WO2008067223A2 - Il-17a/f heterodimeric polypeptides and therapeutic uses thereof - Google Patents
Il-17a/f heterodimeric polypeptides and therapeutic uses thereof Download PDFInfo
- Publication number
- WO2008067223A2 WO2008067223A2 PCT/US2007/085269 US2007085269W WO2008067223A2 WO 2008067223 A2 WO2008067223 A2 WO 2008067223A2 US 2007085269 W US2007085269 W US 2007085269W WO 2008067223 A2 WO2008067223 A2 WO 2008067223A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- disease
- seq
- antibody
- polypeptide
- acid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
- C07K16/244—Interleukins [IL]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/19—Cytokines; Lymphokines; Interferons
- A61K38/20—Interleukins [IL]
- A61K38/2073—IL-11
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/02—Nasal agents, e.g. decongestants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/04—Antipruritics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/10—Screening for compounds of potential therapeutic value involving cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/24—Immunology or allergic disorders
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates generally to the identification and isolation of a novel human cytokine designated herein as interleukin-17A/F (IL-17A/F).
- IL-17A/F interleukin-17A/F
- Extracellular proteins play important roles in, among other things, the formation, differentiation and maintenance of multicellular organisms.
- secreted polypeptides for instance, mitogenic factors, survival factors, cytotoxic factors, differentiation factors, neuropeptides, and hormones
- secreted polypeptides or signaling molecules normally pass through the cellular secretory pathway to reach their site of action in the extracellular environment.
- Secreted proteins have various industrial applications, including as pharmaceuticals, diagnostics, biosensors and bioreactors. Most protein drugs available at present, such as thrombolytic agents, interferons, interleukins, erythropoietins, colony stimulating factors, and various other cytokines, are secretory proteins. Their receptors, which are membrane proteins, also have potential as therapeutic or diagnostic agents.
- Membrane-bound proteins and receptors can play important roles in, among other things, the formation, differentiation and maintenance of multicellular organisms.
- membrane-bound proteins and cell receptors include, but are not limited to, cytokine receptors, receptor kinases, receptor phosphatases, receptors involved in cell-cell interactions, and cellular adhesin molecules like selectins and integrins. For instance, transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases, enzymes that catalyze that process, can also act as growth factor receptors. Examples include fibroblast growth factor receptor and nerve growth factor receptor.
- membrane-bound proteins and receptor molecules have various industrial applications, including as pharmaceutical and diagnostic agents.
- Receptor immunoadhesins for instance, can be employed as therapeutic agents to block receptor-ligand interactions.
- the membrane-bound proteins can also be employed for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction.
- the present invention relates to identifying novel secreted polypeptides of the interleukin-17 (IL- 17) family which have been shown to be related to immune-mediated and inflammatory disease.
- Immune related and inflammatory diseases are the manifestation or consequence of fairly complex, often multiple interconnected biological pathways which in normal physiology are critical to respond to insult or injury, initiate repair from insult or injury, and mount innate and acquired defense against foreign organisms. Disease or pathology occurs when these normal physiological pathways cause additional insult or injury either as directly related to the intensity of the response, as a consequence of abnormal regulation or excessive stimulation, as a reaction to self, or as a combination of these.
- therapeutic intervention can occur by either antagonism of a detrimental process/pathway or stimulation of a beneficial process/pathway.
- T lymphocytes are an important component of a mammalian immune response. T cells recognize antigens which are associated with a self-molecule encoded by genes within the major histocompatibility complex (MHC). The antigen may be displayed together with MHC molecules on the surface of antigen presenting cells, virus infected cells, cancer cells, grafts, etc.
- MHC major histocompatibility complex
- T cells include helper T cells and cytotoxic T cells.
- Helper T cells proliferate extensively following recognition of an antigen-MHC complex on an antigen presenting cell.
- Helper T cells also secrete a variety of cytokines, Le., lymphokines. which play a central role in the activation of B cells, cytotoxic T cells and a variety of other cells which participate in the immune response.
- helper T cell activation is initiated by the interaction of the T cell receptor (TCR)
- T cell a cascade of biochemical events that induce the resting helper T cell to enter a cell cycle (the GO to Gl transition) and results in the expression of a high affinity receptor for IL-2 and sometimes IL-4.
- the activated T cell progresses through the cycle proliferating and differentiating into memory cells or effector cells.
- activation of T cells involves additional costimulation induced by cytokines released by the antigen presenting cell or through interactions with membrane bound molecules on the antigen presenting cell and the T cell.
- the cytokines IL-I and IL-6 have been shown to provide a costimulatory signal.
- T cell activation the interaction between the B7 molecule expressed on the surface of an antigen presenting cell and CD28 and CTLA-4 molecules expressed on the T cell surface effect T cell activation.
- Activated T cells express an increased number of cellular adhesion molecules, such as ICAM- 1 , integrins, VLA-4, LFA- 1 , CD56, etc.
- T-cell proliferation in a mixed lymphocyte culture or mixed lymphocyte reaction is an established indication of the ability of a compound to stimulate the immune system.
- MLR mixed lymphocyte reaction
- inflammatory cells infiltrate the site of injury or infection.
- the migrating cells may be neutrophilic, eosinophilic, monocytic or lymphocytic as can be determined by histologic examination of the affected tissues.
- Immune related diseases could be treated by suppressing the immune response. Using neutralizing antibodies that inhibit molecules having immune stimulatory activity would be beneficial in the treatment of immune-mediated and inflammatory diseases. Molecules which inhibit the immune response can be utilized (proteins directly or via the use of antibody agonists) to inhibit the immune response and thus ameliorate immune related disease.
- Interleukin- 17 is a T-cell derived pro- inflammatory molecule that stimulates epithelial, endothelial and fibroblastic cells to produce other inflammatory cytokines and chemokines including IL-6, IL- 8, G-CSF, and MCP-I [see, Yao, Z. et al., J. Immunol.. 122(12):5483-5486 (1995); Yao, Z. et al, Immunity, 3(61:81 1-821 (1995); Fossiez, F., et al., J. Exp. Med..
- IL-17 also synergizes with other cytokines including TNF- ⁇ and IL-l ⁇ to further induce chemokine expression (Chabaud, M., et al., J. Immunol. i6_I(l):409-14 (1998)).
- Interleukin 17 (IL-17) exhibits pleitropic biological activities on various types of cells.
- IL- 17 also has the ability to induce ICAM- 1 surface expression, proliferation of T cells, and growth and differentiation of CD34 + human progenitors into neutrophils.
- IL-17 has also been implicated in bone metabolism, and has been suggested to play an important role in pathological conditions characterized by the presence of activated T cells and TNF- ⁇ production such as rheumatoid arthritis and loosening of bone implants (Van Bezooijen et al, J. Bone Miner. Res.. 14: 1513-1521 [1999]).
- Activated T cells of synovial tissue derived from rheumatoid arthritis patients were found to secrete higher amounts of IL- 17 than those derived from normal individuals or osteoarthritis patients (Chabaud et al., Arthritis Rheum., 42: 963-970 [1999]).
- IL-17 seems to contribute to the pathology of rheumatoid arthritis by yet another mechanism.
- ODF osteoclast differentiation factor
- IL-17 is also believed to play a key role in certain other autoimmune disorders such as multiple sclerosis (Matusevicius et al., Mult. Scler..
- IL- 17 has further been shown, by intracellular signalling, to stimulate Ca 2+ influx and a reduction in [cAMP], in human macrophages (Jovanovic et al, J. Immunol., 160:3513 [1998]).
- Fibroblasts treated with IL-17 induce the activation of NF- ⁇ B, [Yao et al., Immunity, 1:811 (1995), Jovanovic et al., supra], while macrophages treated with it activate NF- ⁇ B and mitogen-activated protein kinases (Shalom-Barek et al., L Biol. Chem., 273:27467 [1998]).
- IL-17 also shares sequence similarity with mammalian cytokine-like factor 7 that is involved in bone and cartilage growth.
- mammalian cytokine-like factor 7 that is involved in bone and cartilage growth.
- Other proteins with which DL- 17 polypeptides share sequence similarity are human embryo-derived interleukin-related factor (EDIRF) and interleukin-20.
- IL-17 the cell surface receptor for IL-17 has been found to be widely expressed in many tissues and cell types (Yao et al., Cytokine, 9:794 [1997]). While the amino acid sequence of the human IL-17 receptor (IL-R) (866 amino acids) predicts a protein with a single transmembrane domain and a long, 525 amino acid intracellular domain, the receptor sequence is unique and is not similar to that of any of the receptors from the cytokine/growth factor receptor family. This coupled with the lack of similarity of IL-17 itself to other known proteins indicates that IL- 17 and its receptor may be part of a novel family of signaling proteins and receptors.
- IL-R human IL-17 receptor
- IL-17 activity is mediated through binding to its unique cell surface receptor (designated herein as human IL- 17R), wherein previous studies have shown that contacting T cells with a soluble form of the IL-17 receptor polypeptide inhibited T cell proliferation and IL-2 production induced by PHA, concanavalin A and anti-TCR monoclonal antibody (Yao et al., J. Immunol., 155:5483-5486 [1995]).
- IL-17 receptor unique cell surface receptor
- Interleukin 17 is now recognized as the prototype member of an emerging family of cytokines.
- the large scale sequencing of the human and other vertebrate genomes has revealed the presence of additional genes encoding proteins clearly related to IL-17, thus defining a new family of cytokines.
- There are at least 6 members of the IL- 17 family in humans and mice including IL- 17B, IL- 17C, IL- 17D, IL- 17E and IL- 17F as well as novel receptors IL-17RH1, IL-17RH2, IL- 17RH3 and IL-17RH4 (see WO01/46420 published June 28, 2001).
- IL-17F IL-17 receptor
- IL-17R human IL-17 receptor
- the gene encoding human IL-17F is located adjacent to IL- 17 (Hymowitz, S. G., et al., Embo J,
- IL- 17 and IL-17F share 44% amino acid identity whereas the other members of the IL-17 family share a more limited 15-27% amino acid identity suggesting that IL-17 and IL- 17F form a distinct subgroup within the EL- 17 family (Starnes, T., et al.. J Immunol, 167(8):4137-40 (2001); Aggarwal, S. and Gurney, A.L., J. Leukoc Biol, 71(1 ): 1-8 (2002)). IL- 17F appears to have similar biological actions as IL-
- IL- 17 and IL- 17F share similar chromosomal localization and significant sequence similarity sd well as the observation that IL- 17 and EL- 17F appear to be induced with the same cell population in response to a specific stimuli has lead to the identification of a new human cytokine that is comprised of a covalent heterodimer of IL- 17 and EL- 17F (herein designated IL- 17 A/F).
- Human EL-17 A/F is a distinctly new cytokine, distinguishable from human EL- 17 and EL- 17F in both protein structure and in cell- based activity assays.
- EL- 17 A/F is a distinctly new cytokine, detectable as a natural product of isolated activated human T cells, whose recombinant form has been characterized, in both protein structure and cell-based assays, as to be different and distinguishable from related cytokines.
- EL-17A/F that can boost the immune system to respond to a particular antigen that may not have been immunologically active previously.
- the newly identified immune stimulant has important clinical applications.
- This novel EL-17A/F cytokine or agonists thereof would therefore find practical utility as an immune stimulant, whereas molecules which inhibit EL-17A/F activity (antagonists) would be expected to find practical utility when an inhibition of the immune response is desired, such as in autoimmune diseases.
- antibodies to this new cytokine which either mimic (agonist antibodies) or inhibit (antagonist antibodies) the immunological activities of IL- 17 A/F would possess therapeutic qualities. Small molecules which act to inhibit the activity of this novel cytokine would also have potential therapeutic uses.
- the present invention concerns compositions and methods useful for the diagnosis and treatment of immune related disease in mammals, including humans.
- the present invention is based on the identification of proteins (including agonist and antagonist antibodies) which either stimulate or inhibit the immune response in mammals.
- Immune related diseases can be treated by suppressing or enhancing the immune response. Molecules that enhance the immune response stimulate or potentiate the immune response to an antigen.
- the EL- 17 A/F polypeptides of the present invention and agonists and antagonists thereof are also useful to prepare medicines and medicaments for the treatment of immune-related and inflammatory diseases.
- such medicines and medicaments comprise a therapeutically effective amount of an EL- 17 A/F polypeptide, agonist or antagonist thereof with a pharmaceutically acceptable carrier.
- the admixture is sterile.
- the invention concerns a method of identifying agonists of or antagonists to an IL- 17A/F polypeptide which comprises contacting the EL- 17A/F polypeptide with a candidate molecule and monitoring a biological activity mediated by said EL-17 A/F polypeptide.
- the JL- 17 AJF polypeptide is a native sequence IL- 17 A/F polypeptide.
- the BL-17A/F agonist or antagonist is an anti- EL- 17 A/F antibody.
- the invention concerns a composition of matter comprising an IL- 17A/F polypeptide or an agonist or antagonist antibody which binds the polypeptide in admixture with a carrier or excipient.
- the composition comprises a therapeutically effective amount of the polypeptide or antibody.
- the composition when the composition comprises an immune stimulating molecule, the composition is useful for: (a) enhancing infiltration of inflammatory cells into a tissue of a mammal in need thereof, (b) stimulating or enhancing an immune response in a mammal in need thereof, (c) increasing the proliferation of T-lymphocytes in a mammal in need thereof in response to an antigen, (d) stimulating the activity of T-lymphocytes or (e) increasing the vascular permeability.
- the composition when the composition comprises an immune inhibiting molecule, the composition is useful for: (a) decreasing infiltration of inflammatory cells into a tissue of a mammal in need thereof, (b) inhibiting or reducing an immune response in a mammal in need thereof, (c) decreasing the activity of T-lymphocytes or (d) decreasing the proliferation of T-lymphocytes in a mammal in need thereof in response to an antigen.
- the composition comprises a further active ingredient, which may, for example, be a further antibody or a cytotoxic or chemotherapeutic agent.
- the composition is sterile.
- the invention concerns a method of treating an immune related disorder in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of an EL- 17 A/F polypeptide, an agonist thereof, or an antagonist thereto.
- the immune related disorder is selected form the group consisting of: systemic lupus erythematosis, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, spondyloarthropathies, systemic sclerosis, idiopathic inflammatory myopathies, Sjogren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, thyroiditis, diabetes mellitus, immune-mediated renal disease, demyelinating diseases of the central and peripheral nervous systems such as multiple sclerosis, idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic inflammatory demyelinating polyneuropathy, hepatobiliary diseases such as infectious, autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, and sclerosing cholangitis, inflammatory bowel disease, gluten-
- the invention provides an antibody which specifically binds to any of the above or below described polypeptides.
- the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single-chain antibody.
- the present invention concerns an isolated antibody which binds an IL- 17A/F polypeptide.
- the antibody mimics the activity of an EL- 17 A/F polypeptide (an agonist antibody) or conversely the antibody inhibits or neutralizes the activity of an EL- 17 A/F polypeptide (an antagonist antibody).
- the antibody is a monoclonal antibody, which preferably has nonhuman complementarity determining region (CDR) residues and human framework region (FR) residues.
- the antibody may be labeled and may be immobilized on a solid support.
- the antibody is an antibody fragment, a monoclonal antibody, a single-chain antibody, or an anti- idiotypic antibody.
- said Fab fragment further comprises three heavy chain variable regions containing CDR- Hl consisting of amino acid residues 7 to 16 of SEQ ID NOs:9-42, CDR-H2 consisting of amino acid residues 30 to 46 of SEQ ID NOs:9-42, and CDR-H3 consisting of amino acid residue 78 to at least amino acid residue 96 of SEQ ED NOs:9-42, wherein said Fab fragment is capable of binding DL-17A/F.
- the antibody fragment or single-chain antibody comprises a Fab fragment selected from the group consisting of the amino acid sequence shown in Figure 6 as SEQ ID NO:9, SEQ ID NO: 10; SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21 , SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ DD NO:30, SEQ ID NO:31 , SEQ ID NO:32, SEQ ID NO:33, SEQ DD NO:34, SEQ DD NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO
- the antibody fragment or single- chain antibody comprises a Fab fragment selected from the group consisting of the amino acid sequence shown in Figure 6 as SEQ ID NO:9, SEQ ID NO: 10; SEQ DD NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ
- SEQ ID NO: 14 SEQ ID NO: 15, SEQ DD NO: 16, SEQ DD NO: 17, SEQ DD NO: 18, SEQ DD NO: 19, SEQ DD NO:20, SEQ DD NO:21 , SEQ DD NO:22.
- the antibody fragment or single-chain antibody comprises a Fab fragment selected from the group consisting of the amino acid sequence shown in Figure 6 as SEQ DD NO:9, SEQ DD NO: 10; SEQ ID NO: 1 1 , SEQ DD NO: 12, SEQ DD NO: 13, SEQ DD NO: 14, SEQ DD NO: 15, SEQ ID NO: 16, SEQ DD NO: 17, SEQ DD NO: 18, SEQ DD NO: 19, SEQ DD NO:20, SEQ DD NO:21.
- the antibody fragment or single-chain antibody comprises a Fab fragment selected from the group consisting of the amino acid sequence shown in Figure 6 as SEQ ID NO:9, SEQ ID NO: 10; SEQ ED NO: 1 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ED NO:20, SEQ ED NO:21, SEQ ID NO:22, SEQ ED NO:23, SEQ ID NO:24, SEQ ED NO:25, SEQ ED NO:26, SEQ ED NO:27, SEQ ID NO:28, SEQ ED NO:29, SEQ ID NO:30, SEQ ID NO:31 , SEQ ED NO:32, SEQ ED NO:33, SEQ ID NO:34, SEQ ED NO:35, SEQ ED NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ED NO:
- the invention concerns an isolated nucleic acid molecule selected from the group consisting of the nucleotide sequence of SEQ ED NO:43, SEQ ID NO:44, SEQ ED NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ED NO:48, SEQ ED NO:49, SEQ ID NO:50, SEQ ED NO:51 , SEQ ID NO:52, SEQ ED NO:53, SEQ ED NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ED NO:58, SEQ ED NO:59, SEQ ED NO:60, SEQ ED NO:61, SEQ ID NO:62, SEQ ED NO:63, SEQ ED NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ED NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ED NO:71, SEQ ID NO:
- the invention provides an isolated Fab fragment capable of binding IL- 17A/F encoded by a nucleotide sequence that encodes such an amino acid sequence as hereinbefore described.
- Processes for producing the same are also herein described, wherein those processes comprise culturing a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of said Fab fragment and recovering said Fab fragment from the cell culture.
- the present invention provides a composition comprising an anti-IL- 17A/F antibody in admixture with a pharmaceutically acceptable carrier.
- the composition comprises a therapeutically effective amount of the antibody.
- the composition is sterile.
- the composition may be administered in the form of a liquid pharmaceutical formulation, which may be preserved to achieve extended storage stability.
- the antibody is a monoclonal antibody, an antibody fragment, a humanized antibody, or a single-chain antibody.
- the invention concerns an article of manufacture, comprising: (a) a composition of matter comprising an IL- 17 A/F polypeptide or agonist, antagonist, or an antibody that specifically binds to said polypeptide thereof;
- composition may comprise a therapeutically effective amount of the IL-17A/F polypeptide or the agonist or antagonist thereof.
- the present invention concerns a method of diagnosing an immune related disease in a mammal, comprising detecting the level of expression of a gene encoding an IL-17A/F polypeptide (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherein a higher or lower expression level in the test sample as compared to the control sample indicates the presence of immune related disease in the mammal from which the test tissue cells were obtained.
- the present invention concerns a method of diagnosing an immune disease in a mammal, comprising (a) contacting an anti-IL- 17A/F antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between the antibody and an IL- 17A/F polypeptide, in the test sample; wherein the formation of said complex is indicative of the presence or absence of said disease.
- the detection may be qualitative or quantitative, and may be performed in comparison with monitoring the complex formation in a control sample of known normal tissue cells of the same cell type.
- a larger quantity of complexes formed in the test sample indicates the presence or absence of an immune disease in the mammal from which the test tissue cells were obtained.
- the antibody preferably carries a detectable label. Complex formation can be monitored, for example, by light microscopy, flow cytometry, fluorimetry, or other techniques known in the art.
- the test sample is usually obtained from an individual suspected of having a deficiency or abnormality of the immune system.
- the invention provides a method for determining the presence of an IL- 17 A/F polypeptide in a sample comprising exposing a test sample of cells suspected of containing the IL-17A/F polypeptide to an anti-IL-17A/F antibody and determining the binding of said antibody to said cell sample.
- the sample comprises a cell suspected of containing the EL-17 A/F polypeptide and the antibody binds to the cell.
- the antibody is preferably detectably labeled and/or bound to a solid support.
- the present invention concerns an immune-related disease diagnostic kit, comprising an anti-IL-17A/F antibody and a carrier in suitable packaging.
- the kit preferably contains instructions for using the antibody to detect the presence of the IL- 17 ATF polypeptide.
- the carrier is pharmaceutically acceptable.
- the present invention concerns a diagnostic kit, containing an anti-DL-17A/F antibody in suitable packaging.
- the kit preferably contains instructions for using the antibody to detect the DL-17 A/F polypeptide.
- the invention provides a method of diagnosing an immune-related disease in a mammal which comprises detecting the presence or absence or an IL- 17 A/F polypeptide in a test sample of tissue cells obtained from said mammal, wherein the presence or absence of the IL- 17 A/F polypeptide in said test sample is indicative of the presence of an immune-related disease in said mammal.
- the present invention concerns a method for identifying an agonist of an EL-
- the invention concerns a method for identifying a compound capable of inhibiting the activity of an EL-17A/F polypeptide comprising contacting a candidate compound with an DL- 17A/F polypeptide under conditions and for a time sufficient to allow these two components to interact and determining whether the activity of the EL- 17 A/F polypeptide is inhibited.
- either the candidate compound or the DL-17A/F polypeptide is immobilized on a solid support.
- the non-immobilized component carries a detectable label.
- this method comprises the steps of:
- test compound (a) contacting cells and a test compound to be screened in the presence of an EL- 17A/F polypeptide under conditions suitable for the induction of a cellular response normally induced by an EL-17A/F polypeptide; and (b) determining the induction of said cellular response to determine if the test compound is an effective antagonist.
- the invention provides a method for identifying a compound that inhibits the expression of an ⁇ .- 17 A/F polypeptide in cells that normally express the polypeptide, wherein the method comprises contacting the cells with a test compound and determining whether the expression of the IL- 17 A/F polypeptide is inhibited.
- this method comprises the steps of:
- the present invention concerns a method for treating an immune-related disorder in a mammal that suffers therefrom comprising administering to the mammal a nucleic acid molecule that codes for either (a) an ML-17A/F polypeptide, (b) an agonist of an IL- 17 A/F polypeptide or (c) an antagonist of an IL-17 AJF polypeptide, wherein said agonist or antagonist may be an anti-IL-17A/F antibody.
- the mammal is human.
- the nucleic acid is administered via ex vivo gene therapy.
- the nucleic acid is comprised within a vector, more preferably an adenoviral, adeno-associated viral, lentiviral or retroviral vector.
- the invention provides a recombinant viral particle comprising a viral vector consisting essentially of a promoter, nucleic acid encoding (a) an IL- 17 AJF polypeptide, (b) an agonist polypeptide of an IL- 17A/F polypeptide, or (c) an antagonist polypeptide of an IL- 1 IAJF polypeptide, and a signal sequence for cellular secretion of the polypeptide, wherein the viral vector is in association with viral structural proteins.
- the signal sequence is from a mammal, such as from a native IL-17 AJF polypeptide.
- the invention concerns an ex vivo producer cell comprising a nucleic acid construct that expresses retroviral structural proteins and also comprises a retroviral vector consisting essentially of a promoter, nucleic acid encoding (a) an IL- 17A/F polypeptide, (b) an agonist polypeptide of an JL-IlAJF polypeptide or (c) an antagonist polypeptide of an IL-17A/F polypeptide, and a signal sequence for cellular secretion of the polypeptide, wherein said producer cell packages the retroviral vector in association with the structural proteins to produce recombinant retroviral particles.
- the invention provides a method for enhancing the infiltration of inflammatory cells from the vasculature into a tissue of a mammal comprising administering to said mammal (a) an IL-17A/F polypeptide or (b) an agonist of an IL-17 AJF polypeptide, wherein the infiltration of inflammatory cells from the vasculature in the mammal is enhanced.
- the invention provides a method for decreasing the infiltration of inflammatory cells from the vasculature into a tissue of a mammal comprising administering to said mammal (a) an IL-17 AJF polypeptide or (b) an antagonist of an IL-17 AJF polypeptide, wherein the infiltration of inflammatory cells from the vasculature in the mammal is decreased.
- the invention provides a method of increasing the activity of T- lymphocytes in a mammal comprising administering to said mammal (a) an TL-IlAJF polypeptide or (b) an agonist of an IL- 1 IAJF polypeptide, wherein the activity of T-lymphocytes in the mammal is increased.
- the invention provides a method of decreasing the activity of T- lymphocytes in a mammal comprising administering to said mammal (a) an JL-IlAJF polypeptide or (b) an antagonist of an JL- IlAJF polypeptide, wherein the activity of T-lymphocytes in the mammal is decreased.
- the invention provides a method of increasing the proliferation of T- lymphocytes in a mammal comprising administering to said mammal (a) an JL- IlAJF polypeptide or (b) an agonist of an JL-IlAJF polypeptide, wherein the proliferation of T-lymphocytes in the mammal is increased.
- the invention provides a method of decreasing the proliferation of T- lymphocytes in a mammal comprising administering to said mammal (a) an IL- 17 AJF polypeptide or (b) an antagonist of an JL- IlAJF polypeptide, wherein the proliferation of T-lymphocytes in the mammal is decreased.
- the invention concerns the use of an JL- IlAJF polypeptide, or an agonist or antagonist thereof as hereinbefore described, or an anti-IL- 17 AJF antibody, for the preparation of a medicament useful in the treatment of a condition which is responsive to the IL-IlAJF polypeptide or an agonist or antagonist thereof (e.g., anti-EL-17A/F).
- the invention concerns the use of an IL-17 A/F polypeptide, or an agonist or antagonist thereof in a method for treating a degenerative cartilaginous disorder.
- the invention relates to a method of treating a degenerative cartilaginous disorder in a mammal comprising administering a therapeutically effective amount of an EL- 17A/F polypeptide, agonist, or antagonist thereof, to said mammal suffering from said disorder.
- the invention relates to a kit comprising a composition comprising an IL- 17 A/F polypeptide, or an agonist or antagonist thereof, in admixture with a pharmaceutically acceptable carrier; a container containing said composition; and a label affixed to said container, referring to the use of said composition, in the treatment of a degenerative cartilaginous disorder.
- the invention concerns a method of treating an immune related disorder in a mammal in need thereof, comprising administering to the mammal a therapeutically effective amount of one or more antagonists capable of inhibiting both EL-17A (SEQ ID NO: 3) and IL-17F (SEQ ID No: 4) in an EL- 17 A/F polypeptide.
- the mammal is a human subject.
- this method comprises administration of a therapeutically effective amount of an
- IL- 17A antagonist and an EL- 17F antagonist.
- the EL- 17A antagonist is an antibody that specifically binds EL- 17A (SEQ ED NO: 3), or a fragment thereof.
- the EL- 17F antagonist is an antibody that specifically binds EL- 17F (SEQ ED NO: 4), or a fragment thereof.
- the EL- 17A antagonist is an antibody that specifically binds EL- 17A (SEQ ED NO: 3), or a fragment thereof
- the EL- 17F antagonist is an antibody that specifically binds EL- 17F (SEQ ID NO: 4), or a fragment thereof.
- the antagonist is an antibody specifically binding to both EL- 17A (SEQ ID NO: 3) and EL-17F (SEQ ID NO: 4) in an EL-17A/F polypeptide, or a fragment thereof.
- the antibody is a cross-reactive antibody that recognizes identical or similar epitopes present on both EL- 17A (SEQ ID NO: 3) and EL- 17F (SEQ ED NO: 4).
- the antibody is a bispecific antibody having EL- 17A and EL- 17F specificity, or a fragment thereof.
- the antibody can be a monoclonal antibody, which may be a chimeric, humanized or human antibody.
- the invention concerns a method of treating an immune related disorder in a mammal in need thereof comprising simultaneous targeting of EL- 17A and EL- 17F in said mammal wherein said method comprises simultaneous administration to said mammal of a therapeutically effective amount of two distinct antibodies, wherein one antibody specifically binds to IL- 17A and the other antibody specifically binds to EL- 17F.
- the immune related disorder may be systemic lupus erythematosis, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, a spondyloarthropathy, systemic sclerosis, an idiopathic inflammatory myopathy, Sjogren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, thyroiditis, diabetes mellitus, immune-mediated renal disease, a demyelinating disease of the central or peripheral nervous system, idiopathic demyelinating polyneuropathy, Guillain-Barre syndrome, a chronic inflammatory demyelinating polyneuropathy, a hepatobiliary disease, infectious or autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, sclerosing cholangitis, inflammatory bowel disease, gluten-sensitive enteropathy, Whipple's disease, an autoimmune
- the invention concerns a method of treating an immune related disorder in a mammal in need thereof comprising simultaneous targeting of IL- 17A and IL- 17F in said mammal wherein said method comprises administration to said mammal of a therapeutically effective amount of a cross-reactive antibody wherein said antibody recognizes identical or similar epitopes present on both IL- 17 A, a polypeptide having the amino acid sequence of SEQ ID NO: 3, and IL- 17F, a polypeptide having the amino acid sequence of SEQ ID NO: 4.
- the immune related disorder may be systemic lupus erythematosis, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, a spondyloarthropathy, systemic sclerosis, an idiopathic inflammatory myopathy, Sjogren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, thyroiditis, diabetes mellitus, immune-mediated renal disease, a demyelinating disease of the central or peripheral nervous system, idiopathic demyelinating polyneuropathy, Guillain-Barre syndrome, a chronic inflammatory demyelinating polyneuropathy, a hepatobiliary disease, infectious or autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, sclerosing cholangitis, inflammatory bowel disease, gluten-sensitive enteropathy, Whipple's disease, an autoimmune
- the invention concerns a method of treating an immune related disorder in a mammal in need thereof comprising simultaneous targeting of IL- 17A and IL- 17F in said mammal wherein said method comprises administration to said mammal of a therapeutically effective amount of a bi-specific antibody wherein said antibody consists of two arms wherein one arm of said antibody recognizes IL- 17A and the other arm of said antibody recognizes IL- 17F.
- the immune related disorder may include systemic lupus erythematosis, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, a spondyloarthropathy, systemic sclerosis, an idiopathic inflammatory myopathy, Sjogren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, thyroiditis, diabetes mellitus, immune- mediated renal disease, a demyelinating disease of the central or peripheral nervous system, idiopathic demyelinating polyneuropathy, Guillain-Barre syndrome, a chronic inflammatory demyelinating polyneuropathy, a hepatobiliary disease, infectious or autoimmune chronic active hepatitis, primary biliary cirrhosis, granulomatous hepatitis, sclerosing cholangitis, inflammatory bowel disease, gluten-sensitive enteropathy, Whipple's disease, an
- the invention concerns a method of treating an immune related disorder in a mammal in need thereof comprising simultaneous targeting of IL- 17A and IL- 17F in said mammal wherein said method comprises administration to said mammal of a therapeutically effective amount of a bi-specific antibody wherein said antibody consists of a heavy chain which recognizes IL- 17A and a light chain which recognizes IL- 17F
- the immune related disorder may include systemic lupus erythematosis, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, a spondyloarthropathy, systemic sclerosis, an idiopathic inflammatory myopathy, Sjogren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, thyroiditis, diabetes melhtus, immune-mediated renal disease, a demyehnating disease of the central or peripheral nervous system, idiopathic demyelinating polyneur
- the invention concerns a method of treating an immune related disorder m a mammal in need thereof comprising simultaneous targeting of EL- 17A and IL- 17F in said mammal wherein said method comprises administration to said mammal of a therapeutically effective amount of a bi-specific antibody wherein said antibody consists of a heavy chain which recognizes IL- 17F and a light chain which recognizes EL- 17A
- the immune related disorder may include systemic lupus erythematosis, rheumatoid arthritis, osteoarthritis, juvenile chronic arthritis, a spondyloarthropathy, systemic sclerosis, an idiopathic inflammatory myopathy, Sjogren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia, autoimmune thrombocytopenia, thyroiditis, diabetes melhtus, immune-mediated renal disease, a demyelinating disease of the central or peripheral nervous system, idiopathic demyelinating polyneur
- the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes an EL- 17 A/F polypeptide
- the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81 % nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91 % nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nu
- the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid sequence
- the invention concerns an isolated nucleic acid molecule comprising a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91 % nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about
- Another embodiment is directed to fragments of an IL-17 A/F polypeptide coding sequence, or the complement thereof, that may find use as, for example, hybridization probes, for encoding fragments of an IL- 17A/F polypeptide that may optionally encode a polypeptide comprising a binding site for an anti-IL-17A/F antibody or as antisense oligonucleotide probes.
- nucleic acid fragments are usually at least about 20 nucleotides in length, alternatively at least about 30 nucleotides in length, alternatively at least about 40 nucleotides in length, alternatively at least about 50 nucleotides in length, alternatively at least about 60 nucleotides in length, alternatively at least about 70 nucleotides in length, alternatively at least about 80 nucleotides in length, alternatively at least about 90 nucleotides in length, alternatively at least about 100 nucleotides in length, alternatively at least about 1 10 nucleotides in length, alternatively at least about 120 nucleotides in length, alternatively at least about 130 nucleotides in length, alternatively at least about 140 nucleotides in length, alternatively at least about 150 nucleotides in length, alternatively at least about 160 nucleotides in length, alternatively at least about 170 nucleotides in length, alternatively at least about 180 nucleotides in length, alternatively at least about 190 nu
- novel fragments of an IL- 17A/F polypeptide-encoding nucleotide sequence may be determined in a routine manner by aligning the IL-17A/F polypeptide-encoding nucleotide sequence with other known nucleotide sequences using any of a number of well known sequence alignment programs and determining which polypeptide-encoding nucleotide sequence fragment(s) are novel. All of such polypeptide-encoding nucleotide sequences are contemplated herein. Also contemplated are the polypeptide fragments encoded by these nucleotide molecule fragments, preferably those IL-17A/F polypeptide fragments that comprise a binding site for an anti-IL- 17A/F antibody.
- the invention provides an isolated IL- 17 A/F polypeptide encoded by any of the isolated nucleic acid sequences hereinabove identified.
- the invention concerns an isolated IL- 17 A/F polypeptide, comprising an amino acid sequence having at least about 80% amino acid sequence identity, alternatively at least about 81 % amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83% amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91 % amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% amino acid
- the invention concerns an isolated DL- 17 A/F polypeptide comprising an amino acid sequence having at least about 80% amino acid sequence identity, alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83% amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91% amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% amino acid sequence identity and alternatively
- the invention concerns an isolated IL-17A/F polypeptide comprising an amino acid sequence scoring at least about 80% positives, alternatively at least about 81 % positives, alternatively at least about 82% positives, alternatively at least about 83% positives, alternatively at least about 84% positives, alternatively at least about 85% positives, alternatively at least about 86% positives, alternatively at least about 87% positives, alternatively at least about 88% positives, alternatively at least about 89% positives, alternatively at least about 90% positives, alternatively at least about 91% positives, alternatively at least about 92% positives, alternatively at least about 93% positives, alternatively at least about 94% positives, alternatively at least about 95% positives, alternatively at least about 96% positives, alternatively at least about 97% positives, alternatively at least about 98% positives and alternatively at least about 99% positives when compared with the amino acid sequence of an IL- 17 A/F polypeptide having a full-length amino acid sequence as
- the invention provides an isolated IL- 17 A/F polypeptide without the N-terminal signal sequence and/or the initiating methionine and is encoded by a nucleotide sequence that encodes such an amino acid sequence as hereinbefore described.
- Processes for producing the same are also herein described, wherein those processes comprise culturing a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of the IL-17 A/F polypeptide and recovering the IL- 17 A/F polypeptide from the cell culture.
- the invention concerns agonists and antagonists of a native IL- 17 A/F polypeptide as defined herein.
- the agonist or antagonist is an anti-IL- 17A/F antibody or a small molecule.
- the invention concerns a method of identifying agonists or antagonists to an IL- 17 A/F polypeptide which comprise contacting the IL- 17 A/F polypeptide with a candidate molecule and monitoring a biological activity mediated by said IL- 17 A/F polypeptide.
- the DL- 17 A/F polypeptide is a native IL- 17A/F polypeptide.
- the invention concerns a composition of matter comprising an IL- 17 A/F polypeptide, or an agonist or antagonist of an EL- 17 A/F polypeptide as herein described, or an anti-IL- 17 A/F antibody, in combination with a carrier.
- the carrier is a pharmaceutically acceptable carrier.
- Another embodiment of the present invention is directed to the use of an IL- 17 A/F polypeptide, or an agonist or antagonist thereof as hereinbefore described, or an anti-IL- 17 A/F antibody, for the preparation of a medicament useful in the treatment of a condition which is responsive to the IL- 17A/F polypeptide, an agonist or antagonist thereof or an anti-IL- 17 A/F antibody.
- the invention provides vectors comprising DNA encoding any of the herein described polypeptides.
- Host cell comprising any such vector are also provided.
- the host cells may be CHO cells, E. coli, yeast, or Baculovirus-infected insect cells.
- An process for producing any of the herein described polypeptides is further provided and comprises culturing host cells under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture.
- the invention provides chimeric molecules comprising any of the herein described polypeptides fused to a heterologous polypeptide or amino acid sequence.
- Example of such chimeric molecules comprise any of the herein described polypeptides fused to an epitope tag sequence or a Fc region of an immunoglobulin.
- the invention provides an antibody which specifically binds to any of the above or below described polypeptides.
- the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single-chain antibody.
- the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences or as antisense probes, wherein those probes may be derived from any of the above or below described nucleotide sequences.
- FIG 1 shows the results of expressing and isolating a novel human cytokine designated IL- 17 A/F.
- Human 293 kidney cells were transfected with cDNA expression vectors encoding human IL- 17 and IL- 17F alone or in combination as indicated in Figure I A and Figure IB.
- Conditioned media from transfected cells was immunoprecipitated (IP) utilizing antibodies that are able to recognize IL- 17 (lanes 1-5), or IL- 17F (lanes 6-10) as indicated in Figure IA and Figure IB.
- IP immunoprecipitated
- Western Blot analysis is shown demonstrating the presence of a dimeric EL-17 A/F complex in lane 8 of Figure IA and in lane 3 of Figure IB.
- the dimeric EL-17 A/F complex is consistent in size with a covalent heterodimeric species comprised of one polypeptide chain of EL- 17 and one polypeptide chain of EL- 17F.
- Figure 2 shows the purification of recombinant EL-17A/F.
- Figure 2A shows the results of silver stained SDS-PAGE of protein fractions from initial fractionation of EL- 17 A/F on an S-Sepharose column. Fractions 31 and 32 contains a protein with an apparent molecular mass of approximately 33 kD consistent with EL- 17 A/F.
- Figure 2B shows the results of further purification of EL-17A/F using Vydac C4 column chromatography. Shown is the chromatograph of eluted proteins measured at 214 nm and 280 nm.
- Figure 2C demonstrates that purified DL-17A/F protein fractions from the Vydac C4 purification column induce EL-8 production in TK-10 cells.
- Figure 3 shows the results of amino acid sequence analysis of IL- 17 A/F.
- Figure 3 A shows the non- reducing SDS-PAGE analysis of purified EL- 17 A/F. Resolved protein was transferred to a PVDF membrane and stained with Coomassie blue protein stain. The positions of molecular weight markers are indicated on the right side.
- Figure 3B shows the results of N-terminal sequence analysis of isolated EL-17A/F (amino acid residues detected from an N-terminal sequence analysis of the band shown in Figure 3A). The sequence analysis reveals two N-terminal sequences (Sequence 1 is designated SEQ ED NO: 1 and Sequence 2 is designated SEQ ED NO:2, respectively).
- Figure 3C shows the amino acid sequence of human EL-17 (shown in both Figure 3C and Figure 8, designated SEQ ED NO:3) and the amino acid sequence of human EL- 17F (shown both in Figure 3C and Figure 10, designated SEQ ED NO:4).
- the signal sequences of EL-17 and EL- 17F are underlined.
- the sequences that have identity to the two N-terminal peptide sequences (SEQ ED NO: 1 and SEQ ID NO:2) present in EL-17A/F are highlighted in bold for the shown EL-17 and EL- 17F polypeptide sequences.
- Figure 4 shows mass spectrometry analysis of EL-17A/F.
- Figure 4A is a schematic showing the amino acid sequence with its interchain and intrachain disulfide bonds of mature EL-17A/F heterodimer (SEQ ED NO:77).
- the cysteines involved in disulfide linkages are indicated by bullet, (•), and residue number.
- the disulfide bonds are indicated by black lines connecting the bonded cysteines. Those disulfide bonds that form interchain disulfide linkages are highlighted by bold black lines.
- Figure 4B shows the schematic of EL-17A/F peptide fragments #1 and #2 containing disulfide bonds between the EL-17 chain and the EL- 17F chain that would be anticipated to be produced by digestion of EL- 17 A/F with trypsin [EL- 17 A/F disulfide bond fragment #lis designated SEQ ID NO:7; EL-17A/F disulfide bond fragment #2 is designated SEQ ID NO:8, respectively].
- the amino acids contained within these fragments are indicated and numbered relative to the initiating methionine of each chain. Also indicated is the calculated approximate molecular mass of these fragments that would be expected to be observed by mass spectrometry.
- Figure 4C shows the matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF) peptide map of EL- 17 A/F.
- Figure 4D demonstrates further characterization of non-reduced samples of EL- 17A/F by liquid-chromatography electrospray ionization ion trap mass spectrometry (LC-ESI-MS).
- the ion chromatograms represent (from top to bottom) the total ion chromatogram, reconstructed ion chromatogram (RIC) of IL- 17A/F disulfide bond fragment #2 [M+2H]2+, and EL- 17A/F disulfide bond fragment #1 [M+2H]3+. Peaks consistent with both heterodimers were observed whereas no peaks above background chemical noise were observed at the anticipated masses for homodimeric peptides.
- Figure 5A shows the dose response curves comparing the proinflammatory response induced by IL- 17A/F, DL- 17 and IL- 17F.
- IL-17 A/F, IL- 17 and IL- 17F were incubated with TK-IO cells at the indicated concentrations for 24 hours.
- EL-17A/F was shown to have potent IL-8 inducing activity with substantial activity seen at sub-nM concentrations.
- Figure 5B shows the dose response curves comparing IL-6 induction by IL-17A/F, IL-17 and IL-17F.
- DL-17A/F, IL- 17 and IL-17F were incubated with TK- 10 cells at the indicated concentrations for 24 hours.
- TK-10 conditioned media was collected and analyzed by DL-6 ELISA.
- Figure 6 shows the amino acid sequence of the region of the heavy chain variable region containing CDR H1-H3 from Fab that bind IL-17A/F. Shown is an alignment of a region of the predicted amino acid sequence of thirty four (34) clones (SEQ ID NO:9 to SEQ ID NO:42, respectively) that encode distinct antibody heavy chain sequences that are able to bind to IL- 17 A/F.
- the three heavy chain CDR regions (CDR-
- Figure 7 shows a nucleotide sequence (SEQ ID NO:5) of a native sequence DL- 17 cDNA.
- Figure 8 shows the amino acid sequence (SEQ ID NO:3) derived from the coding sequence of SEQ
- Figure 9 shows a nucleotide sequence (SEQ ID NO:6) of a native sequence IL- 17F cDNA.
- Figure 10 shows the amino acid sequence (SEQ ID NO:4) derived from the coding sequence of SEQ ID NO:6 shown in Figure 9.
- Figure 1 1 shows DL-17A/F ELISA measurements of EL-17A/F produced from anti-CD3/anti-CD28 activated human T-cells.
- Figure 12 shows the specificity of the DL-17A/F ELISA wherein three fractions #31 -#33 assayed in parallel were shown to contain nearly equivalent quantities of DL- 17 A/F (DL- 17A and DL- 17F were used as controls).
- Figure 13 shows the level increased level of production of both DL- 17A and DL- 17F when T cells are induced with DL-6 and TGF ⁇ .
- Figure 14 depicts the IL- 17 family of cytokines and the complex pattern of overlapping receptor- ligand specificities. From left to right, Figure 14 demonstrates that IL-17 ligand binds to the IL-17 receptor (IL-17R; herein designated PROl); EL- 17B ligand (PRO 1031) binds to the IL-17RH1 receptor (PRO5801); EL-17E ligand (PRO10272) binds to the EL-17RH1 receptor (PRO5801); EL- 17F ligand (PRO20110) binds to both the EL- 17 receptor (DL-17R, herein designated PROl) as well as to the E.-17RH2 receptor (PRO20040); DL-17C ligand (PROl 122) and DL- 17D ligand (PRO21 175) do not interact with DL-17R, DL-17RH1 or DL- 17RH2 receptors.
- IL-17R IL-17 receptor
- PROl IL-17R
- Figure 15 shows the structure of DL- 17F.
- Figure 15A shows a ribbon trace of the DL- 17F monomer. Strands are labeled. Disulfides are shown as ball-and-stick representation with the sulfur atoms colored yellow. Approximate positions of the additional cysteines are shown as orange balls. Inset shows a cartoon representation of the canonical knot.
- Figure 15B shows the ribbon trace of the DL- 17F dimer in red and blue. Disulfides are shown as in Figure 15 A.
- Figure 15C shows the structure of NGF from the NGF-TrkA complex (Weismann et al.. Nature 401 : 184- 188 ( 1999)). A disordered loop connects strands 2 and 3.
- Figure 16 shows the sequence alignment of IL-17F with other IL- 17 family members. Regions of identity and conserved sequences between IL-17 and IL-17F are highlighted in green and yellow, respectively. When the other family members also have conserved or identical residues in these regions, they are similarly colored. Cysteine residues are indicated in orange. The conserved serines that replace the canonical knot cysteines are highlighted with white letters. Disulfide bonds which are expected to be conserved in all IL- 17s are indicated by a black line connecting the bonded cystines. The two cystines which form the inter-chain disulfide in IL- 17F are marked with an asterisk.
- FIG. 17 shows a comparison of IL-17F (PRO201 10) and IL-17 molecular structure.
- the surface of residues that are identical between the two proteins are colored green, homologous residues are colored yellow, while residues that differ significantly are colored white.
- the view in (B) is oriented approximately 15° rotated from the view in Figure 15B). Residues forming the cavity are labeled.
- Figure 17C is a "cut-away" view of the surface in Figure 17B showing how the large cavities on either side of IL- 17F penetrate deeply into the body of the dimer.
- Figures 18 shows a comparison of the IL- 17F surface and the TrkA binding site on NGF.
- Figures 18A and 18B show the molecular structure of IL-17F is oriented as in Figure 17.
- IL-17F is colored according to the electrostatic surface potential: red, -5 kT, white, 0 kT; and blue, +5 kT. The positions of the cavities are indicated by the circles.
- Figure 18C shows the molecular structure of NGF in the same orientation as IL- 17F in panel (B); domain 5 of TrkA is shown as a green ribbon (Weismann et ai, Nature 401 : 184- 188 (1999); pdb code IWWW).
- Figures 19 and 20 show the efficacy of anti-IL- 17A/F antibodies in a mouse model of collagen- induced arthritis (CIA).
- a “native sequence IL-17A/F polypeptide” comprises a polypeptide having the same amino acid sequence as the corresponding IL-17A/F polypeptide derived from nature. Such native sequence YL-MPJF polypeptides can be isolated from nature or can be produced by recombinant or synthetic means.
- the term "native sequence EL-17A/F polypeptide” specifically encompasses naturally-occurring truncated or secreted forms of the specific IL-17A/F polypeptide (e.g., an extracellular domain sequence), naturally-occurring variant forms (e.g., alternatively spliced forms) and naturally-occurring allelic variants of the polypeptide.
- the native sequence IL- 17 A/F polypeptides disclosed herein are mature or full-length native sequence polypeptides comprising the full-length amino acid sequences shown in the accompanying figures. Start and stop codons are shown in bold font and underlined in the figures.
- the IL- 17A/F polypeptides disclosed in the accompanying figures are shown to begin with methionine residues designated herein as amino acid position 1 in the figures, it is conceivable and possible that other methionine residues located either upstream or downstream from the amino acid position 1 in the figures may be employed as the starting amino acid residue for the IL- 17 A/F polypeptides.
- cleavage of a signal sequence from a secreted polypeptide is not entirely uniform, resulting in more than one secreted species.
- These mature polypeptides, where the signal peptide is cleaved within no more than about 5 amino acids on either side of the C-terminal boundary of the signal peptide as identified herein, and the polynucleotides encoding them, are contemplated by the present invention.
- YL-[IPJP polypeptide variant” means an active IL-17A/F polypeptide as defined above or below having at least about 80% amino acid sequence identity with a full-length native sequence IL-17A/F polypeptide sequence as disclosed herein, an IL-17 A/F polypeptide sequence lacking the signal peptide as disclosed herein, or any other fragment of a full-length IL- 17 A/F polypeptide sequence as disclosed herein.
- Such IL- 17A/F polypeptide variants include, for instance, IL- 17 A/F polypeptides wherein one or more amino acid residues are added, or deleted, at the - or C-terminus of the full-length native amino acid sequence.
- an YL- XlPJF polypeptide variant will have at least about 80% amino acid sequence identity, alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83% amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91 % amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% amino acid sequence identity and alternatively at least about 99% amino acid sequence identity
- IL- 17 A/F variant polypeptides are at least about 10 amino acids in length, alternatively at least about 20 amino acids in length, alternatively at least about 30 amino acids in length, alternatively at least about 40 amino acids in length, alternatively at least about 50 amino acids in length, alternatively at least about 60 amino acids in length, alternatively at least about 70 amino acids in length, alternatively at least about 80 amino acids in length, alternatively at least about 90 amino acids in length, alternatively at least about 100 amino acids in length, alternatively at least about 150 amino acids in length, alternatively at least about 200 amino acids in length, alternatively at least about 300 amino acids in length, or more.
- Percent (%) amino acid sequence identity with respect to the IL-17 A/F polypeptide sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific IL- 17 A/F polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.
- ALIGN-2 sequence comparison computer program
- Table 1 the complete source code for the ALIGN-2 program is provided in Table 1 below.
- the ALIGN-2 sequence comparison computer program was authored by Genentech, Inc. and the source code shown in Table 1 below has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087.
- the ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco, California or may be compiled from the source code provided in Table 1 below.
- the ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
- % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows:
- Tables 2 and 3 demonstrate how to calculate the % amino acid sequence identity of the amino acid sequence designated "Comparison Protein” to the amino acid sequence of a hypothetical polypeptide of interest, “Comparison Protein” represents the amino acid sequence of a polypeptide against which the polypeptide of interest is being compared, and "X, "Y” and “Z” each represent different hypothetical amino acid residues. Unless specifically stated otherwise, all % amino acid sequence identity values used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.
- a % amino acid sequence identity value is determined by dividing (a) the number of matching identical amino acid residues between the amino acid sequence of the polypeptide of interest having a sequence derived from the native polypeptide and the comparison amino acid sequence of interest (i.e., the sequence against which the polypeptide of interest is being compared which may be an IL- 17A/F variant polypeptide) as determined by WU-BLAST-2 by (b) the total number of amino acid residues of the polypeptide of interest.
- amino acid sequence A is the comparison amino acid sequence of the "Comparison Protein” of interest and the amino acid sequence B is the amino acid sequence of the polypeptide of interest.
- Percent amino acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)).
- NCBI-BLAST2 sequence comparison program may be downloaded from http://www.ncbi.nlm.nih.gov or otherwise obtained from the National Institute of Health, Bethesda, MD.
- % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows:
- IL- 17A/F variant polynucleotide or "IL-17A/F variant nucleic acid sequence” means a nucleic acid molecule which encodes an active IL- 17 A/F polypeptide as defined below and which has at least about 80% nucleic acid sequence identity with a nucleotide acid sequence encoding a full-length native sequence IL- XlAfF polypeptide sequence as disclosed herein, a full-length native sequence IL-17A/F polypeptide sequence lacking the signal peptide as disclosed herein, or any other fragment of a full-length IL- 17 A/F polypeptide sequence as disclosed herein.
- an IL- 17 A/F variant polynucleotide will have at least about 80% nucleic acid sequence identity, alternatively at least about 81 % nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic
- EL- 17 A/F variant polynucleotides are at least about 30 nucleotides in length, alternatively at least about 60 nucleotides in length, alternatively at least about 90 nucleotides in length, alternatively at least about 120 nucleotides in length, alternatively at least about 150 nucleotides in length, alternatively at least about 180 nucleotides in length, alternatively at least about 210 nucleotides in length, alternatively at least about 240 nucleotides in length, alternatively at least about 270 nucleotides in length, alternatively at least about 300 nucleotides in length, alternatively at least about 450 nucleotides in length, alternatively at least about 600 nucleotides in length, alternatively at least about 900 nucleotides in length, or more.
- Percent (%) nucleic acid sequence identity with respect to EL-17A/F-encoding nucleic acid sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the IL-17A/F nucleic acid sequence of interest, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.
- % nucleic acid sequence identity values are generated using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided in Table 1 below.
- the ALIGN-2 sequence comparison computer program was authored by Genentech, Inc. and the source code shown in Table 1 below has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087.
- the ALIGN-2 program is publicly available through
- ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
- the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D is calculated as follows:
- Tables 4 and 5 demonstrate how to calculate the % nucleic acid sequence identity of the nucleic acid sequence designated "Comparison DNA” to the nucleic acid sequence designated "IL-17A/F-DNA", wherein "IL-17A/F-DNA” represents a hypothetical IL-17A/F-encoding nucleic acid sequence of interest, “Comparison DNA” represents the nucleotide sequence of a nucleic acid molecule against which the "IL-17A/F-DNA" nucleic acid molecule of interest is being compared, and "N", “L” and “V” each represent different hypothetical nucleotides.
- a % nucleic acid sequence identity value is determined by dividing (a) the number of matching identical nucleotides between the nucleic acid sequence of the IL- 17A/F polypeptide-encoding nucleic acid molecule of interest having a sequence derived from the native sequence IL- 17A/F polypeptide-encoding nucleic acid and the comparison nucleic acid molecule of interest (i.e., the sequence against which the IL-17 A/F polypeptide-encoding nucleic acid molecule of interest is being compared which may be a variant IL- 17A/F polynucleotide) as determined by WU-BLAST-2 by (b) the total number of nucleotides of the IL- 17 A/F polypeptide-encoding nucleic acid molecule of interest.
- an isolated nucleic acid molecule comprising a nucleic acid sequence A which has or having at least 80% nucleic acid sequence identity to the nucleic acid sequence
- nucleic acid sequence A is the comparison nucleic acid molecule of interest and the nucleic acid sequence B is the nucleic acid sequence of the IL- 17A/F polypeptide-encoding nucleic acid molecule of interest.
- Percent nucleic acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al.. Nucleic Acids Res. 25:3389-3402 ( 1997)).
- NCBI-BLAST2 sequence comparison program may be downloaded from http://www.ncbi.nlm.nih.gov or otherwise obtained from the National Institute of Health, Bethesda, MD.
- the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D is calculated as follows: 100 times the fraction W/Z
- IL- 17A/F variant polynucleotides are nucleic acid molecules that encode an active EL-17 A/F polypeptide and which are capable of hybridizing, preferably under stringent hybridization and wash conditions, to nucleotide sequences encoding a full-length IL-17A/F polypeptide as disclosed herein.
- IL- 17 A/F variant polypeptides may be those that are encoded by an IL-17 A/F variant polynucleotide.
- isolated when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other proteinaceous or non- proteinaceous solutes.
- the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain.
- Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the IL-17A/F polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.
- An "isolated" JL-IlAJF polypeptide-encoding nucleic acid or other polypeptide-encoding nucleic acid is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the polypeptide-encoding nucleic acid.
- An isolated polypeptide-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature. Isolated polypeptide-encoding nucleic acid molecules therefore are distinguished from the specific polypeptide-encoding nucleic acid molecule as it exists in natural cells.
- an isolated polypeptide-encoding nucleic acid molecule includes polypeptide-encoding nucleic acid molecules contained in cells that ordinarily express the polypeptide where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells.
- control sequences refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
- the control sequences that are suitable for prokaryotes include an promoter, optionally an operator sequence, and a ribosome binding site.
- Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
- Nucleic acid is "operably linked” when it is placed into a functional relationship with another nucleic acid sequence.
- DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; an promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
- "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
- “Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).
- “Stringent conditions” or “high stringency conditions”, as defined herein, may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50EC; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1 % bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42EC; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1 % sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1% SDS, and 10% dextran
- Modely stringent conditions may be identified as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions ⁇ e.g., temperature, ionic strength and %SDS) less stringent that those described above.
- moderately stringent conditions is overnight incubation at 37EC in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-5OEC.
- the skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.
- epitope tagged when used herein refers to a chimeric polypeptide comprising an VL- MAJF polypeptide fused to a "tag polypeptide".
- the tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of the polypeptide to which it is fused.
- the tag polypeptide preferably also is fairly unique so that the antibody does not substantially cross-react with other epitopes.
- Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 and 50 amino acid residues (preferably, between about 10 and 20 amino acid residues).
- immunoadhesin designates antibody-like molecules which combine the binding specificity of a heterologous protein (an “adhesin”) with the effector functions of immunoglobulin constant domains.
- the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity which is other than the antigen recognition and binding site of an antibody (i.e., is “heterologous"), and an immunoglobulin constant domain sequence.
- the adhesin part of an immunoadhesin molecule typically is a contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand.
- the immunoglobulin constant domain sequence in the immunoadhesin may be obtained from any immunoglobulin, such as IgG- I , IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-I and IgA-2), IgE, IgD or IgM.
- the term "antagonist” is used in the broadest sense, and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity of a native IL-17 A/F polypeptide disclosed herein.
- the term "agonist” is used in the broadest sense and includes any molecule that mimics a biological activity of a native IL- 17 A/F polypeptide disclosed herein.
- Suitable agonist or antagonist molecules specifically include agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of native IL- 17A/F polypeptides, peptides, antisense oligonucleotides, small organic molecules, etc.
- Methods for identifying agonists or antagonists of an BL-17A/F polypeptide may comprise contacting an IL- 17 A/F polypeptide with a candidate agonist or antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the IL- 17 A/F polypeptide.
- Treatment refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the targeted pathologic condition or disorder.
- Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented.
- Chronic administration refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time.
- Intermittent administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature.
- “Mammal” for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, cats, cattle, horses, sheep, pigs, goats, rabbits, etc. Preferably, the mammal is human.
- Administration "in combination with" one or more further therapeutic agents includes simultaneous
- Carriers as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable carrier is an aqueous pH buffered solution.
- physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA: sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEENTM, polyethylene glycol (PEG), and PLURONICSTM.
- buffers such as phosphate, citrate, and other organic acids
- antioxidants including ascorbic acid
- proteins such as serum albumin,
- antibody is used in the broadest sense and specifically covers, for example, single anti-IL- 17A/F monoclonal antibodies (including agonist, antagonist, and neutralizing antibodies), anti-IL-17A/F antibody compositions with polyepitopic specificity (e.g. bispecific antibodies so long as they exhibit the desired biological activity), polyclonal antibodies, single chain anti-IL-17A/F antibodies, and fragments of anti-IL- 17 A/F antibodies (see below) as long as they exhibit the desired biological or immunological activity.
- immunoglobulin Ig is used interchangeable with antibody herein.
- an “isolated antibody” is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.
- the antibody will be purified ( 1 ) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain.
- Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
- the basic 4-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light
- L chains and two identical heavy (H) chains an IgM antibody consists of 5 of the basic heterotetramer unit along with an additional polypeptide called J chain, and therefore contain 10 antigen binding sites, while secreted IgA antibodies can polymerize to form polyvalent assemblages comprising 2-5 of the basic 4-chain units along with J chain).
- the 4-chain unit is generally about 150,000 daltons.
- Each L chain is linked to a H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide bonds depending on the H chain isotype.
- Each H and L chain also has regularly spaced intrachain disulfide bridges.
- Each H chain has at the N-terminus, a variable domain (V H ) followed by three constant domains (C H ) for each of the ⁇ and ⁇ chains and four C H domains for ⁇ and ⁇ isotypes.
- Each L chain has at the N-terminus, a variable domain (V L ) followed by a constant domain (C L ) at its other end.
- the V L is aligned with the V H and the C L is aligned with the first constant domain of the heavy chain (C H 1).
- Particular amino acid residues are believed to form an interface between the light chain and heavy chain variable domains.
- the pairing of a V H and V L together forms a single antigen-binding site.
- immunoglobulins can be assigned to different classes or isotypes. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, having heavy chains designated ⁇ , ⁇ , ⁇ , ⁇ , and ⁇ , respectively.
- the ⁇ and ⁇ classes are further divided into subclasses on the basis of relatively minor differences in C H sequence and function, e.g., humans express the following subclasses: IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2.
- variable refers to the fact that certain segments of the variable domains differ extensively in sequence among antibodies.
- the V domain mediates antigen binding and define specificity of a particular antibody for its particular antigen.
- variability is not evenly distributed across the 110-amino acid span of the variable domains.
- the V regions consist of relatively invariant stretches called framework regions (FRs) of 15-30 amino acids separated by shorter regions of extreme variability called “hypervariable regions” that are each 9- 12 amino acids long.
- FRs framework regions
- hypervariable regions that are each 9- 12 amino acids long.
- the variable domains of native heavy and light chains each comprise four FRs, largely adopting a ⁇ -sheet configuration, connected by three hypervariable regions, which form loops connecting, and in some cases forming part of, the ⁇ -sheet structure.
- the hypervariable regions in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)).
- the constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody dependent cellular cytotoxicity (ADCC).
- hypervariable region when used herein refers to the amino acid residues of an antibody which are responsible for antigen-binding.
- the hypervariable region generally comprises amino acid residues from a "complementarity determining region" or "CDR" (e.g. around about residues 24-34 (Ll), 50-56 (L2) and 89-97 (L3) in the V L , and around about 1-35 (Hl), 50-65 (H2) and 95-102 (H3) in the V H ; Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)) and/or those residues from a "hypervariable loop" (e.g.
- the term "monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site.
- each monoclonal antibody is directed against a single determinant on the antigen.
- the monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies.
- the modifier "monoclonal" is not to be construed as requiring production of the antibody by any particular method.
- the monoclonal antibodies useful in the present invention may be prepared by the hybridoma methodology first described by Kohler et al., Nature, 256:495 (1975), or may be made using recombinant DNA methods in bacterial, eukaryotic animal or plant cells (see, e.g., U.S.
- the "monoclonal antibodies” may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature. 352:624-628 (1991) and Marks et al., J. MoI. Biol.. 222:581- 597 (1991 ), for example.
- the monoclonal antibodies herein include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (see U.S. Patent No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)).
- Chimeric antibodies of interest herein include "primatized" antibodies comprising variable domain antigen-binding sequences derived from a non-human primate (e.g. Old World Monkey, Ape etc), and human constant region sequences.
- an “intact” antibody is one which comprises an antigen-binding site as well as a C L and at least heavy chain constant domains, C H 1 , C H 2 and C H 3.
- the constant domains may be native sequence constant domains (e.g. human native sequence constant domains) or amino acid sequence variant thereof.
- the intact antibody has one or more effector functions.
- Antibody fragments comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody.
- antibody fragments include Fab, Fab', F(ab') 2 , and Fv fragments; diabodies; linear antibodies (see U.S. Patent No. 5,641,870, Example 2; Zapata et al., Protein Eng. 8(10): 1057-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
- Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, and a residual "Fc” fragment, a designation reflecting the ability to crystallize readily.
- the Fab fragment consists of an entire L chain along with the variable region domain of the H chain (V H ), and the first constant domain of one heavy chain (C H 1 )•
- Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen-binding site.
- Pepsin treatment of an antibody yields a single large F(ab') 2 fragment which roughly corresponds to two disulfide linked Fab fragments having divalent antigen-binding activity and is still capable of cross-linking antigen.
- Fab' fragments differ from Fab fragments by having additional few residues at the carboxy terminus of the C H 1 domain including one or more cysteines from the antibody hinge region.
- Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
- F(ab') 2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
- the Fc fragment comprises the carboxy-terminal portions of both H chains held together by disulfides.
- the effector functions of antibodies are determined by sequences in the Fc region, which region is also the part recognized by Fc receptors (FcR) found on certain types of cells.
- Fv is the minimum antibody fragment which contains a complete antigen-recognition and -binding site. This fragment consists of a dimer of one heavy- and one light-chain variable region domain in tight, non- covalent association. From the folding of these two domains emanate six hypervariable loops (3 loops each from the H and L chain) that contribute the amino acid residues for antigen binding and confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three
- CDRs specific for an antigen has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
- Single-chain Fv also abbreviated as “sFv” or “scFv” are antibody fragments that comprise the V ⁇ and V L antibody domains connected into a single polypeptide chain.
- the sFv polypeptide further comprises a polypeptide linker between the V H and V L domains which enables the sFv to form the desired structure for antigen binding.
- diabodies refers to small antibody fragments prepared by constructing sFv fragments (see preceding paragraph) with short linkers (about 5-10 residues) between the V H and V L domains such that interchain but not intra-chain pairing of the V domains is achieved, resulting in a bivalent fragment, i.e., fragment having two antigen-binding sites.
- Bispecific diabodies are heterodimers of two "crossover" sFv fragments in which the V H and V L domains of the two antibodies are present on different polypeptide chains.
- Diabodies are described more fully in, for example, EP 404,097; WO 93/11161 ; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 ( 1993).
- Humanized forms of non-human (e.g., rodent) antibodies are chimeric antibodies that contain minimal sequence derived from the non-human antibody.
- humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or non-human primate having the desired antibody specificity, affinity, and capability.
- donor antibody such as mouse, rat, rabbit or non-human primate having the desired antibody specificity, affinity, and capability.
- framework region (FR) residues of the human immunoglobulin are replaced by corresponding non- human residues.
- humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance.
- the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence.
- the humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
- Fc immunoglobulin constant region
- a "species-dependent antibody,” e.g., a mammalian anti-human IgE antibody, is an antibody which has a stronger binding affinity for an antigen from a first mammalian species than it has for a homologue of that antigen from a second mammalian species.
- the species-dependent antibody "bind specifically" to a human antigen (i.e., has a binding affinity (Kd) value of no more than about 1 x 10 "7 M, preferably no more than about 1 x 10 8 and most preferably no more than about 1 x 10 "9 M) but has a binding affinity for a homologue of the antigen from a second non-human mammalian species which is at least about 50 fold, or at least about 500 fold, or at least about 1000 fold, weaker than its binding affinity for the human antigen.
- the species-dependent antibody can be of any of the various types of antibodies as defined above, but preferably is a humanized or human antibody.
- IL- 17A/F binding oligopeptide is an oligopeptide that binds, preferably specifically, to an EL- 17A/F polypeptide as described herein.
- IL-17A/F binding oligopeptides may be chemically synthesized using known oligopeptide synthesis methodology or may be prepared and purified using recombinant technology.
- EL-17 A/F binding oligopeptides are usually at least about 5 amino acids in length, alternatively at least about 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26. 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38.
- IL- 17A/F binding oligopeptides may be identified without undue experimentation using well known techniques.
- techniques for screening oligopeptide libraries for oligopeptides that are capable of specifically binding to a polypeptide target are well known in the art (see, e.g., U.S. Patent Nos. 5,556,762, 5,750,373, 4,708,871, 4,833,092, 5,223,409, 5,403,484, 5,571,689, 5,663,143; PCT Publication Nos. WO 84/03506 and WO84/03564; Geysen et al., Proc. Natl. Acad. Sci. U.S.A..
- an "YL- Il AfF binding organic molecule” is an organic molecule other than an oligopeptide or antibody as defined herein that binds, preferably specifically, to an IL-17 A/F polypeptide as described herein.
- IL- 17A/F binding organic molecules may be identified and chemically synthesized using known methodology (see, e.g., PCT Publication Nos. WOOO/00823 and WOOO/39585).
- IL- 17A/F binding organic molecules are usually less than about 2000 daltons in size, alternatively less than about 1500, 750, 500, 250 or 200 daltons in size, wherein such organic molecules that are capable of binding, preferably specifically, to an IL- 17A/F polypeptide as described herein may be identified without undue experimentation using well known techniques.
- techniques for screening organic molecule libraries for molecules that are capable of binding to a polypeptide target are well known in the art (see, e.g., PCT Publication Nos. WOOO/00823 and WO00/39585).
- An antibody, oligopeptide or other organic molecule "which binds" an antigen of interest e.g. a tumor-associated polypeptide antigen target, is one that binds the antigen with sufficient affinity such that the antibody, oligopeptide or other organic molecule is useful as a diagnostic and/or therapeutic agent in targeting a cell or tissue expressing the antigen, and does not significantly cross-react with other proteins.
- the extent of binding of the antibody, oligopeptide or other organic molecule to a "non-target" protein will be less than about 10% of the binding of the antibody, oligopeptide or other organic molecule to its particular target protein as determined by fluorescence activated cell sorting (FACS) analysis or radioimmunoprecipitation (RIA).
- FACS fluorescence activated cell sorting
- RIA radioimmunoprecipitation
- Specific binding can be measured, for example, by determining binding of a molecule compared to binding of a control molecule, which generally is a molecule of similar structure that does not have binding activity. For example, specific binding can be determined by competition with a control molecule that is similar to the target, for example, an excess of non-labeled target. In this case, specific binding is indicated if the binding of the labeled target to a probe is competitively inhibited by excess unlabeled target.
- telomere binding or “specifically binds to” or is “specific for” a particular polypeptide or an epitope on a particular polypeptide target as used herein can be exhibited, for example, by a molecule having a Kd for the target of at least about 10 4 M, alternatively at least about 10 5 M, alternatively at least about 10 6 M, alternatively at least about 10 7 M, alternatively at least about 10 8 M, alternatively at least about 10 9 M, alternatively at least about 10 l0 M, alternatively at least about 10 " M, alternatively at least about 10 12 M, or greater.
- the term "specific binding” refers to binding where a molecule binds to a particular polypeptide or epitope on a particular polypeptide without substantially binding to any other polypeptide or polypeptide epitope.
- An antibody, oligopeptide or other organic molecule that "inhibits the growth of tumor cells expressing an "IL- 17A/F polypeptide” or a “growth inhibitory” antibody, oligopeptide or other organic molecule is one which results in measurable growth inhibition of cancer cells expressing or overexpressing the appropriate IL-17 A/F polypeptide.
- Preferred growth inhibitory anti-IL-17A/F antibodies, oligopeptides or organic molecules inhibit growth of IL- 17A/F-expressing tumor cells by greater than 20%, preferably from about 20% to about 50%, and even more preferably, by greater than 50% (e.g., from about 50% to about 100%) as compared to the appropriate control, the control typically being tumor cells not treated with the antibody, oligopeptide or other organic molecule being tested.
- growth inhibition can be measured at an antibody concentration of about 0.1 to 30 ⁇ g/ml or about 0.5 nM to 200 nM in cell culture, where the growth inhibition is determined 1-10 days after exposure of the tumor cells to the antibody. Growth inhibition of tumor cells in vivo can be determined in various ways.
- the antibody is growth inhibitory in vivo if administration of the anti-IL- 17A/F antibody at about 1 ⁇ g/kg to about 100 mg/kg body weight results in reduction in tumor size or tumor cell proliferation within about 5 days to 3 months from the first administration of the antibody, preferably within about 5 to 30 days.
- An antibody, oligopeptide or other organic molecule which "induces apoptosis" is one which induces programmed cell death as determined by binding of annexin V, fragmentation of DNA, cell shrinkage, dilation of endoplasmic reticulum, cell fragmentation, and/or formation of membrane vesicles (called apoptotic bodies).
- the cell is usually one which overexpresses an IL-17A/F polypeptide.
- the cell is a tumor cell, e.g., a prostate, breast, ovarian, stomach, endometrial, lung, kidney, colon, bladder cell.
- Various methods are available for evaluating the cellular events associated with apoptosis.
- phosphatidyl serine (PS) translocation can be measured by annexin binding; DNA fragmentation can be evaluated through DNA laddering; and nuclear/chromatin condensation along with DNA fragmentation can be evaluated by any increase in hypodiploid cells.
- the antibody, oligopeptide or other organic molecule which induces apoptosis is one which results in about 2 to 50 fold, preferably about 5 to 50 fold, and most preferably about
- Antibody effector functions refer to those biological activities attributable to the Fc region (a native sequence Fc region or amino acid sequence variant Fc region) of an antibody, and vary with the antibody isotype. Examples of antibody effector functions include: C 1 q binding and complement dependent cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g., B cell receptor); and B cell activation.
- ADCC antibody-dependent cell-mediated cytotoxicity
- FcRs Fc receptors
- cytotoxic cells e.g., Natural Killer (NK) cells, neutrophils, and macrophages
- NK cells Natural Killer cells
- neutrophils neutrophils
- macrophages cytotoxic cells
- the antibodies “arm” the cytotoxic cells and are absolutely required for such killing.
- the primary cells for mediating ADCC, NK cells express Fc ⁇ R ⁇ I only, whereas monocytes express Fc ⁇ RI, Fc ⁇ RII and Fc ⁇ RIII.
- ADCC activity of a molecule of interest is assessed in vivo, e.g., in a animal model such as that disclosed in Clynes et al.Proc. Natl. Acad. Sci. U.S.A. 95:652-656 (1998).
- Fc receptor or “FcR” describes a receptor that binds to the Fc region of an antibody.
- the preferred FcR is a native sequence human FcR.
- a preferred FcR is one which binds an IgG antibody (a gamma receptor) and includes receptors of the Fc ⁇ RI, Fc ⁇ RII and Fc ⁇ RIII subclasses, including allelic variants and alternatively spliced forms of these receptors.
- Fc ⁇ RII receptors include Fc ⁇ RIIA (an “activating receptor”) and Fc ⁇ RIIB (an “inhibiting receptor”), which have similar amino acid sequences that differ primarily in the cytoplasmic domains thereof.
- Activating receptor Fc ⁇ RUA contains an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain.
- Inhibiting receptor Fc ⁇ RIIB contains an immunoreceptor tyrosine-based inhibition motif (ITIM) in its cytoplasmic domain, (see review M. in Daeron, Annu. Rev. Immunol. 15:203-234 (1997)).
- FcRs are reviewed in Ravetch and Kinet, Annu. Rev. Immunol. 9:457-492 ( 1991); Capel et al., Immunomethods 4:25-34 (1994); and de Haas et al., J. Lab. Clin. Med. 126:330-41 ( 1995).
- FcR FcR
- FcRn neonatal receptor
- Human effector cells are leukocytes which express one or more FcRs and perform effector functions. Preferably, the cells express at least Fc ⁇ RIII and perform ADCC effector function. Examples of human leukocytes which mediate ADCC include peripheral blood mononuclear cells (PBMC), natural killer PBMC, and PBMC.
- PBMC peripheral blood mononuclear cells
- NK cells monocytes, cytotoxic T cells and neutrophils; with PBMCs and NK cells being preferred.
- the effector cells may be isolated from a native source, e.g., from blood.
- “Complement dependent cytotoxicity” or “CDC” refers to the lysis of a target cell in the presence of complement. Activation of the classical complement pathway is initiated by the binding of the first component of the complement system (C 1 q) to antibodies (of the appropriate subclass) which are bound to their cognate antigen.
- C 1 q the first component of the complement system
- a CDC assay e.g., as described in Gazzano-Santoro et al., J. Immunol. Methods 202: 163 ( 1996), may be performed.
- label when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody so as to generate a "labeled" antibody.
- the label may be detectable by itself (e.g. radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable.
- solid phase is meant a non-aqueous matrix to which the antibody of the present invention can adhere.
- solid phases encompassed herein include those formed partially or entirely of glass (e.g., controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicones.
- the solid phase can comprise the well of an assay plate; in others it is a purification column (e.g., an affinity chromatography column). This term also includes a discontinuous solid phase of discrete particles, such as those described in U.S. Patent No. 4,275,149.
- a “liposome” is a small vesicle composed of various types of lipids, phospholipids and/or surfactant which is useful for delivery of a drug (such as an IL-17A/F polypeptide or antibody thereto) to a mammal.
- a drug such as an IL-17A/F polypeptide or antibody thereto
- the components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes.
- a “small molecule” is defined herein to have a molecular weight below about 500 Daltons.
- modulate means to affect (e.g., either upregulate, downregulate or otherwise control) the level of a signaling pathway.
- Cellular processes under the control of signal transduction include, but are not limited to, transcription of specific genes, normal cellular functions, such as metabolism, proliferation, differentiation, adhesion, apoptosis and survival, as well as abnormal processes, such as transformation, blocking of differentiation and metastasis.
- Activity refers to form(s) of an IL- 17A/F polypeptide which retain a biological and/or an immunological activity of native or naturally-occurring IL- 17 A/F polypeptides, wherein "biological” activity refers to a biological function (either inhibitory or stimulatory) caused by a native or naturally-occurring IL- 17A/F polypeptide other than the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally-occurring IL- 17A/F polypeptide and an "immunological" activity refers to the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally-occurring EL- 17A/F polypeptide.
- One preferred biological activity includes inducing activation of NF- ⁇ B and stimulation of the production of the proinflammatory chemokines DL-8 and IL-6. Another preferred biological activity includes stimulation of peripheral blood mononuclear cells or CD4 + cells. Another preferred biological activity includes stimulation of the proliferation of T- lymphocytes. Another preferred biological activity includes, for example, the release of TNF- ⁇ from THPl cells. Another activity includes an enhancement of matrix synthesis in articular cartilage. Alternatively, another activity includes promoting breakdown of articular cartilage matrix as well as inhibiting matrix synthesis. Another preferred biological activity includes modulating the level of the interleukin- 17 signalling pathway during mild to severe stages of inflammatory bowel disease or during stroke.
- Degenerative cartilagenous disorder describes a host of disorders that is characterized principally by the destruction of the cartilage matrix. Additional pathologies includes nitric oxide production, and elevated proteoglycan breakdown. Exemplary disorders encompassed within this definition, include, for example, arthritis (e.g., osteoarthritis, rheumatoid arthritis, psoriatic arthritis).
- immune related disease means a disease in which a component of the immune system of a mammal causes, mediates or otherwise contributes to a morbidity in the mammal. Also included are diseases in which stimulation or intervention of the immune response has an ameliorative effect on progression of the disease. Included within this term are immune-mediated inflammatory diseases, non-immune-mediated inflammatory diseases, infectious diseases, immunodeficiency diseases, neoplasia, etc.
- T cell mediated disease means a disease in which T cells directly or indirectly mediate or otherwise contribute to a morbidity in a mammal.
- the T cell mediated disease may be associated with cell mediated effects, lymphokine mediated effects, etc., and even effects associated with B cells if the B cells are stimulated, for example, by the lymphokines secreted by T cells.
- immune-related and inflammatory diseases examples include systemic lupus erythematosis, rheumatoid arthritis, juvenile chronic arthritis, spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic inflammatory myopathies (dermatomyositis, polymyositis), Sjogren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria), autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia), thyroiditis (Grave's disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic thyroiditis), diabetes mellitus, immune-mediated renal disease (glomerulonephritis, tubulointerstitial n
- an IL- XlPJF polypeptide and/or agonist/antagonist which results in achieving a particular stated purpose.
- An “effective amount” of an IL-17A/F polypeptide or agonist or antagonist thereof may be determined empirically.
- a “therapeutically effective amount” is a concentration or amount of an IL-17A/F polypeptide or agonist or antagonist thereof
- IL- 17A/F polypeptide and/or agonist/antagonist which is effective for achieving a stated therapeutic effect. This amount may also be determined empirically.
- cytotoxic agent refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells.
- the term is intended to include radioactive isotopes (e.g., I 131 , 1 125 , Y 90 and Re 186 ), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof.
- chemotherapeutic agent is a chemical compound useful in the treatment of cancer.
- chemotherapeutic agents include adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids, e.g., paclitaxel (Taxol, Bristol-Myers Squibb Oncology, Princeton, NJ), and doxetaxel (Taxotere, Rh ⁇ ne-Poulenc Rorer, Antony, France), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carmino
- a “growth inhibitory agent” when used herein refers to a compound or composition which inhibits growth of a cell, especially cancer cell overexpressing any of the genes identified herein, either in vitro or in vivo. Thus, the growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in S phase. Examples of growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce Gl arrest and M-phase arrest.
- Classical M-phase blockers include the vincas (vincristine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin.
- Those agents that arrest Gl also spill over into S-phase arrest, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil, and ara-C.
- cytokine is a generic term for proteins released by one cell population which act on another cell as intercellular mediators.
- cytokines are lymphokines, monokines, and traditional polypeptide hormones. Included among the cytokines are growth hormone such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic growth factor; fibroblast growth factor; prolactin; placental lactogen; tumor necrosis factor- ⁇ and - ⁇ ; mullerian-inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factors such as NGF- ⁇ ; platelet-growth factor;
- Max file length is 65535 (limited by unsigned short x in the jmp struct)
- the program may create a tmp file in /tmp to hold info about traceback.
- Ix (lenO ⁇ leniy ? lenO lenl, else
- Table 1 (conf) fprintf(fx, " ⁇ gaps in first sequence: %d”, gapx); ...getmat if (gapx) ⁇ (void) sprintf(outx, " (%d %s%s)", ngapx, (dna)?
- *po[i] *ps[i]; if (islower(*ps[i]))
- *ps[i] toupper(*ps[i]); po[i]++; ps[i]++;
- *py++ *px, else if (islower(*px))
- *py++ toupper(*px), if (index("ATGCU",*(py-l))) natgc++, ⁇ ⁇
- IL-17 A/F Polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as TL- 17 AfF polypeptides.
- TL- 17 AfF polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as TL- 17 AfF polypeptides.
- cDNAs encoding various IL-17A/F polypeptides have been identified and isolated, as disclosed in further detail in the Examples below.
- IL- 17 A/F variants can be prepared.
- IL- 17 A/F variants can be prepared by introducing appropriate nucleotide changes into the IL- 17 A/F DNA, and/or by synthesis of the desired IL-17A/F polypeptide.
- amino acid changes may alter post-translational processes of the IL- 17 A/F, such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics.
- Variations in the native full-length sequence BL- 17 A/F or in various domains of the IL- 17 A/F described herein can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations set forth, for instance, in U.S. Patent No. 5,364,934.
- Variations may be a substitution, deletion or insertion of one or more codons encoding the DL- 17A/F that results in a change in the amino acid sequence of the IL- 17 A/F as compared with the native sequence DL- 17 A/F.
- the variation is by substitution of at least one amino acid with any other amino acid in one or more of the domains of the IL- 17 A/F.
- Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the IL- 17A/F with that of homologous known protein molecules and minimizing the number of amino acid sequence changes made in regions of high homology.
- Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serine, i.e., conservative amino acid replacements.
- Insertions or deletions may optionally be in the range of about 1 to 5 amino acids. The variation allowed may be determined by systematically making insertions, deletions or substitutions of amino acids in the sequence and testing the resulting variants for activity exhibited by the full-length or mature native sequence.
- IL- 17A/F polypeptide fragments are provided herein. Such fragments may be truncated at the N- terminus or C-terminus, or may lack internal residues, for example, when compared with a full length native protein. Certain fragments lack amino acid residues that are not essential for a desired biological activity of the IL- 17A/F polypeptide.
- IL- 17A/F fragments may be prepared by any of a number of conventional techniques. Desired peptide fragments may be chemically synthesized.
- An alternative approach involves generating IL- 17A/F fragments by enzymatic digestion, e.g., by treating the protein with an enzyme known to cleave proteins at sites defined by particular amino acid residues, or by digesting the DNA with suitable restriction enzymes and isolating the desired fragment.
- Yet another suitable technique involves isolating and amplifying a DNA fragment encoding a desired polypeptide fragment, by polymerase chain reaction (PCR). Oligonucleotides that define the desired termini of the DNA fragment are employed at the 5' and 3' primers in the PCR.
- IL-17 A/F polypeptide fragments share at least one biological and/or immunological activity with the native IL- 17A/F polypeptide disclosed herein.
- conservative substitutions of interest are shown in Table 6 under the heading of preferred substitutions. If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table 6, or as further described below in reference to amino acid classes, are introduced and the products screened.
- Substantial modifications in function or immunological identity of the IL- 17 A/F polypeptide are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
- Naturally occurring residues are divided into groups based on common side-chain properties: ( 1) hydrophobic: norleucine, met, ala, val, leu, ile; (2) neutral hydrophilic: cys, ser, thr;
- Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Such substituted residues also may be introduced into the conservative substitution sites or, more preferably, into the remaining (non-conserved) sites.
- oligonucleotide-mediated (site- directed) mutagenesis alanine scanning, and PCR mutagenesis.
- Site-directed mutagenesis [Carter et al., Nucl. Acids Res., _L3:4331 (1986); Zoller et al., Nucl. Acids Res., J0:6487 (1987)], cassette mutagenesis (Wells et al., Gene, 34:315 [ 1985]), restriction selection mutagenesis (Wells et al., Philos. Trans. R. Soc.
- Covalent modifications of EL- 17 A/F are included within the scope of this invention.
- One type of covalent modification includes reacting targeted amino acid residues of an EL- 17 A/F polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the BL- 17 A/F.
- Derivatization with bifunctional agents is useful, for instance, for crosslinking EL- 17A/F to a water-insoluble support matrix or surface for use in the method for purifying anti-DL-17A/F antibodies, and vice-versa.
- crosslinking agents include, e.g., l,l-bis(diazoacetyl)-2- phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succinimidylpropionate), bifunctional maleimides such as bis-N-maleimido- 1 ,8-octane and agents such as methyl-3-[(p- azidophenyl)dithio]propioimidate.
- Another type of covalent modification of the EL- 17A/F polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide.
- "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence EL- 17A/F (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence IL-17A/F.
- the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present.
- Addition of glycosylation sites to the IL- 17A/F polypeptide may be accomplished by altering the amino acid sequence.
- the alteration may be made, for example, by the addition of, or substitution by, one or more serine or threonine residues to the native sequence IL-17A/F (for O-linked glycosylation sites).
- the IL- 17A/F amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the IL-17 A/F polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids.
- Another means of increasing the number of carbohydrate moieties on the IL- 17 A/F polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g., in WO 87/05330 published 1 1 September 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259- 306 (1981).
- Removal of carbohydrate moieties present on the IL-17A/F polypeptide may be accomplished chemically or enzymatically or by mutational substitution of codons encoding for amino acid residues that serve as targets for glycosylation.
- Chemical deglycosylation techniques are known in the art and described, for instance, by Hakimuddin, et al., Arch. Biochem. Biophvs., 259:52 (1987) and by Edge et al., Anal. Biochem., 1 18: 131 (1981).
- Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al., Meth. Enzvmol., 138:350 (1987).
- Another type of covalent modification of IL- 17 A/F comprises linking the IL-17A/F polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
- the DL- 17A/F of the present invention may also be modified in a way to form a chimeric molecule comprising IL- 17 A/F fused to another, heterologous polypeptide or amino acid sequence.
- such a chimeric molecule comprises a fusion of the IL- 17 A/F with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind.
- the epitope tag is generally placed at the amino- or carboxyl- terminus of the IL- 17 A/F. The presence of such epitope-tagged forms of the IL- 17A/F can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the EL- 17A/F to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag.
- Various tag polypeptides and their respective antibodies are well known in the art.
- poly-histidine poly-his
- poly-histidine-glycine poly-his-glycine tags
- flu HA tag polypeptide and its antibody 12CA5 [Field et al., MoI. Cell. Biol., 8:2159- 2165 ( 1988)]
- c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5:3610-3616 ( 1985)]
- Herpes Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein Engineering, 3(6):547-553 (1990)].
- tag polypeptides include the Flag-peptide [Hopp et al., BioTechnology, 6: 1204-1210 ( 1988)]; the KT3 epitope peptide [Martin et al., Science, 255: 192- 194 ( 1992)]; an ⁇ -tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266: 15163- 15166 ( 1991)]; and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 82:6393- 6397 (1990)].
- the chimeric molecule may comprise a fusion of the IL- 17 A/F with an immunoglobulin or a particular region of an immunoglobulin.
- an immunoglobulin also referred to as an "immunoadhesin”
- a fusion could be to the Fc region of an IgG molecule.
- the Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of an IL-17A/F polypeptide in place of at least one variable region within an Ig molecule.
- the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHl, CH2 and CH3 regions of an IgGl molecule.
- immunoglobulin fusions see also US Patent No. 5,428,130 issued June 27, 1995.
- the IL- 17 A/F polypeptides of the present invention may also be modified in a way to form a chimeric molecule comprising an IL- 17 A/F polypeptide fused to a leucine zipper.
- leucine zipper polypeptides have been described in the art. See, e.g., Landschulz et al, Science, 240: 1759 ( 1988); WO 94/10308; Hoppe et al, FEBS Letters, 344: 1991 ( 1994); Maniatis et al. Nature, 341:24 ( 1989).
- leucine zipper fused to an IL- 17 A/F polypeptide may be desirable to assist in dimerizing or trimerizing soluble IL- 17 A/F polypeptide in solution.
- the leucine zipper may be fused at either the N- or C-terminal end of the IL- 17A/F molecule.
- IL- 17 A/F Preparation of IL- 17 A/F
- the description below relates primarily to production of IL- 17 A/F by culturing cells transformed or transfected with a vector containing EL-17A/F nucleic acid. It is, of course, contemplated that alternative methods, which are well known in the art, may be employed to prepare DL-17A/F.
- the IL- 17 A/F sequence, or portions thereof may be produced by direct peptide synthesis using solid-phase techniques [see, e.g., Stewart et al., Solid-Phase Peptide Synthesis, W. H. Freeman Co., San Francisco, CA (1969); Merrifield, J 1 Am. Chem. Soc, 85_:2149-2154 ( 1963)].
- In vitro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's instructions. Various portions of the IL- 17 A/F may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length IL- 17 A/F.
- DNA encoding BL-17A/F may be obtained from a cDNA library prepared from tissue believed to possess the JL- 17A/F mRNA and to express it at a detectable level. Accordingly, human IL-17A/F DNA can be conveniently obtained from a cDNA library prepared from human tissue, such as described in the Examples.
- the IL- 17 A/F-encoding gene may also be obtained from a genomic library or by known synthetic procedures (e.g., automated nucleic acid synthesis).
- Probes such as antibodies to the IL- 17A/F or oligonucleotides of at least about 20-80 bases
- Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989).
- An alternative means to isolate the gene encoding IL-17A/F is to use PCR methodology [Sambrook et al., supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)].
- the oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized.
- the oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels like 32 P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate stringency and high stringency, are provided in Sambrook et al., supra. Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and available in public databases such as GenBank or other private sequence databases. Sequence identity (at either the amino acid or nucleotide level) within defined regions of the molecule or across the full-length sequence can be determined using methods known in the art and as described herein.
- Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al., supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA.
- Host cells are transfected or transformed with expression or cloning vectors described herein for IL-
- the culture conditions such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation. In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology: a Practical Approach. M. Butler, ed. (IRL Press, 1991) and Sambrook et al., supra.
- Methods of eukaryotic cell transfection and prokaryotic cell transformation are known to the ordinarily skilled artisan, for example, CaCl 2 , CaPO 4 , liposome-mediated and electroporation. Depending on the host cell used, transformation is performed using standard techniques appropriate to such cells.
- the calcium treatment employing calcium chloride, as described in Sambrook et al., supra, or electroporation is generally used for prokaryotes.
- Infection with Agrobacterium tumefaciens is used for transformation of certain plant cells, as described by Shaw et al., Gene, 23:315 (1983) and WO 89/05859 published 29 June 1989.
- Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote, yeast, or higher eukaryote cells.
- Suitable prokaryotes include but are not limited to eubacteria, such as Gram- negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli.
- eubacteria such as Gram- negative or Gram-positive organisms
- Enterobacteriaceae such as E. coli.
- Various E. coli strains are publicly available, such as E. coli Kl 2 strain MM294 (ATCC 31 ,446); E. coli X1776 (ATCC 31,537); E. coli strain W3110 (ATCC 27,325) and K5 772 (ATCC 53,635).
- Other suitable prokaryotic host cells include Enterobacteriaceae such as Escherichia, e.g., E.
- Strain W3110 is one particularly preferred host or parent host because it is a common host strain for recombinant TL-IlPJF duct fermentations.
- strain W31 10 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E. coli W31 10 strain 1A2, which has the complete genotype tonA ; E. coli W31 10 strain 9E4, which has the complete genotype tonA ptr3; E. coli W31 10 strain 27C7 (ATCC 55,244), which has the complete genotype tonA ptr3 phoA El 5 (argF-lac)169 degP ompT kan r ; E.
- coli W3110 strain 37D6 which has the complete genotype tonA ptr3 phoA El 5 (argF- lac)169 degP ompT rbs7 UvG kan r ; E. coli W31 10 strain 40B4, which is strain 37D6 with a non-kanamycin resistant degP deletion mutation; and an E. coli strain having mutant periplasmic protease disclosed in U.S. Patent No. 4,946,783 issued 7 August 1990.
- in vitro methods of cloning e.g., PCR or other nucleic acid polymerase reactions, are suitable.
- eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for IL-17A/F-encoding vectors.
- Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism.
- Others include Schizosaccharomyces pombe [Beach and Nurse, Nature, 290: 140 (1981); EP 139,383 published 2 May 1985]; Kluyveromyces hosts (U.S. Patent No. 4,943,529; Fleer et al., Bio/Technology, 9:968-975 [1991]) such as, e.g., K. lactis (MW98-8C, CBS683, CBS4574;
- Schwanniomyces such as Schwanniomyces occidentalis (EP 394,538 published 31 October 1990); and filamentous fungi such as, e.g., Neurospora, Penicillium, Tolypocladium (WO 91/00357 published 10 January 1991), and Aspergillus hosts such as ⁇ . nidulans (Ballance et al., Biochem. Biophys. Res. Commun., 1 12:284- 289 [1983]; Tilburn et al., Gene, 26:205-221 [1983]; Yelton et al., Proc. Natl. Acad. Sci. USA. 8 k 1470- 1474 [1984]) and A.
- Methylotropic yeasts are suitable herein and include, but are not limited to, yeast capable of growth on methanol selected from the genera consisting of Hansenula, Candida, Kloeckera, Pichia, Saccliaromyces, Torulopsis, and Rhodotorula. A list of specific species that are exemplary of this class of yeasts may be found in C. Anthony, The Biochemistry of Methylotrophs, 269 ( 1982).
- Suitable host cells for the expression of glycosylated EL-17A/F are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9 or
- CHO Chinese hamster ovary
- COS-7 monkey kidney CVl line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); Chinese hamster ovary cellsADHFR (CHO,
- mouse mammary tumor (MMT 060562, ATCC CCL51).
- MMT 060562, ATCC CCL51 mouse mammary tumor
- the nucleic acid (e.g., cDNA or genomic DNA) encoding TL-ITAfF may be inserted into a replicable vector for cloning (amplification of the DNA) or for expression.
- a replicable vector for cloning (amplification of the DNA) or for expression.
- the vector may, for example, be in the form of a plasmid, cosmid, viral particle, or phage.
- the appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction endonuclease site(s) using techniques known in the art.
- Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, an promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of these components employs standard ligation techniques which are known to the skilled artisan.
- the TL-ITAfF may be produced recombinantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide.
- the signal sequence may be a component of the vector, or it may be a part of the IL-17A/F-encoding DNA that is inserted into the vector.
- the signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, lpp, or heat-stable enterotoxin II leaders.
- the signal sequence may be, e.g., the yeast invertase leader, alpha factor leader (including Sacclwromyces and Kluyveromyces ⁇ -factor leaders, the latter described in U.S. Patent No. 5,010,182), or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362,179 published 4 April 1990), or the signal described in WO
- mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders.
- Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses.
- the origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2 ⁇ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or
- BPV BPV
- Selection genes will typically contain a selection gene, also termed a selectable marker.
- Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
- selectable markers for mammalian cells are those that enable the identification of cells competent to take up the IL-17A/F-encoding nucleic acid, such as DHFR or thymidine kinase.
- An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:4216 (1980).
- a suitable selection gene for use in yeast is the trpl gene present in the yeast plasmid YRp7 [Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al, Gene, 7: 141 (1979); Tschemper et al, Gene, K): 157 (1980)].
- the trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4- 1 [Jones, Genetics, 85: 12 ( 1977)].
- Expression and cloning vectors usually contain a promoter operably linked to the IL- 17A/F-encoding nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the ⁇ -lactamase and lactose promoter systems [Chang et al., Nature, 275:615 (1978); Goeddel et al, Nature, 281:544 ( 1979)], alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res., 8:4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, 80:21-25 (1983)]. Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA
- Suitable promoting sequences for use with yeast hosts include the promoters for 3- phosphoglycerate kinase [Hitzeman et al, J. Biol. Chem., 255:2073 (1980)] or other glycolytic enzymes [Hess et al, J. Adv.
- yeast promoters which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657.
- EL-17 A/F transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,21 1 ,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus. hepatitis-B virus and Simian Virus 40 (SV40), from heterologous mammalian promoters, e.g., the actin promoter or an immunoglobulin promoter, and from heat-shock promoters, provided such promoters are compatible with the host cell systems.
- viruses such as polyoma virus, fowlpox virus (UK 2,21 1 ,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalo
- Enhancers are cis-acting elements of DNA, usually about from 10 to
- enhancer sequences are now known from mammalian genes (globin, elastase, albumin, ⁇ - fetoprotein, and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. The enhancer may be spliced into the vector at a position 5' or 3' to the IL-17A/F coding sequence, but is preferably located at a site 5' from the promoter.
- Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding IL- 17A/F.
- Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, Proc. Natl. Acad. Sci. USA, 77:5201-5205 [1980]), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein.
- antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
- Gene expression may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
- Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence IL- 17 A/F polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to IL- 17 A/F DNA and encoding a specific antibody epitope.
- IL- 17A/F may be recovered from culture medium or from host cell lysates. If membrane- bound, it can be released from the membrane using a suitable detergent solution (e.g., Triton-X 100) or by enzymatic cleavage. Cells employed in expression of IL- 17A/F can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents.
- IL- 17 A/F It may be desired to purify IL- 17 A/F from recombinant cell proteins or polypeptides.
- the following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE: chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG; and metal chelating columns to bind epitope-tagged forms of the IL-17 A/F.
- IL- 17 A/F Nucleotide sequences (or their complement) encoding IL-17A/F have various applications in the art of molecular biology, including uses as hybridization probes, in chromosome and gene mapping and in the generation of anti-sense RNA and DNA.
- IL- 17 A/F nucleic acid will also be useful for the preparation of EL- 17 A/F polypeptides by the recombinant techniques described herein.
- the full-length native sequence IL- 17 A/F gene, or portions thereof, may be used as hybridization probes for a cDNA library to isolate the full-length BL- 17 A/F cDNA or to isolate still other cDNAs (for instance, those encoding naturally-occurring variants of BL- 17 A/F or IL- 17 A/F from other species) which have a desired sequence identity to the native BL- 17A/F sequence disclosed herein.
- the length of the probes will be about 20 to about 50 bases.
- the hybridization probes may be derived from at least partially novel regions of the full length native nucleotide sequence wherein those regions may be determined without undue experimentation or from genomic sequences including promoters, enhancer elements and introns of native sequence IL- 17 A/F.
- a screening method will comprise isolating the coding region of the BL-17A/F gene using the known DNA sequence to synthesize a selected probe of about 40 bases.
- Hybridization probes may be labeled by a variety of labels, including radionucleotides such as 32 P or 35 S, or enzymatic labels such as alkaline phosphatase coupled to the probe via avidin/biotin coupling systems.
- Labeled probes having a sequence complementary to that of the DL- 17 A/F gene of the present invention can be used to screen libraries of human cDNA, genomic DNA or mRNA to determine which members of such libraries the probe hybridizes to. Hybridization techniques are described in further detail in the Examples below.
- any EST sequences disclosed in the present application may similarly be employed as probes, using the methods disclosed herein.
- Other useful fragments of the IL-17A/F nucleic acids include antisense or sense oligonucleotides comprising a singe-stranded nucleic acid sequence (either RNA or DNA) capable of binding to target IL- 17A/F mRNA (sense) or BL- 17A/F DNA (antisense) sequences.
- Antisense or sense oligonucleotides, according to the present invention comprise a fragment of the coding region of BL- 17 A/F DNA. Such a fragment generally comprises at least about 14 nucleotides, preferably from about 14 to 30 nucleotides.
- binding of antisense or sense oligonucleotides to target nucleic acid sequences results in the formation of duplexes that block transcription or translation of the target sequence by one of several means, including enhanced degradation of the duplexes, premature termination of transcription or translation, or by other means.
- the antisense oligonucleotides thus may be used to block expression of TL- 17 AfF proteins.
- Antisense or sense oligonucleotides further comprise oligonucleotides having modified sugar-phosphodiester backbones (or other sugar linkages, such as those described in WO 91/06629) and wherein such sugar linkages are resistant to endogenous nucleases.
- Such oligonucleotides with resistant sugar linkages are stable in vivo (i.e., capable of resisting enzymatic degradation) but retain sequence specificity to be able to bind to target nucleotide sequences.
- sense or antisense oligonucleotides include those oligonucleotides which are covalently linked to organic moieties, such as those described in WO 90/10048, and other moieties that increases affinity of the oligonucleotide for a target nucleic acid sequence, such as poly-(L-lysine).
- intercalating agents such as ellipticine, and alkylating agents or metal complexes may be attached to sense or antisense oligonucleotides to modify binding specificities of the antisense or sense oligonucleotide for the target nucleotide sequence.
- Antisense or sense oligonucleotides may be introduced into a cell containing the target nucleic acid sequence by any gene transfer method, including, for example, CaPO 4 -mediated DNA transfection, electroporation, or by using gene transfer vectors such as Epstein-Barr virus.
- an antisense or sense oligonucleotide is inserted into a suitable retroviral vector.
- a cell containing the target nucleic acid sequence is contacted with the recombinant retroviral vector, either in vivo or ex vivo.
- Suitable retroviral vectors include, but are not limited to, those derived from the murine retrovirus M-MuLV, N2 (a retrovirus derived from M-MuLV), or the double copy vectors designated DCT5A, DCT5B and DCT5C (see WO 90/13641).
- Sense or antisense oligonucleotides also may be introduced into a cell containing the target nucleotide sequence by formation of a conjugate with a ligand binding molecule, as described in WO 91/04753.
- Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors.
- conjugation of the ligand binding molecule does not substantially interfere with the ability of the ligand binding molecule to bind to its corresponding molecule or receptor, or block entry of the sense or antisense oligonucleotide or its conjugated version into the cell.
- a sense or an antisense oligonucleotide may be introduced into a cell containing the target nucleic acid sequence by formation of an oligonucleotide-lipid complex, as described in WO 90/10448.
- the sense or antisense oligonucleotide-lipid complex is preferably dissociated within the cell by an endogenous lipase.
- Antisense or sense RNA or DNA molecules are generally at least about 5 bases in length, about 10 bases in length, about 15 bases in length, about 20 bases in length, about 25 bases in length, about 30 bases in length, about 35 bases in length, about 40 bases in length, about 45 bases in length, about 50 bases in length, about 55 bases in length, about 60 bases in length, about 65 bases in length, about 70 bases in length, about 75 bases in length, about 80 bases in length, about 85 bases in length, about 90 bases in length, about 95 bases in length, about 100 bases in length, or more.
- the probes may also be employed in PCR techniques to generate a pool of sequences for identification of closely related IL- 17A/F coding sequences.
- Nucleotide sequences encoding an IL-17 A/F can also be used to construct hybridization probes for mapping the gene which encodes that IL- 17 A/F and for the genetic analysis of individuals with genetic disorders.
- the nucleotide sequences provided herein may be mapped to a chromosome and specific regions of a chromosome using known techniques, such as in situ hybridization, linkage analysis against known chromosomal markers, and hybridization screening with libraries.
- the protein can be used in assays to identify the other proteins or molecules involved in the binding interaction. By such methods, inhibitors of the receptor/ligand binding interaction can be identified. Proteins involved in such binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction. Also, the receptor protein can be used to isolate correlative ligand(s). Screening assays can be designed to find lead compounds that mimic the biological activity of a native IL- 17 A/F or a receptor for IL- 17 A/F.
- screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates.
- Small molecules contemplated include synthetic organic or inorganic compounds.
- the assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art.
- Nucleic acids which encode IL-17A/F or its modified forms can also be used to generate either transgenic animals or "knock out" animals which, in turn, are useful in the development and screening of therapeutically useful reagents.
- a transgenic animal e.g., a mouse or rat
- a transgenic animal is an animal having cells that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g., an embryonic stage.
- a transgene is a DNA which is integrated into the genome of a cell from which a transgenic animal develops.
- cDNA encoding IL-17A/F can be used to clone genomic DNA encoding IL- 17 A/F in accordance with established techniques and the genomic sequences used to generate transgenic animals that contain cells which express DNA encoding IL- 17A/F.
- Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009.
- particular cells would be targeted for IL-17A/F transgene incorporation with tissue-specific enhancers.
- Transgenic animals that include a copy of a transgene encoding IL- 17A/F introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding IL- 17 A/F.
- Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression.
- an animal is treated with the reagent and a reduced incidence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition.
- non-human homologues of IL- 17A/F can be used to construct an IL-17A/F "knock out" animal which has a defective or altered gene encoding IL- 17A/F as a result of homologous recombination between the endogenous gene encoding IL-17A/F and altered genomic DNA encoding IL-17A/F introduced into an embryonic stem cell of the animal.
- cDNA encoding IL- 17A/F can be used to clone genomic DNA encoding IL- 17A/F in accordance with established techniques.
- a portion of the genomic DNA encoding IL- 17 A/F can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration.
- another gene such as a gene encoding a selectable marker which can be used to monitor integration.
- several kilobases of unaltered flanking DNA are included in the vector [see e.g., Thomas and Capecchi, Cell, 51:503 (1987) for a description of homologous recombination vectors].
- the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see, e.g., Li et al., Cell, 69:915 (1992)].
- the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see, e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 1 13- 152].
- a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal.
- Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA.
- Knockout animals can be characterized for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the IL- 17A/F polypeptide.
- Nucleic acid encoding the DL- 17A/F polypeptides may also be used in gene therapy.
- genes are introduced into cells in order to achieve in vivo synthesis of a therapeutically effective genetic product, for example for replacement of a defective gene.
- Gene therapy includes both conventional gene therapy where a lasting effect is achieved by a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeutically effective DNA or mRNA.
- Antisense RNAs and DNAs can be used as therapeutic agents for blocking the expression of certain genes in vivo.
- oligonucleotides can be imported into cells where they act as inhibitors, despite their low intracellular concentrations caused by their restricted uptake by the cell membrane. (Zamecnik et ai, Proc. Natl. Acad. Sci. USA, 83:4143-4146 [1986]).
- the oligonucleotides can be modified to enhance their uptake, e.g., by substituting their negatively charged phosphodiester groups by uncharged groups.
- nucleic acids there are a variety of techniques available for introducing nucleic acids into viable cells.
- the techniques vary depending upon whether the nucleic acid is transferred into cultured cells in vitro, or in vivo in the cells of the intended host.
- Techniques suitable for the transfer of nucleic acid into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, etc.
- the currently preferred in vivo gene transfer techniques include transfection with viral (typically retroviral) vectors and viral coat protein-liposome mediated transfection (Dzau et al., Trends in Biotechnology, 11 : 205-210 [ 1993]).
- the nucleic acid source with an agent that targets the target cells, such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cell, etc.
- an agent that targets the target cells such as an antibody specific for a cell surface membrane protein or the target cell, a ligand for a receptor on the target cell, etc.
- proteins which bind to a cell surface membrane protein associated with endocytosis may be used for targeting and/or to facilitate uptake, e.g., capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half-life.
- the technique of receptor-mediated endocytosis is described, for example, by Wu et al.. J. Biol.
- TL-IlAfF polypeptides described herein may also be employed as molecular weight markers for protein electrophoresis purposes and the isolated nucleic acid sequences may be used for recombinantly expressing those markers.
- the nucleic acid molecules encoding the IL-17 A/F polypeptides or fragments thereof described herein are useful for chromosome identification.
- there exists an ongoing need to identify new chromosome markers since relatively few chromosome marking reagents, based upon actual sequence data are presently available.
- Each IL-17A/F nucleic acid molecule of the present invention can be used as a chromosome marker.
- TL-IlAfF polypeptides and nucleic acid molecules of the present invention may also be used diagnostically for tissue typing, wherein the TL-IlAfF polypeptides of the present invention may be differentially expressed in one tissue as compared to another, preferably in a diseased tissue as compared to a normal tissue of the same tissue type.
- TL- IlAfF nucleic acid molecules will find use for generating probes for
- the TL-IlAfF polypeptides described herein may also be employed as therapeutic agents.
- the DL- 17A/F polypeptides of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby the TL-IlAfF product hereof is combined in admixture with a pharmaceutically acceptable carrier vehicle.
- Therapeutic formulations are prepared for storage by mixing the active ingredient having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980)), in the form of lyophilized formulations or aqueous solutions.
- Acceptable carriers, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as
- EDTA EDTA
- sugar alcohols such as mannitol or sorbitol
- salt-forming counterions such as sodium
- nonionic surfactants such as TWEENTM, PLURONICSTM or PEG.
- compositions to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes, prior to or following lyophilization and reconstitution.
- Therapeutic compositions herein generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
- the route of administration is in accord with known methods, e.g., injection or infusion by intravenous, intraperitoneal, intracerebral, intramuscular, intraocular, intraarterial or intralesional routes, topical administration, or by sustained release systems.
- Dosages and desired drug concentrations of pharmaceutical compositions of the present invention may vary depending on the particular use envisioned.
- the determination of the appropriate dosage or route of administration is well within the skill of an ordinary physician. Animal experiments provide reliable guidance for the determination of effective doses for human therapy.
- Interspecies scaling of effective doses can be performed following the principles laid down by Mordenti, J. and Chappell, W. "The use of interspecies scaling in toxicokinetics" In Toxicokinetics and New Drug Development, Yacobi et al, Eds., Pergamon Press, New York 1989, pp. 42-96.
- normal dosage amounts may vary from about 10 ng/kg to up to 100 mg/kg of mammal body weight or more per day, preferably about 1 ⁇ g/kg/day to 10 mg/kg/day, depending upon the route of administration.
- Guidance as to particular dosages and methods of delivery is provided in the literature; see, for example, U.S. Pat. Nos. 4,657,760; 5,206,344; or 5,225,212. It is anticipated that different formulations will be effective for different treatment compounds and different disorders, that administration targeting one organ or tissue, for example, may necessitate delivery in a manner different from that to another organ or tissue.
- microencapsulation of the IL-17 A/F polypeptide is contemplated. Microencapsulation of recombinant proteins for sustained release has been successfully performed with human growth hormone (rhGH), interferon- (rhIFN- ), interleukin-2, and MN rgpl 20. Johnson et al., Nat. Med., 2:795-799 (1996); Yasuda, Biomed.
- rhGH human growth hormone
- rhIFN- interferon-
- MN rgpl 20 MN rgpl 20. Johnson et al., Nat. Med., 2:795-799 (1996); Yasuda, Biomed.
- the sustained-release formulations of these proteins were developed using poly-lactic-coglycolic acid (PLGA) polymer due to its biocompatibility and wide range of biodegradable properties.
- PLGA poly-lactic-coglycolic acid
- the degradation products of PLGA, lactic and glycolic acids, can be cleared quickly within the human body.
- the degradability of this polymer can be adjusted from months to years depending on its molecular weight and composition. Lewis, "Controlled release of bioactive agents from lactide/glycolide polymer," in: M. Chasin and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), pp. 1-41.
- This invention encompasses methods of screening compounds to identify those that mimic the IL- 17A/F polypeptide (agonists) or prevent the effect of the YL-HAfF polypeptide (antagonists).
- Screening assays for antagonist drug candidates are designed to identify compounds that bind or complex with the IL- 17 A/F polypeptides encoded by the genes identified herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins.
- Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates.
- the assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays, which are well characterized in the art. All assays for antagonists are common in that they call for contacting the drug candidate with an IL-
- the interaction is binding and the complex formed can be isolated or detected in the reaction mixture.
- the IL- 17 A/F polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e.g., on a microtiter plate, by covalent or non-covalent attachments
- Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the JL- IT AfF polypeptide and drying
- an immobilized antibody, e g a monoclonal antibody, specific for the IL- 17 A/F polypeptide to be immobilized can be used to anchor it to a solid surface
- the assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e g , the coated surface containing the anchored component
- the non-reacted components are removed, e g , by washing, and complexes anchored on the solid surface
- the candidate compound interacts with but does not bind to a particular IL-17A/F polypeptide encoded by a gene identified herein
- its interaction with that polypeptide can be assayed by methods well known for detecting protem-protem interactions
- assays include traditional approaches, such as, e g , cross-linking, co-immunoprecrpitation, and co-pu ⁇ fication through gradients or chromatographic columns
- protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co-workers (Fields and Song, Nature (London).
- yeast GAL4 consist of two physically discrete modular domains, one acting as the DNA-binding domain, the other one functioning as the transcription-activation domain
- yeast expression system described in the foregoing publications (generally referred to as the "two-hybrid system") takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4, and another, in which candidate activating proteins are fused to the activation domain
- the expression of a GALl-/ ⁇ cZ reporter gene under control of a GAL4-activated promoter depends on reconstitution of GAL4 activity via protein-protein interaction Colonies containing interacting polypeptides are detected with a chromogenic
- antagonists may be detected by combining the IL- 17 A/F polypeptide and a potential antagonist with membrane-bound IL- 17 A/F polypeptide receptors or recombinant receptors under appropriate conditions for a competitive inhibition assay.
- the IL-17A/F polypeptide can be labeled, such as by radioactivity, such that the number of IL-17A/F polypeptide molecules bound to the receptor can be used to determine the effectiveness of the potential antagonist.
- the gene encoding the receptor can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. Coligan et al., Current Protocols in Immun., 1(2): Chapter 5 ( 1991).
- expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the IL- 17 A/F polypeptide and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the IL- 17 A/F polypeptide.
- Transfected cells that are grown on glass slides are exposed to labeled IL-17A/F polypeptide.
- the IL- 17 A/F polypeptide can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to autoradiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an interactive sub-pooling and re-screening process, eventually yielding a single clone that encodes the putative receptor.
- labeled IL- 17 A/F polypeptide can be photoaffinity-linked with cell membrane or extract preparations that express the receptor molecule.
- Cross- linked material is resolved by PAGE and exposed to X-ray film.
- the labeled complex containing the receptor can be excised, resolved into peptide fragments, and subjected to protein micro-sequencing.
- the amino acid sequence obtained from micro- sequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor.
- mammalian cells or a membrane preparation expressing the receptor would be incubated with labeled IL- 17 A/F polypeptide in the presence of the candidate compound. The ability of the compound to enhance or block this interaction could then be measured.
- potential antagonists include an oligonucleotide that binds to the fusions of immunoglobulin with IL- 17A/F polypeptide, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments.
- a potential antagonist may be a closely related protein, for example, a mutated form of the IL- 17 A/F polypeptide that recognizes the receptor but imparts no effect, thereby competitively inhibiting the action of the IL-17A/F polypeptide.
- Another potential IL- 17 A/F polypeptide antagonist is an antisense RNA or DNA construct prepared using antisense technology, where, e.g., an antisense RNA or DNA molecule acts to block directly the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation.
- Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
- the 5' coding portion of the polynucleotide sequence which encodes the mature BL- 17 A/F polypeptides herein, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
- a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al, Nucl. Acids Res., 6:3073 (1979); Cooney et al., Science, 24J,:456 (1988); Dervan et al., Science, 251 : 1360 ( 1991)), thereby preventing transcription and the production of the EL-17 A/F polypeptide.
- the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the EL- 17A/F polypeptide (antisense - Okano, Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 1988).
- the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the IL-17A/F polypeptide.
- antisense DNA is used, oligodeoxyribonucleotides derived from the translation-initiation site, e.g., between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.
- Potential antagonists include small molecules that bind to the active site, the receptor binding site, or growth factor or other relevant binding site of the EL- 17 A/F polypeptide, thereby blocking the normal biological activity of the EL-17A/F polypeptide.
- small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptidyl organic or inorganic compounds.
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details see, e.g., Rossi, Current Biology, 4:469-471 (1994), and PCT publication No. WO 97/33551 (published September 18, 1997).
- Nucleic acid molecules in triple-helix formation used to inhibit transcription should be single- stranded and composed of deoxynucleotides.
- the base composition of these oligonucleotides is designed such that it promotes triple-helix formation via Hoogsteen base-pairing rules, which generally require sizeable stretches of purines or pyrimidines on one strand of a duplex.
- Hoogsteen base-pairing rules which generally require sizeable stretches of purines or pyrimidines on one strand of a duplex.
- tissue expressing the EL- 17 A/F can be identified by determining mRNA expression in various human tissues. The location of such genes provides information about which tissues are most likely to be affected by the stimulating and inhibiting activities of the IL- 17 A/F polypeptides. The location of a gene in a specific tissue also provides sample tissue for the activity blocking assays discussed below.
- gene expression in various tissues may be measured by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, Proc. Natl. Acad. Sci. USA,
- duplexes including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
- Gene expression in various tissues may be measured by immunological methods, such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
- Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence of an IL-17 A/F polypeptide or against a synthetic peptide based on the DNA sequences encoding the EL- 17 A/F polypeptide or against an exogenous sequence fused to a DNA encoding an IL- 17A/F polypeptide and encoding a specific antibody epitope.
- General techniques for generating antibodies, and special protocols for Northern blotting and in situ hybridization are provided below.
- the activity of the EL- 17 A/F polypeptides can be further verified by antibody binding studies, in which the ability of anti-EL- 17A/F antibodies to inhibit the effect of the EL-17A/F polypeptides, respectively, on tissue cells is tested.
- Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies, the preparation of which will be described herein below.
- Antibody binding studies may be carried out in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147- 158 (CRC Press, Enc, 1987).
- ком ⁇ онентs rely on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody.
- the amount of target protein in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies.
- the antibodies preferably are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound.
- Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected.
- the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex.
- the second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an antiimmunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay).
- sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme.
- the tissue sample may be fresh or frozen or may be embedded in paraffin and fixed with a preservative such as formalin, for example.
- Cell-based assays and animal models for immune related diseases can be used to further understand the relationship between the genes and polypeptides identified herein and the development and pathogenesis of immune related disease.
- cells of a cell type known to be involved in a particular immune related disease are transfected with the cDNAs described herein, and the ability of these cDNAs to stimulate or inhibit immune function is analyzed. Suitable cells can be transfected with the desired gene, and monitored for immune function activity. Such transfected cell lines can then be used to test the ability of poly- or monoclonal antibodies or antibody compositions to inhibit or stimulate immune function, for example to modulate T-cell proliferation or inflammatory cell infiltration.
- Cells transfected with the coding sequences of the genes identified herein can further be used to identify drug candidates for the treatment of immune related diseases.
- transgenic animals in addition, primary cultures derived from transgenic animals (as described below) can be used in the cell-based assays herein, although stable cell lines are preferred. Techniques to derive continuous cell lines from transgenic animals are well known in the art ⁇ see, e.g., Small et al., MoI. Cell. Biol., 5: 642-648 [1985]).
- MLR mixed lymphocyte reaction
- a proliferative T cell response in an MLR assay may be due to direct mitogenic properties of an assayed molecule or to external antigen induced activation. Additional verification of the T cell stimulatory activity of the IL- 17A/F polypeptides can be obtained by a costimulation assay.
- T cell activation requires an antigen specific signal mediated through the T-cell receptor (TCR) and a costimulatory signal mediated through a second ligand binding interaction, for example, the B7 (CD80, CD86)/CD28 binding interaction.
- CD28 crosslinking increases lymphokine secretion by activated T cells.
- T cell activation has both negative and positive controls through the binding of ligands which have a negative or positive effect.
- CD28 and CTLA-4 are related glycoproteins in the Ig superfamily which bind to B7.
- CD28 binding to B7 has a positive costimulation effect of T cell activation; conversely, CTLA-4 binding to B7 has a negative T cell deactivating effect.
- the IL-17A/F polypeptides are assayed for T cell costimulatory or inhibitory activity.
- IL-17 A/F polypeptides as well as other compounds of the invention, which are stimulators (costimulators) of T cell proliferation and agonists, e.g., agonist antibodies, thereto as determined by MLR and costimulation assays, for example, are useful in treating immune related diseases characterized by poor, suboptimal or inadequate immune function. These diseases are treated by stimulating the proliferation and activation of T cells (and T cell mediated immunity) and enhancing the immune response in a mammal through administration of a stimulatory compound, such as the stimulating IL- 17A/F polypeptides.
- the stimulating polypeptide may, for example, be an IL- 17A/F polypeptide or an agonist antibody thereof.
- a stimulating compound as in the invention has been validated in experiments with 4- IBB glycoprotein, a member of the tumor necrosis factor receptor family, which binds to a ligand (4- IBBL) expressed on primed T cells and signals T cell activation and growth. Alderson, M. E. et al., J. Immunol., 24:2219 (1994). The use of an agonist stimulating compound has also been validated experimentally. Activation of 4- IBB glycoprotein, a member of the tumor necrosis factor receptor family, which binds to a ligand (4- IBBL) expressed on primed T cells and signals T cell activation and growth. Alderson, M. E. et al., J. Immunol., 24:2219 (1994). The use of an agonist stimulating compound has also been validated experimentally. Activation of 4- IBB glycoprotein, a member of the tumor necrosis factor receptor family, which binds to a ligand (4- IBBL) expressed on primed T cells and signals
- Immunoadjuvant therapy for treatment of tumors is another example of the use of the stimulating compounds of the invention.
- An immune stimulating or enhancing effect can also be achieved by antagonizing or blocking the activity of an IL-17 A/F which has been found to be inhibiting in the MLR assay. Negating the inhibitory activity of the compound produces a net stimulatory effect.
- Suitable antagonists/blocking compounds are antibodies or fragments thereof which recognize and bind to the inhibitory protein, thereby blocking the effective interaction of the protein with its receptor and inhibiting signaling through the receptor. This effect has been validated in experiments using anti-CTLA-4 antibodies which enhance T cell proliferation, presumably by removal of the inhibitory signal caused by CTLA-4 binding. Walunas, T. L. et al., Immunity, 1:405 (1994).
- an immune stimulating or enhancing effect can also be achieved by administration of an IL- 17 A/F polypeptide which has vascular permeability enhancing properties.
- Enhanced vacuolar permeability would be beneficial to disorders which can be attenuated by local infiltration of immune cells ⁇ e.g., monocytes, eosinophils, PMNs) and inflammation.
- IL- 17 A/F polypeptides, as well as other compounds of the invention, which are direct inhibitors of T cell proliferation/activation, lymphokine secretion, and/or vascular permeability can be directly used to suppress the immune response. These compounds are useful to reduce the degree of the immune response and to treat immune related diseases characterized by a hyperactive, superoptimal, or autoimmune response.
- compounds e.g., antibodies, which bind to stimulating VL- MPJP polypeptides and block the stimulating effect of these molecules produce a net inhibitory effect and can be used to suppress the
- T cell mediated immune response by inhibiting T cell proliferation/activation and/or lymphokine secretion.
- Blocking the stimulating effect of the polypeptides suppresses the immune response of the mammal.
- This use has been validated in experiments using an anti-IL2 antibody. In these experiments, the antibody binds to BL2 and blocks binding of IL2 to its receptor thereby achieving a T cell inhibitory effect.
- the results of the cell based in vitro assays can be further verified using in vivo animal models and assays for T-cell function.
- a variety of well known animal models can be used to further understand the role of the genes identified herein in the development and pathogenesis of immune related disease, and to test the efficacy of candidate therapeutic agents, including antibodies, and other antagonists of the native polypeptides, including small molecule antagonists.
- the in vivo nature of such models makes them predictive of responses in human patients.
- Animal models of immune related diseases include both non-recombinant and recombinant (transgenic) animals.
- Non-recombinant animal models include, for example, rodent, e.g., murine models.
- Such models can be generated by introducing cells into syngeneic mice using standard techniques, e.g., subcutaneous injection, tail vein injection, spleen implantation, intraperitoneal implantation, implantation under the renal capsule, etc.
- Graft-versus-host disease occurs when immunocompetent cells are transplanted into immunosuppressed or tolerant patients.
- the donor cells recognize and respond to host antigens. The response can vary from life threatening severe inflammation to mild cases of diarrhea and weight loss.
- Graft- versus- host disease models provide a means of assessing T cell reactivity against MHC antigens and minor transplant antigens. A suitable procedure is described in detail in Current Protocols in Immunology, above, unit 4.3.
- An animal model for skin allograft rejection is a means of testing the ability of T cells to mediate in vivo tissue destruction and a measure of their role in transplant rejection.
- the most common and accepted models use murine tail-skin grafts.
- Repeated experiments have shown that skin allograft rejection is mediated by T cells, helper T cells and killer-effector T cells, and not antibodies.
- a suitable procedure is described in detail in Current Protocols in Immunology, above, unit 4.4.
- transplant rejection models which can be used to test the compounds of the invention are the allogeneic heart transplant models described by Tanabe, M. et al. Transplantation, 58:23 (1994) and Tinubu, S. A. et al, J. Immunol., 4330-4338 (1994).
- Animal models for delayed type hypersensitivity provides an assay of cell mediated immune function as well. Delayed type hypersensitivity reactions are a T cell mediated in vivo immune response characterized by inflammation which does not reach a peak until after a period of time has elapsed after challenge with an antigen. These reactions also occur in tissue specific autoimmune diseases such as multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (EAE, a model for MS). A suitable procedure is described in detail in Current Protocols in Immunology, above, unit 4.5.
- MS multiple sclerosis
- EAE experimental autoimmune encephalomyelitis
- EAE is a T cell mediated autoimmune disease characterized by T cell and mononuclear cell inflammation and subsequent demyelination of axons in the central nervous system.
- EAE is generally considered to be a relevant animal model for MS in humans. Bolton, C, Multiple Sclerosis, 1: 143 (1995). Both acute and relapsing-remitting models have been developed.
- the compounds of the invention can be tested for T cell stimulatory or inhibitory activity against immune mediated demyelinating disease using the protocol described in Current Protocols in Immunology, above, units 15.1 and 15.2. See also the models for myelin disease in which oligodendrocytes or Schwann cells are grafted into the central nervous system as described in Duncan, I. D. et al, Molec. Med. Today, 554-561 (1997).
- Contact hypersensitivity is a simple delayed type hypersensitivity in vivo assay of cell mediated immune function. In this procedure, cutaneous exposure to exogenous haptens which gives rise to a delayed type hypersensitivity reaction which is measured and quantitated.
- Contact sensitivity involves an initial sensitizing phase followed by an elicitation phase. The elicitation phase occurs when the T lymphocytes encounter an antigen to which they have had previous contact. Swelling and inflammation occur, making this an excellent model of human allergic contact dermatitis.
- a suitable procedure is described in detail in Current Protocols in Immunology, Eds. J. E. Cologan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, John Wiley & Sons, Inc., unit 4.2 (1994). I also Grabbe, S. and Schwarz, T, Immun. Today, 19 ( 1): 37-44 (1998) .
- An animal model for arthritis is collagen-induced arthritis. This model shares clinical, histological and immunological characteristics of human autoimmune rheumatoid arthritis and is an acceptable model for human autoimmune arthritis.
- Mouse and rat models are characterized by synovitis, erosion of cartilage and subchondral bone.
- the compounds of the invention can be tested for activity against autoimmune arthritis using the protocols described in Current Protocols in Immunology, above, units 15.5. See also the model using a monoclonal antibody to CD 18 and VLA-4 integrins described in Issekutz, A.C. et al., Immunology, 8£:569 ( 1996).
- a model of asthma has been described in which antigen-induced airway hyper-reactivity, pulmonary eosinophilia and inflammation are induced by sensitizing an animal with ovalbumin and then challenging the animal with the same protein delivered by aerosol.
- Several animal models (guinea pig, rat, non-human primate) show symptoms similar to atopic asthma in humans upon challenge with aerosol antigens.
- Murine models have many of the features of human asthma. Suitable procedures to test the compounds of the invention for activity and effectiveness in the treatment of asthma are described by Wolyniec, W. W. et al.. Am. J. Respir. Cell MoI. Biol., 18:777 (1998) and the references cited therein.
- the compounds of the invention can be tested on animal models for psoriasis like diseases. Evidence suggests a T cell pathogenesis for psoriasis.
- the compounds of the invention can be tested in the scid/scid mouse model described by Schon, M. P. et al., Nat. Med., 3: 183 (1997), in which the mice demonstrate histopathologic skin lesions resembling psoriasis.
- Another suitable model is the human skin/scid mouse chimera prepared as described by Nickoloff, B. J. et al, Am. J. Path., 146:580 (1995).
- Recombinant (transgenic) animal models can be engineered by introducing the coding portion of the genes identified herein into the genome of animals of interest, using standard techniques for producing transgenic animals.
- Animals that can serve as a target for transgenic manipulation include, without limitation, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates, e.g., baboons, chimpanzees and monkeys.
- Techniques known in the art to introduce a transgene into such animals include pronucleic microinjection (Hoppe and Wanger, U.S. Patent No. 4,873,191); retrovirus-mediated gene transfer into germ lines (e.g., Van der Putten et al., Proc. Natl.
- transgenic animals include those that carry the transgene only in part of their cells ("mosaic animals").
- the transgene can be integrated either as a single transgene, or in concatamers, e.g., head-to-head or head-to-tail tandems. Selective introduction of a transgene into a particular cell type is also possible by following, for example, the technique of Lasko et al., Proc. Natl. Acad.
- the expression of the transgene in transgenic animals can be monitored by standard techniques. For example, Southern blot analysis or PCR amplification can be used to verify the integration of the transgene. The level of mRNA expression can then be analyzed using techniques such as in situ hybridization. Northern blot analysis, PCR, or immunocytochemistry . The animals may be further examined for signs of immune disease pathology, for example by histological examination to determine infiltration of immune cells into specific tissues. Blocking experiments can also be performed in which the transgenic animals are treated with the compounds of the invention to determine the extent of the T cell proliferation stimulation or inhibition of the compounds. In these experiments, blocking antibodies which bind to the IL-17 A/F polypeptide, prepared as described above, are administered to the animal and the effect on immune function is determined.
- "knock out" animals can be constructed which have a defective or altered gene encoding a polypeptide identified herein, as a result of homologous recombination between the endogenous gene encoding the polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal.
- cDNA encoding a particular polypeptide can be used to clone genomic DNA encoding that polypeptide in accordance with established techniques.
- a portion of the genomic DNA encoding a particular polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration.
- flanking DNA typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector [see e.g., Thomas and Capecchi, Cell, 51:503 (1987) for a description of homologous recombination vectors].
- the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see e.g., Li et al., Cell, 69:915 (1992)].
- the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (ERL, Oxford, 1987), pp. 1 13-152].
- a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal.
- Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA.
- Knockout animals can be characterized for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the polypeptide.
- the immunostimulating compounds of the invention can be used in immunoadjuvant therapy for the treatment of tumors (cancer).
- tumors cancer
- T cells recognize human tumor specific antigens.
- DeSmet C. et al., Proc. Natl. Acad. Sci. USA, 93_:7149 ( 1996). It has been shown that costimulation of T cells induces tumor regression and an antitumor response both in vitro and in vivo. Melero, I.
- the stimulatory compounds of the invention can be administered as adjuvants, alone or together with a growth regulating agent, cytotoxic agent or chemotherapeutic agent, to stimulate T cell proliferation/activation and an antitumor response to tumor antigens.
- the growth regulating, cytotoxic, or chemotherapeutic agent may be administered in conventional amounts using known administration regimes. Immunostimulating activity by the compounds of the invention allows reduced amounts of the growth regulating, cytotoxic, or chemotherapeutic agents thereby potentially lowering the toxicity to the patient.
- Screening Assays for Drug Candidates are designed to identify compounds that bind to or complex with the polypeptides encoded by the genes identified herein or a biologically active fragment thereof, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins. Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates.
- Small molecules contemplated include synthetic organic or inorganic compounds, including peptides, preferably soluble peptides, (poly)pe ⁇ tide-immunoglobulin fusions, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments.
- the assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art. All assays are common in that they call for contacting the drug candidate with a polypeptide encoded by a nucleic acid identified herein under conditions and for a time sufficient to allow these two components to interact.
- the interaction is binding and the complex formed can be isolated or detected in the reaction mixture.
- the polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e.g., on a microtiter plate, by covalent or non-covalent attachments.
- Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the polypeptide and drying.
- an immobilized antibody e.g., a monoclonal antibody, specific for the polypeptide to be immobilized can be used to anchor it to a solid surface.
- the assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e.g., the coated surface containing the anchored component.
- the non-reacted components are removed, e.g., by washing, and complexes anchored on the solid surface are detected.
- the detection of label immobilized on the surface indicates that complexing occurred.
- complexing can be detected, for example, by using a labelled antibody specifically binding the immobilized complex.
- the candidate compound interacts with but does not bind to a particular protein encoded by a gene identified herein, its interaction with that protein can be assayed by methods well known for detecting protein- protein interactions.
- assays include traditional approaches, such as, cross-linking, co- immunoprecipitation, and co-purification through gradients or chromatographic columns.
- protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co-workers [Fields and Song, Nature (London), 340. 245-246 ( 1989); Chien et ai, Proc. Natl. Acad. Sci. USA. 88, 9578-9582 ( 1991 )] as disclosed by Chevray and Nathans, Proc. Natl. Acad.
- yeast GAL4 Many transcriptional activators, such as yeast GAL4, consist of two physically discrete modular domains, one acting as the DNA-binding domain, while the other one functioning as the transcription activation domain.
- the yeast expression system described in the foregoing publications (generally referred to as the "two-hybrid system") takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4, and another, in which candidate activating proteins are fused to the activation domain.
- the expression of a GALl-lacZ reporter gene under control of a GAL4-activated promoter depends on reconstitution of GAL4 activity via protein-protein interaction.
- Colonies containing interacting polypeptides are detected with a cnromogenic substrate for ⁇ -galactosidase.
- a complete kit (MATCHMAKERTM) for identifying protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Clontech. This system can also be extended to map protein domains involved in specific protein interactions as well as to pinpoint amino acid residues that are crucial for these interactions.
- a reaction mixture is usually prepared containing the product of the gene and the intra- or extracellular component under conditions and for a time allowing for the interaction and binding of the two products.
- the reaction is run in the absence and in the presence of the test compound.
- a placebo may be added to a third reaction mixture, to serve as positive control.
- the binding (complex formation) between the test compound and the intra- or extracellular component present in the mixture is monitored as described above. The formation of a complex in the control reaction(s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner.
- compositions useful in the treatment of immune related diseases include, without limitation, proteins, antibodies, small organic molecules, peptides, phosphopeptides, antisense and ribozyme molecules, triple helix molecules, etc. that inhibit or stimulate immune function, for example, T cell proliferation/activation, lymphokine release, or immune cell infiltration.
- antisense RNA and RNA molecules act to directly block the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation.
- antisense DNA oligodeoxyribonucleotides derived from the translation initiation site, e.g., between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
- Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details see, e.g., Rossi, Current Biology. 4, 469-471 (1994), and PCT publication No. WO 97/33551 (published September 18, 1997).
- Nucleic acid molecules in triple helix formation used to inhibit transcription should be single- stranded and composed of deoxynucleotides.
- the base composition of these oligonucleotides is designed such that it promotes triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of purines or pyrimidines on one strand of a duplex.
- PCT publication No. WO 97/33551, supra These molecules can be identified by any or any combination of the screening assays discussed above and/or by any other screening techniques well known for those skilled in the art.
- the present invention provides anti-IL-17A/F antibodies which may find use herein as therapeutic and/or diagnostic agents.
- Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies.
- Polyclonal antibodies are preferably raised in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the relevant antigen and an adjuvant. It may be useful to conjugate the relevant antigen (especially when synthetic peptides are used) to a protein that is immunogenic in the species to be immunized.
- KLH keyhole limpet hemocyanin
- serum albumin serum albumin
- bovine thyroglobulin or soybean trypsin inhibitor
- a bifunctional or derivatizing agent e.g., maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine residues), N-hydroxysuccinimide (through lysine
- Animals are immunized against the antigen, immunogenic conjugates, or derivatives by combining, e.g., 100 ⁇ g or 5 ⁇ g of the protein or conjugate (for rabbits or mice, respectively) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermally at multiple sites.
- the animals are boosted with 1/5 to 1/10 the original amount of peptide or conjugate in Freund's complete adjuvant by subcutaneous injection at multiple sites.
- the animals are bled and the serum is assayed for antibody titer. Animals are boosted until the titer plateaus.
- Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are suitably used to enhance the immune response.
- Monoclonal antibodies may be made using the hybridoma method first described by Kohler et al., Nature, 256:495 (1975), or may be made by recombinant DNA methods (U.S. Patent No. 4,816.567).
- lymphocytes In the hybridoma method, a mouse or other appropriate host animal, such as a hamster, is immunized as described above to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the protein used for immunization.
- lymphocytes may be immunized in vitro. After immunization, lymphocytes are isolated and then fused with a myeloma cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)).
- the hybridoma cells thus prepared are seeded and grown in a suitable culture medium which medium preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells (also referred to as fusion partner).
- a suitable culture medium which medium preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells (also referred to as fusion partner).
- the parental myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT)
- HGPRT or HPRT the selective culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT-def ⁇ cient cells.
- Preferred fusion partner myeloma cells are those that fuse efficiently, support stable high-level production of antibody by the selected antibody-producing cells, and are sensitive to a selective medium that selects against the unfused parental cells.
- Preferred myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MPC- 1 1 mouse tumors available from the SaIk Institute Cell Distribution Center, San Diego, California USA, and SP-2 and derivatives e.g., X63-Ag8-653 cells available from the American Type Culture Collection, Manassas, Virginia, USA.
- Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (Kozbor, J.
- Culture medium in which hybridoma cells are growing is assayed for production of monoclonal antibodies directed against the antigen.
- the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).
- the binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis described in Munson et al., Anal. Biochem., 107:220 ( 1980).
- the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)). Suitable culture media for this purpose include, for example, D-MEM or RPMI- 1640 medium.
- the hybridoma cells may be grown in vivo as ascites tumors in an animal e.g,, by i.p. injection of the cells into mice.
- the monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional antibody purification procedures such as, for example, affinity chromatography (e.g., using protein A or protein G-Sepharose) or ion-exchange chromatography, hydroxylapatite chromatography, gel electrophoresis, dialysis, etc.
- affinity chromatography e.g., using protein A or protein G-Sepharose
- ion-exchange chromatography e.g., ion-exchange chromatography
- hydroxylapatite chromatography hydroxylapatite chromatography
- gel electrophoresis e.g., dialysis, etc.
- DNA encoding the monoclonal antibodies is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
- the hybridoma cells serve as a preferred source of such DNA.
- the DNA may be placed into expression vectors, which are then transfected into host cells such as E. coli cells, simian COS cells, Chinese Hamster Ovary (CHO) cells, or myeloma cells that do not otherwise produce antibody protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
- host cells such as E. coli cells, simian COS cells, Chinese Hamster Ovary (CHO) cells, or myeloma cells that do not otherwise produce antibody protein.
- Review articles on recombinant expression in bacteria of DNA encoding the antibody include Skerra et al., Curr.
- monoclonal antibodies or antibody fragments can be isolated from antibody phage libraries generated using the techniques described in McCafferty et al., Nature, 348:552-554 (1990). Clackson et al., Nature, 352:624-628 (1991) and Marks et al., J. MoI. Biol., 222:581-597 (1991) describe the isolation of murine and human antibodies, respectively, using phage libraries.
- the DNA that encodes the antibody may be modified to produce chimeric or fusion antibody polypeptides, for example, by substituting human heavy chain and light chain constant domain (C H and C L ) sequences for the homologous murine sequences (U.S. Patent No. 4,816,567; and Morrison, et al., Proc. Natl Acad. Sci. USA, 81 :6851 (1984)), or by fusing the immunoglobulin coding sequence with all or part of the coding sequence for a non-immunoglobulin polypeptide (heterologous polypeptide).
- C H and C L constant domain
- the non- immunoglobulin polypeptide sequences can substitute for the constant domains of an antibody, or they are substituted for the variable domains of one antigen-combining site of an antibody to create a chimeric bivalent antibody comprising one antigen-combining site having specificity for an antigen and another antigen- combining site having specificity for a different antigen.
- the anti-IL-17A/F antibodies of the invention may further comprise humanized antibodies or human antibodies.
- Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab') 2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
- Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non- human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
- CDR complementary determining region
- Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
- Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
- the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
- the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321 :522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol.. 2:593-596 (1992)].
- Fc immunoglobulin constant region
- a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import” variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988);
- humanized antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
- humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
- variable domains both light and heavy
- HAMA response human anti-mouse antibody
- the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences.
- the human V domain sequence which is closest to that of the rodent is identified and the human framework region (FR) within it accepted for the humanized antibody (Sims et al., J. Immunol. 151 :2296 (1993); Chothia et al., J. MoI. Biol., 196:901 (1987)).
- Another method uses a particular framework region derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains.
- the same framework may be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol. 151 :2623 (1993)).
- humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences.
- Three- dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art.
- Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen.
- FR residues can be selected and combined from the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is achieved.
- the hypervariable region residues are directly and most substantially involved in influencing antigen binding.
- the humanized antibody may be an antibody fragment, such as a Fab, which is optionally conjugated with one or more cytotoxic agent(s) in order to generate an immunoconjugate.
- the humanized antibody may be an intact antibody, such as an intact IgG 1 antibody.
- human antibodies can be generated.
- transgenic animals e.g., mice
- transgenic animals e.g., mice
- J H antibody heavy-chain joining region
- transfer of the human germ-line immunoglobulin gene array into such germ-line mutant mice will result in the production of human antibodies upon antigen challenge. See, e.g., Jakobovits et al., Proc. Natl. Acad. Sci.
- phage display technology can be used to produce human antibodies and antibody fragments in vitro, from immunoglobulin variable (V) domain gene repertoires from unimmunized donors.
- V domain genes are cloned in- frame into either a major or minor coat protein gene of a filamentous bacteriophage, such as Ml 3 or fd, and displayed as functional antibody fragments on the surface of the phage particle. Because the filamentous particle contains a single-stranded DNA copy of the phage genome, selections based on the functional properties of the antibody also result in selection of the gene encoding the antibody exhibiting those properties.
- the phage mimics some of the properties of the B-cell.
- Phage display can be performed in a variety of formats, reviewed in, e.g., Johnson, Kevin S. and Chiswell, David J., Current Opinion in Structural Biology 3:564-571 ( 1993).
- V-gene segments can be used for phage display. Clackson et al., Nature, 352:624-628 (1991) isolated a diverse array of anti-oxazolone antibodies from a small random combinatorial library of V genes derived from the spleens of immunized mice.
- a repertoire of V genes from unimmunized human donors can be constructed and antibodies to a diverse array of antigens (including self-antigens) can be isolated essentially following the techniques described by Marks et al., J. MoI. Biol. 222:581-597 (1991), or Griffith et al., EMBO J. 12:725-734 ( 1993). See, also, U.S. Patent Nos. 5,565,332 and 5,573,905.
- human antibodies may also be generated by in vitro activated B cells (see U.S. Patents 5,567,610 and 5,229,275).
- antibody fragments rather than whole antibodies.
- the smaller size of the fragments allows for rapid clearance, and may lead to improved access to solid tumors.
- Various techniques have been developed for the production of antibody fragments. Traditionally, these fragments were derived via proteolytic digestion of intact antibodies (see, e.g., Morimoto et al., Journal of Biochemical and Biophysical Methods 24: 107-1 17 (1992); and Brennan et al., Science, 229:81 (1985)). However, these fragments can now be produced directly by recombinant host cells. Fab, Fv and ScFv antibody fragments can all be expressed in and secreted from E. coli, thus allowing the facile production of large amounts of these fragments.
- Antibody fragments can be isolated from the antibody phage libraries discussed above. Alternatively, Fab'-SH fragments can be directly recovered from E. coli and chemically coupled to form F(ab') 2 fragments (Carter et al., Bio/Technology 10: 163-167 ( 1992)). According to another approach, F(ab') 2 fragments can be isolated directly from recombinant host cell culture. Fab and F(ab') 2 fragment with increased in vivo half-life comprising a salvage receptor binding epitope residues are described in U.S. Patent No. 5,869,046. Other techniques for the production of antibody fragments will be apparent to the skilled practitioner. In other embodiments, the antibody of choice is a single chain Fv fragment (scFv).
- scFv single chain Fv fragment
- Fv and sFv are the only species with intact combining sites that are devoid of constant regions; thus, they are suitable for reduced nonspecific binding during in vivo use.
- sFv fusion proteins may be constructed to yield fusion of an effector protein at either the amino or the carboxy terminus of an sFv. See Antibody Engineering, ed. Borrebaeck, supra.
- the antibody fragment may also be a "linear antibody", e.g., as described in U.S. Patent 5,641,870 for example. Such linear antibody fragments may be monospecific or bispecific.
- Bispecific antibodies are antibodies that have binding specificities for at least two different epitopes. Exemplary bispecific antibodies may bind to two different epitopes of an IL-17 AJF protein as described herein. Other such antibodies may combine an IL-17A/F binding site with a binding site for another protein. Alternatively, an anti-IL-17A/F arm may be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g.
- Bispecific antibodies may also be used to localize cytotoxic agents to cells which express IL-17 A/F. These antibodies possess an IL-17A/F-binding arm and an arm which binds the cytotoxic agent (e.g., saporin, anti-interferon- ⁇ , vinca alkaloid, ricin A chain, methotrexate or radioactive isotope hapten). Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e.g., F(ab') 2 bispecific antibodies).
- WO 96/16673 describes a bispecific anti-ErbB2/anti-Fc ⁇ RIII antibody and U.S. Patent No. 5,837,234 discloses a bispecific anti-ErbB2/anti-Fc ⁇ RI antibody. A bispecific anti-ErbB2/Fc ⁇ antibody is shown in WO98/02463.
- U.S. Patent No. 5,821,337 teaches a bispecific anti-ErbB2/anti-CD3 antibody.
- Methods for making bispecific antibodies are known in the art. Traditional production of full length bispecific antibodies is based on the co-expression of two immunoglobulin heavy chain-light chain pairs, where the two chains have different specificities (Millstein et al., Nature 305:537-539 (1983)).
- antibody variable domains with the desired binding specificities are fused to immunoglobulin constant domain sequences.
- the fusion is with an Ig heavy chain constant domain, comprising at least part of the hinge, C H 2, and C H 3 regions.
- the first heavy-chain constant region (C H 1 ) containing the site necessary for light chain bonding present in at least one of the fusions.
- DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain are inserted into separate expression vectors, and are co-transfected into a suitable host cell. This provides for greater flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yield of the desired bispecific antibody.
- the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed in WO 94/04690. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods in Enzymology 121 :210 (1986).
- the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture.
- the preferred interface comprises at least a part of the C H 3 domain.
- one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g., tyrosine or tryptophan).
- Compensatory "cavities" of identical or similar size to the large side chain(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g., alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers.
- Bispecific antibodies include cross-linked or "heteroconjugate" antibodies.
- one of the antibodies in the heteroconjugate can be coupled to avidin, the other to biotin.
- Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Patent No. 4,676,980). and for treatment of HIV infection (WO 91/00360, WO 92/200373, and EP 03089).
- Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Patent No. 4,676,980, along with a number of cross-linking techniques.
- bispecific antibodies can be prepared using chemical linkage.
- Brennan et al., Science 229:81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab') 2 fragments. These fragments are reduced in the presence of the dithiol complexing agent, sodium arsenite, to stabilize vicinal dithiols and prevent intermolecular disulfide formation.
- the Fab' fragments generated are then converted to thionitrobenzoate (TNB) derivatives.
- One of the Fab'-TNB derivatives is then reconverted to the Fab'-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody.
- the bispecific antibodies produced can be used as agents for the selective immobilization of enzymes.
- bispecific antibodies have been produced using leucine zippers.
- the leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion.
- the antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers.
- the fragments comprise a V H connected to a V L by a linker which is too short to allow pairing between the two domains on the same chain. Accordingly, the V H and V L domains of one fragment are forced to pair with the complementary V L and V H domains of another fragment, thereby forming two antigen-binding sites.
- Another strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See Gruber et al., J. Immunol., 152:5368 (1994). Antibodies with more than two valencies are contemplated. For example, trispecific antibodies can be prepared. Tutt et al., J. Immunol. 147:60 (1991).
- Heteroconjugate antibodies are also within the scope of the present invention.
- Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U.S. Patent No. 4.676,980], and for treatment of
- the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents.
- immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond.
- suitable reagents for this purpose include iminothiolate and methyl-4- mercaptobutyrimidate and those disclosed, for example, in U.S. Patent No. 4,676,980.
- a multivalent antibody may be internalized (and/or catabolized) faster than a bivalent antibody by a cell expressing an antigen to which the antibodies bind.
- the antibodies of the present invention can be multivalent antibodies (which are other than of the IgM class) with three or more antigen binding sites (e.g. tetravalent antibodies), which can be readily produced by recombinant expression of nucleic acid encoding the polypeptide chains of the antibody.
- the multivalent antibody can comprise a dimerization domain and three or more antigen binding sites.
- the preferred dimerization domain comprises (or consists of) an Fc region or a hinge region. In this scenario, the antibody will comprise an Fc region and three or more antigen binding sites amino-terminal to the Fc region.
- the preferred multivalent antibody herein comprises (or consists of) three to about eight, but preferably four, antigen binding sites.
- the multivalent antibody comprises at least one polypeptide chain (and preferably two polypeptide chains), wherein the polypeptide chain(s) comprise two or more variable domains.
- the polypeptide chain(s) may comprise VDl-(Xl) n -VD2-(X2) n -Fc, wherein VDl is a first variable domain, VD2 is a second variable domain, Fc is one polypeptide chain of an Fc region, Xl and X2 represent an amino acid or polypeptide, and n is 0 or 1.
- the polypeptide chain(s) may comprise: VH-CHl -flexible linker-VH-CHl-Fc region chain: or VH-CHl -VH-CHl -Fc region chain.
- the multivalent antibody herein preferably further comprises at least two (and preferably four) light chain variable domain polypeptides.
- the multivalent antibody herein may, for instance, comprise from about two to about eight light chain variable domain polypeptides.
- the light chain variable domain polypeptides contemplated here comprise a light chain variable domain and, optionally, further comprise a CL domain.
- ADCC antigen-dependent cell-mediated cyotoxicity
- CDC complement dependent cytotoxicity
- This may be achieved by introducing one or more amino acid substitutions in an Fc region of the antibody.
- cysteine residue(s) may be introduced in the Fc region, thereby allowing interchain disulfide bond formation in this region.
- the homodimeric antibody thus generated may have improved internalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). See Caron et al., L Exp Med. 176: 1 191- 1195 (1992) and Shopes, B. J.
- Homodimeric antibodies with enhanced anti-tumor activity may also be prepared using heterobifunctional cross-linkers as described in Wolff et al., Cancer Research 53:2560-2565 ( 1993).
- an antibody can be engineered which has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities. See Stevenson et al., Anti-Cancer Drug Design 3:219-230 (1989).
- a salvage receptor binding epitope into the antibody (especially an antibody fragment) as described in U.S. Patent 5,739,277, for example.
- the term "salvage receptor binding epitope” refers to an epitope of the Fc region of an IgG molecule (e.g., IgG b IgG 2 , IgG 3 , or IgG 4 ) that is responsible for increasing the in vivo serum half-life of the IgG molecule.
- the invention also pertains to immunoconj ugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, a growth inhibitory agent, a toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i.e.. a radioconjugate).
- a cytotoxic agent such as a chemotherapeutic agent, a growth inhibitory agent, a toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i.e.. a radioconjugate).
- Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes.
- radionuclides are available for the production of radioconjugated antibodies. Examples include 212 Bi, 131 I. 131 In, 90 Y, and 186 Re. Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein-coupling agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate).
- SPDP N-succinimidyl-3-(2-pyridyldithiol) propionate
- IT iminothiolane
- bifunctional derivatives of imidoesters such as dimethyl adipimidate HCL
- active esters such as disuccinimidyl suberate.
- aldehydes such as glutareldehyde
- bis-azido compounds such as bis (p- azidobenzoyl) hexanediamine
- bis-diazonium derivatives such as bis-(p-diazoniumbenzoyl)- ethylenediamine
- diisocyanates such as tolyene 2,6-diisocyanate
- bis-active fluorine compounds such as l ,5-difluoro-2,4-dinitrobenzene.
- a ricin immunotoxin can be prepared as described in Vitetta et al. Science, 238: 1098 (1987).
- Carbon- 14-labeled l-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See WO94/1 1026.
- Conjugates of an antibody and one or more small molecule toxins such as a calicheamicin, maytansinoids, a trichothene, and CC 1065, and the derivatives of these toxins that have toxin activity, are also contemplated herein.
- Maytansine and maytansinoids are also contemplated herein.
- an anti-IL- 17A/F antibody (full length or fragments) of the invention is conjugated to one or more maytansinoid molecules.
- Maytansinoids are mitototic inhibitors which act by inhibiting tubulin polymerization. Maytansine was first isolated from the east African shrub Maytenus serrata (U.S. Patent No. 3,896,1 1 1). Subsequently, it was discovered that certain microbes also produce maytansinoids, such as maytansinol and C-3 maytansinol esters (U.S. Patent No. 4,151,042). Synthetic maytansinol and derivatives and analogues thereof are disclosed, for example, in U.S. Patent Nos.
- maytansine and maytansinoids have been conjugated to antibodies specifically binding to tumor cell antigens.
- Immunoconjugates containing maytansinoids and their therapeutic use are disclosed, for example, in U.S. Patent Nos. 5,208,020, 5,416,064 and European Patent EP 0 425 235 B l , the disclosures of which are hereby expressly incorporated by reference. Liu et al., Proc. Natl. Acad. Sci. USA 93:8618-8623 (1996) described immunoconjugates comprising a maytansinoid designated DMl linked to the monoclonal antibody C242 directed against human colorectal cancer.
- the conjugate was found to be highly cytotoxic towards cultured colon cancer cells, and showed antitumor activity in an in vivo tumor growth assay.
- Chari et al., Cancer Research 52: 127-131 (1992) describe immunoconjugates in which a maytansinoid was conjugated via a disulfide linker to the murine antibody A7 binding to an antigen on human colon cancer cell lines, or to another murine monoclonal antibody TA.1 that binds the HER-2/ne; ⁇ oncogene.
- the cytotoxicity of the TA.l-maytansonoid conjugate was tested in vitro on the human breast cancer cell line SK-BR-3, which expresses 3 x 10 5 HER-2 surface antigens per cell.
- the drug conjugate achieved a degree of cytotoxicity similar to the free maytansonid drug, which could be increased by increasing the number of maytansinoid molecules per antibody molecule.
- the A7-maytansinoid conjugate showed low systemic cytotoxicity in mice.
- Anti-EL- 17 A/F polypeptide antibody-maytansinoid conjugates immunoconjugates
- Anti-IL-17A/F antibody-maytansinoid conjugates are prepared by chemically linking an anti-EL- 17 A/F antibody to a maytansinoid molecule without significantly diminishing the biological activity of either the antibody or the maytansinoid molecule.
- An average of 3-4 maytansinoid molecules conjugated per antibody molecule has shown efficacy in enhancing cytotoxicity of target cells without negatively affecting the function or solubility of the antibody, although even one molecule of toxin/antibody would be expected to enhance cytotoxicity over the use of naked antibody.
- Maytansinoids are well known in the art and can be synthesized by known techniques or isolated from natural sources. Suitable maytansinoids are disclosed, for example, in U.S. Patent No.
- Preferred maytansinoids are maytansinol and maytansinol analogues modified in the aromatic ring or at other positions of the maytansinol molecule, such as various maytansinol esters.
- linking groups known in the art for making antibody-maytansinoid conjugates, including, for example, those disclosed in U.S. Patent No. 5,208,020 or EP Patent 0 425 235 Bl, and Chari et al., Cancer Research 52: 127-131 (1992).
- the linking groups include disufide groups, thioether groups, acid labile groups, photolabile groups, peptidase labile groups, or esterase labile groups, as disclosed in the above- identified patents, disulfide and thioether groups being preferred.
- Conjugates of the antibody and maytansinoid may be made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), succinimidyl-4-(N- maleimidomefhyl) cyclohexane- 1 -carboxylate, iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as toluene 2,6- diisocyanate), and bis-active fluorine compounds (
- Particularly preferred coupling agents include N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP) (Carlsson et al., Biochem. J. 173:723-737 [1978]) and N-succinimidyl-4-(2-pyridylthio)pentanoate (SPP) to provide for a disulfide linkage.
- SPDP N-succinimidyl-3-(2-pyridyldithio) propionate
- SPP N-succinimidyl-4-(2-pyridylthio)pentanoate
- the linker may be attached to the maytansinoid molecule at various positions, depending on the type of the link.
- an ester linkage may be formed by reaction with a hydroxyl group using conventional coupling techniques. The reaction may occur at the C-3 position having a hydroxyl group, the C- 14 position modified with hyrdoxymethyl, the C- 15 position modified with a hydroxyl group, and the C-20 position having a hydroxyl group.
- the linkage is formed at the C-3 position of maytansinol or a maytansinol analogue.
- Another immunoconjugate of interest comprises an anti-IL- 17 A/F antibody conjugated to one or more calicheamicin molecules.
- the calicheamicin family of antibiotics are capable of producing double- stranded DNA breaks at sub-picomolar concentrations.
- For the preparation of conjugates of the calicheamicin family see U.S. patents 5,712,374, 5,714,586, 5,739, 1 16, 5,767,285, 5,770,701, 5,770,710, 5,773,001, 5,877,296 (all to American Cyanamid Company).
- Structural analogues of calicheamicin which may be used include, but are not limited to, y s ⁇ ⁇ 2 ', ⁇ 3 ', N-acetyl- ⁇ , 1 , PSAG and (Hinman et al., Cancer Research 53:3336-3342 ( 1993), Lode et al., Cancer Research 58:2925-2928 ( 1998) and the aforementioned U.S. patents to American Cyanamid).
- Another anti-tumor drug that the antibody can be conjugated is QFA which is an antifolate.
- QFA is an antifolate.
- Both calicheamicin and QFA have intracellular sites of action and do not readily cross the plasma membrane. Therefore, cellular uptake of these agents through antibody mediated internalization greatly enhances their cytotoxic effects.
- Enzymatically active toxins and fragments thereof which can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseiidomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin and the tricothecenes. See, for example, WO 93/21232 published October 28, 1993.
- the present invention further contemplates an immunoconjugate formed between an antibody and a compound with nucleolytic activity (e.g., a ribonuclease or a DNA endonuclease such as a deoxyribonuclease; DNase).
- a compound with nucleolytic activity e.g., a ribonuclease or a DNA endonuclease such as a deoxyribonuclease; DNase.
- the antibody may comprise a highly radioactive atom.
- radioactive isotopes are available for the production of radioconjugated anti-IL-17A/F antibodies. Examples include At 211 , I 131 , I 125 , Y 90 , Re 186 , Re 188 , Sm 153 , Bi 212 , F 52 , Pb 212 and radioactive isotopes of Lu.
- the conjugate When used for diagnosis, it may comprise a radioactive atom for scintigraphic studies, for example tc" m or I 123 , or a spin label for nuclear magnetic resonance (NMR) imaging (also known as magnetic resonance imaging, mri), such as iodine- 123 again, iodine- 131 , indium- 1 1 1, fluorine- 19, carbon- 13, nitrogen- 15, oxygen-17, gadolinium, manganese or iron.
- NMR nuclear magnetic resonance
- the radio- or other labels may be incorporated in the conjugate in known ways.
- the peptide may be biosynthesized or may be synthesized by chemical amino acid synthesis using suitable amino acid precursors involving, for example, fluorine- 19 in place of hydrogen.
- Labels such as tc 99m or I 123 , .Re 186 , Re 188 and In" 1 can be attached via a cysteine residue in the peptide.
- Yttrium-90 can be attached via a lysine residue.
- the IODOGEN method (Fraker et al (1978) Biochem. Biophys. Res. Commun. 80: 49-57 can be used to incorporate iodine- 123.
- Conjugates of the antibody and cytotoxic agent may be made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3-(2-pyridyldithio) propionate (SPDP), succinimidyl-4-(N- maleimidomethyl) cyclohexane- 1 -carboxylate, iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diis
- bifunctional protein coupling agents such as N-succinimidyl-3-(2-pyridyldithio) prop
- a ricin immunotoxin can be prepared as described in Vitetta et al., Science 238: 1098 (1987).
- Carbon- 14-labeled l-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See WO94/11026.
- the linker may be a "cleavable linker" facilitating release of the cytotoxic drug in the cell.
- an acid-labile linker for example, an acid-labile linker, peptidase- sensitive linker, photolabile linker, dimethyl linker or disulfide-containing linker (Chari et al., Cancer Research 52: 127-131 (1992); U.S. Patent No. 5,208,020) may be used.
- a fusion protein comprising the anti-IL- 17A/F antibody and cytotoxic agent may be made, e.g., by recombinant techniques or peptide synthesis.
- the length of DNA may comprise respective regions encoding the two portions of the conjugate either adjacent one another or separated by a region encoding a linker peptide which does not destroy the desired properties of the conjugate.
- the antibody may be conjugated to a "receptor” (such streptavidin) for utilization in tumor pre-targeting wherein the antibody-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent and then administration of a "ligand” (e.g., avidin) which is conjugated to a cytotoxic agent (e.g., a radionucleotide).
- a "receptor” such streptavidin
- a ligand e.g., avidin
- cytotoxic agent e.g., a radionucleotide
- anti-IL-17A/F antibodies disclosed herein may also be formulated as immunoliposomes.
- liposome is a small vesicle composed of various types of lipids, phospholipids and/or surfactant which is useful for delivery of a drug to a mammal.
- the components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes.
- Liposomes containing the antibody are prepared by methods known in the art, such as described in Epstein et al., Proc. Natl. Acad. Sci.
- Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter.
- Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin et al., J. Biol. Chem. 257:286-288 (1982) via a disulfide interchange reaction. A chemotherapeutic agent is optionally contained within the liposome. See Gabizon et al., J. National Cancer Inst. 8 K 19): 1484 (1989).
- IL-17 A/F binding oligopeptides of the present invention are oligopeptides that bind, preferably specifically, to an IL- 17 A/F polypeptide as described herein.
- IL- 17 A/F binding oligopeptides may be chemically synthesized using known oligopeptide synthesis methodology or may be prepared and purified using recombinant technology.
- IL- 17 A/F binding oligopeptides are usually at least about 5 amino acids in length, alternatively at least about 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28.
- IL- 17A/F binding oligopeptides may be identified without undue experimentation using well known techniques.
- techniques for screening oligopeptide libraries for oligopeptides that are capable of specifically binding to a polypeptide target are well known in the art (see, e.g., U.S. Patent Nos. 5,556,762, 5,750,373, 4,708,871 , 4,833,092, 5,223.409, 5,403,484, 5,571,689, 5,663,143; PCT Publication Nos. WO 84/03506 and WO84/03564; Geysen et al., Proc. Natl. Acad. Sci.
- bacteriophage (phage) display is one well known technique which allows one to screen large oligopeptide libraries to identify member(s) of those libraries which are capable of specifically binding to a polypeptide target.
- Phage display is a technique by which variant polypeptides are displayed as fusion proteins to the coat protein on the surface of bacteriophage particles (Scott, J.K. and Smith, G. P. (1990) Science 249: 386).
- the utility of phage display lies in the fact that large libraries of selectively randomized protein variants (or randomly cloned cDNAs) can be rapidly and efficiently sorted for those sequences that bind to a target molecule with high affinity. Display of peptide (Cwirla, S. E. et al. (1990) Proc. Natl. Acad. Sci. USA, 87:6378) or protein (Lowman, H.B. et al.
- Sorting phage libraries of random mutants requires a strategy for constructing and propagating a large number of variants, a procedure for affinity purification using the target receptor, and a means of evaluating the results of binding enrichments.
- U.S. Patent Nos. 5,223,409, 5,403,484, 5,571,689, and 5,663,143 Although most phage display methods have used filamentous phage, lambdoid phage display systems
- T4 phage display systems (Ren, Z-J. et al. (1998) Gene 215:439; Zhu, Z. ( 1997) CAN 33:534; Jiang, J. et al. (1997) can 128:44380; Ren, Z-J. et al. (1997) CAN 127:215644; Ren, Z-J. (1996) Protein Sci. 5: 1833; Efimov, V. P. et al. (1995) Virus Genes 10: 173) and T7 phage display systems (Smith, G. P. and Scott, J.K. ( 1993) Methods in Enzymology, 217, 228 _ 257; U.S.
- WO 97/35196 describes a method of isolating an affinity ligand in which a phage display library is contacted with one solution in which the ligand will bind to a target molecule and a second solution in which the affinity ligand will not bind to the target molecule, to selectively isolate binding ligands.
- WO 97/46251 describes a method of biopanning a random phage display library with an affinity purified antibody and then isolating binding phage, followed by a micropanning process using microplate wells to isolate high affinity binding phage.
- Staphylococcus aureus protein A as an affinity tag has also been reported (Li et al. (1998) MoI Biotech., 9: 187).
- WO 97/47314 describes the use of substrate subtraction libraries to distinguish enzyme specificities using a combinatorial library which may be a phage display library.
- a method for selecting enzymes suitable for use in detergents using phage display is described in WO 97/09446. Additional methods of selecting specific binding proteins are described in U.S. Patent Nos. 5,498,538, 5,432,018, and WO 98/15833.
- EL-17A/F binding organic molecules are organic molecules other than oligopeptides or antibodies as defined herein that bind, preferably specifically, to an IL-Il A/F polypeptide as described herein.
- IL-HATF binding organic molecules may be identified and chemically synthesized using known methodology (see, e.g., PCT Publication Nos. WOOO/00823 and WO00/39585).
- EL-17A/F binding organic molecules are usually less than about 2000 daltons in size, alternatively less than about 1500, 750, 500, 250 or 200 daltons in size, wherein such organic molecules that are capable of binding, preferably specifically, to an IL-17A/F polypeptide as described herein may be identified without undue experimentation using well known techniques.
- techniques for screening organic molecule libraries for molecules that are capable of binding to a polypeptide target are well known in the art (see, e.g., PCT Publication Nos. WOOO/00823 and WOOO/39585).
- IL- 17 A/F binding organic molecules may be, for example, aldehydes, ketones, oximes, hydrazones, semicarbazones, carbazides, primary amines, secondary amines, tertiary amines, N-substituted hydrazines, hydrazides, alcohols, ethers, thiols, thioethers, disulfides, carboxylic acids, esters, amides, ureas, carbamates, carbonates, ketals, thioketals, acetals, thioacetals, aryl halides, aryl sulfonates, alkyl halides, alkyl sulfonates, aromatic compounds, heterocyclic compounds, anilines, alkenes, alkynes, diols, amino alcohols, oxazolidines, oxazolines, thiazolidines, thiazolines, enamines, sulfonamide
- an anti-EL-17A/F antibody, oligopeptide or other organic molecule of the invention may be assessed by methods known in the art, e.g., using cells which express an JL- IlAJF polypeptide either endogenously or following transfection with the EL-17 AJF gene.
- appropriate tumor cell lines and IL-17A/F-transfected cells may treated with an anti-EL-17A/F monoclonal antibody, oligopeptide or other organic molecule of the invention at various concentrations for a few days (e.g., 2-7) days and stained with crystal violet or MTT or analyzed by some other colorimetric assay.
- Another method of measuring proliferation would be by comparing 3 H-thymidine uptake by the cells treated in the presence or absence an anti-EL-17A/F antibody, IL-17 AJF binding oligopeptide or EL-17 AJF binding organic molecule of the invention.
- the cells are harvested and the amount of radioactivity incorporated into the DNA quantitated in a scintillation counter.
- Appropriate positive controls include treatment of a selected cell line with a growth inhibitory antibody known to inhibit growth of that cell line. Growth inhibition of tumor cells in vivo can be determined in various ways known in the art.
- the tumor cell is one that overexpresses an EL- 17 A/F polypeptide.
- the anti-IL-17A/F antibody, EL-17 A/F binding oligopeptide or EL- 17A/F binding organic molecule will inhibit cell proliferation of an EL- 17A/F-expressing tumor cell in vitro or in vivo by about 25-100% compared to the untreated tumor cell, more preferably, by about 30- 100%, and even more preferably by about 50- 100% or 70-100%, in one embodiment, at an antibody concentration of about 0.5 to 30 ⁇ g/ml. Growth inhibition can be measured at an antibody concentration of about 0.5 to 30 ⁇ g/ml or about 0.5 nM to 200 nM in cell culture, where the growth inhibition is determined 1- 10 days after exposure of the tumor cells to the antibody.
- the antibody is growth inhibitory in vivo if administration of the anti-IL- 17A/F antibody at about 1 ⁇ g/kg to about 100 mg/kg body weight results in reduction in tumor size or reduction of tumor cell proliferation within about 5 days to 3 months from the first administration of the antibody, preferably within about 5 to 30 days.
- IL-17A/F binding oligopeptide or IL-17A/F binding organic molecule which induces cell death, loss of membrane integrity as indicated by, e.g., propidium iodide (PI), trypan blue or 7AAD uptake may be assessed relative to control.
- PI uptake assay can be performed in the absence of complement and immune effector cells.
- IL-17A/F polypeptide-expressing tumor cells are incubated with medium alone or medium containing the appropriate anti-EL-17A/F antibody (e.g, at about lO ⁇ g/ml), IL-17A/F binding oligopeptide or IL-17A/F binding organic molecule. The cells are incubated for a 3 day time period. Following each treatment, cells are washed and aliquoted into 35 mm strainer-capped 12 x 75 tubes (ImI per tube, 3 tubes per treatment group) for removal of cell clumps. Tubes then receive PI (lO ⁇ g/ml). Samples may be analyzed using a FACSCAN® flow cytometer and FACSCONVERT® CellQuest software (Becton Dickinson).
- Those anti-IL-17A/F antibodies, IL- 17A/F binding oligopeptides or IL-17A/F binding organic molecules that induce statistically significant levels of cell death as determined by PI uptake may be selected as cell death-inducing anti-IL- 17A/F antibodies, IL-17A/F binding oligopeptides or IL-17A/F binding organic molecules.
- a routine cross-blocking assay such as that described in Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, Ed Harlow and David Lane (1988), can be performed. This assay can be used to determine if a test antibody, oligopeptide or other organic molecule binds the same site or epitope as a known anti-IL-17A/F antibody.
- epitope mapping can be performed by methods known in the art .
- the antibody sequence can be mutagenized such as by alanine scanning, to identify contact residues.
- the mutant antibody is initailly tested for binding with polyclonal antibody to ensure proper folding.
- peptides corresponding to different regions of an IL-17 A/F polypeptide can be used in competition assays with the test antibodies or with a test antibody and an antibody with a characterized or known epitope.
- the active IL- 17 A/F molecules of the invention e.g., IL- 17 A/F polypeptides, anti-IL- 17 A/F antibodies, and/or variants of each
- IL- 17 A/F molecules of the invention can be administered for the treatment of immune related diseases, in the form of pharmaceutical compositions.
- Therapeutic formulations of the active IL- 17A/F molecule are prepared for storage by mixing the active molecule having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. [1980]), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients.
- buffers such as phosphate, citrate, and other organic acids
- antioxidants including ascorbic acid and methionine
- preservatives such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine;
- Lipofections or liposomes can also be used to deliver the IL-17A/F molecule into cells.
- the smallest inhibitory fragment which specifically binds to the binding domain of the target protein is preferred.
- peptide molecules can be designed which retain the ability to bind the target protein sequence.
- Such peptides can be synthesized chemically and/or produced by recombinant DNA technology (see, e.g., Marasco et al, Proc. Natl. Acad. Sci. USA, 90:7889-7893 [1993]).
- the formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
- the composition may comprise a cytotoxic agent, cytokine or growth inhibitory agent.
- cytotoxic agent cytokine or growth inhibitory agent.
- Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
- the active YL-MAfF molecules may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin- microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
- colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
- sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, or microcapsules.
- sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No.
- LUPRON DEPOTTM injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate
- poly-D-(-)-3-hydroxybutyric acid While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.
- encapsulated antibodies When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 371 C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved.
- stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
- polypeptides, antibodies and other active compounds of the present invention may be used to treat various immune related diseases and conditions, such as T cell mediated diseases, including those characterized by infiltration of inflammatory cells into a tissue, stimulation of T-cell proliferation, inhibition of T-cell proliferation, increased or decreased vascular permeability or the inhibition thereof, such as autoimmune diseases.
- T cell mediated diseases including those characterized by infiltration of inflammatory cells into a tissue, stimulation of T-cell proliferation, inhibition of T-cell proliferation, increased or decreased vascular permeability or the inhibition thereof, such as autoimmune diseases.
- Exemplary conditions or disorders to be treated with the polypeptides, antibodies and other compounds of the invention include, but are not limited to systemic lupus erythematosis, rheumatoid arthritis, juvenile chronic arthritis, osteoarthritis, spondyloarthropathies, systemic sclerosis (scleroderma), idiopathic inflammatory myopathies (dermatomyositis, polymyositis), Sjogren's syndrome, systemic vasculitis, sarcoidosis, autoimmune hemolytic anemia (immune pancytopenia, paroxysmal nocturnal hemoglobinuria), autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-mediated thrombocytopenia), thyroiditis (Grave's disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, atrophic thyroiditis), diabetes mellitus, immune-mediated renal disease (glomerulonephritis, tubulo
- T lymphocytes have not been shown to be directly involved in tissue damage, T lymphocytes are required for the development of auto-reactive antibodies. The genesis of the disease is thus T lymphocyte dependent. Multiple organs and systems are affected clinically including kidney, lung, musculoskeletal system, mucocutaneous, eye, central nervous system, cardiovascular system, gastrointestinal tract, bone marrow and blood.
- Rheumatoid arthritis is a chronic systemic autoimmune inflammatory disease that mainly involves the synovial membrane of multiple joints with resultant injury to the articular cartilage.
- the pathogenesis is T lymphocyte dependent and is associated with the production of rheumatoid factors, auto- antibodies directed against self IgG, with the resultant formation of immune complexes that attain high levels in joint fluid and blood.
- These complexes in the joint may induce the marked infiltrate of lymphocytes and monocytes into the synovium and subsequent marked synovial changes; the joint space/fluid if infiltrated by similar cells with the addition of numerous neutrophils.
- Tissues affected are primarily the joints, often in symmetrical pattern.
- extra-articular disease also occurs in two major forms.
- One form is the development of extra-articular lesions with ongoing progressive joint disease and typical lesions of pulmonary fibrosis, vasculitis, and cutaneous ulcers.
- the second form of extra-articular disease is the so called Felty's syndrome which occurs late in the RA disease course, sometimes after joint disease has become quiescent, and involves the presence of neutropenia, thrombocytopenia and splenomegaly. This can be accompanied by vasculitis in multiple organs with formations of infarcts, skin ulcers and gangrene.
- rheumatoid nodules Patients often also develop rheumatoid nodules in the subcutis tissue overlying affected joints; the nodules late stage have necrotic centers surrounded by a mixed inflammatory cell infiltrate.
- Other manifestations which can occur in RA include: pericarditis, pleuritis, coronary arteritis, interstitial pneumonitis with pulmonary fibrosis, keratoconjunctivitis sicca, and rheumatoid nodules.
- Juvenile chronic arthritis is a chronic idiopathic inflammatory disease which begins often at less than
- RA rheumatoid arthritis
- the disease is sub-classified into three major categories: pauciarticular, polyarticular, and systemic.
- pauciarticular polyarticular
- systemic systemic
- the arthritis can be severe and is typically destructive and leads to joint ankylosis and retarded growth.
- Other manifestations can include chronic anterior uveitis and systemic amyloidosis.
- Spondyloarthropathies are a group of disorders with some common clinical features and the common association with the expression of HLA-B27 gene product.
- the disorders include: ankylosing spondylitis, Reiter's syndrome (reactive arthritis), arthritis associated with inflammatory bowel disease, spondylitis associated with psoriasis, juvenile onset spondyloarthropathy and undifferentiated spondyloarthropathy.
- Distinguishing features include sacroileitis with or without spondylitis; inflammatory asymmetric arthritis; association with HLA-B27 (a serologically defined allele of the HLA-B locus of class I MHC); ocular inflammation, and absence of autoantibodies associated with other rheumatoid disease.
- the cell most implicated as key to induction of the disease is the CD8 + T lymphocyte, a cell which targets antigen presented by class I MHC molecules.
- CD8 + T cells may react against the class I MHC allele HLA-B27 as if it were a foreign peptide expressed by MHC class I molecules. It has been hypothesized that an epitope of HLA-B27 may mimic a bacterial or other microbial antigenic epitope and thus induce a CD8 + T cells response.
- Systemic sclerosis has an unknown etiology.
- a hallmark of the disease is induration of the skin; likely this is induced by an active inflammatory process.
- Scleroderma can be localized or systemic; vascular lesions are common and endothelial cell injury in the microvasculature is an early and important event in the development of systemic sclerosis; the vascular injury may be immune mediated.
- An immunologic basis is implied by the presence of mononuclear cell infiltrates in the cutaneous lesions and the presence of anti-nuclear antibodies in many patients.
- ICAM-I is often upregulated on the cell surface of fibroblasts in skin lesions suggesting that T cell interaction with these cells may have a role in the pathogenesis of the disease.
- kidney concentric subendothelial intimal proliferation affecting small arcuate and interlobular arteries with resultant reduced renal cortical blood flow, results in proteinuria, azotemia and hypertension, skeletal muscle atrophy, interstitial fibrosis, inflammation, lung interstitial pneumonitis and interstitial fibrosis, and heart contraction band necrosis, scarring/fibrosis
- Idiopathic inflammatory myopathies including dermatomyositis, polymyositis and others are disorders of chronic muscle inflammation of unknown etiology resulting in muscle weakness Muscle injury/inflammation is often symmetric and progressive Autoantibodies are associated with most forms
- myositis-specific autoantibodies are directed against and inhibit the function of components, proteins and RNA's, involved in protein synthesis
- Sjogren's syndrome is due to immune-mediated inflammation and subsequent functional destruction of the tear glands and salivary glands
- the disease can be associated with or accompanied by inflammatory connective tissue diseases
- the disease is associated with autoantibody production against Ro and La antigens, both of which are small RNA-protein complexes Lesions result in keratoconjunctivitis sicca, xerostomia, with other manifestations or associations including biliary cirrhosis, peripheral or sensory neuropathy, and palpable purpura
- Systemic vasculitis are diseases in which the primary lesion is inflammation and subsequent damage to blood vessels which results in ischemia/necrosis/degeneration to tissues supplied by the affected vessels and eventual end-organ dysfunction in some cases
- Vasculitides can also occur as a secondary lesion or sequelae to other immune-inflammatory mediated diseases such as rheumatoid arthritis, systemic sclerosis, etc , particularly in diseases also associated with the formation of immune complexes Diseases m the primary systemic va
- Sarcoidosis is a condition of unknown etiology which is characterized by the presence of epithelioid granulomas in nearly any tissue in the body, involvement of the lung is most common
- the pathogenesis involves the persistence of activated macrophages and lymphoid cells at sites of the disease with subsequent chronic sequelae resultant from the release of locally and systemically active products released by these cell types
- Autoimmune hemolytic anemia including autoimmune hemolytic anemia, immune pancytopenia, and paroxysmal noctural hemoglobinuria is a result of production of antibodies that react with antigens expressed on the surface of red blood cells (and in some cases other blood cells including platelets as well) and is a reflection of the removal of those antibody coated cells via complement mediated lysis and/or ADCC/Fc- receptor-mediated mechanisms
- Thyroiditis including Grave's disease, Hashimoto's thyroiditis, juvenile lymphocytic thyroiditis, and atrophic thyroiditis
- Experimental models exist including spontaneous models: rats (BUF and BB rats) and chickens (obese chicken strain); inducible models: immunization of animals with either thyroglobulin, thyroid microsomal antigen (thyroid peroxidase).
- Type I diabetes mellitus or insulin-dependent diabetes is the autoimmune destruction of pancreatic islet cells; this destruction is mediated by auto-antibodies and auto-reactive T cells.
- Antibodies to insulin or the insulin receptor can also produce the phenotype of insulin-non-responsiveness.
- Immune mediated renal diseases are the result of antibody or T lymphocyte mediated injury to renal tissue either directly as a result of the production of autoreactive antibodies or T cells against renal antigens or indirectly as a result of the deposition of antibodies and/or immune complexes in the kidney that are reactive against other, non-renal antigens.
- immune-mediated diseases that result in the formation of immune-complexes can also induce immune mediated renal disease as an indirect sequelae.
- Both direct and indirect immune mechanisms result in inflammatory response that produces/induces lesion development in renal tissues with resultant organ function impairment and in some cases progression to renal failure. Both humoral and cellular immune mechanisms can be involved in the pathogenesis of lesions.
- Demyelinating diseases of the central and peripheral nervous systems including multiple sclerosis; idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome; and chronic inflammatory demyelinating polyneuropathy, are believed to have an autoimmune basis and result in nerve demyelination as a result of damage caused to oligodendrocytes or to myelin directly.
- MS there is evidence to suggest that disease induction and progression is dependent on T lymphocytes.
- Multiple sclerosis is a demyelinating disease that is T lymphocyte-dependent and has either a relapsing-remitting course or a chronic progressive course.
- T lymphocyte mediated, microglial cells and infiltrating macrophages CD4 + T lymphocytes are the predominant cell type at lesions.
- the mechanism of oligodendrocyte cell death and subsequent demyelination is not known but is likely T lymphocyte driven.
- Inflammatory and fibrotic lung disease including eosinophilic pneumonia; idiopathic pulmonary fibrosis, and hypersensitivity pneumonitis may involve a disregulated immune-inflammatory response.
- Autoimmune or immune-mediated skin disease including bullous skin diseases, erythema multiforme, and contact dermatitis are mediated by auto-antibodies, the genesis of which is T lymphocyte-dependent.
- Psoriasis is a T lymphocyte-mediated inflammatory disease. Lesions contain infiltrates of T lymphocytes, macrophages and antigen processing cells, and some neutrophils.
- Allergic diseases including asthma; allergic rhinitis; atopic dermatitis; food hypersensitivity; and urticaria are T lymphocyte dependent. These diseases are predominantly mediated by T lymphocyte induced inflammation, IgE mediated-inflammation or a combination of both.
- Transplantation associated diseases including graft rejection and graft-versus-host-disease (GVHD) are T lymphocyte-dependent; inhibition of T lymphocyte function is ameliorative.
- Other diseases in which intervention of the immune and/or inflammatory response have benefit are infectious disease including but not limited to viral infection (including but not limited to AIDS, hepatitis A, B, C, D, E and herpes) bacterial infection, fungal infections, and protozoal and parasitic infections (molecules (or derivatives/agonists) which stimulate the MLR can be utilized therapeutically to enhance the immune response to infectious agents), diseases of immunodeficiency (molecules/derivatives/agonists) which stimulate the MLR can be utilized therapeutically to enhance the immune response for conditions of inherited, acquired, infectious induced (as in HTV infection), or iatrogenic (i.e., as from chemotherapy) immunodeficiency, and neoplasia.
- viral infection including but not limited to AIDS, hepatitis A, B, C, D
- Molecules that inhibit the lymphocyte response in the MLR also function in vivo during neoplasia to suppress the immune response to a neoplasm; such molecules can either be expressed by the neoplastic cells themselves or their expression can be induced by the neoplasm in other cells.
- Antagonism of such inhibitory molecules enhances immune-mediated tumor rejection.
- inhibition of molecules with proinflammatory properties may have therapeutic benefit in reperfusion injury; stroke; myocardial infarction; atherosclerosis; acute lung injury; hemorrhagic shock; burn; sepsis/septic shock: acute tubular necrosis; endometriosis; degenerative joint disease and pancreatitis.
- the compounds of the present invention are administered to a mammal, preferably a human, in accord with known methods, such as intravenous administration as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerebral spinal, subcutaneous, intra-articular, intra synovial, intrathecal, oral, topical, or inhalation (intranasal, intrapulmonary) routes.
- Intravenous or inhaled administration of polypeptides and antibodies is preferred.
- an anti-cancer agent may be combined with the administration of the proteins, antibodies or compounds of the instant invention.
- the patient to be treated with a the immunoadjuvant of the invention may also receive an anticancer agent (chemotherapeutic agent) or radiation therapy.
- chemotherapeutic agent chemotherapeutic agent
- Preparation and dosing schedules for such chemotherapeutic agents may be used according to manufacturers' instructions or as determined empirically by the skilled practitioner. Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy Service, Ed., M.C. Perry, Williams & Wilkins, Baltimore, MD (1992).
- the chemotherapeutic agent may precede, or follow administration of the immunoadjuvant or may be given simultaneously therewith.
- an anti-oestrogen compound such as tamoxifen or an anti-progesterone such as onapristone (see, EP 616812) may be given in dosages known for such molecules.
- IL-17 A/F polypeptides are coadministered with a growth inhibitory agent.
- the growth inhibitory agent may be administered first, followed by an IL- 17 A/F polypeptide.
- Suitable dosages for the growth inhibitory agent are those presently used and may be lowered due to the combined action (synergy) of the growth inhibitory agent and the IL- 17 A/F polypeptide.
- an a compound of the invention for the treatment or reduction in the severity of immune related disease, the appropriate dosage of an a compound of the invention will depend on the type of disease to be treated, as defined above, the severity and course of the disease, whether the agent is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the compound, and the discretion of the attending physician.
- the compound is suitably administered to the patient at one time or over a series of treatments.
- about 1 mg/kg to 15 mg/kg (e.g., 0.1- 20 mg/kg) of polypeptide or antibody is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion.
- a typical daily dosage might range from about 1 mg/kg to 100 mg/kg or more, depending on the factors mentioned above.
- the treatment is sustained until a desired suppression of disease symptoms occurs.
- other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays.
- an article of manufacture containing materials useful for the diagnosis or treatment of the disorders described above.
- the article of manufacture comprises a container and an instruction.
- Suitable containers include, for example, bottles, vials, syringes, and test tubes.
- the containers may be formed from a variety of materials such as glass or plastic.
- the container holds a composition which is effective for diagnosing or treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
- the active agent in the composition is usually a polypeptide or an antibody of the invention.
- the article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
- a pharmaceutically-acceptable buffer such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
- Cell surface proteins such as proteins which are overexpressed in certain immune related diseases, are excellent targets for drug candidates or disease treatment.
- the same proteins along with secreted proteins encoded by the genes amplified in immune related disease states find additional use in the diagnosis and prognosis of these diseases.
- antibodies directed against the protein products of genes amplified in multiple sclerosis, rheumatoid arthritis, inflammatory bowel disorder, or another immune related disease can be used as diagnostics or prognostics.
- antibodies can be used to qualitatively or quantitatively detect the expression of proteins encoded by amplified or overexpressed genes ("marker gene products").
- the antibody preferably is equipped with a detectable, e.g., fluorescent label, and binding can be monitored by light microscopy, flow cytometry, fluorimetry, or other techniques known in the art. These techniques are particularly suitable, if the overexpressed gene encodes a cell surface protein Such binding assays are performed essentially as described above.
- In situ detection of antibody binding to the marker gene products can be performed, for example, by immunofluorescence or immunoelectron microscopy.
- a histological specimen is removed from the patient, and a labeled antibody is applied to it, preferably by overlaying the antibody on a biological sample.
- This procedure also allows for determining the distribution of the marker gene product in the tissue examined. It will be apparent for those skilled in the art that a wide variety of histological methods are readily available for in situ detection. The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.
- F12:DMEM containing 10% FCS, 5 mM L-glutamine, penicillin-streptomycin was removed and replaced with serum-free PS24 media and cultured for an additional four days. After four days, conditioned media was collected centrifuged and sterile filtered, prior to purification.
- Buffer A using a 10 kilodalton cutoff membrane to a volume of 480 milliliters, then applied to a Pharmacia HiLoad S Sepharose 26/10 column at 6 ml/min.
- the column was eluted with a linear gradient to 100% Buffer B (20 mM sodium acetate, 1 M NaCl, 1 mM sodium azide, pH 5.0) at a rate of 1%/minute with a flow rate of 6 ml/min collecting 12 ml fractions. SDS PAGE analysis was performed on the fractions collected from this column. Proteins were revealed with silver staining. Molecular mass markers are labeled for gel containing fractions 25-37 ( Figure 2). Fractions 31 and 32 contained a protein with an apparent molecular mass of approximately 33 kD consistent with IL-17 A/F.
- Figure 2 shows the chromatograph of eluted proteins measured at 214 nm and 280 nm. The acetonitrile step gradient is overlain over the profile. Protein concentration of fraction 38 was found to be 0.536 mg/ml by amino acid analysis.
- fractions 31 , 32 and 33 were 0.258, 0.359 and 0.291 mg/ml respectively.
- Gels, blots, amino acid sequence, mass spectrophotometry and activity assays were run primarily on fraction 32 and 33.
- Fractions generated by chromatography were assayed for IL- 17 and EL- 17F content through the use of Western blotting.
- One ⁇ g/ml of monoclonal antibody directed against either BL- 17 or IL- 17F was used to detect the presence of either DL- 17 or IL- 17F in the samples.
- Figure 4B shows a schematic of the IL-17A/F peptide fragments containing disulfide bonds between the IL- 17 and the IL- 17F chain that would be anticipated by digestion of the DL- 17A/F with trypsin [DL- 17A/F disulfide bond fragment #1 is designated as SEQ ID NO:7; DL-17A/F disulfide bond fragment #2 is designated as SEQ IDNO:8, respectively].
- SEQ ID NO:7 DL- 17A/F disulfide bond fragment #1 is designated as SEQ ID NO:7
- DL-17A/F disulfide bond fragment #2 is designated as SEQ IDNO:8, respectively].
- the amino acids contained within these fragments are indicated and numbered relative to the initiating methionine of each chain.
- Matrix-assisted laser desorption/ionization time of flight mass spectrometry was performed with delayed extraction in positive ion reflectron mode using a 2', 4', 6'-trihydoxyacetophenone matrix.
- a second sample aliquot was digested at pH 8 following reduction of disulfide bonds with dithiothreitol and alkylation of sulfhydryl groups with iodoacetamide.
- the MALDI-TOF spectrum of this sample lacked the peaks in question, supporting their assignment as disulfide-linked.
- the non-reduced sample was further characterized by liquid-chromatography electrospray ionization ion trap mass spectrometry (LC-ESI-MS) ( Figure 4D).
- the ion chromatograms represent (from top to bottom) the total ion chromatogram, reconstructed ion chromatogram (RIC) of IL- 17A/F disulfide bond fragment #2 [M+2H]2+, and DL-17A/F disulfide bond fragment #1 [M+2H]3+.
- Phage Library Screening For Antibodies That Bind To IL- 17 A/F In order to identify antibodies which bind to DL- 1 IPJF, a phage library of synthetic Fab antibodies was screened. Thirty four (34) independent clones encoding distinct Fab antibody sequences were identified. Which were able to mediate binding to EL- 1 IPJF. The phage library of human antibody sequences was prepared and screened for antigen specific Fab in a manner similar to that previously described (Gerstner, R. B. et al., J. MoI. Biol., 32_i(5):851-62 (2002).
- the humanized monoclonal antibody 4D5 an anti-HER2 antibody
- phage-displayed Fab libraries These Fab are displayed on the phage monovalently and/or divalently by fusion to a homodimerizable leucine zipper.
- To generate library diversity we chose to randomize surface exposed heavy chain CDR residues that were also found to be highly diverse in the Kabat database of natural antibody sequences and form a contiguous patch.
- site-directed mutagenesis with tailored degenerate codons to generate amino acid diversity that mimicked the natural immune repertoire at each CDR site.
- Hl and H2 were allowed limited diversity of same length as Herceptin, whereas H3 is designed to have high degeneracy with length ranged from 7 to 19. All antibodies generated from the initial library selection have the identical light chain.
- Full length IgG or Fab can be generated by one-step cloning of the heavy chain variable domain into vectors providing the desired isotype specific constant region sequence.
- a second-step randomization of light chain CDRs can be employed.
- the amino acid sequence of the region of the variable domain of the heavy chains that contains the three (3) CDRs [Hl- H3] from Fab that bind IL-17A/F are shown in Figure 6.
- SEQ ID NO:44 TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTGATTCCTATATACACTGGGTGCGTCAGGCCCCG GGTAAGGGCCTGGAATGGGTTGCTGAAATTTCTCCTCCTGGCGGCGATACTTACTATGCCGATAG
- SEQ ID NO:47 TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTGGTTCTGATATACACTGGGTGCGTCAGGCCCCG GGTAAGGGCCTGGAATGGGTTGCTTATATTAATCCTTATGGCGGTTCTACTGACTATGCCGATAG CGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAAC AGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGCGTACGTTAT GGACTACTGGGGTCAA
- SEQ ID NO:49 TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTAGTACTTATATACACTGGGTGCGTCAGGCCCCG GGTAAGGGCCTGGAATGGGTTGCTTGGATTTCTCCTTATAGCGGTTATACTGACTATGCCGATAG
- SEQ ID NO:52 TTGTCCTGTGCAGCTTCTGGCTTCACCATTAATGATTCTGATATACACTGGGTGCGTCAGGCCCCG GGTAAGGGCCTGGAATGGGTTGGTATTATTTATCCTTATGACGGTTATACTTACTATGCCGATAG CGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAAC AGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCAAGAAGCAACCTGGACAACAACTTGTT CGACTACTGGGGTCAA
- SEQ ID NO:57 TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGATAATTATATACACTGGGTGCGTCAGGCCCCG GGTAAGGGCCTGGAATGGGTTGGTTGGATTTCTCCTTATAGCGGTTATACTTACTATGCCGATAG CGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAAC AGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTGAGACCCTCTTCTACGACAAGGA CCAGTACTCCTACGTTATGGACTACTGGGGTCAA
- SEQ ID NO:59 TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGATAATGGGATACACTGGGTGCGTCAGGCCCC GGGTAAGGGCCTGGAATGGGTTGGTTGGATTACTCCTACTAGCGGTTATACTAACTATGCCGATA GCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAA CAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGCGACGGGGACACCTGGAAGTGG GACGCCCCGTACGTTATGGACTACTGGGGTCAA
- SEQ ID NO:61 TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTAGTACCTGGATACACTGGGTGCGTCAGGCCCC GGGTAAGGGCCTGGAATGGGTTGGTGTTATTACTCCTACTAACGGTTCTACTTACTATGCCGATA
- SEQ ID NO:64 TTGTCCTGTGCAGCTTCTGGCTTCACCATTACTGGTTACGGGATACACTGGGTGCGTCAGGCCCC GGGTAAGGGCCTGGAATGGGTTGCTTGGATTTCTCCTTCTAACGGTTATACTTACTATGCCGATA GCGTCAAGGGCCGTTTCACTATAAGCGCAGACACATCCAAAAACACAGCCTACCTACAAATGAA CAGCTTAAGAGCTGAGGACACTGCCGTCTATTATTGTGCTCGTCGCGTCAGCTACTACGTCTACA GGCACGACTGGGTCAGGGGCTACGTTATGGACTACTGGGGTCAA
- SEQ ID NO:66 TTGTCCTGTGCAGCTTCTGGCTTCACCATTAGTGATTCCTCTATACACTGGGTGCGTCAGGCCCCG GGTAAGGGCCTGGAATGGGTTGCTTTTATTTATCCTACTAGCGGTTCTACTTACTATGCCAATAGC
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Diabetes (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Pulmonology (AREA)
- Zoology (AREA)
- Hematology (AREA)
- Endocrinology (AREA)
- Physical Education & Sports Medicine (AREA)
- Toxicology (AREA)
- Dermatology (AREA)
- Epidemiology (AREA)
- Neurology (AREA)
- Rheumatology (AREA)
- Virology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Biomedical Technology (AREA)
- Transplantation (AREA)
- Communicable Diseases (AREA)
- Otolaryngology (AREA)
- Urology & Nephrology (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| MX2009005304A MX2009005304A (es) | 2006-11-29 | 2007-11-20 | Polipeptidos heterodimericos il-17a/f y usos terapeuticos de los mismos. |
| AU2007325316A AU2007325316C1 (en) | 2006-11-29 | 2007-11-20 | IL-17A/F heterodimeric polypeptides and therapeutic uses thereof |
| UAA200906752A UA103297C2 (uk) | 2006-11-29 | 2007-11-20 | Спосіб лікування захворювання, пов'язаного з імунітетом, шляхом одночасного націлювання на il-17a і il-17f антитіл-антагоністів |
| EP07864668A EP2056860A2 (en) | 2006-11-29 | 2007-11-20 | Il-17a/f heterodimeric polypeptides and therapeutic uses thereof |
| BRPI0719288-6A BRPI0719288A2 (pt) | 2006-11-29 | 2007-11-20 | Polipeptídeos heterodiméricos il-17a/f e usos terapêuticos dos mesmos |
| NZ575700A NZ575700A (en) | 2006-11-29 | 2007-11-20 | Il-17a/f heterodimeric polypeptides and therapeutic uses thereof |
| CA002666549A CA2666549A1 (en) | 2006-11-29 | 2007-11-20 | Il-17a/f heterodimeric polypeptides and therapeutic uses thereof |
| JP2009539420A JP2010511056A (ja) | 2006-11-29 | 2007-11-20 | Il−17a/fヘテロ二量体ポリペプチドおよびその治療上の使用 |
| IL197776A IL197776A0 (en) | 2006-11-29 | 2009-03-24 | Il-17a/f heterodimeric polypeptides and therapeutic uses thereof |
| NO20092448A NO20092448L (no) | 2006-11-29 | 2009-06-26 | IL-17A/F-heterologe polypeptider og terapeutiske anvendelser derav |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US11/606,192 | 2006-11-29 | ||
| US11/606,192 US20070160576A1 (en) | 2001-06-05 | 2006-11-29 | IL-17A/F heterologous polypeptides and therapeutic uses thereof |
Publications (4)
| Publication Number | Publication Date |
|---|---|
| WO2008067223A2 true WO2008067223A2 (en) | 2008-06-05 |
| WO2008067223A9 WO2008067223A9 (en) | 2008-07-17 |
| WO2008067223A3 WO2008067223A3 (en) | 2008-09-25 |
| WO2008067223A8 WO2008067223A8 (en) | 2009-07-30 |
Family
ID=39468626
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2007/085269 Ceased WO2008067223A2 (en) | 2006-11-29 | 2007-11-20 | Il-17a/f heterodimeric polypeptides and therapeutic uses thereof |
Country Status (26)
| Country | Link |
|---|---|
| US (3) | US20070160576A1 (https=) |
| EP (3) | EP2056860A2 (https=) |
| JP (3) | JP2010511056A (https=) |
| KR (1) | KR101561926B1 (https=) |
| CN (2) | CN104784688A (https=) |
| AR (1) | AR064032A1 (https=) |
| AU (1) | AU2007325316C1 (https=) |
| BR (1) | BRPI0719288A2 (https=) |
| CA (1) | CA2666549A1 (https=) |
| CL (1) | CL2007003439A1 (https=) |
| CO (1) | CO6180451A2 (https=) |
| CR (1) | CR10824A (https=) |
| EC (1) | ECSP099401A (https=) |
| IL (1) | IL197776A0 (https=) |
| MA (1) | MA31077B1 (https=) |
| MX (1) | MX2009005304A (https=) |
| MY (2) | MY185649A (https=) |
| NO (1) | NO20092448L (https=) |
| NZ (1) | NZ575700A (https=) |
| PE (1) | PE20081501A1 (https=) |
| RU (2) | RU2440134C2 (https=) |
| SG (1) | SG177136A1 (https=) |
| TW (1) | TWI527830B (https=) |
| UA (1) | UA103297C2 (https=) |
| WO (1) | WO2008067223A2 (https=) |
| ZA (2) | ZA200902480B (https=) |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010114859A1 (en) * | 2009-04-01 | 2010-10-07 | Genentech, Inc. | Treatment of insulin-resistant disorders |
| US7931900B2 (en) | 2003-11-21 | 2011-04-26 | Ucb Pharma S.A. | Method for the treatment of multiple sclerosis by inhibiting IL-17 activity |
| EP2450050A1 (en) | 2006-11-29 | 2012-05-09 | Genentech, Inc. | IL-17A/F heterodimeric polypeptides and therapeutic uses thereof |
| WO2012138977A1 (en) * | 2011-04-06 | 2012-10-11 | Board Of Trustees Of The Leland Stanford Junior University | Structural based design of il-17 dominant negative mutants |
| EP1641822B1 (en) * | 2003-07-08 | 2013-05-15 | Genentech, Inc. | Il-17 a/f heterologous polypeptides and therapeutic uses thereof |
| EP2485763A4 (en) * | 2009-10-10 | 2013-10-30 | Univ Leland Stanford Junior | CYTOKINE COMPOSITIONS OF THE IL-17 FAMILY AND ITS USES |
| US8580265B2 (en) | 2011-01-14 | 2013-11-12 | Ucb Pharma S.A. | Antibody molecules which bind IL-17A and IL-17F |
| US9284283B2 (en) | 2012-02-02 | 2016-03-15 | Ensemble Therapeutics Corporation | Macrocyclic compounds for modulating IL-17 |
| WO2016070062A2 (en) | 2014-10-31 | 2016-05-06 | Genentech, Inc. | Anti-il-17a and il-17f cross reactive antibody variants and compositions comprising and methods of making and using same |
| RU2605318C2 (ru) * | 2009-05-05 | 2016-12-20 | Новиммун С.А. | Анти-il-17f антитела и способы их применения |
| US9650437B2 (en) | 2008-05-05 | 2017-05-16 | Novimmune S.A. | Nucleic acid encoding and method of producing anti-IL-17A/IL-17F cross-reactive antibodies |
| US9932403B2 (en) | 2010-05-20 | 2018-04-03 | Ablynx Nv | Biological materials related to HER3 |
| US10017568B2 (en) | 2011-05-05 | 2018-07-10 | Merck Patent Gmbh | Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and method of treatment using same |
| US11492396B2 (en) | 2015-10-27 | 2022-11-08 | UCB Biopharma SRL | Methods of treatment using anti-IL-17A/F antibodies |
| US12296008B2 (en) | 2014-12-22 | 2025-05-13 | Novartis Ag | Pharmaceutical products and stable liquid compositions of IL-17 antibodies |
Families Citing this family (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7771719B1 (en) * | 2000-01-11 | 2010-08-10 | Genentech, Inc. | Pharmaceutical compositions, kits, and therapeutic uses of antagonist antibodies to IL-17E |
| US20040043397A1 (en) * | 2000-01-11 | 2004-03-04 | Genentech, Inc. | IL-17 homologous polypeptides and therapeutic uses thereof |
| US7718397B2 (en) | 2000-03-21 | 2010-05-18 | Genentech, Inc. | Nucleic acids encoding receptor for IL-17 homologous polypeptides and uses thereof |
| US20030203451A1 (en) * | 2000-08-24 | 2003-10-30 | Genentech, Inc. | IL-17 homologous polypeptides and therapeutic uses thereof |
| US20030096969A1 (en) * | 2000-06-02 | 2003-05-22 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
| CN101160528A (zh) | 2005-02-14 | 2008-04-09 | 惠氏公司 | Il17-f在诊断和治疗气道炎症中的用途 |
| GT200600065A (es) * | 2005-02-14 | 2006-10-02 | Anticuerpos para interleucina-17f y otros antagonistas de la señalizacion de il-17f y sus usos | |
| GB0620729D0 (en) * | 2006-10-18 | 2006-11-29 | Ucb Sa | Biological products |
| TW200902064A (en) * | 2007-03-28 | 2009-01-16 | Wyeth Corp | Methods and compositions for modulating IL-17F/IL-17A biological activity |
| ES2614735T3 (es) * | 2007-07-23 | 2017-06-01 | Janssen Biotech, Inc. | Métodos y composiciones para tratar los trastornos relacionados con fibrosis usando antagonistas de la IL-17 |
| GB0807413D0 (en) | 2008-04-23 | 2008-05-28 | Ucb Pharma Sa | Biological products |
| US8790642B2 (en) | 2008-08-29 | 2014-07-29 | Genentech, Inc. | Cross-reactive and bispecific anti-IL-17A/F antibodies |
| TWI541021B (zh) | 2009-03-05 | 2016-07-11 | 艾伯維有限公司 | Il-17結合蛋白 |
| US20100310502A1 (en) * | 2009-06-09 | 2010-12-09 | Anders Linden | Method of treating local infections in mammals |
| AU2011249908A1 (en) | 2010-05-06 | 2012-11-22 | Singulex, Inc. | Methods for diagnosing, staging, predicting risk for developing and identifying treatment responders for rheumatoid arthritis |
| US11421025B2 (en) * | 2013-12-27 | 2022-08-23 | Osaka University | Treatment of IL-17A diseases |
| CN104784687A (zh) * | 2015-04-27 | 2015-07-22 | 苏州大学附属第一医院 | 重组绿脓杆菌鞭毛钩蛋白FlgE的用途 |
| RU2680011C2 (ru) | 2016-04-29 | 2019-02-14 | Закрытое Акционерное Общество "Биокад" | Триспецифические антитела против il-17a, il-17f и другой провоспалительной молекулы |
| US10858427B2 (en) | 2017-03-10 | 2020-12-08 | Suzhou Kanova Biopharmaceutical Co., Ltd. | Monoclonal antibody against both IL-17A and IL-17F and use of the same |
| WO2019217407A1 (en) * | 2018-05-07 | 2019-11-14 | Yale University | Blockade of mir466l-3p binding to il-17a mrna with site-specific target site blocker prevents neuro-inflammatory-mediated disease |
| HRP20240999T1 (hr) | 2018-07-16 | 2024-10-25 | Regeneron Pharmaceuticals, Inc. | Glodavački modeli bolesti ditra i njihova upotreba |
| CN116751277A (zh) * | 2023-01-10 | 2023-09-15 | 武汉爱博泰克生物科技有限公司 | 利用毕赤酵母表达活性重组人il-17a蛋白的方法 |
| CN117843801B (zh) * | 2023-12-29 | 2024-08-02 | 北京贝来药业有限公司 | 以白介素家族成员为靶点的新型抗体以及下游产品 |
| CN118206654B (zh) * | 2024-03-05 | 2024-09-20 | 北京贝来药业有限公司 | 用于疾病治疗的新型抗体及其产品和应用 |
Citations (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4179337A (en) | 1973-07-20 | 1979-12-18 | Davis Frank F | Non-immunogenic polypeptides |
| US4301144A (en) | 1979-07-11 | 1981-11-17 | Ajinomoto Company, Incorporated | Blood substitute containing modified hemoglobin |
| WO1984003564A1 (en) | 1983-03-08 | 1984-09-13 | Commw Serum Lab Commission | Method of determining antigenically active amino acid sequences |
| WO1984003506A1 (en) | 1983-03-08 | 1984-09-13 | Commw Serum Lab Commission | Antigenically active amino acid sequences |
| US4485045A (en) | 1981-07-06 | 1984-11-27 | Research Corporation | Synthetic phosphatidyl cholines useful in forming liposomes |
| US4496689A (en) | 1983-12-27 | 1985-01-29 | Miles Laboratories, Inc. | Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer |
| US4544545A (en) | 1983-06-20 | 1985-10-01 | Trustees University Of Massachusetts | Liposomes containing modified cholesterol for organ targeting |
| US4640835A (en) | 1981-10-30 | 1987-02-03 | Nippon Chemiphar Company, Ltd. | Plasminogen activator derivatives |
| US4657760A (en) | 1979-03-20 | 1987-04-14 | Ortho Pharmaceutical Corporation | Methods and compositions using monoclonal antibody to human T cells |
| US4670417A (en) | 1985-06-19 | 1987-06-02 | Ajinomoto Co., Inc. | Hemoglobin combined with a poly(alkylene oxide) |
| WO1987005330A1 (en) | 1986-03-07 | 1987-09-11 | Michel Louis Eugene Bergh | Method for enhancing glycoprotein stability |
| US4708871A (en) | 1983-03-08 | 1987-11-24 | Commonwealth Serum Laboratories Commission | Antigenically active amino acid sequences |
| US4791192A (en) | 1986-06-26 | 1988-12-13 | Takeda Chemical Industries, Ltd. | Chemically modified protein with polyethyleneglycol |
| US4833092A (en) | 1985-04-22 | 1989-05-23 | Commonwealth Serum Laboratories Commission | Method for determining mimotopes |
| US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US5206344A (en) | 1985-06-26 | 1993-04-27 | Cetus Oncology Corporation | Interleukin-2 muteins and polymer conjugation thereof |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5225212A (en) | 1989-10-20 | 1993-07-06 | Liposome Technology, Inc. | Microreservoir liposome composition and method |
| EP0616812A1 (en) | 1993-03-24 | 1994-09-28 | Berlex Biosciences | Combination with anti-hormonal compounds and binding molecules for the treatment of cancer |
| US5364934A (en) | 1991-02-01 | 1994-11-15 | Genentech, Inc. | Plasma carboxypeptidase |
| US5428130A (en) | 1989-02-23 | 1995-06-27 | Genentech, Inc. | Hybrid immunoglobulins |
| WO1996007399A1 (en) | 1994-09-09 | 1996-03-14 | Takeda Chemical Industries, Ltd. | Sustained release preparation containing metal salt of a peptide |
| US5556762A (en) | 1990-11-21 | 1996-09-17 | Houghten Pharmaceutical Inc. | Scanning synthetic peptide combinatorial libraries: oligopeptide mixture sets having a one predetermined residue at a single, predetermined position, methods of making and using the same |
| US5571689A (en) | 1988-06-16 | 1996-11-05 | Washington University | Method of N-acylating peptide and proteins with diheteroatom substituted analogs of myristic acid |
| WO1996040072A2 (en) | 1995-06-07 | 1996-12-19 | Alkermes Controlled Therapeutics, Inc. | Composition for sustained release of human growth hormone |
| WO1997003692A1 (en) | 1995-07-14 | 1997-02-06 | Novo Nordisk A/S | A stabilized pharmaceutical formulation comprising a growth hormone pre-treated with zinc and optionally lysine or calcium ions |
| US5654010A (en) | 1992-12-02 | 1997-08-05 | Alkermes, Inc. | Composition for sustained release of human growth hormone |
| US5663143A (en) | 1988-09-02 | 1997-09-02 | Dyax Corp. | Engineered human-derived kunitz domains that inhibit human neutrophil elastase |
| WO1997038731A1 (en) | 1996-04-18 | 1997-10-23 | The Regents Of The University Of California | Immunoliposomes that optimize internalization into target cells |
| US5750373A (en) | 1990-12-03 | 1998-05-12 | Genentech, Inc. | Enrichment method for variant proteins having altered binding properties, M13 phagemids, and growth hormone variants |
| WO2000000823A1 (en) | 1998-06-26 | 2000-01-06 | Sunesis Pharmaceuticals, Inc. | Methods for rapidly identifying small organic ligands |
| WO2000039585A1 (en) | 1998-12-28 | 2000-07-06 | Sunesis Pharmaceuticals, Inc. | Identifying small organic molecule ligands for binding |
Family Cites Families (135)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3773919A (en) | 1969-10-23 | 1973-11-20 | Du Pont | Polylactide-drug mixtures |
| US3896111A (en) | 1973-02-20 | 1975-07-22 | Research Corp | Ansa macrolides |
| US4151042A (en) | 1977-03-31 | 1979-04-24 | Takeda Chemical Industries, Ltd. | Method for producing maytansinol and its derivatives |
| US4137230A (en) | 1977-11-14 | 1979-01-30 | Takeda Chemical Industries, Ltd. | Method for the production of maytansinoids |
| FR2413974A1 (fr) | 1978-01-06 | 1979-08-03 | David Bernard | Sechoir pour feuilles imprimees par serigraphie |
| US4307016A (en) | 1978-03-24 | 1981-12-22 | Takeda Chemical Industries, Ltd. | Demethyl maytansinoids |
| US4265814A (en) | 1978-03-24 | 1981-05-05 | Takeda Chemical Industries | Matansinol 3-n-hexadecanoate |
| US4275149A (en) | 1978-11-24 | 1981-06-23 | Syva Company | Macromolecular environment control in specific receptor assays |
| JPS5562090A (en) | 1978-10-27 | 1980-05-10 | Takeda Chem Ind Ltd | Novel maytansinoid compound and its preparation |
| JPS55164687A (en) | 1979-06-11 | 1980-12-22 | Takeda Chem Ind Ltd | Novel maytansinoid compound and its preparation |
| US4256746A (en) | 1978-11-14 | 1981-03-17 | Takeda Chemical Industries | Dechloromaytansinoids, their pharmaceutical compositions and method of use |
| JPS5566585A (en) | 1978-11-14 | 1980-05-20 | Takeda Chem Ind Ltd | Novel maytansinoid compound and its preparation |
| JPS55102583A (en) | 1979-01-31 | 1980-08-05 | Takeda Chem Ind Ltd | 20-acyloxy-20-demethylmaytansinoid compound |
| JPS55162791A (en) | 1979-06-05 | 1980-12-18 | Takeda Chem Ind Ltd | Antibiotic c-15003pnd and its preparation |
| JPS55164685A (en) | 1979-06-08 | 1980-12-22 | Takeda Chem Ind Ltd | Novel maytansinoid compound and its preparation |
| JPS55164686A (en) | 1979-06-11 | 1980-12-22 | Takeda Chem Ind Ltd | Novel maytansinoid compound and its preparation |
| US4309428A (en) | 1979-07-30 | 1982-01-05 | Takeda Chemical Industries, Ltd. | Maytansinoids |
| JPS5645483A (en) | 1979-09-19 | 1981-04-25 | Takeda Chem Ind Ltd | C-15003phm and its preparation |
| JPS5645485A (en) | 1979-09-21 | 1981-04-25 | Takeda Chem Ind Ltd | Production of c-15003pnd |
| EP0028683A1 (en) | 1979-09-21 | 1981-05-20 | Takeda Chemical Industries, Ltd. | Antibiotic C-15003 PHO and production thereof |
| US4399216A (en) | 1980-02-25 | 1983-08-16 | The Trustees Of Columbia University | Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials |
| ZA811368B (en) | 1980-03-24 | 1982-04-28 | Genentech Inc | Bacterial polypedtide expression employing tryptophan promoter-operator |
| US4376110A (en) | 1980-08-04 | 1983-03-08 | Hybritech, Incorporated | Immunometric assays using monoclonal antibodies |
| WO1982001188A1 (en) | 1980-10-08 | 1982-04-15 | Takeda Chemical Industries Ltd | 4,5-deoxymaytansinoide compounds and process for preparing same |
| US4450254A (en) | 1980-11-03 | 1984-05-22 | Standard Oil Company | Impact improvement of high nitrile resins |
| US4313946A (en) | 1981-01-27 | 1982-02-02 | The United States Of America As Represented By The Secretary Of Agriculture | Chemotherapeutically active maytansinoids from Trewia nudiflora |
| US4315929A (en) | 1981-01-27 | 1982-02-16 | The United States Of America As Represented By The Secretary Of Agriculture | Method of controlling the European corn borer with trewiasine |
| JPS57192389A (en) | 1981-05-20 | 1982-11-26 | Takeda Chem Ind Ltd | Novel maytansinoid |
| US4873191A (en) | 1981-06-12 | 1989-10-10 | Ohio University | Genetic transformation of zygotes |
| NZ201705A (en) | 1981-08-31 | 1986-03-14 | Genentech Inc | Recombinant dna method for production of hepatitis b surface antigen in yeast |
| US4943529A (en) | 1982-05-19 | 1990-07-24 | Gist-Brocades Nv | Kluyveromyces as a host strain |
| US4870009A (en) | 1982-11-22 | 1989-09-26 | The Salk Institute For Biological Studies | Method of obtaining gene product through the generation of transgenic animals |
| US4713339A (en) | 1983-01-19 | 1987-12-15 | Genentech, Inc. | Polycistronic expression vector construction |
| AU2353384A (en) | 1983-01-19 | 1984-07-26 | Genentech Inc. | Amplification in eukaryotic host cells |
| US4816567A (en) * | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4675187A (en) | 1983-05-16 | 1987-06-23 | Bristol-Myers Company | BBM-1675, a new antibiotic complex |
| DD266710A3 (de) | 1983-06-06 | 1989-04-12 | Ve Forschungszentrum Biotechnologie | Verfahren zur biotechnischen Herstellung van alkalischer Phosphatase |
| AU3145184A (en) | 1983-08-16 | 1985-02-21 | Zymogenetics Inc. | High expression of foreign genes in schizosaccharomyces pombe |
| US4736866B1 (en) | 1984-06-22 | 1988-04-12 | Transgenic non-human mammals | |
| US4879231A (en) | 1984-10-30 | 1989-11-07 | Phillips Petroleum Company | Transformation of yeasts of the genus pichia |
| US6492107B1 (en) | 1986-11-20 | 2002-12-10 | Stuart Kauffman | Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique |
| DE229046T1 (de) | 1985-03-30 | 1987-12-17 | Marc Genf/Geneve Ballivet | Verfahren zum erhalten von dns, rns, peptiden, polypeptiden oder proteinen durch dns-rekombinant-verfahren. |
| US4676980A (en) | 1985-09-23 | 1987-06-30 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Target specific cross-linked heteroantibodies |
| GB8610600D0 (en) | 1986-04-30 | 1986-06-04 | Novo Industri As | Transformation of trichoderma |
| US5567610A (en) | 1986-09-04 | 1996-10-22 | Bioinvent International Ab | Method of producing human monoclonal antibodies and kit therefor |
| IL85035A0 (en) | 1987-01-08 | 1988-06-30 | Int Genetic Eng | Polynucleotide molecule,a chimeric antibody with specificity for human b cell surface antigen,a process for the preparation and methods utilizing the same |
| US4946783A (en) | 1987-01-30 | 1990-08-07 | President And Fellows Of Harvard College | Periplasmic protease mutants of Escherichia coli |
| US5010182A (en) | 1987-07-28 | 1991-04-23 | Chiron Corporation | DNA constructs containing a Kluyveromyces alpha factor leader sequence for directing secretion of heterologous polypeptides |
| IL87737A (en) | 1987-09-11 | 1993-08-18 | Genentech Inc | Method for culturing polypeptide factor dependent vertebrate recombinant cells |
| GB8724885D0 (en) | 1987-10-23 | 1987-11-25 | Binns M M | Fowlpox virus promotors |
| US5770701A (en) | 1987-10-30 | 1998-06-23 | American Cyanamid Company | Process for preparing targeted forms of methyltrithio antitumor agents |
| US5606040A (en) | 1987-10-30 | 1997-02-25 | American Cyanamid Company | Antitumor and antibacterial substituted disulfide derivatives prepared from compounds possessing a methyl-trithio group |
| US5053394A (en) | 1988-09-21 | 1991-10-01 | American Cyanamid Company | Targeted forms of methyltrithio antitumor agents |
| KR0154872B1 (ko) | 1987-12-21 | 1998-10-15 | 로버트 에이. 아미테이지 | 발아하는 식물종자의 아크로박테리움 매개된 형질전환 |
| US5266684A (en) | 1988-05-02 | 1993-11-30 | The Reagents Of The University Of California | Peptide mixtures |
| AU4005289A (en) | 1988-08-25 | 1990-03-01 | Smithkline Beecham Corporation | Recombinant saccharomyces |
| GB8823869D0 (en) | 1988-10-12 | 1988-11-16 | Medical Res Council | Production of antibodies |
| US5175384A (en) | 1988-12-05 | 1992-12-29 | Genpharm International | Transgenic mice depleted in mature t-cells and methods for making transgenic mice |
| US5009772A (en) | 1989-02-27 | 1991-04-23 | Kerr-Mcgee Corporation | Solvent extraction process |
| CA2049028A1 (en) | 1989-03-07 | 1990-09-08 | Genentech, Inc. | Covalent conjugates of lipid and oligonucleotide |
| FR2646437B1 (fr) | 1989-04-28 | 1991-08-30 | Transgene Sa | Nouvelles sequences d'adn, leur application en tant que sequence codant pour un peptide signal pour la secretion de proteines matures par des levures recombinantes, cassettes d'expression, levures transformees et procede de preparation de proteines correspondant |
| ES2038579T3 (es) | 1989-04-28 | 1997-02-16 | Rhein Biotech Proz & Prod Gmbh | Celulas de levadura del genero schwanniomyces. |
| WO1990013641A1 (en) | 1989-05-10 | 1990-11-15 | Sloan-Kettering Institute For Cancer Research | Stably transformed eucaryotic cells comprising a foreign transcribable dna under the control of a pol iii promoter |
| EP0402226A1 (en) | 1989-06-06 | 1990-12-12 | Institut National De La Recherche Agronomique | Transformation vectors for yeast yarrowia |
| DE3920358A1 (de) | 1989-06-22 | 1991-01-17 | Behringwerke Ag | Bispezifische und oligospezifische, mono- und oligovalente antikoerperkonstrukte, ihre herstellung und verwendung |
| ES2096590T3 (es) | 1989-06-29 | 1997-03-16 | Medarex Inc | Reactivos biespecificos para la terapia del sida. |
| FR2649120B1 (fr) | 1989-06-30 | 1994-01-28 | Cayla | Nouvelle souche et ses mutants de champignons filamenteux, procede de production de proteines recombinantes a l'aide de ladite souche et souches et proteines obtenues selon ce procede |
| WO1991004753A1 (en) | 1989-10-02 | 1991-04-18 | Cetus Corporation | Conjugates of antisense oligonucleotides and therapeutic uses thereof |
| JPH05504553A (ja) | 1989-10-24 | 1993-07-15 | ギリアド サイエンシズ,インコーポレイテッド | 新規の結合を有するオリゴヌクレオチドアナログ |
| US5208020A (en) | 1989-10-25 | 1993-05-04 | Immunogen Inc. | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| CA2026147C (en) | 1989-10-25 | 2006-02-07 | Ravi J. Chari | Cytotoxic agents comprising maytansinoids and their therapeutic use |
| US5498538A (en) | 1990-02-15 | 1996-03-12 | The University Of North Carolina At Chapel Hill | Totally synthetic affinity reagents |
| US5229275A (en) | 1990-04-26 | 1993-07-20 | Akzo N.V. | In-vitro method for producing antigen-specific human monoclonal antibodies |
| US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| US5723286A (en) | 1990-06-20 | 1998-03-03 | Affymax Technologies N.V. | Peptide library and screening systems |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| ATE158021T1 (de) | 1990-08-29 | 1997-09-15 | Genpharm Int | Produktion und nützung nicht-menschliche transgentiere zur produktion heterologe antikörper |
| US5698426A (en) | 1990-09-28 | 1997-12-16 | Ixsys, Incorporated | Surface expression libraries of heteromeric receptors |
| US5770434A (en) | 1990-09-28 | 1998-06-23 | Ixsys Incorporated | Soluble peptides having constrained, secondary conformation in solution and method of making same |
| US5122469A (en) | 1990-10-03 | 1992-06-16 | Genentech, Inc. | Method for culturing Chinese hamster ovary cells to improve production of recombinant proteins |
| US5571894A (en) | 1991-02-05 | 1996-11-05 | Ciba-Geigy Corporation | Recombinant antibodies specific for a growth factor receptor |
| WO1992020373A1 (en) | 1991-05-14 | 1992-11-26 | Repligen Corporation | Heteroconjugate antibodies for treatment of hiv infection |
| EP1400536A1 (en) | 1991-06-14 | 2004-03-24 | Genentech Inc. | Method for making humanized antibodies |
| US5565332A (en) | 1991-09-23 | 1996-10-15 | Medical Research Council | Production of chimeric antibodies - a combinatorial approach |
| FI941572A7 (fi) | 1991-10-07 | 1994-05-27 | Oncologix Inc | Anti-erbB-2-monoklonaalisten vasta-aineiden yhdistelmä ja käyttömenete lmä |
| US5270170A (en) | 1991-10-16 | 1993-12-14 | Affymax Technologies N.V. | Peptide library and screening method |
| WO1993008829A1 (en) | 1991-11-04 | 1993-05-13 | The Regents Of The University Of California | Compositions that mediate killing of hiv-infected cells |
| ATE207080T1 (de) | 1991-11-25 | 2001-11-15 | Enzon Inc | Multivalente antigen-bindende proteine |
| CA2372813A1 (en) | 1992-02-06 | 1993-08-19 | L.L. Houston | Biosynthetic binding protein for cancer marker |
| US5573905A (en) | 1992-03-30 | 1996-11-12 | The Scripps Research Institute | Encoded combinatorial chemical libraries |
| ZA932522B (en) | 1992-04-10 | 1993-12-20 | Res Dev Foundation | Immunotoxins directed against c-erbB-2(HER/neu) related surface antigens |
| CA2140280A1 (en) | 1992-08-17 | 1994-03-03 | Avi J. Ashkenazi | Bispecific immunoadhesins |
| PT672141E (pt) | 1992-10-23 | 2003-09-30 | Immunex Corp | Metodos de preparacao de proteinas oligomericas soluveis |
| DK0752248T3 (da) | 1992-11-13 | 2000-11-13 | Idec Pharma Corp | Terapeutisk anvendelse af kimæriske og radioaktivt mærkede antistoffer mod humant B-lymfocytbegrænset differentieringsantig |
| US5536637A (en) | 1993-04-07 | 1996-07-16 | Genetics Institute, Inc. | Method of screening for cDNA encoding novel secreted mammalian proteins in yeast |
| US6274711B1 (en) * | 1993-06-14 | 2001-08-14 | Inserm, Institut National De La Sante Et De La Recherche Medicale | Purified mammalian CTLA-8 antigens and related reagents |
| US5773001A (en) | 1994-06-03 | 1998-06-30 | American Cyanamid Company | Conjugates of methyltrithio antitumor agents and intermediates for their synthesis |
| AU7104294A (en) | 1994-06-10 | 1996-01-05 | Symbiotech, Inc. | Method of detecting compounds utilizing genetically modified lambdoid bacteriophage |
| US5627024A (en) | 1994-08-05 | 1997-05-06 | The Scripps Research Institute | Lambdoid bacteriophage vectors for expression and display of foreign proteins |
| AU4289496A (en) | 1994-12-02 | 1996-06-19 | Chiron Corporation | Method of promoting an immune response with a bispecific antibody |
| US5731168A (en) | 1995-03-01 | 1998-03-24 | Genentech, Inc. | Method for making heteromultimeric polypeptides |
| US5641870A (en) | 1995-04-20 | 1997-06-24 | Genentech, Inc. | Low pH hydrophobic interaction chromatography for antibody purification |
| US5869046A (en) | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US5739277A (en) | 1995-04-14 | 1998-04-14 | Genentech Inc. | Altered polypeptides with increased half-life |
| US5837234A (en) | 1995-06-07 | 1998-11-17 | Cytotherapeutics, Inc. | Bioartificial organ containing cells encapsulated in a permselective polyether suflfone membrane |
| US5714586A (en) | 1995-06-07 | 1998-02-03 | American Cyanamid Company | Methods for the preparation of monomeric calicheamicin derivative/carrier conjugates |
| US5712374A (en) | 1995-06-07 | 1998-01-27 | American Cyanamid Company | Method for the preparation of substantiallly monomeric calicheamicin derivative/carrier conjugates |
| US6074849A (en) * | 1995-07-19 | 2000-06-13 | Genetics Institute, Inc. | Polynucleotides encoding human CTLA-8 related proteins |
| EP0854933B1 (en) | 1995-09-07 | 2003-05-07 | Novozymes A/S | Phage display for detergent enzyme activity |
| DE19544393A1 (de) | 1995-11-15 | 1997-05-22 | Hoechst Schering Agrevo Gmbh | Synergistische herbizide Mischungen |
| AU4385696A (en) * | 1996-01-18 | 1997-08-11 | Christian Gronhoj Larsen | Synthetic il-10 analogues |
| US6458939B1 (en) | 1996-03-15 | 2002-10-01 | Millennium Pharmaceuticals, Inc. | Compositions and methods for the diagnosis, prevention, and treatment of neoplastic cell growth and proliferation |
| WO1997035196A1 (en) | 1996-03-20 | 1997-09-25 | Dyax Corp. | Engineering affinity ligands for macromolecules |
| KR20000016414A (ko) | 1996-06-06 | 2000-03-25 | 와이즈먼 앤드루 | Apl 면역반응성 펩티드, 그것의 콘주게이트 및 apl항체-매개병변의 치료방법 |
| AU735015B2 (en) | 1996-06-10 | 2001-06-28 | Scripps Research Institute, The | Use of substrate subtraction libraries to distinguish enzyme specificities |
| US5766905A (en) | 1996-06-14 | 1998-06-16 | Associated Universities Inc. | Cytoplasmic bacteriophage display system |
| US5922845A (en) | 1996-07-11 | 1999-07-13 | Medarex, Inc. | Therapeutic multispecific compounds comprised of anti-Fcα receptor antibodies |
| WO1998014277A1 (en) | 1996-10-04 | 1998-04-09 | Whatman, Inc. | Device and method for simultaneous multiple chemical syntheses |
| DK0934526T3 (da) | 1996-10-08 | 2003-05-05 | Bisys B V U | Fremgangsmåder og midler til udvælgelse af peptider og proteiner, der har specifik affinitet til et mål |
| WO1998020036A1 (en) | 1996-11-06 | 1998-05-14 | Genentech, Inc. | Constrained helical peptides and methods of making same |
| IL119586A (en) | 1996-11-07 | 2001-09-13 | Univ Ramot | Discontinuous library of a single biological unit and a method for its preparation |
| IL119587A (en) | 1996-11-07 | 2000-12-06 | Univ Ramot | Method of preparing and for obtaining bimolecular interactions |
| US20020177188A1 (en) * | 1998-05-15 | 2002-11-28 | Genentech, Inc. | IL-17 homologous polypeptides and therapeutic uses thereof |
| US6696545B1 (en) * | 1997-04-11 | 2004-02-24 | Sangstat Medical Corporation | Cytomodulating lipophilic peptides for modulating immune system activity and inhibiting inflammation |
| US6482923B1 (en) * | 1997-09-17 | 2002-11-19 | Human Genome Sciences, Inc. | Interleukin 17-like receptor protein |
| ES2380812T3 (es) | 1999-12-23 | 2012-05-18 | Genentech, Inc. | Polipéptidos homólogos a IL-17 y usos terapéuticos de los mismos |
| CN1341660A (zh) * | 2000-09-07 | 2002-03-27 | 上海博德基因开发有限公司 | 一种新的多肽——人白细胞介素受体-配体(il-17b和il-17br)32.56和编码这种多肽的多核苷酸 |
| US20070160576A1 (en) | 2001-06-05 | 2007-07-12 | Genentech, Inc. | IL-17A/F heterologous polypeptides and therapeutic uses thereof |
| US20030049255A1 (en) * | 2001-08-07 | 2003-03-13 | Sims John E. | Interleukin-1 receptors in the treatment of diseases |
| WO2004042009A2 (en) | 2002-10-30 | 2004-05-21 | Genentech, Inc. | Inhibition of il-17 production |
| EP2784084B2 (en) * | 2003-07-08 | 2023-10-04 | Novartis Pharma AG | Antagonist antibodies to IL-17A/F heterologous polypeptides |
| HUE026260T2 (en) * | 2003-11-21 | 2016-06-28 | Ucb Biopharma Sprl | A method for treating multiple sclerosis by inhibiting IL-17 activity |
| BRPI0510617A (pt) * | 2004-05-03 | 2007-10-30 | Schering Corp | uso de expressão de il-17 para prever inflamação de pele; processos de tratamento |
| US7910540B2 (en) * | 2004-06-10 | 2011-03-22 | Zymogenetics, Inc. | Soluble ZcytoR14, anti-ZcytoR14 antibodies and binding partners and methods of using in inflammation |
| GT200600065A (es) * | 2005-02-14 | 2006-10-02 | Anticuerpos para interleucina-17f y otros antagonistas de la señalizacion de il-17f y sus usos |
-
2006
- 2006-11-29 US US11/606,192 patent/US20070160576A1/en not_active Abandoned
-
2007
- 2007-11-20 KR KR1020097013364A patent/KR101561926B1/ko active Active
- 2007-11-20 CN CN201510080703.4A patent/CN104784688A/zh active Pending
- 2007-11-20 EP EP07864668A patent/EP2056860A2/en not_active Withdrawn
- 2007-11-20 WO PCT/US2007/085269 patent/WO2008067223A2/en not_active Ceased
- 2007-11-20 BR BRPI0719288-6A patent/BRPI0719288A2/pt not_active Application Discontinuation
- 2007-11-20 NZ NZ575700A patent/NZ575700A/en unknown
- 2007-11-20 MX MX2009005304A patent/MX2009005304A/es not_active Application Discontinuation
- 2007-11-20 SG SG2011087772A patent/SG177136A1/en unknown
- 2007-11-20 ZA ZA200902480A patent/ZA200902480B/xx unknown
- 2007-11-20 EP EP16197439.9A patent/EP3181147A1/en not_active Withdrawn
- 2007-11-20 CN CNA2007800404658A patent/CN101563098A/zh active Pending
- 2007-11-20 RU RU2009124453/15A patent/RU2440134C2/ru active
- 2007-11-20 UA UAA200906752A patent/UA103297C2/uk unknown
- 2007-11-20 MY MYPI2012003615A patent/MY185649A/en unknown
- 2007-11-20 EP EP11169022A patent/EP2450050A1/en not_active Withdrawn
- 2007-11-20 JP JP2009539420A patent/JP2010511056A/ja not_active Withdrawn
- 2007-11-20 MY MYPI20092183A patent/MY171772A/en unknown
- 2007-11-20 AU AU2007325316A patent/AU2007325316C1/en not_active Withdrawn - After Issue
- 2007-11-20 CA CA002666549A patent/CA2666549A1/en not_active Abandoned
- 2007-11-28 PE PE2007001671A patent/PE20081501A1/es not_active Application Discontinuation
- 2007-11-29 AR ARP070105308A patent/AR064032A1/es unknown
- 2007-11-29 TW TW096145454A patent/TWI527830B/zh active
- 2007-11-29 CL CL200703439A patent/CL2007003439A1/es unknown
-
2009
- 2009-03-24 IL IL197776A patent/IL197776A0/en unknown
- 2009-03-31 CO CO09033096A patent/CO6180451A2/es not_active Application Discontinuation
- 2009-05-22 CR CR10824A patent/CR10824A/es unknown
- 2009-06-11 EC EC2009009401A patent/ECSP099401A/es unknown
- 2009-06-24 MA MA32043A patent/MA31077B1/fr unknown
- 2009-06-26 NO NO20092448A patent/NO20092448L/no not_active Application Discontinuation
-
2010
- 2010-04-06 ZA ZA2010/02391A patent/ZA201002391B/en unknown
-
2011
- 2011-03-02 US US13/039,201 patent/US20110256126A1/en not_active Abandoned
- 2011-10-05 RU RU2011140509/15A patent/RU2011140509A/ru not_active Application Discontinuation
-
2013
- 2013-09-20 JP JP2013195345A patent/JP2013253112A/ja not_active Withdrawn
-
2015
- 2015-03-02 JP JP2015039884A patent/JP2015108015A/ja active Pending
-
2016
- 2016-11-23 US US15/360,803 patent/US20170291940A1/en not_active Abandoned
Patent Citations (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4179337A (en) | 1973-07-20 | 1979-12-18 | Davis Frank F | Non-immunogenic polypeptides |
| US4657760A (en) | 1979-03-20 | 1987-04-14 | Ortho Pharmaceutical Corporation | Methods and compositions using monoclonal antibody to human T cells |
| US4301144A (en) | 1979-07-11 | 1981-11-17 | Ajinomoto Company, Incorporated | Blood substitute containing modified hemoglobin |
| US4485045A (en) | 1981-07-06 | 1984-11-27 | Research Corporation | Synthetic phosphatidyl cholines useful in forming liposomes |
| US4640835A (en) | 1981-10-30 | 1987-02-03 | Nippon Chemiphar Company, Ltd. | Plasminogen activator derivatives |
| WO1984003564A1 (en) | 1983-03-08 | 1984-09-13 | Commw Serum Lab Commission | Method of determining antigenically active amino acid sequences |
| WO1984003506A1 (en) | 1983-03-08 | 1984-09-13 | Commw Serum Lab Commission | Antigenically active amino acid sequences |
| US4708871A (en) | 1983-03-08 | 1987-11-24 | Commonwealth Serum Laboratories Commission | Antigenically active amino acid sequences |
| US4544545A (en) | 1983-06-20 | 1985-10-01 | Trustees University Of Massachusetts | Liposomes containing modified cholesterol for organ targeting |
| US4496689A (en) | 1983-12-27 | 1985-01-29 | Miles Laboratories, Inc. | Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer |
| US4833092A (en) | 1985-04-22 | 1989-05-23 | Commonwealth Serum Laboratories Commission | Method for determining mimotopes |
| US4670417A (en) | 1985-06-19 | 1987-06-02 | Ajinomoto Co., Inc. | Hemoglobin combined with a poly(alkylene oxide) |
| US5206344A (en) | 1985-06-26 | 1993-04-27 | Cetus Oncology Corporation | Interleukin-2 muteins and polymer conjugation thereof |
| WO1987005330A1 (en) | 1986-03-07 | 1987-09-11 | Michel Louis Eugene Bergh | Method for enhancing glycoprotein stability |
| US4791192A (en) | 1986-06-26 | 1988-12-13 | Takeda Chemical Industries, Ltd. | Chemically modified protein with polyethyleneglycol |
| US5571689A (en) | 1988-06-16 | 1996-11-05 | Washington University | Method of N-acylating peptide and proteins with diheteroatom substituted analogs of myristic acid |
| US5663143A (en) | 1988-09-02 | 1997-09-02 | Dyax Corp. | Engineered human-derived kunitz domains that inhibit human neutrophil elastase |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5403484A (en) | 1988-09-02 | 1995-04-04 | Protein Engineering Corporation | Viruses expressing chimeric binding proteins |
| US5428130A (en) | 1989-02-23 | 1995-06-27 | Genentech, Inc. | Hybrid immunoglobulins |
| US5225212A (en) | 1989-10-20 | 1993-07-06 | Liposome Technology, Inc. | Microreservoir liposome composition and method |
| US5013556A (en) | 1989-10-20 | 1991-05-07 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| US5556762A (en) | 1990-11-21 | 1996-09-17 | Houghten Pharmaceutical Inc. | Scanning synthetic peptide combinatorial libraries: oligopeptide mixture sets having a one predetermined residue at a single, predetermined position, methods of making and using the same |
| US5750373A (en) | 1990-12-03 | 1998-05-12 | Genentech, Inc. | Enrichment method for variant proteins having altered binding properties, M13 phagemids, and growth hormone variants |
| US5364934A (en) | 1991-02-01 | 1994-11-15 | Genentech, Inc. | Plasma carboxypeptidase |
| US5654010A (en) | 1992-12-02 | 1997-08-05 | Alkermes, Inc. | Composition for sustained release of human growth hormone |
| EP0616812A1 (en) | 1993-03-24 | 1994-09-28 | Berlex Biosciences | Combination with anti-hormonal compounds and binding molecules for the treatment of cancer |
| WO1996007399A1 (en) | 1994-09-09 | 1996-03-14 | Takeda Chemical Industries, Ltd. | Sustained release preparation containing metal salt of a peptide |
| WO1996040072A2 (en) | 1995-06-07 | 1996-12-19 | Alkermes Controlled Therapeutics, Inc. | Composition for sustained release of human growth hormone |
| WO1997003692A1 (en) | 1995-07-14 | 1997-02-06 | Novo Nordisk A/S | A stabilized pharmaceutical formulation comprising a growth hormone pre-treated with zinc and optionally lysine or calcium ions |
| WO1997038731A1 (en) | 1996-04-18 | 1997-10-23 | The Regents Of The University Of California | Immunoliposomes that optimize internalization into target cells |
| WO2000000823A1 (en) | 1998-06-26 | 2000-01-06 | Sunesis Pharmaceuticals, Inc. | Methods for rapidly identifying small organic ligands |
| WO2000039585A1 (en) | 1998-12-28 | 2000-07-06 | Sunesis Pharmaceuticals, Inc. | Identifying small organic molecule ligands for binding |
Non-Patent Citations (55)
| Title |
|---|
| "Current Protocols in Immunology", JOHN WILEY & SONS, INC |
| AGGARWAL, S. ET AL., J. BIOL. CHEM., vol. 278, no. 3, 2003, pages 1910 - 4 |
| APLIN; WRISTON, CRC CRIT. REV. BIOCHEM., 1981, pages 259 - 306 |
| ATHAUDA, J. BIOCHEM., vol. 113, 1993, pages 742 - 746 |
| BARCK ET AL., ARTHRITIS & RHEUMATISM, vol. 50, 2004, pages 3377 - 3386 |
| BRADLEY: "Teratocarcinomas and Embryonic Stem Cells: A Practical Approach", 1987, IRL, OXFORD, pages: 113 - 152 |
| BRAXTON; WELLS, BIOCHEMISTRY, vol. 31, 1992, pages 7796 - 7801 |
| CHAMBERS. C. A.; ALLISON, J. P., CURR. OPIN. IMMUNOL., vol. 9, 1997, pages 396 |
| CLACKSON, T. ET AL., NATURE, vol. 352, 1991, pages 624 |
| CLELAND: "Vaccine Design: The Subunit and Adjuvant Approach", 1995, PLENUM PRESS, article "Design and Production of Single Immunization Vaccines Using Polylactide Polyglycolide Microsphere Systems", pages: 439 - 462 |
| CWIRLA, S. E. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 6378 |
| DEUTSCHER: "Methods in Enzymology", 1990, pages: 182 |
| ED HARLOW AND DAVID LANE: "Antibodies, A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY |
| EDGE ET AL., ANAL. BIOCHEM., vol. 118, 1981, pages 131 |
| EPSTEIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 3688 |
| EVAN ET AL., MOLECULAR AND CELLULAR BIOLOGY, vol. 5, 1985, pages 3610 - 3616 |
| FIELD ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 2159 - 2165 |
| GABIZON ET AL., J. NATIONAL CANCER INST., vol. 81, no. 19, 1989, pages 1484 |
| GEYSEN ET AL., J. IMMUNOL. METH., vol. 102, 1987, pages 259 - 274 |
| GEYSEN ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 81, 1984, pages 3998 - 4002 |
| GEYSEN ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 82, 1985, pages 178 - 182 |
| GEYSEN ET AL., SYNTHETIC PEPTIDES AS ANTIGENS, 1986, pages 130 - 149 |
| HAKIMUDDIN ET AL., ARCH. BIOCHEM. BIOPHYS., vol. 259, 1987, pages 52 |
| HODGSON, BIO/TECHNOLOGY, vol. 9, 1991, pages 19 - 21 |
| HOPP ET AL., BIOTECHNOLOGY, vol. 6, 1988, pages 1204 - 1210 |
| HORA ET AL., BIO/TECHNOLOGY, vol. 8, 1990, pages 755 - 758 |
| HWANG ET AL., PROC. NATL ACAD. SCI. USA, vol. 77, 1980, pages 4030 |
| JENKINS, M. K., IMMUNITY, vol. 1, 1994, pages 405 |
| JOHNSON ET AL., NAT. MED., vol. 2, 1996, pages 795 - 799 |
| JUNE, C. H., IMMUNOL. TODAY, vol. 15, 1994, pages 321 |
| KANG, A.S. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 8363 |
| LEWIS: "Biodegradable Polymers as Drug Delivery Systems", 1990, MARCEL DEKKER, article "Controlled release of bioactive agents from lactide/glycolide polymer", pages: 1 - 41 |
| LI ET AL., CELL, vol. 69, 1992, pages 915 |
| LINSLEY, P. S.; LEDBETTER, J. A., ANNU. REV. IMMUNOL., vol. 11, 1993, pages 191 |
| LOWMAN, H.B. ET AL., BIOCHEMISTRY, vol. 30, 1991, pages 10832 |
| LUTZ-FREYERMUTH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 6393 - 6397 |
| M.C. PERRY,: "Chemotherapy Service", 1992, WILLIAMS & WILKINS, pages: 110 |
| MARKS, J. D. ET AL., J. MOL. BIOL., vol. 222, 1991, pages 581 |
| MARTIN ET AL., J. BIOL. CHEM., vol. 257, 1982, pages 286 - 288 |
| MARTIN ET AL., SCIENCE, vol. 255, 1992, pages 192 - 194 |
| MERRIFIELD, J. AM. CHEM. SOC., vol. 85, 1963, pages 2149 - 2154 |
| PABORSKY ET AL., PROTEIN ENGINEERING, vol. 3, no. 6, 1990, pages 547 - 553 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", COLD SPRING HARBOR SEPHADEX, pages: G-75 |
| SCHOOFS, J. IMMUNOL., vol. 140, 1988, pages 611 - 616 |
| SCHWARTZ, R. H., CELL, vol. 71, 1992, pages 1065 |
| SCOPES: "Protein Purification: Principles and Practice", 1982, SPRINGER-VERLAG |
| See also references of EP2056860A2 |
| SKINNER ET AL., J. BIOL. CHEM., vol. 266, 1991, pages 15163 - 15166 |
| SMALL ET AL., MOL. CELL. BIOL., vol. 5, 1985, pages 642 - 648 |
| SMITH, G. P., CURRENT OPIN. BIOTECHNOL., vol. 2, 1991, pages 668 |
| STEWART ET AL.: "Solid-Phase Peptide Synthesis", 1969, W.H. FREEMAN CO. |
| THOMAS; CAPECCHI, CELL, vol. 51, 1987, pages 503 |
| THOTAKURA ET AL., METH. ENZYMOL., vol. 138, 1987, pages 350 |
| YACOBI ET AL.,: "Toxicokinetics and New Drug Development", 1989, PERGAMON PRESS, pages: 42 - 96 |
| YASUDA, BIOMED. THER., vol. 27, 1993, pages 1221 - 1223 |
Cited By (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10011654B2 (en) | 2003-07-08 | 2018-07-03 | Genentech, Inc. | Antibodies directed to IL-17A/IL-17F heterodimers |
| EP1641822B1 (en) * | 2003-07-08 | 2013-05-15 | Genentech, Inc. | Il-17 a/f heterologous polypeptides and therapeutic uses thereof |
| US7931900B2 (en) | 2003-11-21 | 2011-04-26 | Ucb Pharma S.A. | Method for the treatment of multiple sclerosis by inhibiting IL-17 activity |
| EP2450050A1 (en) | 2006-11-29 | 2012-05-09 | Genentech, Inc. | IL-17A/F heterodimeric polypeptides and therapeutic uses thereof |
| US9650437B2 (en) | 2008-05-05 | 2017-05-16 | Novimmune S.A. | Nucleic acid encoding and method of producing anti-IL-17A/IL-17F cross-reactive antibodies |
| CN102448493A (zh) * | 2009-04-01 | 2012-05-09 | 弗·哈夫曼-拉罗切有限公司 | 胰岛素抗性疾病的治疗 |
| JP2012522788A (ja) * | 2009-04-01 | 2012-09-27 | ジェネンテック, インコーポレイテッド | インスリン抵抗性疾患の治療 |
| WO2010114859A1 (en) * | 2009-04-01 | 2010-10-07 | Genentech, Inc. | Treatment of insulin-resistant disorders |
| CN102448493B (zh) * | 2009-04-01 | 2014-04-30 | 弗·哈夫曼-拉罗切有限公司 | 胰岛素抗性疾病的治疗 |
| RU2537142C2 (ru) * | 2009-04-01 | 2014-12-27 | Дженентек, Инк. | Лечение нарушений, связанных с инсулинорезистентностью |
| RU2605318C2 (ru) * | 2009-05-05 | 2016-12-20 | Новиммун С.А. | Анти-il-17f антитела и способы их применения |
| EP2485763A4 (en) * | 2009-10-10 | 2013-10-30 | Univ Leland Stanford Junior | CYTOKINE COMPOSITIONS OF THE IL-17 FAMILY AND ITS USES |
| US10808032B2 (en) | 2010-05-20 | 2020-10-20 | Ablynx Nv | Biological materials related to HER3 |
| US9932403B2 (en) | 2010-05-20 | 2018-04-03 | Ablynx Nv | Biological materials related to HER3 |
| US11919950B2 (en) | 2011-01-14 | 2024-03-05 | UCB Biopharma SRL | Expression vector encoding antibody molecule which binds IL-17A and IL-17F |
| US9034600B2 (en) | 2011-01-14 | 2015-05-19 | Ucb Biopharma Sprl | DNA encoding antibody molecules which bind IL-17A and IL-17F |
| US8580265B2 (en) | 2011-01-14 | 2013-11-12 | Ucb Pharma S.A. | Antibody molecules which bind IL-17A and IL-17F |
| US9988446B2 (en) | 2011-01-14 | 2018-06-05 | Ucb Biopharma Sprl | Methods of treatment using antibodies which bind IL-17A and IL-17F |
| WO2012138977A1 (en) * | 2011-04-06 | 2012-10-11 | Board Of Trustees Of The Leland Stanford Junior University | Structural based design of il-17 dominant negative mutants |
| US10017568B2 (en) | 2011-05-05 | 2018-07-10 | Merck Patent Gmbh | Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and method of treatment using same |
| US10829552B2 (en) | 2011-05-05 | 2020-11-10 | Merck Patent Gmbh | Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and methods of treatment using same |
| US11773159B2 (en) | 2011-05-05 | 2023-10-03 | Merck Patent Gmbh | Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and methods of treatment using same |
| US9284283B2 (en) | 2012-02-02 | 2016-03-15 | Ensemble Therapeutics Corporation | Macrocyclic compounds for modulating IL-17 |
| WO2016070062A2 (en) | 2014-10-31 | 2016-05-06 | Genentech, Inc. | Anti-il-17a and il-17f cross reactive antibody variants and compositions comprising and methods of making and using same |
| US12296008B2 (en) | 2014-12-22 | 2025-05-13 | Novartis Ag | Pharmaceutical products and stable liquid compositions of IL-17 antibodies |
| US12485172B2 (en) | 2014-12-22 | 2025-12-02 | Novartis Ag | Pharmaceutical products and stable liquid compositions of IL-17 antibodies |
| US12485173B2 (en) | 2014-12-22 | 2025-12-02 | Novartis Ag | Pharmaceutical products and stable liquid compositions of IL-17 antibodies |
| US12544438B2 (en) | 2014-12-22 | 2026-02-10 | Novartis Ag | Pharmaceutical products and stable liquid compositions of IL-17 antibodies |
| US12599664B2 (en) | 2014-12-22 | 2026-04-14 | Novartis Ag | Pharmaceutical products and stable liquid compositions of IL-17 antibodies |
| US11492396B2 (en) | 2015-10-27 | 2022-11-08 | UCB Biopharma SRL | Methods of treatment using anti-IL-17A/F antibodies |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2007325316C1 (en) | IL-17A/F heterodimeric polypeptides and therapeutic uses thereof | |
| AU2004259638C1 (en) | IL-17 A/F heterologous polypeptides and therapeutic uses thereof | |
| AU2013216585A1 (en) | IL-17A/F heterodimeric polypeptides and therapeutic uses thereof | |
| US20220204606A1 (en) | Il-17a/f heterologous polypeptides and therapeutic uses thereof | |
| HK1257482A1 (en) | Il-17 a/f heterodimeric polypeptides and therapeutic uses thereof | |
| HK1257482A (en) | Il-17 a/f heterodimeric polypeptides and therapeutic uses thereof | |
| HK1168554A (en) | Il-17a/f heterodimeric polypeptides and therapeutic uses thereof | |
| HK1201539B (en) | Antagonist antibodies to il-17a/f heterologous polypeptides | |
| HK1152051A (en) | Il-17a/f heterologous polypeptides, antibodies and therapeutic uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780040465.8 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07864668 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1862/DELNP/2009 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 575700 Country of ref document: NZ |
|
| REEP | Request for entry into the european phase |
Ref document number: 2007864668 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007864668 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 09033096 Country of ref document: CO Ref document number: 14025345 Country of ref document: CO |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2666549 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12009500931 Country of ref document: PH |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2009/005304 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2009539420 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007325316 Country of ref document: AU Ref document number: CR2009-010824 Country of ref document: CR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009050800 Country of ref document: EG |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2007325316 Country of ref document: AU Date of ref document: 20071120 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020097013364 Country of ref document: KR |
|
| ENP | Entry into the national phase |
Ref document number: 2009124453 Country of ref document: RU Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: A200906752 Country of ref document: UA |
|
| ENP | Entry into the national phase |
Ref document number: PI0719288 Country of ref document: BR Kind code of ref document: A2 Effective date: 20090527 |