inc. | Analysis methods |
| WO2013112655A1 (en) * | 2012-01-24 | 2013-08-01 | Gigagen, Inc. | Method for correction of bias in multiplexed amplification |
| US10450606B2 (en) | 2012-02-17 | 2019-10-22 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
| US11441180B2 (en) | 2012-02-17 | 2022-09-13 | Fred Hutchinson Cancer Center | Compositions and methods for accurately identifying mutations |
| EP2814959B1 (en) | 2012-02-17 | 2018-01-17 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
| EP3363901B1 (en) * | 2012-02-17 | 2020-12-30 | Fred Hutchinson Cancer Research Center | Compositions and methods for accurately identifying mutations |
| US11149308B2 (en) | 2012-04-04 | 2021-10-19 | Invitae Corporation | Sequence assembly |
| US10604799B2 (en) | 2012-04-04 | 2020-03-31 | Molecular Loop Biosolutions, Llc | Sequence assembly |
| US11667965B2 (en) | 2012-04-04 | 2023-06-06 | Invitae Corporation | Sequence assembly |
| US11155863B2 (en) | 2012-04-04 | 2021-10-26 | Invitae Corporation | Sequence assembly |
| US9298804B2 (en) | 2012-04-09 | 2016-03-29 | Good Start Genetics, Inc. | Variant database |
| US8812422B2 (en) | 2012-04-09 | 2014-08-19 | Good Start Genetics, Inc. | Variant database |
| US10227635B2 (en) | 2012-04-16 | 2019-03-12 | Molecular Loop Biosolutions, Llc | Capture reactions |
| WO2013158540A1 (en) * | 2012-04-16 | 2013-10-24 | Good Start Genetics, Inc. | Capture reactions |
| US10683533B2 (en) | 2012-04-16 | 2020-06-16 | Molecular Loop Biosolutions, Llc | Capture reactions |
| US12110537B2 (en) | 2012-04-16 | 2024-10-08 | Molecular Loop Biosciences, Inc. | Capture reactions |
| USRE50065E1 (en) | 2012-10-17 | 2024-07-30 | 10X Genomics Sweden Ab | Methods and product for optimising localised or spatial detection of gene expression in a tissue sample |
| US11525163B2 (en) | 2012-10-29 | 2022-12-13 | The Johns Hopkins University | Papanicolaou test for ovarian and endometrial cancers |
| US9677124B2 (en) | 2013-03-14 | 2017-06-13 | Good Start Genetics, Inc. | Methods for analyzing nucleic acids |
| US20140308667A1 (en) * | 2013-03-14 | 2014-10-16 | Good Start Genetics, Inc. | Methods for analyzing nucleic acids |
| US9115387B2 (en) * | 2013-03-14 | 2015-08-25 | Good Start Genetics, Inc. | Methods for analyzing nucleic acids |
| US8778609B1 (en) * | 2013-03-14 | 2014-07-15 | Good Start Genetics, Inc. | Methods for analyzing nucleic acids |
| US10202637B2 (en) | 2013-03-14 | 2019-02-12 | Molecular Loop Biosolutions, Llc | Methods for analyzing nucleic acid |
| WO2014143994A3 (en) * | 2013-03-15 | 2015-02-19 | Good Start Genetics, Inc. | Methods and compositions for evaluating genetic markers |
| EP2979168A4 (en) * | 2013-03-29 | 2016-11-23 | Univ Washington Ct Commerciali | SYSTEMS, ALGORITHMS AND SOFTWARE FOR THE DESIGN OF A MOLECULAR INVERSION PROBE (MIP) |
| US9535920B2 (en) | 2013-06-03 | 2017-01-03 | Good Start Genetics, Inc. | Methods and systems for storing sequence read data |
| US10706017B2 (en) | 2013-06-03 | 2020-07-07 | Good Start Genetics, Inc. | Methods and systems for storing sequence read data |
| US10774372B2 (en) | 2013-06-25 | 2020-09-15 | Prognosy s Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11359228B2 (en) | 2013-06-25 | 2022-06-14 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11046996B1 (en) | 2013-06-25 | 2021-06-29 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11753674B2 (en) | 2013-06-25 | 2023-09-12 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US10927403B2 (en) | 2013-06-25 | 2021-02-23 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11286515B2 (en) | 2013-06-25 | 2022-03-29 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11821024B2 (en) | 2013-06-25 | 2023-11-21 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| US11618918B2 (en) | 2013-06-25 | 2023-04-04 | Prognosys Biosciences, Inc. | Methods and systems for determining spatial patterns of biological targets in a sample |
| CN105980574A (zh) * | 2013-08-02 | 2016-09-28 | 豪夫迈·罗氏有限公司 | 使用专门捕获探针(heatseq)的序列捕获方法 |
| WO2015014962A1 (en) * | 2013-08-02 | 2015-02-05 | F. Hoffmann-La Roche Ag | Sequence capture method using specialized capture probes (heatseq) |
| US10851414B2 (en) | 2013-10-18 | 2020-12-01 | Good Start Genetics, Inc. | Methods for determining carrier status |
| WO2015057512A1 (en) * | 2013-10-18 | 2015-04-23 | Good Start Genetics, Inc. | Methods for determining carrier status |
| US11041203B2 (en) | 2013-10-18 | 2021-06-22 | Molecular Loop Biosolutions, Inc. | Methods for assessing a genomic region of a subject |
| US12077822B2 (en) | 2013-10-18 | 2024-09-03 | Molecular Loop Biosciences, Inc. | Methods for determining carrier status |
| US11053548B2 (en) | 2014-05-12 | 2021-07-06 | Good Start Genetics, Inc. | Methods for detecting aneuploidy |
| US11486002B2 (en) | 2014-06-06 | 2022-11-01 | Cornell University | Method for identification and enumeration of nucleic acid sequence, expression, copy, or DNA methylation changes, using combined nuclease, ligase, polymerase, and sequencing reactions |
| EP3889271A1 (en) * | 2014-06-06 | 2021-10-06 | Cornell University | Method for identification and enumeration of nucleic acid sequence, expression, copy, or dna methylation changes, using combined nuclease, ligase, polymerase, and sequencing reactions |
| US10839939B2 (en) | 2014-06-26 | 2020-11-17 | 10X Genomics, Inc. | Processes and systems for nucleic acid sequence assembly |
| US11133084B2 (en) | 2014-06-26 | 2021-09-28 | 10X Genomics, Inc. | Systems and methods for nucleic acid sequence assembly |
| US12386895B2 (en) | 2014-08-15 | 2025-08-12 | Laboratory Corporation Of America Holdings | Systems and methods for genetic analysis |
| US11408024B2 (en) | 2014-09-10 | 2022-08-09 | Molecular Loop Biosciences, Inc. | Methods for selectively suppressing non-target sequences |
| US10429399B2 (en) | 2014-09-24 | 2019-10-01 | Good Start Genetics, Inc. | Process control for increased robustness of genetic assays |
| US10066259B2 (en) | 2015-01-06 | 2018-09-04 | Good Start Genetics, Inc. | Screening for structural variants |
| US11680284B2 (en) | 2015-01-06 | 2023-06-20 | Moledular Loop Biosciences, Inc. | Screening for structural variants |
| US10650912B2 (en) | 2015-01-13 | 2020-05-12 | 10X Genomics, Inc. | Systems and methods for visualizing structural variation and phasing information |
| US12387821B2 (en) | 2015-01-13 | 2025-08-12 | 10X Genomics, Inc. | Systems and methods for visualizing structural variation and phasing information |
| US10774374B2 (en) | 2015-04-10 | 2020-09-15 | Spatial Transcriptomics AB and Illumina, Inc. | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11613773B2 (en) | 2015-04-10 | 2023-03-28 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11299774B2 (en) | 2015-04-10 | 2022-04-12 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11162132B2 (en) | 2015-04-10 | 2021-11-02 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11739372B2 (en) | 2015-04-10 | 2023-08-29 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11390912B2 (en) | 2015-04-10 | 2022-07-19 | Spatial Transcriptomics Ab | Spatially distinguished, multiplex nucleic acid analysis of biological specimens |
| US11702765B2 (en) | 2015-06-09 | 2023-07-18 | Gigagen, Inc. | Recombinant fusion proteins and libraries from immune cell repertoires |
| US10689641B2 (en) | 2015-06-09 | 2020-06-23 | Gigagen, Inc. | Recombinant fusion proteins and libraries from immune cell repertoires |
| US10214740B2 (en) | 2015-06-09 | 2019-02-26 | Gigagen, Inc. | Recombinant fusion proteins and libraries from immune cell repertoires |
| US9926555B2 (en) | 2015-06-09 | 2018-03-27 | Gigamune, Inc. | Recombinant fusion proteins and libraries from immune cell repertoires |
| US12241178B2 (en) | 2015-06-09 | 2025-03-04 | Gigagen, Inc. | Recombinant fusion proteins and libraries from immune cell repertoires |
| US9926554B2 (en) | 2015-06-09 | 2018-03-27 | Gigamune, Inc. | Recombinant fusion proteins and libraries from immune cell repertoires |
| US9738699B2 (en) | 2015-06-09 | 2017-08-22 | Gigagen, Inc. | Recombinant fusion proteins and libraries from immune cell repertoires |
| WO2017020024A3 (en) * | 2015-07-29 | 2017-03-09 | Progenity, Inc. | Systems and methods for genetic analysis |
| US10947595B2 (en) | 2015-07-29 | 2021-03-16 | Progenity, Inc. | Nucleic acids and methods for detecting chromosomal abnormalities |
| CN108138220A (zh) * | 2015-07-29 | 2018-06-08 | 普罗格尼迪公司 | 遗传分析的系统和方法 |
| US11286531B2 (en) | 2015-08-11 | 2022-03-29 | The Johns Hopkins University | Assaying ovarian cyst fluid |
| US11081208B2 (en) | 2016-02-11 | 2021-08-03 | 10X Genomics, Inc. | Systems, methods, and media for de novo assembly of whole genome sequence data |
| WO2018174821A1 (en) * | 2017-03-20 | 2018-09-27 | Nanyang Technological University | A sequencing method for detecting dna mutation |
| US11584958B2 (en) | 2017-03-31 | 2023-02-21 | Grail, Llc | Library preparation and use thereof for sequencing based error correction and/or variant identification |
| US12195803B2 (en) | 2017-08-07 | 2025-01-14 | The Johns Hopkins University | Methods and materials for assessing and treating cancer |
| US12270077B2 (en) | 2018-08-28 | 2025-04-08 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US12378607B2 (en) | 2018-08-28 | 2025-08-05 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US11519033B2 (en) | 2018-08-28 | 2022-12-06 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US12344892B2 (en) | 2018-08-28 | 2025-07-01 | 10X Genomics, Inc. | Method for transposase-mediated spatial tagging and analyzing genomic DNA in a biological sample |
| US12385083B2 (en) | 2018-12-10 | 2025-08-12 | 10X Genomics, Inc. | Methods of using master / copy arrays for spatial detection |
| US12497654B2 (en) | 2018-12-10 | 2025-12-16 | 10X Genomics, Inc. | Resolving spatial arrays by proximity-based deconvolution |
| US12545949B2 (en) | 2018-12-10 | 2026-02-10 | 10X Genomics, Inc. | Resolving spatial arrays using deconvolution |
| US12404544B2 (en) | 2018-12-10 | 2025-09-02 | 10X Genomics, Inc. | Methods of capturing multiple analytes on a spatial array |
| US12180543B2 (en) | 2018-12-10 | 2024-12-31 | 10X Genomics, Inc. | Imaging system hardware |
| US11933957B1 (en) | 2018-12-10 | 2024-03-19 | 10X Genomics, Inc. | Imaging system hardware |
| US12024741B2 (en) | 2018-12-10 | 2024-07-02 | 10X Genomics, Inc. | Imaging system hardware |
| US12529094B2 (en) | 2018-12-10 | 2026-01-20 | 10X Genomics, Inc. | Imaging system hardware |
| US11926867B2 (en) | 2019-01-06 | 2024-03-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US11649485B2 (en) | 2019-01-06 | 2023-05-16 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US11753675B2 (en) | 2019-01-06 | 2023-09-12 | 10X Genomics, Inc. | Generating capture probes for spatial analysis |
| US12497711B2 (en) | 2019-03-21 | 2025-12-16 | Gigamune, Inc. | Engineered cells expressing anti-viral T cell receptors and methods of use thereof |
| US11421220B2 (en) | 2019-03-21 | 2022-08-23 | Gigamune, Inc. | Engineered cells expressing anti-viral T cell receptors and methods of use thereof |
| US11959129B2 (en) | 2019-04-02 | 2024-04-16 | Enumera Molecular, Inc. | Methods, systems, and compositions for counting nucleic acid molecules |
| US11965213B2 (en) | 2019-05-30 | 2024-04-23 | 10X Genomics, Inc. | Methods of detecting spatial heterogeneity of a biological sample |
| US12442045B2 (en) | 2019-05-30 | 2025-10-14 | 10X Genomics, Inc. | Methods of detecting spatial heterogeneity of a biological sample |
| US12157124B2 (en) | 2019-11-06 | 2024-12-03 | 10X Genomics, Inc. | Imaging system hardware |
| US11592447B2 (en) | 2019-11-08 | 2023-02-28 | 10X Genomics, Inc. | Spatially-tagged analyte capture agents for analyte multiplexing |
| US11702698B2 (en) | 2019-11-08 | 2023-07-18 | 10X Genomics, Inc. | Enhancing specificity of analyte binding |
| US11808769B2 (en) | 2019-11-08 | 2023-11-07 | 10X Genomics, Inc. | Spatially-tagged analyte capture agents for analyte multiplexing |
| US11332790B2 (en) | 2019-12-23 | 2022-05-17 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| US11560593B2 (en) | 2019-12-23 | 2023-01-24 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| US11981965B2 (en) | 2019-12-23 | 2024-05-14 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| US12566113B2 (en) | 2019-12-23 | 2026-03-03 | 10X Genomics, Inc. | Reversible fixing reagents and methods of use thereof |
| US11505828B2 (en) | 2019-12-23 | 2022-11-22 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| US12117439B2 (en) | 2019-12-23 | 2024-10-15 | 10X Genomics, Inc. | Compositions and methods for using fixed biological samples |
| US12241890B2 (en) | 2019-12-23 | 2025-03-04 | 10X Genomics, Inc. | Methods for generating barcoded nucleic acid molecules using fixed cells |
| US11795507B2 (en) | 2019-12-23 | 2023-10-24 | 10X Genomics, Inc. | Methods for spatial analysis using RNA-templated ligation |
| US12365942B2 (en) | 2020-01-13 | 2025-07-22 | 10X Genomics, Inc. | Methods of decreasing background on a spatial array |
| US12405264B2 (en) | 2020-01-17 | 2025-09-02 | 10X Genomics, Inc. | Electrophoretic system and method for analyte capture |
| US11732299B2 (en) | 2020-01-21 | 2023-08-22 | 10X Genomics, Inc. | Spatial assays with perturbed cells |
| US11702693B2 (en) | 2020-01-21 | 2023-07-18 | 10X Genomics, Inc. | Methods for printing cells and generating arrays of barcoded cells |
| US12297486B2 (en) | 2020-01-24 | 2025-05-13 | 10X Genomics, Inc. | Methods for spatial analysis using proximity ligation |
| US11821035B1 (en) | 2020-01-29 | 2023-11-21 | 10X Genomics, Inc. | Compositions and methods of making gene expression libraries |
| US12076701B2 (en) | 2020-01-31 | 2024-09-03 | 10X Genomics, Inc. | Capturing oligonucleotides in spatial transcriptomics |
| US11898205B2 (en) | 2020-02-03 | 2024-02-13 | 10X Genomics, Inc. | Increasing capture efficiency of spatial assays |
| US12110541B2 (en) | 2020-02-03 | 2024-10-08 | 10X Genomics, Inc. | Methods for preparing high-resolution spatial arrays |
| US12286673B2 (en) | 2020-02-05 | 2025-04-29 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US11732300B2 (en) | 2020-02-05 | 2023-08-22 | 10X Genomics, Inc. | Increasing efficiency of spatial analysis in a biological sample |
| US12129516B2 (en) | 2020-02-07 | 2024-10-29 | 10X Genomics, Inc. | Quantitative and automated permeabilization performance evaluation for spatial transcriptomics |
| US11835462B2 (en) | 2020-02-11 | 2023-12-05 | 10X Genomics, Inc. | Methods and compositions for partitioning a biological sample |
| US12421558B2 (en) | 2020-02-13 | 2025-09-23 | 10X Genomics, Inc. | Systems and methods for joint interactive visualization of gene expression and DNA chromatin accessibility |
| US12442038B2 (en) | 2020-02-14 | 2025-10-14 | The Johns Hopkins University | Methods and materials for assessing nucleic acids |
| US12399123B1 (en) | 2020-02-14 | 2025-08-26 | 10X Genomics, Inc. | Spatial targeting of analytes |
| US12553082B2 (en) | 2020-02-14 | 2026-02-17 | The Johns Hopkins University | Methods and materials for assessing nucleic acids |
| US12281357B1 (en) | 2020-02-14 | 2025-04-22 | 10X Genomics, Inc. | In situ spatial barcoding |
| US11891654B2 (en) | 2020-02-24 | 2024-02-06 | 10X Genomics, Inc. | Methods of making gene expression libraries |
| US11926863B1 (en) | 2020-02-27 | 2024-03-12 | 10X Genomics, Inc. | Solid state single cell method for analyzing fixed biological cells |
| US12228544B2 (en) | 2020-03-04 | 2025-02-18 | 10X Genomics, Inc. | Electrophoretic methods for spatial analysis |
| US11768175B1 (en) | 2020-03-04 | 2023-09-26 | 10X Genomics, Inc. | Electrophoretic methods for spatial analysis |
| WO2021216622A1 (en) * | 2020-04-21 | 2021-10-28 | Aspen Neuroscience, Inc. | Gene editing of gba1 in stem cells and method of use of cells differentiated therefrom |
| US11773433B2 (en) | 2020-04-22 | 2023-10-03 | 10X Genomics, Inc. | Methods for spatial analysis using targeted RNA depletion |
| US11535887B2 (en) | 2020-04-22 | 2022-12-27 | 10X Genomics, Inc. | Methods for spatial analysis using targeted RNA depletion |
| US12416603B2 (en) | 2020-05-19 | 2025-09-16 | 10X Genomics, Inc. | Electrophoresis cassettes and instrumentation |
| US11608520B2 (en) | 2020-05-22 | 2023-03-21 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
| US11624086B2 (en) | 2020-05-22 | 2023-04-11 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| US11959130B2 (en) | 2020-05-22 | 2024-04-16 | 10X Genomics, Inc. | Spatial analysis to detect sequence variants |
| US11866767B2 (en) | 2020-05-22 | 2024-01-09 | 10X Genomics, Inc. | Simultaneous spatio-temporal measurement of gene expression and cellular activity |
| US11560592B2 (en) | 2020-05-26 | 2023-01-24 | 10X Genomics, Inc. | Method for resetting an array |
| US11859178B2 (en) | 2020-06-02 | 2024-01-02 | 10X Genomics, Inc. | Nucleic acid library methods |
| US11840687B2 (en) | 2020-06-02 | 2023-12-12 | 10X Genomics, Inc. | Nucleic acid library methods |
| US11845979B2 (en) | 2020-06-02 | 2023-12-19 | 10X Genomics, Inc. | Spatial transcriptomics for antigen-receptors |
| US12098417B2 (en) | 2020-06-02 | 2024-09-24 | 10X Genomics, Inc. | Spatial transcriptomics for antigen-receptors |
| US11608498B2 (en) | 2020-06-02 | 2023-03-21 | 10X Genomics, Inc. | Nucleic acid library methods |
| US11512308B2 (en) | 2020-06-02 | 2022-11-29 | 10X Genomics, Inc. | Nucleic acid library methods |
| US12265079B1 (en) | 2020-06-02 | 2025-04-01 | 10X Genomics, Inc. | Systems and methods for detecting analytes from captured single biological particles |
| US11692218B2 (en) | 2020-06-02 | 2023-07-04 | 10X Genomics, Inc. | Spatial transcriptomics for antigen-receptors |
| US12031177B1 (en) | 2020-06-04 | 2024-07-09 | 10X Genomics, Inc. | Methods of enhancing spatial resolution of transcripts |
| US11492612B1 (en) | 2020-06-08 | 2022-11-08 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US11407992B2 (en) | 2020-06-08 | 2022-08-09 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US11624063B2 (en) | 2020-06-08 | 2023-04-11 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US11781130B2 (en) | 2020-06-08 | 2023-10-10 | 10X Genomics, Inc. | Methods of determining a surgical margin and methods of use thereof |
| US12508590B2 (en) | 2020-06-10 | 2025-12-30 | 10X Genomics, Inc. | Fluid delivery methods |
| US12435363B1 (en) | 2020-06-10 | 2025-10-07 | 10X Genomics, Inc. | Materials and methods for spatial transcriptomics |
| US11434524B2 (en) | 2020-06-10 | 2022-09-06 | 10X Genomics, Inc. | Methods for determining a location of an analyte in a biological sample |
| US12128403B2 (en) | 2020-06-10 | 2024-10-29 | 10X Genomics, Inc. | Fluid delivery methods |
| US12060604B2 (en) | 2020-06-25 | 2024-08-13 | 10X Genomics, Inc. | Spatial analysis of epigenetic modifications |
| US11661626B2 (en) | 2020-06-25 | 2023-05-30 | 10X Genomics, Inc. | Spatial analysis of DNA methylation |
| US11408029B2 (en) | 2020-06-25 | 2022-08-09 | 10X Genomics, Inc. | Spatial analysis of DNA methylation |
| US11981960B1 (en) | 2020-07-06 | 2024-05-14 | 10X Genomics, Inc. | Spatial analysis utilizing degradable hydrogels |
| US12209280B1 (en) | 2020-07-06 | 2025-01-28 | 10X Genomics, Inc. | Methods of identifying abundance and location of an analyte in a biological sample using second strand synthesis |
| US11952627B2 (en) | 2020-07-06 | 2024-04-09 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
| US11761038B1 (en) | 2020-07-06 | 2023-09-19 | 10X Genomics, Inc. | Methods for identifying a location of an RNA in a biological sample |
| US12553898B1 (en) | 2020-08-10 | 2026-02-17 | 10X Genomics, Inc. | Fluorescent hybridization of antibody-oligonucleotide for multiplexing and signal amplification |
| US11981958B1 (en) | 2020-08-20 | 2024-05-14 | 10X Genomics, Inc. | Methods for spatial analysis using DNA capture |
| US12249085B2 (en) | 2020-09-18 | 2025-03-11 | 10X Genomics, Inc. | Sample handling apparatus and image registration methods |
| US11926822B1 (en) | 2020-09-23 | 2024-03-12 | 10X Genomics, Inc. | Three-dimensional spatial analysis |
| US11827935B1 (en) | 2020-11-19 | 2023-11-28 | 10X Genomics, Inc. | Methods for spatial analysis using rolling circle amplification and detection probes |
| US12241060B2 (en) | 2020-12-21 | 2025-03-04 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US11959076B2 (en) | 2020-12-21 | 2024-04-16 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US11680260B2 (en) | 2020-12-21 | 2023-06-20 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
| US12371688B2 (en) | 2020-12-21 | 2025-07-29 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
| US11873482B2 (en) | 2020-12-21 | 2024-01-16 | 10X Genomics, Inc. | Methods, compositions, and systems for spatial analysis of analytes in a biological sample |
| US11618897B2 (en) | 2020-12-21 | 2023-04-04 | 10X Genomics, Inc. | Methods, compositions, and systems for capturing probes and/or barcodes |
| US12566114B2 (en) | 2021-02-19 | 2026-03-03 | 10X Genomics, Inc. | Methods of using modular assay support devices |
| US12098985B2 (en) | 2021-02-19 | 2024-09-24 | 10X Genomics, Inc. | Modular assay support devices |
| US12287264B2 (en) | 2021-02-19 | 2025-04-29 | 10X Genomics, Inc. | Modular assay support devices |
| US11739381B2 (en) | 2021-03-18 | 2023-08-29 | 10X Genomics, Inc. | Multiplex capture of gene and protein expression from a biological sample |
| US11970739B2 (en) | 2021-03-18 | 2024-04-30 | 10X Genomics, Inc. | Multiplex capture of gene and protein expression from a biological sample |
| US12203134B2 (en) | 2021-04-14 | 2025-01-21 | 10X Genomics, Inc. | Methods of measuring mislocalization of an analyte |
| US12365935B2 (en) | 2021-05-06 | 2025-07-22 | 10X Genomics, Inc. | Methods for increasing resolution of spatial analysis |
| US12071655B2 (en) | 2021-06-03 | 2024-08-27 | 10X Genomics, Inc. | Methods, compositions, kits, and systems for enhancing analyte capture for spatial analysis |
| US12553805B2 (en) | 2021-08-02 | 2026-02-17 | 10X Genomics, Inc. | Methods of preserving a biological sample |
| US11840724B2 (en) | 2021-09-01 | 2023-12-12 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| US11753673B2 (en) | 2021-09-01 | 2023-09-12 | 10X Genomics, Inc. | Methods, compositions, and kits for blocking a capture probe on a spatial array |
| US12275988B2 (en) | 2021-11-10 | 2025-04-15 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of an analyte in a biological sample |
| US12195790B2 (en) | 2021-12-01 | 2025-01-14 | 10X Genomics, Inc. | Methods for improved in situ detection of nucleic acids and spatial analysis |
| US12223751B2 (en) | 2021-12-20 | 2025-02-11 | 10X Genomics, Inc. | Self-test for imaging device |
| US12571029B1 (en) | 2022-11-09 | 2026-03-10 | 10X Genomics, Inc. | Methods, compositions, and kits for determining the location of multiple analytes in a biological sample |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2425240A2 (en) | 2012-03-07 |
| US20240327908A1 (en) | 2024-10-03 |
| AU2010242073A1 (en) | 2011-11-24 |
| AU2010242073C1 (en) | 2015-12-24 |
| CA2760439A1 (en) | 2010-11-04 |
| JP2012525147A (ja) | 2012-10-22 |
| US11840730B1 (en) | 2023-12-12 |
| IL216054A0 (en) | 2012-01-31 |
| AU2010242073B2 (en) | 2015-09-03 |
| WO2010126614A3 (en) | 2011-03-17 |
| IL216054A (en) | 2016-03-31 |
| EP2425240A4 (en) | 2012-12-12 |
| JP2016000046A (ja) | 2016-01-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240327908A1 (en) | Methods and compositions for evaluating genetic markers | |
| US20120165202A1 (en) | Methods and compositions for evaluating genetic markers | |
| US12129514B2 (en) | Methods and compositions for evaluating genetic markers | |
| AU2018214075B2 (en) | Systems and methods for prenatal genetic analysis | |
| ES2971972T3 (es) | Análisis estadístico para la determinación no invasiva de aneuploidía del cromosoma Y | |
| US20150184233A1 (en) | Quantification of nucleic acids and proteins using oligonucleotide mass tags | |
| WO2014101655A1 (zh) | 一种高通量核酸分析方法及其应用 | |
| JP2015522293A (ja) | 多重化連続ライゲーションに基づく遺伝子変異体の検出 | |
| AU2019283856B2 (en) | Non-invasive fetal sex determination | |
| US20180171395A1 (en) | Enzymatic methods for genotyping on arrays | |
| CN113913493A (zh) | 一种靶基因区域快速富集方法 | |
| EP2971114A2 (en) | Methods and compositions for evaluating genetic markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10770071 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2760439 Country of ref document: CA Ref document number: 2012508490 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 216054 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010770071 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 8063/CHENP/2011 Country of ref document: IN |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2010242073 Country of ref document: AU Date of ref document: 20100430 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13266862 Country of ref document: US |