WO1993008829A1 - Compositions that mediate killing of hiv-infected cells - Google Patents
Compositions that mediate killing of hiv-infected cells Download PDFInfo
- Publication number
- WO1993008829A1 WO1993008829A1 PCT/US1992/009550 US9209550W WO9308829A1 WO 1993008829 A1 WO1993008829 A1 WO 1993008829A1 US 9209550 W US9209550 W US 9209550W WO 9308829 A1 WO9308829 A1 WO 9308829A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- domains
- binding domain
- binding
- antibody
- cells
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2809—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70514—CD4
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/46—Hybrid immunoglobulins
- C07K16/468—Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/32—Fusion polypeptide fusions with soluble part of a cell surface receptor, "decoy receptors"
Definitions
- This application relates to pharmaceutical compositions useful in the treatment of human immunodeficiency virus (HIV) infections and particularly those useful for stimulating killing of HIV-infected cells by cytotoxic T
- HIV human immunodeficiency virus
- lymphocytes are lymphocytes.
- CD4 is a non-polymorphic glycoprotein with homology to the immunoglobulin gene superfamily (P. Maddon et al., Cell 42:93 [1985]).
- CD4 defines two distinct subsets of mature peripheral T cells (E. Reinherz et al., Cell 19:821 [1980]), which are distinguished by their ability to interact with nominal antigen targets in the context of class I and class II major histocompatibility complex (MHC) antigens, respectively (S. Swain, Proc. Natl. Acad. Sci. 78:7101 [1981]; E. Engleman et al., J. Immunol. 127:2124 [1981]; H. Spitz et al., J. Immunol. 129:1563 [1982]; W. Biddison et al., J. Exp. Med. 156: 1065 [1982]; and D. Wilde et al., J.
- CD4 T cells display the helper/inducer T cell phenotype (E. Reinherz, supra), although CD4 T cells characterized as cytotoxic/suppressor T cells have also been identified (Y. Thomas et al., J. Exp. Med. 154:459 [1981]; S. Mauer et al., Proc. Natl. Acad. Sci. USA 79:4395 [1982]; and A. Krensky et al., Proc. Natl. Acad. Sci. USA 79:2365
- CD4 helper/inducer T cell function probably underlies the profound defects in cellular and humoral immunity leading to the opportunistic infections and malignancies characteristic of the acquired immunodeficiency syndrome (AIDS) (H. Lane supra).
- CD4 T cells Studies of HIV-I infection of fractionated CD4 and CD8 T cells from normal donors and AIDS patients have revealed that depletion of CD4 T cells results from the ability of HIV-I to selectively infect, replicate in, and ultimately destroy this T lymphocyte subset (D. Klatzmann et al., Science 225:59 [1984]).
- CD4 itself is an essential component of the cellular receptor for HIV-I was first indicated by the observation that monoclonal antibodies directed against CD4 block HIV-I infection and syncytia induction (A.
- CD4 Antibody against CD4 was found to inhibit the fusion of uninfected CD4 T cells with HIV-I infected cells in vitro: moreover, the giant multinucleated cells produced by this event die shortly after being formed resulting in the depletion of the population of CD4 cells (J. Lifson et al., Science 232:1123 [1986]).
- syncytia also requires gp120 expression, and can be elicited by coculturing CD4-positive cell lines with cell lines expressing the HTV-I any. gene in the absence of other viral structural or regulatory proteins (J. Sodroski et al., Nature 322:470 [1986]; J. Lifson et al., Nature 323:725 [1986]).
- the interaction between gp120 and CD4 constitutes one of several critical entry points in the viral life cycle amenable to therapeutic intervention (H. Mitauya et al., Nature 325:773 [1987]).
- the known sequence of the CD4 precursor predicts a hydrophobic signal peptide, an extracellular region of approximately 370 amino acids, a highly hydrophobic stretch with significant identity to the membrane-spanning domain of the class ⁇ MHC beta chain, and a highly charged intracellular sequence of 40 residues (P. Madden, Cell 42:93 [1985]).
- the extracellular domain of CD4 consists of four contiguous regions each having amino acid and structural similarity to the variable and joining (V-J) domains of immunoglobulin light chains as well as related regions in other members of the immunoglobulin gene superfamily. These structurally similar regions of CD4 are termed the V 1 , V 2 , V 3 and V 4 domains (denominated 1-4 in Figure 1).
- One specific binding region of the molecule generally referred to herein as a binding domain, consists of a portion (or all) of a CD4 variable region that is capable of binding to HIV gp120 while the other binding region (binding domain) exhibits specific binding affinity for a cytotoxic T cell, typically via an anti-CD3 binding region of an antibody.
- the bispecific molecules used in compositions of the invention referred to herein as "bispecs," are able to mediate the killing of cells infected with HIV virus of any strain by cytotoxic T cells of any specificity. It is no longer necessary to direct an antibody specifically to the HIV virus or to any particular class of T lymphocytes.
- Bispecs include single polypeptide chains with a CD4 region at one end and an anti-CD3 region at the other end, typically prepared by splicing CD4 variable region domains of a CD4 molecule onto anti-CD3 variable region domains of an anti-CD3 antibody, using techniques of genetic engineering.
- modified antibody molecules can be prepared, in which one arm of the antibody is derived from an anti-CD3 antibody and the other arm is derived from a CD4 molecule.
- These antibody molecules are preferably designed to be specifically useful in clinical situations by incorporating deletions of non-specific binding regions in, for example, the Fc region of the antibody chain, so that undesired binding, and thus indiscriminate cell killing, does not occur.
- Bispecs of the invention as described in detail below, have been demonstrated to mediate killing of HIV infected cells in the presence of completely unrelated cytotoxic T lymphocytes.
- Figure 1 is a schematic representation of the structure of a CD4 molecule and of a typical immunoglobulin chain exemplified by the ⁇ 1 antibody chain.
- CD4 and ⁇ 1 are shown in the first two lines of the Figure 1.
- the third line of Figure 1 shows the four immunoglobulin-like domains of CD4 as a separate soluble entity, as they can be prepared by techniques of recombinant engineering (soluble rCD4).
- the last two lines of Figure 1 show two fusion proteins formed by linking various CD4 domains to the constant region of the ⁇ 1 immunoglobulin chain.
- the first of these two representations, indicated by CD4 2 ⁇ 1 consists of the first two domains of CD4 linked to the constant region of ⁇ 1.
- the last line of the Figure, identified as CD4 2 ⁇ 1 shows a construct in which the first four domains of have been attached to the constant region of ⁇ 1.
- FIG. 2 is a schematic representation of a bispecific antibody.
- the left arm of the molecule consists of the fusion protein CD4 ⁇ 1 linked to ⁇ light chain by a disulfide bridge; the right arm consists of a ⁇ 1, ⁇ pair.
- the left arm binds to HIV gp120 of any strain.
- the right arm of the bispecific antibody binds to CD3, a component of the T cell receptor, and, thereby, activates the cytotoxic T cell.
- CD4.1, CD4.2, CD4.3, and CD4.4 are immunoglobulin-like domains of CD4; CH1, CH2, and CH3 are constant region domains of ⁇ 1 chains; VH is the variable region of ⁇ 1 heavy chain; VL is the variable region of ⁇ .
- Figure 3 is a series of schematic representations of autoradiographs.
- Positions 1, 2, and 3 indicate M-T301 immunoglobulin, bispecific antibody, and CD4 ⁇ 1, ⁇ tetramers, respectively.
- Lane 4 of Figure 3(c) was cut out and rerun under reducing conditions,
- (e) Transfectoma supernatant purified over an anti-CD4 column, electrophoresed non-reduced or after reduction,
- (f) Non-reduced material electrophoresed as in Figure 3(e) rerun under reducing conditions.
- Positions 1 and 2 indicate bispecific antibody and CD4 ⁇ 1, ⁇ dimers, respectively. Staining in 2(e) and 2(f) was with Commassie blue.
- bispecific molecules usually a modified form of antibodies, that direct cytotoxic T lymphocytes of any specificity to cells that express gp120.
- These bispecific molecules comprise an anti-T-cell- specific-antigen binding region and a CD4 region; e.g., one heavy/light chain pair from an antibody to a CD3 antigen linked to a heavy chain whose variable region has been replaced with sequences from CD4 plus a second light chain.
- CD3 is part of the antigen receptor on T cells and is responsible for signal transduction and is used throughout this specification as the exemplary (and preferred) cytotoxic-T-cell-specific antigen.
- T cells of irrelevant specificity effectively lyse HIV-infected cells, as shown by the examples below in which this cytotoxicity has been demonstrated.
- CD4 the anti-gp120 monoclonal antibody, which was strain-specific and, therefore, of limited therapeutic potential
- a CD4 derivative such as a CD4 ⁇ 1 chain
- the heavy antibody chain consists of the first four immunoglobulin-like domains of CD4 fused to the whole constant region of mouse ⁇ 1 chain. HIV cannot mutate out of the binding capability of CD4 without losing its ability to infect cells via their membrane CD4 molecule, so that this and other bispecs will be effective against any HIV strain.
- domain is used in this specification in the same manner as it is used in biochemistry to describe regions of molecules, usually proteins, that interact with other molecules or have other properties restricted to one (or more) region of the total molecule.
- a domain is simply a region of a molecule that is associated with a particular physical or chemical property, such as binding to another molecule. This region is generally but not always comprised of a single continuous segment of the amino acid sequence that makes up the total protein.
- a domain preferably refers to such a continuous segment.
- domain has come to have a more specialized meaning, namely one of the roughly spherical regions of an antibody chain that are linked to each other to form an immunoglobulin chain (or a similar region of another member of the immunoglobulin superfamily of molecules, such as CD4).
- the particular meaning of domain as used herein will be clear from the context, but generally domain is used in the broader sense defined above unless it is used to refer to one of the immunoglobulin (or immunoglobulin-like) regions of an antibody chain or CD4 molecule that is specifically referred to as a domain in the scientific literature.
- domain For exemplification of the meaning of domain as it is used in context of immunoglobulin and CD4 segments in the scientific literature, see the publications discussed in the
- the invention can be practiced with other molecules that are bispecific in the same manner as the antibodies described above.
- the immunoglobulin-like domains of a CD4 molecule can be linked to a molecule retaining its specificity for CD3 in any fashion, including using linkers (usually short polypeptide chains), to provide a bispec of the invention.
- a particularly preferred bispec is prepared as a fusion protein in which one end of the molecule is a CD4 domain or domains and the other end of the molecule is a binding region for CD3.
- Such molecules can readily be prepared as fused proteins by genetic engineering by linking coding regions together, such as the coding region for one or more domains of CD4 and the coding region for at least the binding region of one strand, preferably the heavy chain variable region, of an anti-CD3 antibody. Recent work has shown that single-stranded antibody chains retain specificity for their specific antigen
- a single-chain polypeptide of the invention can be prepared by linking together the coding regions for at least one CD4 variable region domain, for V H and V L , and for C ⁇ .
- the resuling single polypeptide will thus contain both V L and V H .
- Examples of molecules prepared in this manner are given below.
- a particularly preferred example, D-V H -V L -C ⁇ has been shown to be effective by colleagues of the present inventors.
- V H and V L are linked via a short peptide linker in order to provide sufficient flexibility for the antibody binding site to form.
- the CD4 domain can be attached directly to the N terminus of the V H domain.
- the CD4 domain has its leader sequence for secretion from mammalian cells, but the leader sequences of the V H and V L are not present.
- the C ⁇ region is retained in order to assist in folding and stability of the antibody part of the molecule, even if other deletions occur, as discussed in more detail below.
- Constructs that comprise entire antibody and CD4 domains are also preferred for ease of folding, expression, and genetic
- detectably labeled gp120 molecules can be used in a variety of well-known techniques to determine the ability of the CD4 portion of the molecule to bind gp120.
- detectably labeled CD3 antigen can be used to determine whether the anti-CD3 portion of the molecule retains its binding ability. If desired for higher binding affinity or greater specificity, a genetic construct can be prepared that encodes two proteins, one being the fused
- CD4/antibody chain e.g., with an antibody heavy chain
- the other being the remaining anti-CD3 antibody chain (e.g., the light chain).
- Expression of the two proteins concurrently will result in assembly of the light and heavy chains to form one light/heavy chain pair (i.e., one arm of an antibody against CD3) with the CD4 domain being attached to one of the antibody chains.
- the antibody binding domain When assembled in this fashion, it is preferred to have the antibody binding domain at the N terminus of the fused molecule and (in some embodiments) to include at least part of the constant region of the two antibody chains for ease of post-expression assembly.
- other embodiments eliminate all or part of one or more constant region domains, as discussed in more detail below, in order to eliminate undesired binding of the antibody Fc region to other cells and/or molecules.
- the CD4 region is normally attached in such constructs at the C terminus, although the alternative order can occur as well.
- Such genetic constructs are prepared in the same manner as is described in detail below for the production of bispecific antibodies of the invention except for the order and/or selection of the segments that are spliced together.
- Another preferred embodiment uses the concept described by Ward et al., Nature, 341:544 (1989), in which single antibody chains are prepared that retain binding specificity, where the first or the first two domains of the heavy chain are linked by a peptide bridge to the first domain of or the complete light chain.
- the resulting single antibody chain can be readily fused to a CD4 domain or domains as described herein, using, in preferred embodiments, the same linking groups to attach the two antibody variable regions.
- the resulting single-chain protein which is readily produced by genetic engineering and expression, has a structure such as D-V L -V H -C ⁇ , D-V H -V L -C ⁇ , D-V H -V L -C ⁇ , V H -V L -C ⁇ -D, V L -V H -C ⁇ -D, V H -V L -C ⁇ -D, and other similar combinations in which a portion (D) of CD4 that retains its binding affinity for gp120 is fused to variable (V; heavy and light chains) and constant (C) domains of an anti-CD3 antibody.
- Preferred fusions have a CD4 domain or domains at one terminus of the polypeptide chain and the antibody domains at the other terminus. Additional amino acids can be present in central portions of the polypeptide (i.e., between CD4 and antibody domains) without adversely affecting binding affinities.
- Bispecs of the invention can readily be prepared using existing sources of genetic material encoding the indicated specific molecules. However, the invention also encompasses variations derived from the original material that has been modified by techniques of genetic and protein engineering to provide additional desirable properties in the resulting bispecs. Those bispecs that have the same amino acid sequence (in their relevant portions) as can be found in naturally occurring CD4 and anti-CD3 molecules are referred to herein as
- Naturally-sequence bispecs This invention, however, is also concerned with amino acid sequence variants of natural-sequence bispecs.
- Amino acid sequence variants of bispecs are prepared with various objectives in mind, including increasing the affinity of the bispec for its binding partner, facilitating the stability, purification and preparation of the bispec, increasing its plasma half life, improving therapeutic efficacy as described above in the background, introducing additional functionalities and lessening the severity or occurrence of side effects during therapeutic use of the bispec.
- Amino acid sequence variants of bispecs fall into one or a combination of insertional, substitutional, and deletional variants, as will be discussed in detail below.
- CD4 immunoglobulin-like domains which may be homologous either to the constant or to the variable region domains, or any other fragment of CD4 (as long as the CD4 sequence retains its ability to bind gp120) is conjugated with an immunoglobulin constant region sequence.
- Immunoglobulins and certain variants thereof are known and many have been prepared in recombinant cell culture. For example, see U.S. Patent 4,745,055; EP 256,654; Faulkner et al., Nature 298:286 (1982); EP 120,694; EP 125,023; Morrison, J. Immun. 123:793 (1979); Kohler et al., P.N.A.S.
- the domains of CD4 that are homologous to immunoglobulins and extracellular in their native environment are fused C-terminally to the N-terminus of the constant region of immunoglobulins in place of the variable region(s) thereof, retaining at least functionally active hinge, CH2 and CH3 domains of the constant region of an immunoglobulin heavy chain.
- This ordinarily is accomplished by constructing the appropriate DNA sequence and expressing it in recombinant cell culture.
- Immunoglobulins and other polypeptides having enhanced plasma half life are fused to the extracellular or ligand binding domains of other CD4 variants in the same fashion.
- the boundary domains for the CD4 V-like regions are, respectively, about 100-109, about 175-184, about 289-298, and about 360-369 (based on the precursor CD4 amino acid sequence in which the initiating met is -25).
- the CD4 sequence which is well known to those familiar with HIV infections and the CD4 molecule, see Figures 1 and 2 of PCT application US 88/03414 published under the International Publication No. WO
- CD4 sequences containing any of the CD4 domains involved in binding to gp120 are fused to the immunoglobulin sequence. It is preferable that V1V2 or V1V2V3V4 be fused at its C-terminus to the immunoglobulin constant region.
- the precise site at which the fusion is made is not critical; the boundary domains noted herein are for guidance only and other sites neighboring or within the V regions may be selected in order to optimize the secretion or binding characteristics of the CD4. The optimal site will be determined by routine experimentation.
- the fusions are generally expressed intracellularly, but a great deal of variation is encountered in the degree of secretion of the fusions from recombinant hosts.
- Table 1 shows various CD4 immunoglobulin fusions that were obtained in PCT/US88/03414. These immunoglobulin chains were referred as "immuno- adhesons," and this terminology is retained here to refer to single antibody chains consisting of one or more CD4 domains linked to the constant region of an immunoglobulin chain. In all of these examples of CD4 immunoadhesons, the CD4 signal was used to direct secretion from 293 cells.
- CD4 immunoadhesons typically contained either the first N-terminal 366 residues of CD4 (CD4 4 ) or the first 180 N-terminal residues of CD4 (CD4 2 ) linked at their C-terminus to the ⁇ (light) chain or IgG1 heavy chain constant region ( ⁇ 1).
- CD4/human-heavy-chain immunoadheson was secreted as a dimer whereas the analogous murine construction was not detected (this does not exclude the intracellular accumulation of the protein, however).
- CD4-IgG immunoadheson chimeras are readily secreted wherein the CD4 epitope is present fused to one or more light or heavy chains, including heterotetramers wherein up to and including all four variable region analogues are derived from CD4.
- a heterofunctional antibody thus is provided.
- the heterofunctional antibody is a bispec when the separate heavy-light chain is obtained from an anti-CD3 antibody.
- Such antibodies are available commercially, as are hybridomas that contain genetic information encoding anti-CD3 antibodies. Additionally, production of new anti-CD3-producing cell lines can readily be accomplished by routine immunological techniques.
- exemplary hetero- and chimeric bispecific antibodies produced in accordance with this invention are schematically diagrammed below.
- “D” means at least a portion of the extracellular domain of CD4 containing its ligand binding site;
- V L , V H , C L and C H represent light or heavy chain variable or constant domains of an immunoglobulin;
- n is an integer; and
- Y designates a covalent cross-linking moiety.
- the structures in this list of formulas show only key features; e.g., they do not show joining (J) or other domains of the immunoglobulins, nor are disulfide bonds shown. These are omitted in the interests of brevity. However, where such domains are required for binding activity they shall be construed as being present in the ordinary locations which they occupy in the CD4, bispec, or immunoglobulin molecules as the case may be. These examples are representative of divalent antibodies; more complex structures would result by employing immunoglobulin heavy chain sequences from other classes, e.g., IgM.
- the immunoglobulin V L V H antibody combining site also designated as the companion immunoglobulin, preferably is capable of binding to a predetermined antigen. Suitable companion immunoglobulin combining sites and fusion partners are obtained from IgG-1, -2, -3, or -4 subtypes, IgA, IgE, IgD or IgM.
- a preferred embodiment of a fused CD4/immunoglobulin chain for use in preparing a bispec of the invention is a fusion of an N-terminal portion of CD4, which contains the binding site for the gp120 envelope protein of HIV, to the C-terminal F c portion of an antibody, containing the effector functions of immunoglobulin G 1 .
- those variants in which one or more immunoglobulin-like domains of CD4 are substituted for the variable region of an immunoglobulin chain are useful in preparing bispecs of the invention.
- These chimeras are constructed in a fashion similar to chimeric antibodies in which a variable domain from an antibody of one species is substituted for the variable domain of another species. See, for example, EP 0 125 023; Munro, Nature 312:
- the DNA encoding the CD4 immunoglobulin-like domain(s) is cleaved by a restriction enzyme at or proximal to the 3' end of the DNA encoding the immunoglobulin-like domain(s) and at a point at or near the DNA encoding the N-terminal end of the mature CD4 polypeptide (where use of a different leader is contemplated) or at or proximal to the N-terminal coding region for CD4 (where the native CD4 signal is employed).
- This DNA fragment then is readily inserted into DNA encoding an
- immunoglobulin light or heavy chain constant region and, if necessary, tailored by deletional mutagenesis.
- this is a human immunoglobulin when the variant is intended for in vivo therapy for humans.
- immunoglobulin light or heavy chain constant regions is known or readily available from cDNA libraries or is synthesized. See for example, Adams et al.,
- DNA encoding the immunoglobulin or immunoadheson chimeric chain(s) is transfected into a host cell for expression. If the host cell is producing an immunoglobulin prior to transfection, then one need only transfect with the CD4 domains fused to light or to heavy chain to produce a heteroantibody.
- the aforementioned immunoglublins having one or more arms bearing the CD4 domain and one or more arms bearing companion variable regions specific for CD3 result in dual specificity for gp120 of any source and for a CD3 antigen.
- F(ab') 2 fragments of the adheson fusion and an immunoglobulin are prepared, the F(ab') 2 fragments converted to Fab' fragments by reduction under mild reducing conditions, and then reoxidized in each other's presence under acidic conditions in accord with methods known per se. See also
- heteroantibodies from immunoglobulins having different specificities can be adopted for the in vitro production of bispecs by simply substituting the CD4-containing chains for one of the previously employed immunoglobulins.
- host cells producing a CD4-immunoglobulin fusion e.g., transfected myelomas
- B cells or hybridomas which secrete antibody having the desired companion specificity for CD3 antigen also are fused with B cells or hybridomas which secrete antibody having the desired companion specificity for CD3 antigen.
- Heterobifunctional antibody is recovered from the culture medium of such hybridomas, and thus can be produced somewhat more conveniently than by conventional in vitro resorting methods (EP 68,763).
- the present invention contemplates not only natural-sequence bispecs, but variants in which there have been single, multiple, or combinations of insertions, deletions, and/or substitutions of amino acids in the naturally derived sequences.
- Insertional amino acid sequence variants are those in which one or more amino acid residues extraneous to the bispec are introduced into a predetermined site in the bispec including the C or N terminus of any polypeptide chain.
- Such variants, particularly when the insertions are lengthy, are referred to as fusions of the bispec and a different polypeptide.
- Such fusions contain sequences other than those which are normally found in the bispec at the inserted position.
- Another class of bispec variants comprises deletional variants.
- Deletions are characterized by the removal of one or more amino acid residues from a given sequence.
- CD4 are deleted. When such deletions are desired in the case of CD4, at least residues 368 to 395 (the transmembrane region), and ordinarily 396-433 as well (the cytoplasmic domain), will be deleted.
- Another preferred deletion is one which reduces or eliminates the ability of CD4 to bind to MHC class ⁇ antigens.
- the amino acid residues associated with binding are numbers 19, 89, and 165 of the CD4 molecule.
- CD4 deletions affecting MHC class II antigen binding with a CD4 molecule is described in Fleury et al., Cell 66: 1037.
- a preferred class of compounds encompasses bispecs derived from antibodies in which the binding region for Fc receptor is deleted or modified to reduce undesired binding.
- Such deletions can be of one or more entire domains of the Fc region or can a deletion or mutation of part of a domain or even a single amino acid.
- a preferred mutation would be to change residue 235 of IgG from leu to glu, as demonstrated and described in Alegre et al., J. Immunol. 148:3461.
- the CH2 domain which is the domain that interacts the Fc receptor, should be deleted. Whether or not any given deletion results in a bispec with the desired binding properties can readily be tested using the procedures described in the following examples to determine whether the resulting molecule is capable of directing cytotoxic T cells to HIV-infected cells.
- Substitutional variants are those in which at least one residue in a sequence has been removed and a different residue inserted in its place.
- the native N-terminal residue for mature CD4 is now known to be lysine.
- the normal sequence shown in Figure 1 of PCT/US88/03414, with an N-terminal asparagine is an amino acid sequence variant of native mature CD4.
- Table 2 below describes substitutions which in general will result in fine modulation of the characteristics of the CD4 antigen or anti-CD3 binding region.
- substitutions that are less conservative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain.
- the substitutions which in general are expected to produce the greatest changes in adheson properties will be those in which (a) a hydrophilic residue, e.g., seryl or threonly, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl,
- a cysteinyl or prolyl is substituted for (or by) any other residue
- a residue having an electropositive side chain e.g., lysyl, arginyl, or histidyl
- an electronegative residue e.g., glutamyl or aspartyl
- a residue having a bulky side chain e.g.,
- phenylalanyl is substituted for (or by) one not having a side chain, e.g., glycyl.
- variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the CD4 or anti-CD3 molecules, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture.
- variant bispecs also are prepared by in vitro synthesis. Obviously, variations made in the DNA encoding the variant bispecs must not place the sequence out of reading from and preferably will not create complementary regions that could produce secondary mRNA structure deleterious to expression (EP 75 444 A).
- the CD4-derived region or regions of the variants typically exhibit the same gp120 binding activity as does the naturally occurring prototype, although variants also are selected in order to modify the characteristics of the CD4 adheson as indicated above.
- the regions of the CD4 molecule that are responsible for binding to class II major histocompatibility antigen (MHC) can be deleted in order to eliminate binding to undesired locations in vivo. Similar considerations exist for the anti-CD3 region or regions.
- the mutation per se need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random
- mutagenesis may be conducted at the target codon or region and the expressed adheson variants screened for the optimal combination of desired activities.
- substitution mutations are predetermined sites in DNA having a known sequence are well known, for example M13 primer mutagenesis.
- CD4 The DNA encoding CD4 is obtained by known procedures. See Williams, Immunol. Today 8:298-303 (1987) and citations therein. In general, prokaryotes are used for cloning of CD4 variant DNA sequences.
- E. coli strain SR101 for propagating ml3 phage, a ⁇ -resistant strain of JM 101; Messing et al., Nucl. Acids. Res. 9(2):309-321 [1981]
- E. coli K12 strain 294 ATCC No. 31446) are particularly useful.
- Other microbial strains which may be used include E. coli B, UM101 and E. coli ⁇ 1776 (ATCC No. 31537). These examples are illustrative rather than limiting.
- DNA encoding the various constructs used in preparing polypeptides of the invention is inserted for expression into vectors containing promoters and control sequences which are derived from species compatible with the intended host cell.
- the vector will ordinarily, but need not, carry a replication site as well as one or more marker sequences which are capable of providing phenotypic selection in transformed cells.
- E. coli is typically transformed using a derivative of pBR322 which is a plasmid derived from an E. coli species
- pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells.
- the pBR322 plasmid, or other microbial plasmid must also contain or be modified to contain promoters and other control elements commonly used in recombinant DNA constructions.
- Promoters suitable for use with prokaryotic hosts illustratively include the ⁇ -lactamase and lactose promoter systems (Chang et al., Nature
- eukaryotic microbes such as yeast cultures also are useful as cloning or expression hosts.
- Saccharomyces cerevisiae. or common baker's yeast is the most commonly used eukaryotic microorganism, although a number of other strains are commonly available.
- the plasmid YRp7 for example, (Stinchcomb et al., Nature
- This plasmid already contains the trp1 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics
- Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem.
- glycolytic enzymes Hess et al., J. Adv. Enzyme Reg. 7:149 [1968]; and Holland, Biochemistry 17:4900 [1978]
- enolase glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
- yeast promoters which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid
- yeast promoters for use in yeast expression are further described in R. Hitzeman et al. , European Patent Publication No. 73,657A. Yeast enhancers also are advantageously used with yeast promoters.
- Promoters for controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters of the S V40 virus are conveniently obtained as an S V40 restriction fragment which also contains the SV40 viral origin of replication. Fiers et al., Nature 273:113 (1978). The immediate early promoter of the human cytomegalovirus is conveniently obtained as a HindIII E restriction fragment. Greenaway, P.J. et al., Gene 18:355-360 (1982). Of course, promoters from the host cell or related species also are useful herein.
- viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus,
- Enhancers are cis acting elements of DNA, usually from about 10 to 300bp, that act to increase the transcription initiation capability of a promoter. Enhancers are relatively orientation ad position independent having been found 5' (Laurrins, L. et al., Proc. Natl. Acid. Sci. 78:993 [1981]) and 3' (Lusky, MX., et al., Mol. Cell Bio.
- enhancer sequences are now known from mammalian genes (globin, elastase, albumin, ⁇ -fetoprotein and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the
- cytomegalovirus early promoter enhancer the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
- Expression vectors used in eukaryotic host cells may also contain sequences necessary for the termination of transcription which may affect mRNA expression.
- Selection gene also termed a selectable marker.
- suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase or neomycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure.
- DHFR dihydrofolate reductase
- thymidine kinase thymidine kinase
- neomycin thymidine kinase
- CHO DHFR cells and mouse LTK cells. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented medium.
- supplementing the medium is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non supplemented media.
- the second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell.
- Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection.
- Examples of such dominant selection use the drugs neomycin, Southern P. and Berg, P., J. Molec. Appl. Genet. 1:327 (1982), mycophenolic acid, Mulligan, R.C. and Berg, P., Science 209:1422 (1980) or hygromycin, Sugden, B. et al., Mol. Cell, Bio. 5:410-413 (1985).
- the three examples given above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively.
- Amplification refers to the increase or replication of an isolated region within a cell's chromosomal DNA. Amplification is achieved using a selection agent e.g, methotrexate (MTX) which inactivates DHFR. Amplications for the making of successive copies of the DHFR gene results in greater amounts of DHFR being produced in the face of greater amounts of MTX. Amplification pressure is applied notwithstanding the presence of endogenous DHFR, by adding ever greater amounts of MTX to the media. Amplification of desired gene can be achieved by cotransfecting a mammalian host cell with a plasmid having a DNA encoding a desired protein and the DHFR or amplification gene permitting cointegration.
- MTX methotrexate
- the result is that increased copies of the gene, i.e., an amplified gene, encoding the desired heterologous protein express more of the desired heterologous protein.
- Preferred host cells for expressing the CD antigen variants of this invention are mammalian cell lines, examples including: monkey kidney CF1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic M ney line (293, Graham, F.L. et al., J. Gen. Virol. 16:59 [1977] and 2938 cells [293 subclones selected for better suspension growth]); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary-cells-DHFR (CHO, Urlaub and Chas ⁇ n, Proc. Natl. Acad. Sci. USA 17:4216, [1980]); mouse sertoli cells (TM4,
- human cervical carcinoma cells HELA, ATCC CCL2
- canine ki ney cells MM K, ATCC CCL 34
- buffalo rat liver cells BRL 3A, ATCC CRL 1442
- human lung cells W138, ATCC CCL 75
- human liver cells Hep G2, HB 8065
- mouse mammary tumor MMT 060562, ATCC CCL51 cells
- TRI cells TRI cells
- Transformation means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integration.
- One suitable for transformation of the host cells is the method of
- Plasmids containing the desired coding and control sequences employ standard and manipulative ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and relegated in the form desired to form the plasmids required. Suitable procedures are well known for the construction described herein. See, for example, (Maniatis, T. et al., Molecular Cloning, 133-134 Cold Spring Harbor, [1982]; "Current Protocols in Molecular Biology,” edited by Ausubel et al., [1987], publ. by Greene Publishing Associates & Wiley-Interscience).
- Host cells are transformed with the expression vectors of this invention. Thereafter they are cultured in appropriate culture media, e.g., containing substances for inducing promoters, selecting transformants or amplifying genes.
- appropriate culture media e.g., containing substances for inducing promoters, selecting transformants or amplifying genes.
- the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
- the secreted polypeptides are recovered and purified from the culture supernatants or lysates of recombinant hosts.
- the supernatants are concentrated by ultrafiltration, contacted with a ligand affinity or immunoaffinity matrix so as to adsorb the adheson variant, and eluted from the matrix.
- the bispec or adheson is purified by ion exchange chromatography.
- the purified bispec is formulated into conventional
- pharmacologically acceptable excipients It is admimstered to patients having HIV infection at a dosage capable of maintaining a concentration of greater than about 100 ng of soluble bispec/ml plasma.
- soluble bispec/ml plasma For variants having different molecular weights, about 2 picomoles of soluble receptor per ml of plasma will be initially evaluated clinically in order to establish a stoichiometric equivalence with native (membrane bound) and soluble receptor.
- the ordinary initial dosage of a bispec is 100 ⁇ g/kg of patient weight/day. This initial dosage can be adjusted either upward or downward depending on the effects of the initial dosage.
- a composition of the invention for use in vivo generally will contain a pharmaceutically acceptable carrier.
- a pharmaceutically acceptable carrier By this is intended either solid or liquid material, which may inorganic or organic and of synthetic or natural origin, with which the active component of the composition is mixed or formulated to facilitate administration to a subject.
- Inert materials in pharmaceutical compositions are also called excipients. Any other materials customarily employed in formulating pharmaceutical are suitable.
- Solid carriers include natural and synthetic cloisonne silicates, for example natural silicates such as diatomaceous earths; magnesium silicates, for example, talcs; magnesium aluminum silicates, for example attapulgites and vermiculites; aluminum silicates, for example kaolinites, montinorillonites, and micas; calcium carbonates; calcium sulfate; synthetic hydrated silicone oxides and synthetic calcium or aluminum silicates; elements such as carbon or sulfur; natural and synthetic resin such as polyvinyl alcohol; and waxes such as parafan and beeswax.
- suitable liquid carriers include water and aqueous solutions containing oxygenated organic compounds such as ethanol.
- the therapeutic bispec can be employed by itself or with other therapies and agents for the treatment of AIDS, including AZT, neutralizing antibodies, immunocytotoxins, and vaccines.
- Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
- the starting plasmids herein are either commercially available, publicly available, publicly available on a restricted basis, or can be constructed from available plasmids in accord with published
- “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
- the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
- For analytical purposes typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
- For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
- Recovery or “isolation” of a given fragment of DNA form a restriction digest means separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA.
- This procedure is known generally (Lawn, R. et al., Nucelic Acids Res. 9:6103-6114 [1981], and Goeddel, D. et al., Nucleic Acids Res.
- Dephosphorylation refers to the removal of the terminal 5' phosphates by treatment with bacterial alkaline phosphatase (BAP). This procedure prevents the two restriction cleaved ends of a DNA fragment from "circularizing” or forming a closed loop that would impede insertion of another DNA fragment at the restriction site. Procedures and reagents for
- Reactions using BAP are carried out in 50mM Tris at 68°C to suppress the activity of any exonuclease which may be present in the enzyme preparations. Reactions were run for 1 hours. Following the reaction the DNA fragment is gel purified.
- “Ligation” refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (maniatis, T. et al., Id. at
- ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
- ligase T4 DNA ligase
- “Filling” or “blunting” refers to the procedures by which the single stranded end in the cohesive terminus of a restriction enzyme-cleaved nucleic acid is converted to a double strand. This eliminates the cohesive terminus and forms a blunt end. This process is a versatile tool for converting a restriction cut end that may be cohesive with the ends created by only one or a few other restriction enzymes into a terminus compatible with any blunt-cutting restriction endonuclease or other filled cohesive terminus.
- blunting is accomplished by incubating 2-15 ⁇ g of the target DNA in 10mM MgCl 2 , 1mM dithiothreitol, 50mM NaCl, 10mM Tris (pH 7.5) buffer at about 37°C in the presence of 8 units of the Klenow fragment of DNA polymerase I and 250 ⁇ M of each of the four deoxynucleoside triphosphates.
- the incubation generally is terminated after 30 min. phenol and chloroform extraction and ethanol precipitation.
- Examples 1-4 are prior examples published in PCT/US88/03414 which show preparation of antibody/CD4 fusions that can be used to prepare bispecs of the invention, such as those described in Example 5.
- Example 1 is prior examples published in PCT/US88/03414 which show preparation of antibody/CD4 fusions that can be used to prepare bispecs of the invention, such as those described in Example 5.
- Example 1 is prior examples published in PCT/US88/03414 which show preparation of antibody/CD4 fusions that can be used to prepare bispecs of the invention, such as those described in Example 5.
- the plasmid used for recombinant synthesis of human CD4 was pSVeCD4DHFR.
- the plasmid was constructed as follows:
- XCD4P1 containing most of the coding sequence of human CD4 was digested with
- pUC18 was digested with EcoRI and the single fragment recovered by polyacrylamide gel electrophoresis (Fragment 2). Fragment 1 was ligated to fragment 2 and the ligation mixture transformed into E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the correct DNA fragments. This plasmid is referred to as pUCD4.
- pSVeE'DHFR (Muesing et al., Cell 48:691-701 [1987]) was digested with KpnI and BamHI and blunted with E. coli DNA polymerase I
- Fragment 3 containing the pML-Amp r region, SV40 early promoter, the HIV LTR, and the mouse DHFR gene was recovered by gel electrophoresis, ligated and the ligation mixture transformed into E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the BamHI restriction site and the absence of the KpnI restriction site. This plasmid is referred to as pSVe ⁇ BKDHFR and allows EcoRI-BamHI fragments to be inserted after the SV40 early promoter and transcribed under its control, following transfection into an appropriate cell line.
- Synthetic oligonucleotides (adaptors 1-8, below) were made to extend from 76 bp 5' of the initiation codon of CD4 translation to the RaaI restriction site at 121 bp 3' of the initiator, with the sequence AATT at the 5' end of the sense strand t generate an end which could ligate to an EcoRI restriction fragment. These oligonucleotides were ligated and the 204 bp fragment containing the entire sequence recovered by gel electrophoresis (Fragment 4).
- CD4 adaptor 1 AATTCAAGCCCAGAGCCCTGCCATTTCTGTGGGCTC
- AGGTCCCT CD4 adaptor 2 pACTGCTCAGCCCCTTCCTCCCTCGGCAAGGCCACA
- CD4 adaptor 3 pCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGCG
- CTCCTCCCAGC CD4 adaptor 4 pAGCCACTCAGGGAAACAAAGTGGTGCTGGGCAAAA
- AGGGGATACAGTGGAAGTGACCTGT CD4 adaptor 5 pACAGGTCAGTTCCACTGTATCCCCTTTTTTGCCCAG
- CACCACTTTGTTTCC CD4 adaptor 6 pCTGAGTGGCTGCTGGGAGGAGCGCCAGTTGCAGCA
- CCAGAAGCAAGT CD4 adaptor 7 pGCCTAAAAGGGACTCCCCGGTTCATTGTGGCCTTG
- CGAGGGAGGAAGGG CD4 adaptor 8 GCTGAGCAGTAGGGACCTGAGCCCACAGAAATGGCAGG
- pUCCD4 was digested with RsaI and SstI and the 401 bp fragment containing part of the CD4 coding sequence recovered by gel electrophoresis (Fragment 5).
- pUC18 was digested with EcoRI and SstI and the fragment comprising the bulk of the plasmid recovered by gel electrophoresis (Fragment 6).
- Fragments 4 and 5 were ligated to Fragment 6 and the ligation mixture
- E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the correct fragment. The sequence of the inserted synthetic DNA was checked by excising the 605 bp EcoRI-SstI fragments from several transformants and ligating them to M13mp19 which had been digested with the same enzymes. After transformation into E. coli strain JM101, single-stranded DNA was prepared and sequenced. One plasmid which contained the correct sequence was selected, and is referred to as pCD4int.
- pCD4int was digested with EcoRI and SstI and fragment 7 containing the 5' end of the CD4 coding region was recovered by gel
- pUCCD4 was digested with SstI and BamHI and the 1139 bp fragment containing the remainder of the CD4 coding region (fragment 8)
- pSVe ⁇ BKDHFR was digested with EcoRI and BamHI and fragment 9 comprising the bulk of the plasmid was isolated. Fragments 7, 8, and 9 were ligated and the ligation mixture transformed into E. coli strain 294. The
- Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the correct fragment. This plasmid is referred to as pSVeCD4DHFR, and was used to direct synthesis of recombinant intact CD4.
- Synthetic DNA is made to code for the C region of human ⁇ chain (residues 109-214) based on the sequence published by Morin et al., Proc. Natl.
- pRKCD4 is digested with EcoRI and BspMI and the 478bp fragment containing the region coding for the putative V-like domain of CD4 is recovered (fragment 34). Fragments 33 and 34 are ligated together with fragment 16 (from the expression vector pRK5). The ligation mixture is transformed into E. coli strain 294, the transformed culture plated on ampicillin media plates and resistant colonies selected. Plasmid DNA is prepared from transformants and checked by restriction analysis for the presence of the correct fragment. The resulting plasmid is referred to as pRKCD4Ck.
- a plasmid encoding a fusion of the CD4 V-like domain to the human immunoglobulin C ⁇ 2 region is constructed in a similar fashion, and is referred to as pRKCD4C ⁇ 2. Both of these plasmids are transfected into 293 cells, myeloma cells or other competent cells in order to obtain cell lines expressing variant CD4 molecules as described above.
- Plasmids were constructed to direct the expression of proteins containing differing lengths of the ammo-terminal, extracellular domain of CD4 fused to the constant region of human immunoglobulin ⁇ 1. These plasmids are referred to as pRKCD4 2 ⁇ 1 , pRKCD4 e4 ⁇ 1 , pRKCD4 2 ⁇ 1 , PRKCD4 1 , and pRKCD4 el ⁇ 1 .
- Plasmid pRKCD4 4 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for serine reside 366 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
- Plasmid pRKCD4 e4 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for lysine residue 360 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
- Plasmid pRKCD4 2 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for glutamine residue 180 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
- Plasmid pRKCD4 e2 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for leucine residue 117 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
- Plasmid pRKCD4 1 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for aspartic acid residue 105 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
- Plasmid pRKCD4 e1 ⁇ 1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for leucine residue 100 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin ⁇ 1, starting at the codon for serine residue 114 of mature human immunoglobulin ⁇ 1 (Kabat et al.).
- a cDNA clone coding for human immunoglobulin ⁇ 1 was obtained from a human spleen cDNA library (Clontech Laboratories, Ine.) using oligonucleotides based on the published sequence (Ellison et al., Nucl. Acids Res. 10:4071-4079 [1982]), and an EcoRI-EagI fragment (the EcpRI site was contributed by a linker; see Figure 4a and b of PCT/US88/03414) containing part of the variable and all of the constant region was obtained. This fragment was blunted with Klenow fragment, and recovered by gel electrophoresis (Fragment al).
- Plasmid pRKCD4TP-kk encoding a substitutional variant of soluble CD4 (residues 1-368) containing a lysine residue instead of asparagine at position
- Plasmid pRKCD4TP was transformed into E. coli strain SR101 and the transformed colonies plated on ampicillin media plates. Resistant colonies were selected and grown in the presence of m13K07 helper bacteriophage to yield secreted, encapsidated single-stranded templates of pRKCD4TP. The single-stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers. The mutagenesis reaction was transformed E. coli SR101 and the transformed culture plated on ampicillin media plates. Transformants were screened by colony hybridization (ref . Grunstein-Hogness) for the presence of the appropriate sequence, using the following 16 mer as the probe.
- hybridization conditions chosen were sufficiently stringent that the probe only detects the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain SR101. The transformed cultures were plated on ampicillin media plates, and resistant colonies were selected and grown in the presence of m13K07 bacteriophage. Templates were prepared as above and screened by sequencing.
- Plasmid pRKCD4TP-kk was digested with Xbal and treated with
- Klenow Enzyme, and Fragment a2 containing the linearized plasmid was recovered by gel electrophoresis, and ligated with fragment al.
- the ligation mixture as transformed into E. coli strain 294, the transformed culture plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from the transformants and checked by restriction analysis for the presence of the correct fragment in the correct orientation (i.e., the
- This plasmid is referred to as pRKCD4TP/ ⁇ 1.
- Synthetic oligonucleotides were made as primers for deletional mutagenesis reactions to fuse the appropriate coding sequence of IgG1 and CD4 as described above. These were synthesized as 48-mers comprising 24 nucleotides on each side of the desired fusion site (i.e., corresponding to the COOH-terminal 8 residues of the desired immunoglobulin moiety). Plasmid pRKCD4TP/ ⁇ 1 was transformed into E. coli strain SR101 and the transformed cultures plated on ampicillin media plates. Resistant colonies were selected and grown in the presence of ml3K07 helper bacteriophage to yield secreted, encapsidated single-stranded templates of pRKCD4TP/ ⁇ 1.
- the single-stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers.
- the mutagenesis reactions were transformed E. coli SR101 and the transformed culture plated on ampicillin media plates. Transformants were screened by colony hybridization (ref. Grunstein- Hogness) for the presence of the appropriate fusion site, using l ⁇ mers as probes. These l ⁇ mers comprise 8 bases on either side of the fusion site, and the hybridization conditions chosen were sufficiently stringent that the probes only detect the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain SR101. The transformed cultures were plated on ampicillin media plates, and resistant colonies were selected and grown in the presence of m13K07 bacteriophage. Templates were prepared as above and screened by sequencing.
- the plasmids were transfected into 293 cells using standard procedures and assayed for expression and production as described above.
- PRKCD4 4 ⁇ 1 + + Plasmids also were constructed to direct the expression of fusion proteins containing differing lengths of the ammo-terminal, extracellular domain of CD4 fused to the truncated portion of the constant region of human
- immunoglobulin ⁇ 1 comprising only the hind region and constant domains CH 2 and CH 3 .
- Synthetic oligonucleotides were made as primers for mutagenesis reactions to delete the immunoglobulin sequence from Ser114 to Cys215 inclusive (Kabat et al.). These were synthesized as 48-mers comprising 24 nucleotides on each side of the desired fusion site (i.e., corresponding to the COOH-terminal 8 residues of the desired CD4 moiety, and the NH 2 -terminal 8 residues of the desired immunoglobulin moiety). Plasmids pRKCD4 4 ⁇ 1 , pRKCD4 2 ⁇ and the transformed culture plated on ampicillin media plates.
- Resistant colonies were selected and grown in the presence of m13K07 helper bacteriophage to yieldd secreted, encapsidated single-stranded templates of these plasmids.
- the single- stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers.
- the mutagenesis reactions were transformed E. coli SR101 and the transformed culture plated on ampicillin media plates.
- Transformants were screened by colony hybridization (Grunstein-Hogness) for the presence of the appropriate fusion sites, using 16mers as probes. These 16mers comprise 8 bases on either side of the fusion site, and the hybridization conditions chosen were sufficiently stringent that the probes only detect the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain
- Templates were prepared as above and screened by sequencing.
- pRKCD4 rFc1 The plasmid derived from plasmid pRKCD4 4 ⁇ 1 is referred to as pRKCD4 rFc1 , that derived from plasmid pRKCD4 2 ⁇ 1 is referred to as
- pRKCD4 2Fcl and that derived from plasmid pRKCD4 1 ⁇ 1 is referred to as pRKCD4 1Fc1 .
- pRKCD4 2Fc1 , pRKCD4 1Fc1 and PRKCD4 4Fc1 are cultured in the same fashion as described above and CHI-deleted CD4 immunoadhesons recovered as described elsewhere herein.
- Plasmids were constructed to direct the expression of proteins containing differing lengths of the amino terminal, extracellular domain of CD4 fused to the constant region of human immunoglobulin JC. These plasmids are referred to as pRKCD4 4 ⁇ , and pRKCD4 e4 ⁇ .
- Plasmid pRKCD4 4 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for serine residue 366 of the mature CD4 polypeptide, immediately followed by the sequence for the constant region of human immunoglobulin ⁇ , starting at the codon for threonine residue 109 of the mature human immunoglobulin ⁇ .
- Plasmid pRKCD4 e4 ⁇ contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for lysine residue 360 of the mature CD4 polypeptide, immediately followed by the sequence for the constant region of human immunoglobulin JC, starting at the codon for threonine residue 109 of the mature human immunoglobulin JC. (Kabat et al.)
- plasmids were constructed in a manner analogous to plasmids pRKCD4 4 ⁇ 1 and pRKCD4 e4 ⁇ 1 described above, with the following exception:
- PCT/US88/034144 was obtained from a human spleen cDNA library (Clontech Laboratories, Inc.) using oligonucleotides based on the published sequence (Hieter,
- Plasmids were or are constructed to direct the expression of the immunoadhesons described above in CHO cells. These are referred to as pSVeCD4 4 ⁇ SVDHFR, pSVeCD4 2 ⁇ 1 SVDHFR, pSVeCD4 1 ⁇ SVDHFR,
- Fragment 31 was prepared as described above.
- Fragment 32a was prepared by digesting plasmid pE348HBV.E400 D22 with BamHI, blunting with
- pRKCD4 1 ⁇ 1 , pRKCD4 e4 ⁇ 1 , pRKCD4 e2 ⁇ 1 , pRKCD4 e1 ⁇ 1 , pRKCD4 4Fc1 , pRKCD4 2FC1 , pRKCD4 4 ⁇ and pRKCD4 2 ⁇ were separately digested with HindIII, blunted with Klenow fragment and the four dNTPs, then digested with EcoRI and the fragments encoding the CD4-Ig fusion protein were isolated. The resulting DNA fragments were ligated together with fragments 31 and 32a and transformed into E. coli strain 294. Colonies were selected and checked for the presence of the correct plasmid as above, then transferred into CHO cells and amplified by methotrexate selection using conventional procedures.
- Plasmids encoding soluble CD4 immunoadhesons were calcium phosphate transfected into CHO-DP7 (a proinsulin-transformed autocrine host cell derived from CHO; U.S.S.N. 97,472) and the transformants grown in selective medium (1:1 HAM F12/DMEM GHT containing 1-10% diafiltered or dialyzed bovine serum).
- CHO-DP7 a proinsulin-transformed autocrine host cell derived from CHO; U.S.S.N. 97,472
- Other suitable host cells are CHO cells or 293S human embryonic kidney cells. The transformants were amplified by methotrexate.
- the plasmid that was integrated in the genome of the transfectoma was generated by cutting out an EcoRI - SfiI fragment from the CD4 ⁇ 1 plasmid, filling the ends, and blunt end-ligating the fragment into the XbaI site of the pcDEB vector, which contains the hygromycin resistance gene.
- CD4TP soluble CD4 variant consisting essentially of the first four domains (expressed in soluble form) known as CD4TP.
- Culture fluid from CD4 transformants was concentrated and diafiltered to lower the ionic strength.
- the concentrate was passed through a large volume of Q-Sepharose anion exchange resin (previously equilibrated with 25 mM NaCl, pH 8.5) in order to adsorb contaminants from the culture fluid.
- the unadsorbed culture fluid from the anion exchange resin step was then passed through a cation exchange resin (previously equilibrated with 25 mM NaCl at pH 8.5) whereby the CD4 variant was adsorbed to the resin.
- the protein was eluted with a NaCl gradient at pH 8.5.
- Ammonium sulfate was added to the eluate to a concentration of 1.7M and the solution passed through a column of hydrophobic interaction chromatography resin (phenyl or butyl Sepharose). The protein was eluted from the hydrophobic interaction column with a gradient of ammonium sulfate.
- the eluate was concentrated and buffer exchanged on a G-25 column using phosphate buffered saline containing .02% (w/v) Tween 20 or Tween 80.
- Other polymeric nonionic surfactants are suitably used with the CD4 formulations, including Pluronic block copolymers or polyethylene glycol.
- CD4 V1-V4 optionally are further purified by the procedure described above for unfused CD4 variants (i.e., the general procedure of this Example).
- CD4 immunoglobulin fusions with CD4 V1-V2 also may be purified by the procedure above, except that it is not expected that the isoelectric point of this class of molecules will be as alkaline as that of species ⁇ ntajhing all four V regions of CD4.
- FIG. 3a shows an autoradiograph of biosynthetically labeled intracellular proteins obtained from the hybridoma of this invention precipitated with antibody to mouse ⁇ 1 chain (lanes 2 and 3).
- a 92 kd polypeptide representing CD4 ⁇ 1 is precipitated from the transfected (lane 3), but not from the untransfected cell line (lane 2).
- Some of the CD4 ⁇ 1 is secreted (Figure 3b) in association with the ⁇ chain of M-T301, this dimer being linked to the heavy(H) X light(L) chain pair of M-T301.
- the rather large CD4 ⁇ 1 is not sterically hindered from being linked to the ⁇ 1 chain, probably because of the flexibility of the hinge region, which allows the amino ends of the polypeptides to move apart.
- the ⁇ chain is also not hindered from forming a disulfide bridge with the CD4 ⁇ 1 chain.
- target cells were incubated with antibodies at one or more concentrations (or with no antibody), washed, and cells of the cytotoxic T cell line MX66 (effector cells) (obtained from H. Spits, DNAX, Palo Alto) were added at a ratio of 0.5:1 or
- Targets were one of the following: HeLa cells expressing CD4 and infected with HIV- LAV I (HeLa LAV I); or not infected (HeLa); or allogeneic cell line HUT 78.
- Antibodies were one of the following: anti-CD3 monoclonal antibody M-T301; bispecific antibodies (bispecs) with one arm specific for CD3 (derived from M- T301) and the other arm specific for gp120 (derived from CD4g1); a 1:1 mixture of M-T301 and CD4g1 (antibody mixture).
- %lysis (cpm experimental release - cpm spontaneous release) : (cpm maximal release - cpm spontaneous release) ⁇ 100. Spontaneous release was always less than 15% of maximal release. Maximum release was determined after lysis with 1N HCl.
- M-T301 antibody was purified from M-T301 hybridoma supernatant, and thus must have been free of such contamination.
- Table 3 shows that bispecs are effective in killing HW-infected cells in vitro.
- HeLa.T4 cells whether HIV-infected or not, were not killed by effector cells alone.
- our bispecs at a concentration of 1.6 ⁇ g/ml, 26.8% of infected cells were killed at an effector:target ratio of 0.5:1, while the uninfected cells were not killed.
- a mixture of equal parts of bivalent CD4 ⁇ 1, ⁇ tetramers and M-T301 antibodies did not cause killing (below 0.7%).
- the bispec preparation contained an equal amount of monospecific bivalent CD4 ⁇ 1, ⁇ tetramers, which do not help the killing, but which, due to their superior avidity (two binding sites vs. one), may rather prevent bispecs from binding to the target cells. Further purification of the bispecs should yield preparations that are somewhat more efficient. To alleviate the necessity for a tedious purification, mutations in the ⁇ chains that allow only heterologous pairing, i.e. V H ⁇ 1 with CD4 ⁇ 1, can be selected.
Abstract
A method for directing a cytotoxic T cell to an HIV-I-infected cell, which comprises contacting the infected cell with a bispecific proteinaceous molecule comprising two binding domains, wherein the first binding domain comprises a CD4 domain or domains and the second binding domain comprises an anti-CD3 binding region.
Description
COMPOSITIONS THAT MEDIATE KILLING
OF HIV-INFECTED CELLS
INTRODUCTION
Technical Field
This application relates to pharmaceutical compositions useful in the treatment of human immunodeficiency virus (HIV) infections and particularly those useful for stimulating killing of HIV-infected cells by cytotoxic T
lymphocytes.
Background
The primary immunologic abnormality resulting from infection by HIV is the progressive depletion and functional impairment of T lymphocytes expressing the CD4 cell surface glycoprotein (H. Lane et al., Ann. Rev. Immunol. 3:477 [1985]). CD4 is a non-polymorphic glycoprotein with homology to the immunoglobulin gene superfamily (P. Maddon et al., Cell 42:93 [1985]).
Together with the CD8 surface antigen, CD4 defines two distinct subsets of mature peripheral T cells (E. Reinherz et al., Cell 19:821 [1980]), which are distinguished by their ability to interact with nominal antigen targets in the context of class I and class II major histocompatibility complex (MHC) antigens, respectively (S. Swain, Proc. Natl. Acad. Sci. 78:7101 [1981]; E. Engleman et al., J. Immunol. 127:2124 [1981]; H. Spitz et al., J. Immunol. 129:1563 [1982]; W. Biddison et al., J. Exp. Med. 156: 1065 [1982]; and D. Wilde et al., J.
Immunol. 131:2178 [1983]). For the most part, CD4 T cells display the helper/inducer T cell phenotype (E. Reinherz, supra), although CD4 T cells characterized as cytotoxic/suppressor T cells have also been identified (Y. Thomas et al., J. Exp. Med. 154:459 [1981]; S. Mauer et al., Proc. Natl. Acad. Sci. USA 79:4395 [1982]; and A. Krensky et al., Proc. Natl. Acad. Sci. USA 79:2365
[1982]). The loss of CD4 helper/inducer T cell function probably underlies the
profound defects in cellular and humoral immunity leading to the opportunistic infections and malignancies characteristic of the acquired immunodeficiency syndrome (AIDS) (H. Lane supra).
Studies of HIV-I infection of fractionated CD4 and CD8 T cells from normal donors and AIDS patients have revealed that depletion of CD4 T cells results from the ability of HIV-I to selectively infect, replicate in, and ultimately destroy this T lymphocyte subset (D. Klatzmann et al., Science 225:59 [1984]). The possibility that CD4 itself is an essential component of the cellular receptor for HIV-I was first indicated by the observation that monoclonal antibodies directed against CD4 block HIV-I infection and syncytia induction (A.
Dalgleish et al., Nature [London] 312:767 [1984]; J. McDougal et al., Science 231:382 [1986]; and the finding that HIV-I tropism can be conferred upon ordinarily non-permissive human cells following the stable expression of CD4 cDNA (P. Maddon et al., Cell 47:333[1986]). Furthermore, the neurotropic properties of HIV-I, reflected by a high incidence of central nervous system dysfunction in HIV-I infected individuals (W. Snider et al., Ann. Neurol. 14:403 [1983]), and the ability to detect HIV-I in the brain tissue and cerebrospinal fluid of AIDS patients (G. Shaw et al., Science 227:177 [1985]; L. Epstein, AIDS Res. 1:447 [1985]; S. Koenig, Science 233:1089 [1986]; D. Ho et al., N. Engl. J. Med. 313: 1498 [1985]; J. Levy et al., Lancet II:586 [1985]), appears to have its explanation in the expression of CD4 in cells of neuronal, glial and
monocyte/macrophage origin (P. Maddon, Cell 47:444 [1986]; I. Funke et al., J. Exp. Med. 165:1230 [1986]; B. Tourvielle et al., Science 234:610 [1986]).
In addition to determining the susceptibility to HIV-I infection, the manifestation of cytopathic effects in the infected host cell appears to involve
CD4. Antibody against CD4 was found to inhibit the fusion of uninfected CD4 T cells with HIV-I infected cells in vitro: moreover, the giant multinucleated cells produced by this event die shortly after being formed resulting in the depletion of the population of CD4 cells (J. Lifson et al., Science 232:1123 [1986]).
Formation of syncytia also requires gp120 expression, and can be elicited by coculturing CD4-positive cell lines with cell lines expressing the HTV-I any. gene in the absence of other viral structural or regulatory proteins (J. Sodroski et al.,
Nature 322:470 [1986]; J. Lifson et al., Nature 323:725 [1986]). Thus, in mediating both the initial infection by HTB-I as well as eventual cell death, the interaction between gp120 and CD4 constitutes one of several critical entry points in the viral life cycle amenable to therapeutic intervention (H. Mitauya et al., Nature 325:773 [1987]).
The known sequence of the CD4 precursor predicts a hydrophobic signal peptide, an extracellular region of approximately 370 amino acids, a highly hydrophobic stretch with significant identity to the membrane-spanning domain of the class π MHC beta chain, and a highly charged intracellular sequence of 40 residues (P. Madden, Cell 42:93 [1985]). The extracellular domain of CD4 consists of four contiguous regions each having amino acid and structural similarity to the variable and joining (V-J) domains of immunoglobulin light chains as well as related regions in other members of the immunoglobulin gene superfamily. These structurally similar regions of CD4 are termed the V1, V2, V3 and V4 domains (denominated 1-4 in Figure 1).
Some work preliminary to the present invention was described in a publication from the laboratory of the present inventors, namely J. Berg et al., Proc. Natl. Acad. Sci. USA, 88:4723-4727. However, this publication describes only bispecific antibodies with complete Fc and CD4 domains and not other bispecific molecules. As noted in the publication, only clinical testing can determine whether such compounds that contain both CD4 and anti-CD3 regions along with other binding regions, such as those for the Fc receptor and MHC class II antigens, will be of clinical value.
Accordingly, it is an object of this invention to produce pharmaceutical compositions containing CD4 derivatives useful in the treatment of
AIDS and related conditions, in a manner essentially unaffected by the extreme degree of genetic variation observed among various HIV-I isolates and their respective env polypeptides (J. Coffin, Cell 46:1 [1986]). In particular, it is an objective to prepare compositions containing molecules for directing cytotoxic T cells to cells exhibiting HIV antigens, e.g. HIV gp120, on their surfaces so that the infected cells can be destroyed using molecules that are particularly designed for clinical use.
SUMMARY OF THE INVENTION
The objects of this invention have been accomplished by providing pharmaceutical compositions containing a pharmaceutically acceptable carrier and an effective amount of a molecule that is bispecific and that can easily be produced by techniques of genetic engineering from readily available genetic sources. One specific binding region of the molecule, generally referred to herein as a binding domain, consists of a portion (or all) of a CD4 variable region that is capable of binding to HIV gp120 while the other binding region (binding domain) exhibits specific binding affinity for a cytotoxic T cell, typically via an anti-CD3 binding region of an antibody. The bispecific molecules used in compositions of the invention, referred to herein as "bispecs," are able to mediate the killing of cells infected with HIV virus of any strain by cytotoxic T cells of any specificity. It is no longer necessary to direct an antibody specifically to the HIV virus or to any particular class of T lymphocytes.
Several types of Bispecs are particularly preferred. These include single polypeptide chains with a CD4 region at one end and an anti-CD3 region at the other end, typically prepared by splicing CD4 variable region domains of a CD4 molecule onto anti-CD3 variable region domains of an anti-CD3 antibody, using techniques of genetic engineering. Alternatively, modified antibody molecules can be prepared, in which one arm of the antibody is derived from an anti-CD3 antibody and the other arm is derived from a CD4 molecule. These antibody molecules are preferably designed to be specifically useful in clinical situations by incorporating deletions of non-specific binding regions in, for example, the Fc region of the antibody chain, so that undesired binding, and thus indiscriminate cell killing, does not occur. Bispecs of the invention, as described in detail below, have been demonstrated to mediate killing of HIV infected cells in the presence of completely unrelated cytotoxic T lymphocytes.
BRIEF DFSCRIPTION OF THE DRAWINGS
Figure 1 is a schematic representation of the structure of a CD4 molecule and of a typical immunoglobulin chain exemplified by the γ1 antibody chain. CD4 and γ1 are shown in the first two lines of the Figure 1. The third
line of Figure 1 shows the four immunoglobulin-like domains of CD4 as a separate soluble entity, as they can be prepared by techniques of recombinant engineering (soluble rCD4). The last two lines of Figure 1 show two fusion proteins formed by linking various CD4 domains to the constant region of the γ1 immunoglobulin chain. The first of these two representations, indicated by CD42γ1, consists of the first two domains of CD4 linked to the constant region of γ1. The last line of the Figure, identified as CD42γ1, shows a construct in which the first four domains of have been attached to the constant region of γ1.
Figure 2 is a schematic representation of a bispecific antibody. The left arm of the molecule consists of the fusion protein CD4γ1 linked to κ light chain by a disulfide bridge; the right arm consists of a γ1,κ pair. The left arm binds to HIV gp120 of any strain. The right arm of the bispecific antibody binds to CD3, a component of the T cell receptor, and, thereby, activates the cytotoxic T cell. CD4.1, CD4.2, CD4.3, and CD4.4 are immunoglobulin-like domains of CD4; CH1, CH2, and CH3 are constant region domains of γ1 chains; VH is the variable region of γ1 heavy chain; VL is the variable region of κ.
Figure 3 is a series of schematic representations of autoradiographs.
(a) Autoradiograph obtained after SDS-polyacrylamide gel electrophoresis of
[35S]methionine-labeled immunoglobulin chains produced by hybridoma M-T301 (lane 2) and the transfectoma (lane 3). Lane 1: molecular weight standards.
Cells were incubated for 20 min in RPMI containing [35S]methionine. Proteins were immunoprecipitated from lysed cells using goat antibody to mouse
immunoglobulin followed by S. aureus. The precipitate was reduced and analyzed on a 10% gel. The band at a mol. weight of circa 40,000 presumably represents a truncated immunoglobulin chain encoded by a silent allele; it is not secreted [see
(b)]. (b) Fluorograph obtained after SDS-polyacrylamide gel electrophoresis of [35S]methionine-labeled immunoglobulin from the supernatants of hybridoma M- T301 (lane 1) and the transfectoma (lane 2). Material in lanes 1 and 2 was reduced before being loaded onto the gel. Far left lane: molecular weight standards, (c) Non-reduced precipitates from M-T301 (Lane 3) and the transfectoma (lane 4). Positions 1, 2, and 3 indicate M-T301 immunoglobulin, bispecific antibody, and CD4γ1,κ tetramers, respectively, (d) Lane 4 of Figure
3(c) was cut out and rerun under reducing conditions, (e) Transfectoma supernatant purified over an anti-CD4 column, electrophoresed non-reduced or after reduction, (f) Non-reduced material electrophoresed as in Figure 3(e) rerun under reducing conditions. Positions 1 and 2 indicate bispecific antibody and CD4γ1,κ dimers, respectively. Staining in 2(e) and 2(f) was with Commassie blue.
DESCRIPTION OF SPECIFIC EMBODIMENTS
Although AIDS patients lose HIV-specific cytotoxic T cells, their remaining CD8-positive T lymphocytes maintain cytotoxic function. To exploit this fact, we have constructed bispecific molecules, usually a modified form of antibodies, that direct cytotoxic T lymphocytes of any specificity to cells that express gp120. These bispecific molecules ("bispecs") comprise an anti-T-cell- specific-antigen binding region and a CD4 region; e.g., one heavy/light chain pair from an antibody to a CD3 antigen linked to a heavy chain whose variable region has been replaced with sequences from CD4 plus a second light chain. CD3 is part of the antigen receptor on T cells and is responsible for signal transduction and is used throughout this specification as the exemplary (and preferred) cytotoxic-T-cell-specific antigen. In the presence of bispecific molecules of these specificities, T cells of irrelevant specificity effectively lyse HIV-infected cells, as shown by the examples below in which this cytotoxicity has been demonstrated.
It was previously known that human peripheral blood lymphocytes can kill HIV-infected cells in vitro in the presence of monoclonal anti-gp120 antibodies chemically cross-linked to monoclonal antibodies to CD3. We have improved upon this scheme in two ways. First, we have replaced the chemical linkage with a biochemical one. By transfection we produced a cell line expressing molecules of both specificities. This line secretes, among other products, the desired bispecific molecules. Second, we have replaced the anti-gp120 monoclonal antibody, which was strain-specific and, therefore, of limited therapeutic potential, by a CD4 derivative, such as a CD4γ1 chain; in this example the heavy antibody chain consists of the first four immunoglobulin-like
domains of CD4 fused to the whole constant region of mouse γ1 chain. HIV cannot mutate out of the binding capability of CD4 without losing its ability to infect cells via their membrane CD4 molecule, so that this and other bispecs will be effective against any HIV strain.
The word "domain" is used in this specification in the same manner as it is used in biochemistry to describe regions of molecules, usually proteins, that interact with other molecules or have other properties restricted to one (or more) region of the total molecule. In its broadest sense, a domain is simply a region of a molecule that is associated with a particular physical or chemical property, such as binding to another molecule. This region is generally but not always comprised of a single continuous segment of the amino acid sequence that makes up the total protein. As used herein, a "domain" preferably refers to such a continuous segment. In the field of immunology, "domain" has come to have a more specialized meaning, namely one of the roughly spherical regions of an antibody chain that are linked to each other to form an immunoglobulin chain (or a similar region of another member of the immunoglobulin superfamily of molecules, such as CD4). The particular meaning of domain as used herein will be clear from the context, but generally domain is used in the broader sense defined above unless it is used to refer to one of the immunoglobulin (or immunoglobulin-like) regions of an antibody chain or CD4 molecule that is specifically referred to as a domain in the scientific literature. For exemplification of the meaning of domain as it is used in context of immunoglobulin and CD4 segments in the scientific literature, see the publications discussed in the
Background section of this specification.
In addition to bispecific antibodies, the invention can be practiced with other molecules that are bispecific in the same manner as the antibodies described above. For example, the immunoglobulin-like domains of a CD4 molecule can be linked to a molecule retaining its specificity for CD3 in any fashion, including using linkers (usually short polypeptide chains), to provide a bispec of the invention. A particularly preferred bispec is prepared as a fusion protein in which one end of the molecule is a CD4 domain or domains and the other end of the molecule is a binding region for CD3. Such molecules can
readily be prepared as fused proteins by genetic engineering by linking coding regions together, such as the coding region for one or more domains of CD4 and the coding region for at least the binding region of one strand, preferably the heavy chain variable region, of an anti-CD3 antibody. Recent work has shown that single-stranded antibody chains retain specificity for their specific antigen
(discussed below in more detail). See, for example, the techniques described in Ward et al., Nature, 341:544 (1989). Expression of the resulting polynucleotide results in production of a fused protein containing two regions with the desired primary amino acid structures.
For example, a single-chain polypeptide of the invention can be prepared by linking together the coding regions for at least one CD4 variable region domain, for VH and VL, and for Cκ. The resuling single polypeptide will thus contain both VL and VH. This is readily achieved by inserting a polypeptide linker between VH and VL. Examples of molecules prepared in this manner are given below. A particularly preferred example, D-VH-VL-Cκ, has been shown to be effective by colleagues of the present inventors. In these molecules, VH and VL are linked via a short peptide linker in order to provide sufficient flexibility for the antibody binding site to form. However, the CD4 domain can be attached directly to the N terminus of the VH domain. In the molecule that has been expressed, the CD4 domain has its leader sequence for secretion from mammalian cells, but the leader sequences of the VH and VL are not present. In preferred embodiments, the Cκ region is retained in order to assist in folding and stability of the antibody part of the molecule, even if other deletions occur, as discussed in more detail below. Constructs that comprise entire antibody and CD4 domains (rather than parts of domains) are also preferred for ease of folding, expression, and genetic
manipulation.
Whether any particular construct retains its ability after folding to carry out the desired binding functions can readily be determined by simple binding experiments. For example, detectably labeled gp120 molecules can be used in a variety of well-known techniques to determine the ability of the CD4 portion of the molecule to bind gp120. Similarly, detectably labeled CD3 antigen can be used to determine whether the anti-CD3 portion of the molecule retains its binding
ability. If desired for higher binding affinity or greater specificity, a genetic construct can be prepared that encodes two proteins, one being the fused
CD4/antibody chain (e.g., with an antibody heavy chain) and the other being the remaining anti-CD3 antibody chain (e.g., the light chain). Expression of the two proteins concurrently will result in assembly of the light and heavy chains to form one light/heavy chain pair (i.e., one arm of an antibody against CD3) with the CD4 domain being attached to one of the antibody chains.
When assembled in this fashion, it is preferred to have the antibody binding domain at the N terminus of the fused molecule and (in some embodiments) to include at least part of the constant region of the two antibody chains for ease of post-expression assembly. However, other embodiments eliminate all or part of one or more constant region domains, as discussed in more detail below, in order to eliminate undesired binding of the antibody Fc region to other cells and/or molecules. The CD4 region is normally attached in such constructs at the C terminus, although the alternative order can occur as well. Such genetic constructs are prepared in the same manner as is described in detail below for the production of bispecific antibodies of the invention except for the order and/or selection of the segments that are spliced together.
Another preferred embodiment uses the concept described by Ward et al., Nature, 341:544 (1989), in which single antibody chains are prepared that retain binding specificity, where the first or the first two domains of the heavy chain are linked by a peptide bridge to the first domain of or the complete light chain. The resulting single antibody chain can be readily fused to a CD4 domain or domains as described herein, using, in preferred embodiments, the same linking groups to attach the two antibody variable regions. The resulting single-chain protein, which is readily produced by genetic engineering and expression, has a structure such as D-VL-VH-Cκ, D-VH-VL-Cκ, D-VH-VL-Cλ, VH-VL-Cκ-D, VL-VH-Cκ-D, VH-VL-Cλ-D, and other similar combinations in which a portion (D) of CD4 that retains its binding affinity for gp120 is fused to variable (V; heavy and light chains) and constant (C) domains of an anti-CD3 antibody. Preferred fusions have a CD4 domain or domains at one terminus of the polypeptide chain and the antibody domains at the other terminus. Additional amino acids can be
present in central portions of the polypeptide (i.e., between CD4 and antibody domains) without adversely affecting binding affinities.
Bispecs of the invention can readily be prepared using existing sources of genetic material encoding the indicated specific molecules. However, the invention also encompasses variations derived from the original material that has been modified by techniques of genetic and protein engineering to provide additional desirable properties in the resulting bispecs. Those bispecs that have the same amino acid sequence (in their relevant portions) as can be found in naturally occurring CD4 and anti-CD3 molecules are referred to herein as
"natural-sequence bispecs." This invention, however, is also concerned with amino acid sequence variants of natural-sequence bispecs. Amino acid sequence variants of bispecs are prepared with various objectives in mind, including increasing the affinity of the bispec for its binding partner, facilitating the stability, purification and preparation of the bispec, increasing its plasma half life, improving therapeutic efficacy as described above in the background, introducing additional functionalities and lessening the severity or occurrence of side effects during therapeutic use of the bispec. Amino acid sequence variants of bispecs fall into one or a combination of insertional, substitutional, and deletional variants, as will be discussed in detail below.
In a specific embodiment of a bispec of the invention, one or more
CD4 immunoglobulin-like domains, which may be homologous either to the constant or to the variable region domains, or any other fragment of CD4 (as long as the CD4 sequence retains its ability to bind gp120) is conjugated with an immunoglobulin constant region sequence. Immunoglobulins and certain variants thereof are known and many have been prepared in recombinant cell culture. For example, see U.S. Patent 4,745,055; EP 256,654; Faulkner et al., Nature 298:286 (1982); EP 120,694; EP 125,023; Morrison, J. Immun. 123:793 (1979); Kohler et al., P.N.A.S. USA 77:2197 (1980); Raso et al., Cancer Res. 41:2073 (1981); Morrison et al., Ann. Rev. Immunol. 2:239 91984); Morrison, Science 229:1202 (1985); Morrison et al., P.N.A.S. USA 81:6851 91984); EP 255,694; EP
266,663; and WO 88/03559. Reassorted immunoglobulin chains also are known. See for example U.S. Patent 4,444,878; WO 88/03565; and EP 68,763 and
references cited therein. For production of single antibody chains that retain binding specificity, where the first or the first two domains of the heavy chain are linked by a peptide bridge to the first domain of or the complete light chain, see Ward et al., Nature, 341:544 (1989). All of these patents and other publications are herein incorporated by reference.
Ordinarily, the domains of CD4 that are homologous to immunoglobulins and extracellular in their native environment are fused C-terminally to the N-terminus of the constant region of immunoglobulins in place of the variable region(s) thereof, retaining at least functionally active hinge, CH2 and CH3 domains of the constant region of an immunoglobulin heavy chain. This ordinarily is accomplished by constructing the appropriate DNA sequence and expressing it in recombinant cell culture. Immunoglobulins and other polypeptides having enhanced plasma half life are fused to the extracellular or ligand binding domains of other CD4 variants in the same fashion.
The boundary domains for the CD4 V-like regions (V1-V4) are, respectively, about 100-109, about 175-184, about 289-298, and about 360-369 (based on the precursor CD4 amino acid sequence in which the initiating met is -25). For a full disclosure of the CD4 sequence, which is well known to those familiar with HIV infections and the CD4 molecule, see Figures 1 and 2 of PCT application US 88/03414 published under the International Publication No. WO
89/02922 on 6 April 1989. This PCT publication, which is herein incorporated by reference, describes the preparation of immunoglobulin chains containing various CD4 domains and the constant region of an antibody, but is not directed to combinations specifically involving anti-CD3 binding regions or to the targeting of cytotoxic T cells to HIV-infected cells.
CD4 sequences containing any of the CD4 domains involved in binding to gp120 are fused to the immunoglobulin sequence. It is preferable that V1V2 or V1V2V3V4 be fused at its C-terminus to the immunoglobulin constant region. The precise site at which the fusion is made is not critical; the boundary domains noted herein are for guidance only and other sites neighboring or within the V regions may be selected in order to optimize the secretion or binding characteristics of the CD4. The optimal site will be determined by routine
experimentation. Unless the first constant region domain of the immunoglobulin heavy chain is deleted, or a light chain is provided, the fusions are generally expressed intracellularly, but a great deal of variation is encountered in the degree of secretion of the fusions from recombinant hosts. For instance, the following table (Table 1) shows various CD4 immunoglobulin fusions that were obtained in PCT/US88/03414. These immunoglobulin chains were referred as "immuno- adhesons," and this terminology is retained here to refer to single antibody chains consisting of one or more CD4 domains linked to the constant region of an immunoglobulin chain. In all of these examples of CD4 immunoadhesons, the CD4 signal was used to direct secretion from 293 cells. Lower case m represent murine origin, while the lower case a designates human origin. V and C are abbreviations for immunoglobulin variable and constant domains respectively. The numerical subscripts indicate the number of parenthetical units found in the designated multimer. It will be understood that the chains of the multimers are believed to be disulfide bonded in the same fashion as native immunoglobulins. The CD4 immunoadhesons typically contained either the first N-terminal 366 residues of CD4 (CD44) or the first 180 N-terminal residues of CD4 (CD42) linked at their C-terminus to the κ (light) chain or IgG1 heavy chain constant region (γ1).
It can be seen that the CD4/human-heavy-chain immunoadheson was secreted as a dimer whereas the analogous murine construction was not detected (this does not exclude the intracellular accumulation of the protein, however). These CD4-IgG immunoadheson chimeras are readily secreted wherein the CD4 epitope is present fused to one or more light or heavy chains, including heterotetramers wherein up to and including all four variable region analogues are derived from CD4. Where a separate light-heavy chain non-CD4 variable domain is also present, a heterofunctional antibody thus is provided. In the present invention, the heterofunctional antibody is a bispec when the separate heavy-light chain is obtained from an anti-CD3 antibody. Such antibodies are available commercially, as are hybridomas that contain genetic information encoding anti-CD3 antibodies. Additionally, production of new anti-CD3-producing cell lines can readily be accomplished by routine immunological techniques.
Various exemplary hetero- and chimeric bispecific antibodies produced in accordance with this invention (as well as single polypeptide chains used to prepare bispecs) are schematically diagrammed below. "D" means at least a portion of the extracellular domain of CD4 containing its ligand binding site; VL, VH, CL and CH represent light or heavy chain variable or constant domains of an immunoglobulin; n is an integer; and Y designates a covalent cross-linking moiety.
(a) DCL;
(b) DCL-DCL;
(c) DCH-[CDH, DCL-DCH, DCL-VHCH, VLCL-DCH, or VLCL- VHCH];
(d) DCL-DCH-[DCH, DCL-DCH, DCL-VHCH, VLCL-DCH, or VLCL- VHCH];
(e) DCL-VHCH-[CDH, DCL-DCH, DCL-VHCH, VLCL-DCH, or VLCL- VHCH];
(f) VLCL-DCH-[CDH, DCL-DCH, DCL-VHCH, VLCL-DCH, OR VLCL- VHCH];
or
(g) [D-Y]n-[VLCL-VHCH]2..
The structures in this list of formulas show only key features; e.g., they do not show joining (J) or other domains of the immunoglobulins, nor are disulfide bonds shown. These are omitted in the interests of brevity. However, where such domains are required for binding activity they shall be construed as being present in the ordinary locations which they occupy in the CD4, bispec, or immunoglobulin molecules as the case may be. These examples are representative of divalent antibodies; more complex structures would result by employing immunoglobulin heavy chain sequences from other classes, e.g., IgM. The immunoglobulin VLVH antibody combining site, also designated as the companion immunoglobulin, preferably is capable of binding to a predetermined antigen. Suitable companion immunoglobulin combining sites and fusion partners are obtained from IgG-1, -2, -3, or -4 subtypes, IgA, IgE, IgD or IgM.
A preferred embodiment of a fused CD4/immunoglobulin chain for use in preparing a bispec of the invention is a fusion of an N-terminal portion of CD4, which contains the binding site for the gp120 envelope protein of HIV, to the C-terminal Fc portion of an antibody, containing the effector functions of immunoglobulin G1. There are two preferred embodiments of this sort with respect to the portion of the antibody chain that is used; in one, the entire heavy chain constant region is fused to a portion of CD4; in another, a sequence beginning in the hinge region just upstream of the papain cleavage site which
defines IgG F chemically (residue 216, taking the first residue of heavy chain constant region to be 114 [Kabat et al., "Sequences of Proteins of Immunological Interest" 4th Ed., 1987], or analogous sites of other immunoglobulins) is fused to a portion of CD4. These embodiments are described in the examples.
More particularly, those variants in which one or more immunoglobulin-like domains of CD4 are substituted for the variable region of an immunoglobulin chain are useful in preparing bispecs of the invention. These chimeras are constructed in a fashion similar to chimeric antibodies in which a variable domain from an antibody of one species is substituted for the variable domain of another species. See, for example, EP 0 125 023; Munro, Nature 312:
(13 December 1984); Neuberger et al., Nature 312: (13 December 1984); Sharon et al., Nature 309: (24 May 1984); Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851-6855 91984); Morrison et al., Science 229:1202-1207 (1985); and Boulianne et al., Nature 312:643-646 (13 December 1984). The DNA encoding the CD4 immunoglobulin-like domain(s) is cleaved by a restriction enzyme at or proximal to the 3' end of the DNA encoding the immunoglobulin-like domain(s) and at a point at or near the DNA encoding the N-terminal end of the mature CD4 polypeptide (where use of a different leader is contemplated) or at or proximal to the N-terminal coding region for CD4 (where the native CD4 signal is employed). This DNA fragment then is readily inserted into DNA encoding an
immunoglobulin light or heavy chain constant region and, if necessary, tailored by deletional mutagenesis. Preferably, this is a human immunoglobulin when the variant is intended for in vivo therapy for humans. DNA encoding
immunoglobulin light or heavy chain constant regions is known or readily available from cDNA libraries or is synthesized. See for example, Adams et al.,
Biochemistry 19:2711-2719 91980); Gough et al., Biochemistry 19:2702-2710 (1980); Dolby et al., P.N.A.S. USA 77:6027-6031 (1980); Rice et al., P.N.A.S. USA 79:7862-7865 (1982); Falkner et al., Nature 298:286-288 (1982); and Morrison et al., Ann. Rev. Immunol. 2:239-256 (1984). All publications cited in this paragraph are herein incorporated by reference.
DNA encoding the immunoglobulin or immunoadheson chimeric chain(s) is transfected into a host cell for expression. If the host cell is producing
an immunoglobulin prior to transfection, then one need only transfect with the CD4 domains fused to light or to heavy chain to produce a heteroantibody. The aforementioned immunoglublins having one or more arms bearing the CD4 domain and one or more arms bearing companion variable regions specific for CD3 result in dual specificity for gp120 of any source and for a CD3 antigen. These are produced by the above-described recombinant methods or by in vitro procedures. In the latter case, for example, F(ab')2 fragments of the adheson fusion and an immunoglobulin are prepared, the F(ab')2 fragments converted to Fab' fragments by reduction under mild reducing conditions, and then reoxidized in each other's presence under acidic conditions in accord with methods known per se. See also
U.S. Patent 4,444,878, which is incorporated herein by reference.
Additionally, procedures are known for producing intact
heteroantibodies from immunoglobulins having different specificities. These procedures can be adopted for the in vitro production of bispecs by simply substituting the CD4-containing chains for one of the previously employed immunoglobulins.
In an alternative method for producing a heterofunctional antibody, host cells producing a CD4-immunoglobulin fusion, e.g., transfected myelomas, also are fused with B cells or hybridomas which secrete antibody having the desired companion specificity for CD3 antigen. Heterobifunctional antibody is recovered from the culture medium of such hybridomas, and thus can be produced somewhat more conveniently than by conventional in vitro resorting methods (EP 68,763).
As was previously mentioned, the present invention contemplates not only natural-sequence bispecs, but variants in which there have been single, multiple, or combinations of insertions, deletions, and/or substitutions of amino acids in the naturally derived sequences. Insertional amino acid sequence variants are those in which one or more amino acid residues extraneous to the bispec are introduced into a predetermined site in the bispec including the C or N terminus of any polypeptide chain. Such variants, particularly when the insertions are lengthy, are referred to as fusions of the bispec and a different polypeptide. Such fusions
contain sequences other than those which are normally found in the bispec at the inserted position.
Another class of bispec variants comprises deletional variants.
Deletions are characterized by the removal of one or more amino acid residues from a given sequence. Typically, the transmembrane and cytoplasmic domains of
CD4 are deleted. When such deletions are desired in the case of CD4, at least residues 368 to 395 (the transmembrane region), and ordinarily 396-433 as well (the cytoplasmic domain), will be deleted.
Another preferred deletion is one which reduces or eliminates the ability of CD4 to bind to MHC class π antigens. The amino acid residues associated with binding are numbers 19, 89, and 165 of the CD4 molecule.
Mutations of these residues abrogate MHC binding. CD4 deletions affecting MHC class II antigen binding with a CD4 molecule is described in Fleury et al., Cell 66: 1037.
Other deletions can be used with the present invention as long as the binding specificity or other desired properties, such as effector functions, are retained. A preferred class of compounds encompasses bispecs derived from antibodies in which the binding region for Fc receptor is deleted or modified to reduce undesired binding. Such deletions can be of one or more entire domains of the Fc region or can a deletion or mutation of part of a domain or even a single amino acid. For example, a preferred mutation would be to change residue 235 of IgG from leu to glu, as demonstrated and described in Alegre et al., J. Immunol. 148:3461. When an entire domain is to be deleted, the CH2 domain, which is the domain that interacts the Fc receptor, should be deleted. Whether or not any given deletion results in a bispec with the desired binding properties can readily be tested using the procedures described in the following examples to determine whether the resulting molecule is capable of directing cytotoxic T cells to HIV-infected cells.
Substitutional variants are those in which at least one residue in a sequence has been removed and a different residue inserted in its place. For example, the native N-terminal residue for mature CD4 is now known to be lysine. Thus, the normal sequence shown in Figure 1 of PCT/US88/03414, with
an N-terminal asparagine, is an amino acid sequence variant of native mature CD4. Table 2 below describes substitutions which in general will result in fine modulation of the characteristics of the CD4 antigen or anti-CD3 binding region.
Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in adheson properties will be those in which (a) a hydrophilic residue, e.g., seryl or threonly, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl,
pheylalanyl, valyl or alanyl; (b) a cysteinyl or prolyl is substituted for (or by) any
other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g.,
phenylalanyl, is substituted for (or by) one not having a side chain, e.g., glycyl.
It will be amply apparent from the foregoing discussion that substitutions, deletions, insertions or any combination thereof are easily introduced to arrive at a final construct. These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the CD4 or anti-CD3 molecules, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture. However, variant bispecs also are prepared by in vitro synthesis. Obviously, variations made in the DNA encoding the variant bispecs must not place the sequence out of reading from and preferably will not create complementary regions that could produce secondary mRNA structure deleterious to expression (EP 75 444 A). The CD4-derived region or regions of the variants typically exhibit the same gp120 binding activity as does the naturally occurring prototype, although variants also are selected in order to modify the characteristics of the CD4 adheson as indicated above. For example, the regions of the CD4 molecule that are responsible for binding to class II major histocompatibility antigen (MHC) can be deleted in order to eliminate binding to undesired locations in vivo. Similar considerations exist for the anti-CD3 region or regions.
While the site for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random
mutagenesis may be conducted at the target codon or region and the expressed adheson variants screened for the optimal combination of desired activities.
Techniques for making substitution mutations are predetermined sites in DNA having a known sequence are well known, for example M13 primer mutagenesis.
The DNA encoding CD4 is obtained by known procedures. See Williams, Immunol. Today 8:298-303 (1987) and citations therein. In general, prokaryotes are used for cloning of CD4 variant DNA sequences. For example, E. coli strain SR101 (for propagating ml3 phage, a λ-resistant strain of JM 101;
Messing et al., Nucl. Acids. Res. 9(2):309-321 [1981]); and E. coli K12 strain 294 (ATCC No. 31446) are particularly useful. Other microbial strains which may be used include E. coli B, UM101 and E. coli χ1776 (ATCC No. 31537). These examples are illustrative rather than limiting.
DNA encoding the various constructs used in preparing polypeptides of the invention is inserted for expression into vectors containing promoters and control sequences which are derived from species compatible with the intended host cell. The vector will ordinarily, but need not, carry a replication site as well as one or more marker sequences which are capable of providing phenotypic selection in transformed cells. For example, E. coli is typically transformed using a derivative of pBR322 which is a plasmid derived from an E. coli species
(Bolivar et al., Gene 2:95 [1977]). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid must also contain or be modified to contain promoters and other control elements commonly used in recombinant DNA constructions.
Promoters suitable for use with prokaryotic hosts illustratively include the β-lactamase and lactose promoter systems (Chang et al., Nature
275:615 [1978]; and Goeddel et al., Nature 281:544 [1979]), alkaline phosphatase, the tryptophan (trp) promoter systems (Goeddel, Nucleic Acids Res. 8:4057 [1980] and EPO Appln. Publ. No. 36,776) and hybrid promoters such as the tac promoter (H. de Boer et al., Proc. Natl. Acad. Sci. USA 80:21-25 [1983]). However, other functional bacterial promoters are suitable. Their nucleotide sequences are generally known, thereby enabling a skilled worker operably to ligate them to DNA encoding the adheson variant using linkers or adaptors to supply any required restriction sites (Siebenlist et al., Cell 20:269 [1980]). Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding the antigen.
In addition to prokaryotes, eukaryotic microbes such as yeast cultures also are useful as cloning or expression hosts. Saccharomyces cerevisiae. or common baker's yeast is the most commonly used eukaryotic microorganism, although a number of other strains are commonly available. For expression in
Saccharomyces, the plasmid YRp7, for example, (Stinchcomb et al., Nature
282:39 [1979]; Kingsman et al., Gene 7:141 [1979]; Tschemper et al., Gene
10:157 [1980]) s commonly used. This plasmid already contains the trp1 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics
85:12 [1977]). The presence of the trp1 lesion as a characteristic of the yeast host cell genome then provides an effective means of selection by growth in the absence of tryptophan.
Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem.
255:2073 [1980]) or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg. 7:149 [1968]; and Holland, Biochemistry 17:4900 [1978]), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid
phosphatase, degradative enzymes associated with nitrogen metabolism,
metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al. , European Patent Publication No. 73,657A. Yeast enhancers also are advantageously used with yeast promoters.
Promoters for controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters of the S V40 virus are conveniently obtained as an S V40 restriction fragment which also contains the SV40 viral origin of replication. Fiers et al., Nature 273:113 (1978). The immediate early promoter of the human
cytomegalovirus is conveniently obtained as a HindIII E restriction fragment. Greenaway, P.J. et al., Gene 18:355-360 (1982). Of course, promoters from the host cell or related species also are useful herein.
DNA transcription in higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis acting elements of DNA, usually from about 10 to 300bp, that act to increase the transcription initiation capability of a promoter. Enhancers are relatively orientation ad position independent having been found 5' (Laurrins, L. et al., Proc. Natl. Acid. Sci. 78:993 [1981]) and 3' (Lusky, MX., et al., Mol. Cell Bio. 3:1108 [1983]) to the transcription unit, within an intron (Banerji, J.L., et al., Cell 33:729 [1983]) as well as within the coding sequence itself (Osborne, T.F., et al. , Mol. Cell Bio. 4:1293 [1984]). Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, α-fetoprotein and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the
cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human or nucleated cells) may also contain sequences necessary for the termination of transcription which may affect mRNA expression.
These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding the adheson.
Expression vector systems generally will contain a selection gene, also termed a selectable marker. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase or neomycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow independent of a
supplemented medium. Two examples are: CHO DHFR cells and mouse LTK cells. These cells lack the ability to grow without the addition of such nutrients as
thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented medium. An alternative to
supplementing the medium is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non supplemented media.
The second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell.
Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, Southern P. and Berg, P., J. Molec. Appl. Genet. 1:327 (1982), mycophenolic acid, Mulligan, R.C. and Berg, P., Science 209:1422 (1980) or hygromycin, Sugden, B. et al., Mol. Cell, Bio. 5:410-413 (1985). The three examples given above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively.
"Amplification" refers to the increase or replication of an isolated region within a cell's chromosomal DNA. Amplification is achieved using a selection agent e.g, methotrexate (MTX) which inactivates DHFR. Amplications for the making of successive copies of the DHFR gene results in greater amounts of DHFR being produced in the face of greater amounts of MTX. Amplification pressure is applied notwithstanding the presence of endogenous DHFR, by adding ever greater amounts of MTX to the media. Amplification of desired gene can be achieved by cotransfecting a mammalian host cell with a plasmid having a DNA encoding a desired protein and the DHFR or amplification gene permitting cointegration. One ensures that the cell requires more DHFR, which requirement is met by replication of the selection gene, by selecting only for cells that can grow in the presence of ever-greater MTX concentration, so long as the gene encoding a desired heterologous protein has cointegrated with the selection gene replication of this gene give rise to replication of the gene encoding the desired
protein. The result is that increased copies of the gene, i.e., an amplified gene, encoding the desired heterologous protein express more of the desired heterologous protein.
Preferred host cells for expressing the CD antigen variants of this invention are mammalian cell lines, examples including: monkey kidney CF1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic M ney line (293, Graham, F.L. et al., J. Gen. Virol. 16:59 [1977] and 2938 cells [293 subclones selected for better suspension growth]); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary-cells-DHFR (CHO, Urlaub and Chasϊn, Proc. Natl. Acad. Sci. USA 17:4216, [1980]); mouse sertoli cells (TM4,
MM her, J.P., Biol. Reprod. 23:243-251 [1980]); monkey kidney cells (CF1 ATCC CCL 70); african green monkey kidney cells (VERO-76, ATCC CRL-1587);
human cervical carcinoma cells (HELA, ATCC CCL2); canine ki ney cells (MM K, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51 cells); and TRI cells (Mather, J.P., et al., Annals N.Y. Acad. Sci. 383:44-68 [1982]).
"Transformation" means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integration. One suitable for transformation of the host cells is the method of
Graham, F. and van der Eb, A., Virology 52:456-457 (1973). However, other methods for introducing DNA into cells such as by nuclear injection or by protoplast fusion may also be used. If prokaryotic cells or cells which contain substantial cell walls are used as hosts, the preferred method of transfection is calcium treatment using calcium chloride as described by Cohen, F.N. et al.,
Proc. Natl. Acad. Sci. USA 69:2110 (1972).
Construction of suitable vectors containing the desired coding and control sequences employ standard and manipulative ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and relegated in the form desired to form the plasmids required. Suitable procedures are well known for the construction described herein. See, for example, (Maniatis, T. et al., Molecular Cloning, 133-134 Cold Spring Harbor, [1982]; "Current Protocols in Molecular
Biology," edited by Ausubel et al., [1987], publ. by Greene Publishing Associates & Wiley-Interscience).
Correct plasmid sequences are confirmed by transforming E. coli K12 strains 294 (ATCC 31446) with ligation mixtures, successful transformants selected by ampicillin or tetracycline resistance where appropriate, plasmids from the transformants prepared, and then analyzed by restriction enzyme digestion and/or sequenced by the method of Messing et al., Nucleic Acids Res. 9:309 (1981) or by the method of Maxam et al., Methods in Enzymology 65:499 (1980).
Host cells are transformed with the expression vectors of this invention. Thereafter they are cultured in appropriate culture media, e.g., containing substances for inducing promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
The secreted polypeptides (including bispecific antibodies) are recovered and purified from the culture supernatants or lysates of recombinant hosts. Typically, the supernatants are concentrated by ultrafiltration, contacted with a ligand affinity or immunoaffinity matrix so as to adsorb the adheson variant, and eluted from the matrix. Optionally, the bispec or adheson is purified by ion exchange chromatography.
The purified bispec is formulated into conventional
pharmacologically acceptable excipients. It is admimstered to patients having HIV infection at a dosage capable of maintaining a concentration of greater than about 100 ng of soluble bispec/ml plasma. For variants having different molecular weights, about 2 picomoles of soluble receptor per ml of plasma will be initially evaluated clinically in order to establish a stoichiometric equivalence with native (membrane bound) and soluble receptor. The ordinary initial dosage of a bispec is 100 μg/kg of patient weight/day. This initial dosage can be adjusted either upward or downward depending on the effects of the initial dosage.
A composition of the invention for use in vivo generally will contain a pharmaceutically acceptable carrier. By this is intended either solid or liquid material, which may inorganic or organic and of synthetic or natural origin,
with which the active component of the composition is mixed or formulated to facilitate administration to a subject. Inert materials in pharmaceutical compositions are also called excipients. Any other materials customarily employed in formulating pharmaceutical are suitable. Solid carriers include natural and synthetic cloisonne silicates, for example natural silicates such as diatomaceous earths; magnesium silicates, for example, talcs; magnesium aluminum silicates, for example attapulgites and vermiculites; aluminum silicates, for example kaolinites, montinorillonites, and micas; calcium carbonates; calcium sulfate; synthetic hydrated silicone oxides and synthetic calcium or aluminum silicates; elements such as carbon or sulfur; natural and synthetic resin such as polyvinyl alcohol; and waxes such as parafan and beeswax. Examples of suitable liquid carriers include water and aqueous solutions containing oxygenated organic compounds such as ethanol.
The therapeutic bispec can be employed by itself or with other therapies and agents for the treatment of AIDS, including AZT, neutralizing antibodies, immunocytotoxins, and vaccines.
In order to facilitate understanding of the following examples, certain frequently occurring methods and/or terms will be described.
"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available, publicly available on a restricted basis, or can be constructed from available plasmids in accord with published
procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a
larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
"Recovery" or "isolation" of a given fragment of DNA form a restriction digest means separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA. This procedure is known generally (Lawn, R. et al., Nucelic Acids Res. 9:6103-6114 [1981], and Goeddel, D. et al., Nucleic Acids Res.
8:4057 [1980]).
"Dephosphorylation" refers to the removal of the terminal 5' phosphates by treatment with bacterial alkaline phosphatase (BAP). This procedure prevents the two restriction cleaved ends of a DNA fragment from "circularizing" or forming a closed loop that would impede insertion of another DNA fragment at the restriction site. Procedures and reagents for
dephosphorylation and other recombinant manipulations are conventional.
Reactions using BAP are carried out in 50mM Tris at 68°C to suppress the activity of any exonuclease which may be present in the enzyme preparations. Reactions were run for 1 hours. Following the reaction the DNA fragment is gel purified.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (maniatis, T. et al., Id. at
146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amounts of the DNA fragments to be ligated.
"Filling" or "blunting" refers to the procedures by which the single stranded end in the cohesive terminus of a restriction enzyme-cleaved nucleic acid is converted to a double strand. This eliminates the cohesive terminus and forms a blunt end. This process is a versatile tool for converting a restriction cut end
that may be cohesive with the ends created by only one or a few other restriction enzymes into a terminus compatible with any blunt-cutting restriction endonuclease or other filled cohesive terminus. Typically, blunting is accomplished by incubating 2-15 μg of the target DNA in 10mM MgCl2, 1mM dithiothreitol, 50mM NaCl, 10mM Tris (pH 7.5) buffer at about 37°C in the presence of 8 units of the Klenow fragment of DNA polymerase I and 250 μM of each of the four deoxynucleoside triphosphates. The incubation generally is terminated after 30 min. phenol and chloroform extraction and ethanol precipitation.
The following examples merely illustrate the best mode now contemplated for practicing the invention, but should not be construed to limit the invention. Examples 1-4 are prior examples published in PCT/US88/03414 which show preparation of antibody/CD4 fusions that can be used to prepare bispecs of the invention, such as those described in Example 5. Example 1
Construction of Vectors for the Expression of Native CD4 and Secreted
Derivatives Section 1
The plasmid used for recombinant synthesis of human CD4 was pSVeCD4DHFR. The plasmid was constructed as follows:
XCD4P1 containing most of the coding sequence of human CD4 (obtained from a human placental cDNA library using oligonucleotide probes based on the published CD4 sequence [Maddon et al. 1985]) was digested with
EcoRI to produce cDNA insert. This fragment was recovered by polyacrylamide gel electrophoresis (Fragment 1).
pUC18 was digested with EcoRI and the single fragment recovered by polyacrylamide gel electrophoresis (Fragment 2). Fragment 1 was ligated to fragment 2 and the ligation mixture transformed into E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by
restriction analysis for the presence of the correct DNA fragments. This plasmid is referred to as pUCD4.
pSVeE'DHFR (Muesing et al., Cell 48:691-701 [1987]) was digested with KpnI and BamHI and blunted with E. coli DNA polymerase I
(Klenow fragment) and the four dNTPs. Fragment 3 containing the pML-Ampr region, SV40 early promoter, the HIV LTR, and the mouse DHFR gene was recovered by gel electrophoresis, ligated and the ligation mixture transformed into E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the BamHI restriction site and the absence of the KpnI restriction site. This plasmid is referred to as pSVeΔBKDHFR and allows EcoRI-BamHI fragments to be inserted after the SV40 early promoter and transcribed under its control, following transfection into an appropriate cell line.
Synthetic oligonucleotides (adaptors 1-8, below) were made to extend from 76 bp 5' of the initiation codon of CD4 translation to the RaaI restriction site at 121 bp 3' of the initiator, with the sequence AATT at the 5' end of the sense strand t generate an end which could ligate to an EcoRI restriction fragment. These oligonucleotides were ligated and the 204 bp fragment containing the entire sequence recovered by gel electrophoresis (Fragment 4).
CD4 adaptor 1: AATTCAAGCCCAGAGCCCTGCCATTTCTGTGGGCTC
AGGTCCCT CD4 adaptor 2: pACTGCTCAGCCCCTTCCTCCCTCGGCAAGGCCACA
ATGAACCGGGGAGTC
CD4 adaptor 3: pCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGCG
CTCCTCCCAGC CD4 adaptor 4: pAGCCACTCAGGGAAACAAAGTGGTGCTGGGCAAAA
AGGGGATACAGTGGAAGTGACCTGT CD4 adaptor 5: pACAGGTCAGTTCCACTGTATCCCCTTTTTTGCCCAG
CACCACTTTGTTTCC
CD4 adaptor 6: pCTGAGTGGCTGCTGGGAGGAGCGCCAGTTGCAGCA
CCAGAAGCAAGT CD4 adaptor 7: pGCCTAAAAGGGACTCCCCGGTTCATTGTGGCCTTG
CGAGGGAGGAAGGG CD4 adaptor 8: GCTGAGCAGTAGGGACCTGAGCCCACAGAAATGGCAGG
GCTCTGGGCTTG
pUCCD4 was digested with RsaI and SstI and the 401 bp fragment containing part of the CD4 coding sequence recovered by gel electrophoresis (Fragment 5). pUC18 was digested with EcoRI and SstI and the fragment comprising the bulk of the plasmid recovered by gel electrophoresis (Fragment 6).
Fragments 4 and 5 were ligated to Fragment 6 and the ligation mixture
transformed into E. coli strain 294. The transformed culture was plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the correct fragment. The sequence of the inserted synthetic DNA was checked by excising the 605 bp EcoRI-SstI fragments from several transformants and ligating them to M13mp19 which had been digested with the same enzymes. After transformation into E. coli strain JM101, single-stranded DNA was prepared and sequenced. One plasmid which contained the correct sequence was selected, and is referred to as pCD4int.
pCD4int was digested with EcoRI and SstI and fragment 7 containing the 5' end of the CD4 coding region was recovered by gel
electrophoresis. pUCCD4 was digested with SstI and BamHI and the 1139 bp fragment containing the remainder of the CD4 coding region (fragment 8)
recovered by gel electrophoresis.
pSVeΔBKDHFR was digested with EcoRI and BamHI and fragment 9 comprising the bulk of the plasmid was isolated. Fragments 7, 8, and 9 were ligated and the ligation mixture transformed into E. coli strain 294. The
transformed culture was plated on ampicillin media plates and the resistant colonies selected. Plasmid DNA was prepared from transformants and checked by restriction analysis for the presence of the correct fragment. This plasmid is
referred to as pSVeCD4DHFR, and was used to direct synthesis of recombinant intact CD4.
Example 2
Fusions of the V region of the CD4 gene, which is homologous to the variable region of immunoglobulin genes (ref. Maddon et al. 1985), to the constant (C) region of human immunoglobulin κ and γ2 chains are constructed as follows:
Synthetic DNA is made to code for the C region of human κ chain (residues 109-214) based on the sequence published by Morin et al., Proc. Natl.
Acad. Sci. 82:7025-7029, with the addition at the 5' end of the coding strand of the sequence GGGG, which allows this fragment to be ligated to the BspMI site at the end of the putative V-like region of CD4. At the 3' end of the coding region, a translatipnal stop codon is added as well as a sequence which allows this end to be ligated to BamHI restriction fragments. The synthetic DNA is made in 8 fragments, 4 for each strand, 70-90 bases long. These are then allowed to anneal and ligated prior to isolation on a polyacrylamide gel (fragment 33).
pRKCD4 is digested with EcoRI and BspMI and the 478bp fragment containing the region coding for the putative V-like domain of CD4 is recovered (fragment 34). Fragments 33 and 34 are ligated together with fragment 16 (from the expression vector pRK5). The ligation mixture is transformed into E. coli strain 294, the transformed culture plated on ampicillin media plates and resistant colonies selected. Plasmid DNA is prepared from transformants and checked by restriction analysis for the presence of the correct fragment. The resulting plasmid is referred to as pRKCD4Ck.
A plasmid encoding a fusion of the CD4 V-like domain to the human immunoglobulin Cγ2 region is constructed in a similar fashion, and is referred to as pRKCD4Cγ2. Both of these plasmids are transfected into 293 cells, myeloma cells or other competent cells in order to obtain cell lines expressing variant CD4 molecules as described above.
Example 3
Plasmids were constructed to direct the expression of proteins containing differing lengths of the ammo-terminal, extracellular domain of CD4 fused to the constant region of human immunoglobulin γ1. These plasmids are referred to as pRKCD42γ1, pRKCD4e4γ1, pRKCD42γ1, PRKCD41, and pRKCD4elγ1.
Plasmid pRKCD44γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for serine reside 366 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Plasmid pRKCD4e4γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for lysine residue 360 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Plasmid pRKCD42γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for glutamine residue 180 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Plasmid pRKCD4e2γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for leucine residue 117 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Plasmid pRKCD41γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for aspartic acid residue 105 of the mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Plasmid pRKCD4e1γ1 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for leucine residue 100 of the
mature CD4 polypeptide, immediately followed by the sequence coding for the constant region of human immunoglobulin γ1, starting at the codon for serine residue 114 of mature human immunoglobulin γ1 (Kabat et al.).
Construction of these plasmids required the prior construction of plasmid pRKCD4TP/γ1. It was constructed as follows:
A cDNA clone coding for human immunoglobulin γ1 was obtained from a human spleen cDNA library (Clontech Laboratories, Ine.) using oligonucleotides based on the published sequence (Ellison et al., Nucl. Acids Res. 10:4071-4079 [1982]), and an EcoRI-EagI fragment (the EcpRI site was contributed by a linker; see Figure 4a and b of PCT/US88/03414) containing part of the variable and all of the constant region was obtained. This fragment was blunted with Klenow fragment, and recovered by gel electrophoresis (Fragment al).
Plasmid pRKCD4TP-kk, encoding a substitutional variant of soluble CD4 (residues 1-368) containing a lysine residue instead of asparagine at position
1 of the mature polypeptide, was constructed from plasmid pRKCD4TP by sitedirected mutagenesis. A synthetic oligonucleotide was made as a primer for a mutagenesis reaction to obtain the desired coding sequence. This was synthesized as a 51-mer which contained two silent mutations from the natural sequence in addition to the substitution mutation, and 21 bases on each side of the mutated codons:
5' - CCC TTT TTT GCC CAG GAC CAC CTT CTT GCC CTG¬
AGT GGC TGC TGG GAG GAG -3'
Plasmid pRKCD4TP was transformed into E. coli strain SR101 and the transformed colonies plated on ampicillin media plates. Resistant colonies were selected and grown in the presence of m13K07 helper bacteriophage to yield secreted, encapsidated single-stranded templates of pRKCD4TP. The single-stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers. The mutagenesis reaction was transformed E. coli SR101 and the transformed culture plated on ampicillin media plates. Transformants were screened by colony
hybridization (ref . Grunstein-Hogness) for the presence of the appropriate sequence, using the following 16 mer as the probe.
5' - C CAC CTT CTT GCC CTG -3'
The hybridization conditions chosen were sufficiently stringent that the probe only detects the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain SR101. The transformed cultures were plated on ampicillin media plates, and resistant colonies were selected and grown in the presence of m13K07 bacteriophage. Templates were prepared as above and screened by sequencing.
Plasmid pRKCD4TP-kk was digested with Xbal and treated with
Klenow Enzyme, and Fragment a2, containing the linearized plasmid was recovered by gel electrophoresis, and ligated with fragment al. The ligation mixture as transformed into E. coli strain 294, the transformed culture plated on ampicillin media plates and resistant colonies selected. Plasmid DNA was prepared from the transformants and checked by restriction analysis for the presence of the correct fragment in the correct orientation (i.e., the
immunoglobulin coding region in the same orientation as the CD4 coding region, and at the 3' end of the CD4 coding region). This plasmid is referred to as pRKCD4TP/γ1.
Synthetic oligonucleotides were made as primers for deletional mutagenesis reactions to fuse the appropriate coding sequence of IgG1 and CD4 as described above. These were synthesized as 48-mers comprising 24 nucleotides on each side of the desired fusion site (i.e., corresponding to the COOH-terminal 8 residues of the desired immunoglobulin moiety). Plasmid pRKCD4TP/γ1 was transformed into E. coli strain SR101 and the transformed cultures plated on ampicillin media plates. Resistant colonies were selected and grown in the presence of ml3K07 helper bacteriophage to yield secreted, encapsidated single-stranded templates of pRKCD4TP/γ1. The single-stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers. The mutagenesis reactions were transformed E. coli SR101 and the transformed culture plated on ampicillin media plates. Transformants were screened by colony hybridization (ref. Grunstein-
Hogness) for the presence of the appropriate fusion site, using lόmers as probes. These lόmers comprise 8 bases on either side of the fusion site, and the hybridization conditions chosen were sufficiently stringent that the probes only detect the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain SR101. The transformed cultures were plated on ampicillin media plates, and resistant colonies were selected and grown in the presence of m13K07 bacteriophage. Templates were prepared as above and screened by sequencing.
The plasmids were transfected into 293 cells using standard procedures and assayed for expression and production as described above.
Expressed Secreted pRKCD41γ1 + - pRKCD4e2γ1 + +
pRKCD42γ1 + +
pRKCD4e4γ1 + +
PRKCD44γ1 + + Plasmids also were constructed to direct the expression of fusion proteins containing differing lengths of the ammo-terminal, extracellular domain of CD4 fused to the truncated portion of the constant region of human
immunoglobulin γ1, comprising only the hind region and constant domains CH2 and CH3.
Synthetic oligonucleotides were made as primers for mutagenesis reactions to delete the immunoglobulin sequence from Ser114 to Cys215 inclusive (Kabat et al.). These were synthesized as 48-mers comprising 24 nucleotides on each side of the desired fusion site (i.e., corresponding to the COOH-terminal 8 residues of the desired CD4 moiety, and the NH2-terminal 8 residues of the desired immunoglobulin moiety). Plasmids pRKCD44γ1, pRKCD42 γ and the transformed culture plated on ampicillin media plates. Resistant colonies were selected and grown in the presence of m13K07 helper bacteriophage to yieldd
secreted, encapsidated single-stranded templates of these plasmids. The single- stranded plasmid DNA was isolated and used as the template for mutagenesis reactions with the synthetic oligonucleotides described above as primers. The mutagenesis reactions were transformed E. coli SR101 and the transformed culture plated on ampicillin media plates. Transformants were screened by colony hybridization (Grunstein-Hogness) for the presence of the appropriate fusion sites, using 16mers as probes. These 16mers comprise 8 bases on either side of the fusion site, and the hybridization conditions chosen were sufficiently stringent that the probes only detect the correctly fused product. Colonies identified as positive were selected and plasmid DNA was isolated and transformed into E. coli strain
SR101. The transformed cultures were plated on ampicillin media plates, and resistant colonies were selected and grown in the presence of m13K07
bacteriophage. Templates were prepared as above and screened by sequencing.
The plasmid derived from plasmid pRKCD44γ1 is referred to as pRKCD4rFc1, that derived from plasmid pRKCD42γ1 is referred to as
pRKCD42Fcl and that derived from plasmid pRKCD41γ1 is referred to as pRKCD41Fc1.
pRKCD42Fc1, pRKCD41Fc1 and PRKCD44Fc1 are cultured in the same fashion as described above and CHI-deleted CD4 immunoadhesons recovered as described elsewhere herein.
Light Chain Fusions
Plasmids were constructed to direct the expression of proteins containing differing lengths of the amino terminal, extracellular domain of CD4 fused to the constant region of human immunoglobulin JC. These plasmids are referred to as pRKCD44κ, and pRKCD4e4κ.
Plasmid pRKCD44 contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for serine residue 366 of the mature CD4 polypeptide, immediately followed by the sequence for the constant region of human immunoglobulin κ, starting at the codon for threonine residue 109 of the mature human immunoglobulin κ. (Kabat et al.)
Plasmid pRKCD4e4κ contains the portion of the CD4 gene from the initiation codon to the fusion site after the codon for lysine residue 360 of the mature CD4 polypeptide, immediately followed by the sequence for the constant region of human immunoglobulin JC, starting at the codon for threonine residue 109 of the mature human immunoglobulin JC. (Kabat et al.)
These plasmids were constructed in a manner analogous to plasmids pRKCD44 γ1 and pRKCD4e4γ1 described above, with the following exception:
The human immunoglobulin κ coding sequence (Figure 5 of
PCT/US88/03414) was obtained from a human spleen cDNA library (Clontech Laboratories, Inc.) using oligonucleotides based on the published sequence (Hieter,
P. A. et al., Cell 22:197-207 [1980]), and an EcoRI-BspMI fragment containing part of the variable region and the entire constant region was obtained (see Figure 5 of PCT/US88/03414). This fragment was blunted with Klenow fragment and the four dNTPs. This fragment was used instead of fragment al, and was used to construct plasmid pRKCD4TP/hjc.
Expression in CHO Cells
Plasmids were or are constructed to direct the expression of the immunoadhesons described above in CHO cells. These are referred to as pSVeCD44γSVDHFR, pSVeCD42γ1SVDHFR, pSVeCD41γSVDHFR,
pSVeCD434γ1SVDHFR, pSVeCD4e2γ1SVDHFR, pSV3CD4e1γ1SVDHFR, pSVeCD44Fc1SVDHFR, pSVeCD42Fc1SVDHFR, pSVeCD41Fc1SFCHFR, pSVeCD44κSVDHFR and pSV3CD42κSVDHFR.
Fragment 31 was prepared as described above. Fragment 32a was prepared by digesting plasmid pE348HBV.E400 D22 with BamHI, blunting with
Klenow fragment and the four dNTPs, then digesting with PyuI and isolating the large fragment containing the balance of the β-lactamase gene and the SV40 early promoter and the DHFR gene. Plasmids pRKCD44γ1, pRKCD42 γ1,
pRKCD41γ1, pRKCD4e4γ1, pRKCD4e2γ1, pRKCD4e1γ1, pRKCD44Fc1, pRKCD42FC1, pRKCD44κ and pRKCD42κ were separately digested with HindIII, blunted with Klenow fragment and the four dNTPs, then digested with EcoRI and the fragments encoding the CD4-Ig fusion protein were isolated. The resulting
DNA fragments were ligated together with fragments 31 and 32a and transformed into E. coli strain 294. Colonies were selected and checked for the presence of the correct plasmid as above, then transferred into CHO cells and amplified by methotrexate selection using conventional procedures.
Example 4
Culture, Purification and formulation of CD4 variants
Plasmids encoding soluble CD4 immunoadhesons were calcium phosphate transfected into CHO-DP7 (a proinsulin-transformed autocrine host cell derived from CHO; U.S.S.N. 97,472) and the transformants grown in selective medium (1:1 HAM F12/DMEM GHT containing 1-10% diafiltered or dialyzed bovine serum). Other suitable host cells are CHO cells or 293S human embryonic kidney cells. The transformants were amplified by methotrexate. The plasmid that was integrated in the genome of the transfectoma was generated by cutting out an EcoRI - SfiI fragment from the CD4γ1 plasmid, filling the ends, and blunt end-ligating the fragment into the XbaI site of the pcDEB vector, which contains the hygromycin resistance gene.
The general procedure for purifying a variety of CD4 proteins was as follows. Specific parameter values (e.g., pH) in this paragraph are for a soluble CD4 variant consisting essentially of the first four domains (expressed in soluble form) known as CD4TP. Culture fluid from CD4 transformants was concentrated and diafiltered to lower the ionic strength. The concentrate was passed through a large volume of Q-Sepharose anion exchange resin (previously equilibrated with 25 mM NaCl, pH 8.5) in order to adsorb contaminants from the culture fluid. The unadsorbed culture fluid from the anion exchange resin step was then passed through a cation exchange resin (previously equilibrated with 25 mM NaCl at pH 8.5) whereby the CD4 variant was adsorbed to the resin. The protein was eluted with a NaCl gradient at pH 8.5. Ammonium sulfate was added to the eluate to a concentration of 1.7M and the solution passed through a column of hydrophobic interaction chromatography resin (phenyl or butyl
Sepharose). The protein was eluted from the hydrophobic interaction column with a gradient of ammonium sulfate. The eluate was concentrated and buffer exchanged on a G-25 column using phosphate buffered saline containing .02% (w/v) Tween 20 or Tween 80. Other polymeric nonionic surfactants are suitably used with the CD4 formulations, including Pluronic block copolymers or polyethylene glycol.
It is also possible to employ immunoaffinity purification of soluble CD4 variants wherein the CD4 is adsorbed onto an immobilized antibody against CD4. This method suffers from the disadvantage that elution of the soluble CD4 under acidic conditions leads to protein aggregation that is only thoroughly ameliorated at relatively higher levels of surfactant. The foregoing procedure permits the use of much lower quantities of surfactant, about from 0.01 to 0.10% (w/v) surfactant.
The procedure followed for the purification of CD4 fusions with immunoglobulin heavy chain was to concentrate recombinant supernatants by ultrafiltration and thereafter adsorb the fusion onto resin-immobilized
Staphylococcal protein A. The fusion was eluted with 0.1M citrate buffer pH 3 with no salt or detergent. This preparation is buffered into Tris buffer at pH 7.5. The immunoglobulin fusions with CD4 V1-V4 optionally are further purified by the procedure described above for unfused CD4 variants (i.e., the general procedure of this Example). CD4 immunoglobulin fusions with CD4 V1-V2 also may be purified by the procedure above, except that it is not expected that the isoelectric point of this class of molecules will be as alkaline as that of species ∞ntajhing all four V regions of CD4.
Example 5
We cloned the gene encoding the fusion polypeptide CD4γ1 (CD4 V1-V4 fused to γ1) described above into a vector that allows expression in mouse cells and transfected it into hybridoma M-T301, which secretes a γ1,κ anti-human CD3 antibody. This antibody can activate T cells when added in polymerized form. This particular hybridoma and anti-human CD3 antibody were selected for convenience only. The same transfection process can be carried out with other
hybridomas that produce anti-CD3 antibodies in order to produce bispecific antibodies of the invention.
The bispecific antibody produced in this example is shown schematically in Figure 2. Figure 3a shows an autoradiograph of biosynthetically labeled intracellular proteins obtained from the hybridoma of this invention precipitated with antibody to mouse γ1 chain (lanes 2 and 3). A 92 kd polypeptide representing CD4γ1 is precipitated from the transfected (lane 3), but not from the untransfected cell line (lane 2). Some of the CD4γ1 is secreted (Figure 3b) in association with the κ chain of M-T301, this dimer being linked to the heavy(H) X light(L) chain pair of M-T301. In addition, there are other combinations of the three polypeptide chains present in the transfectoma; this can be deduced from the molecular weights of the unreduced molecules (Figure 3c, lane 4). Furthermore, we have rerun lane 4 of Figure 3c under reducing conditions, confirming that some of the molecules contain CD4γ1, H and L chain (Figure 3d).
From the supernatant of the transfectoma, we then purified bispecs by binding them to and later eluting them from an affinity column consisting of monoclonal antibody to CD4, which separated them from bivalent anti-CD3 antibodies, which passed through the column. Electrophoresis of this material on a polyacrylamide gel revealed equal proportions of two kinds of molecules: a bivalent monospecific tetramer consisting of CD4γ1 and κ, and the desired bispec with the composition κ, CD4γ1, γ, κ (Figure 3e). Thus the CD4γ1 chain is linked to κ and pairs with the H x L chain half of IgG1 molecule of M-T301 (Figure 3f). The rather large CD4γ1 is not sterically hindered from being linked to the γ1 chain, probably because of the flexibility of the hinge region, which allows the amino ends of the polypeptides to move apart. The κ chain is also not hindered from forming a disulfide bridge with the CD4γ1 chain.
The ability of the bispecs to mediate killing of HIV-infected cells by nonspecific cytotoxic T cells was tested with a chromium release assay that we developed. As target cells, we used CD4-expressing HeLa cells, which we had infected with HIV. The percentage of infected cells was assessed by
immunofluorescence using a monoclonal antibody to viral p24 in the cytoplasm
and the monospecific CD4g1, κ antibody for testing expression of membrane gp120. From the bulk culture we subcloned lines in which greater than 90% of the cells stably expressed these proteins. As effector cells we used clones of the human cytotoxic T cell line MX66, which is specific for influenza virus matrix protein when presented on human cells expressing the histocompatibility antigen
A2. At an effector:target ratio of 1:1 the MX66 cells did not show significant killing of the CD3-positive HUT 78 cell line; however, when M-T301 antibody, which is specific to CD3, was added, good killing was seen. (Table 3). This confirms that M-T301 antibody is able to mediate the killing of non-cognate target cells, by activating the MX66 cells and linking them to these targets.
Thus, this is a suitable system for testing the bispecs.
In the experimental work that provided the data set out in Table 3, target cells were incubated with antibodies at one or more concentrations (or with no antibody), washed, and cells of the cytotoxic T cell line MX66 (effector cells) (obtained from H. Spits, DNAX, Palo Alto) were added at a ratio of 0.5:1 or
1:1, or as a control, medium with no effector cells was added (no E). Targets were one of the following: HeLa cells expressing CD4 and infected with HIV- LAV I (HeLa LAV I); or not infected (HeLa); or allogeneic cell line HUT 78. Antibodies were one of the following: anti-CD3 monoclonal antibody M-T301; bispecific antibodies (bispecs) with one arm specific for CD3 (derived from M- T301) and the other arm specific for gp120 (derived from CD4g1); a 1:1 mixture of M-T301 and CD4g1 (antibody mixture). The values in the body of the table are the percentages of cells killed (resulting 51Cr release) as calculated from the formula: %lysis = (cpm experimental release - cpm spontaneous release) : (cpm maximal release - cpm spontaneous release) × 100. Spontaneous release was always less than 15% of maximal release. Maximum release was determined after lysis with 1N HCl.
In Experiment II the background killing, i.e., chromium release in the presence of effector cells but in the absence of antibodies, is higher than in Experiment I. This commonly observed non-specific killing by T cell clones is thought to depend on culture conditions. Furthermore, in Exp. II the mixture of monospecific antibodies also resulted in some killing of the infected, but not the uninfected, cells. In Exp. II the M-T301 antibody was purified from
transfectoma supernatant and presumably contained small amounts of bispecs. In Exp. I, the M-T301 antibody was purified from M-T301 hybridoma supernatant, and thus must have been free of such contamination.
In summary, Table 3 shows that bispecs are effective in killing HW-infected cells in vitro. In Experiment I HeLa.T4 cells, whether HIV-infected or not, were not killed by effector cells alone. However, when we added our bispecs at a concentration of 1.6 μg/ml, 26.8% of infected cells were killed at an effector:target ratio of 0.5:1, while the uninfected cells were not killed. At an effector:target ratio of 1:1, 40% of the infected, but only 2% of
uninfected cells were killed. A mixture of equal parts of bivalent CD4γ1, κ tetramers and M-T301 antibodies did not cause killing (below 0.7%). The effect of the bispecs diminished at a lower concentration and was absent at 16 ng/ml. However, in Experiment II this concentration was still effective (in another experiment not shown, 1.6 ng/ml showed some effect). As mentioned above, the bispec preparation contained an equal amount of monospecific bivalent CD4γ1, κ tetramers, which do not help the killing, but which, due to their superior avidity (two binding sites vs. one), may rather prevent bispecs from binding to the target cells. Further purification of the bispecs should yield preparations that are somewhat more efficient. To alleviate the necessity for a tedious purification, mutations in the γ chains that allow only heterologous pairing, i.e. VHγ1 with CD4γ1, can be selected.
All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
The invention now being fully described, it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims.
Table 3 ( page 1 )
% specific 51Cr release from target cells
HUT 78 HeLa.LAV I HeLa
Antibody conc, Effector:Target Effector:Target Effector:Target
μg/ml 0.5: 1 1: 1 0.5:1 1:1 no E 0.5: 1 1 :1 no E no antibody ╌ 0 0,4±0.2 0 0.7±1,2 ╌ 1.6±1.7 1.7±0.8 ╌
M-T301 ~2 34.2±2.3 48.3±1 ,9 ╌ ╌ ╌ ╌ ╌ ╌ bispec 1.6 ╌ ╌ 26.8±3.0 40.3±3.3 0 0.3±0.6 2.2±0.4 0
0.16 ╌ ╌ 9.8±1.7 14.6±2.1 0.9±1.2 0.8±0.8 0.5±0.6 0
0.016 ╌ ╌ 0,9±1.6 3.2±1.5 0 0.4±0.1 1.7±1.8 0
0.0016 ╌ ╌ 2.3±0.9 0.9±1.2 0 0 0 0
0.00016 ╌ ╌ 0.9±0.6 2.0±2.2 0 0.2±0.3 0.9±1.4 0 antibody 1.6 ╌ ╌ 0 0 0 0.2±0.9 0.7±0.8 0 mixture
0.16 ╌ ╌ 0 0.2±1.8 0 0 0.3±0.9 0
Table 3 ( page 2)
% specific 51Cr release from target cells
HUT 78 HeLa LAV 1 HeLa
Antibody conc. Effector:Target Effector:Target Effector:Target
μg/ml 0.5: 1 1:1 0.5: 1 1 : 1 no E 0.5: 1 1: 1 no E no antibody ╌ 0.3±0.8 1.5±0.5 3.5±1.6 8.2±1.9 ╌ 0 0 ╌
M-T301 ~2 53.3±1.2 64.6±4.0 ╌ ╌ ╌ ╌ ╌ ╌ bispec 1.6 ╌ ╌ 49.0±5.4 67.2±3.2 0.8±0.7 4.3±1.9 6.0±1.5 0
0.16 ╌ ╌ 31.6±3.5 44.6±2.8 1.0±0.8 0 1.1±2.1 0
0.016 ╌ ╌ 10.7±0.4 16.0±2.5 0.4±1.3 0 0.8±2.0 0
0.0016 ╌ ╌ 3.1±2.0 5.7±0.2 0 0 2.7±1.3 0
0.00016 ╌ ╌ 1.9± 1.7 7.0±1.0 0 0 0 0 antibody 1.6 ╌ ╌ 1 1.1±0.5 17.5±1.2 0 0 0 0 mixture
0.16 ╌ ╌ 6.6±0.5 1 1.3±1.1 0.1±0.7 0 0 0
Claims
1. A method for directing a cytotoxic T cell to an HIV-infected cell, which comprises:
contacting said infected cell with a bispecific proteinaceous molecule comprising two binding domains, wherein said first binding domain comprises a CD4 region that binds to HTV gp120 and said second binding domain comprises an anti-CD3 binding region, wherein said molecule is other than a molecule consisting essentially of a CD4 variable region domain or domains that bind to both HTV gp120 and class II MHC antigen fused to a complete antibody constant region as one half of a bispecific antibody in which the second half of said bispecific antibody is a complete light/heavy antibody chain pair specific for CD3.
2. The method of Claim 1, wherein said bispecific molecule is a bispecific antibody with a deletion of a binding region specific for Fc receptor or a deletion of a CD4 binding region for class II MHC antigen.
3. The method of Claim 2, wherein said first binding domain comprises a CD4 domain or domains that is fused to an antibody constant region to form a chimeric antibody chain.
4. The method of Claim 3, wherein said second binding domain comprises a variable region domain of an anti-CD3 antibody chain.
5. The method of Claim 1, wherein said first binding domain and said second binding domain are different regions of a single polypeptide chain.
6. The method of Claim 5, wherein said polypeptide chain comprises an N- terminus and a C-terminus and each of said first and second binding domains is located at one or the other of said termini.
7. The method of Claim 6, wherein said first binding domain is located at said N-terminus and said second binding domain is located at said C-terminus.
8. The method of Claim 7, wherein said first binding domain contains V1V2 domains of CD4.
9. The method of Claim 7, wherein said first binding domain contains V1V2V3V4 domains of CD4.
10. The method of Claim 1, wherein said bispecific molecule is present at a concentration of from at least 16 ng/ml in contact with said infected cell.
11. The method of Claim 1, wherein said cytotoxic T cell is a member of a collection of cytotoxic T cells and said cytotoxic T cells are present at a ratio of from 0.1:1 to 10:1, relative to infected cells, while in contact with said bispecific molecule and HIV-infected cells.
12. The method of Claim 1, wherein said infected cells are located in vivo.
13. A pharmaceutical composition for directing a cytotoxic T cell to an HIV-infected cell in vivo, which comprises:
a bispecific proteinaceous molecule comprising two binding domains, wherein said first binding domain comprises a CD4 region that binds to HIV gp120 and said second binding domain comprises an anti-CD3 binding region and a pharmaceutically acceptable carrier.
14. The composition of Claim 13, wherein said bispecific molecule is a bispecific antibody.
15. The composition of Claim 13, wherein said first binding domain consists essentially of a CD4 variable region domain or domains and said second binding domain consists essentially of an anti-CD3 antibody variable region domain or domains.
16. The composition of Claim 13, wherein said first binding domain comprises a CD4 variable region domain or domains that is fused to an antibody constant region to form a chimeric antibody chain.
17. The composition of Claim 16, wherein said second binding domain comprises a variable region of an anti-CD3 antibody chain.
18. The composition of Claim 13, wherein said first binding domain and said second binding domain are different regions of a single polypeptide chain.
19. The composition of Claim 18, wherein said polypeptide chain comprises an N-terminus and a C-terminus and each of said first and second binding domains is located at one or the other of said termini.
20. The composition of Claim 19, wherein said first binding domain is located at said N-terminus and said second binding domain is located at said C-terminus.
21. The composition of Claim 13, wherein said first binding domain contains V1V2 domains of CD4.
22. The composition of Claim 13, wherein said first binding domain contains V1V2V3V4 domains of CD4.
23. The composition of Claim 13, wherein said composition further comprises a second active component suitable for treating HIV-I infection.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US78737891A | 1991-11-04 | 1991-11-04 | |
US787,378 | 1991-11-04 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO1993008829A1 true WO1993008829A1 (en) | 1993-05-13 |
Family
ID=25141289
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US1992/009550 WO1993008829A1 (en) | 1991-11-04 | 1992-11-04 | Compositions that mediate killing of hiv-infected cells |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO1993008829A1 (en) |
Cited By (1141)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0871726A1 (en) * | 1995-02-06 | 1998-10-21 | Cell Genesys, Inc. | Multispecific chimeric receptors |
US5851984A (en) * | 1996-08-16 | 1998-12-22 | Genentech, Inc. | Method of enhancing proliferation or differentiation of hematopoietic stem cells using Wnt polypeptides |
US5990281A (en) * | 1996-09-30 | 1999-11-23 | Genentech, Inc. | Vertebrate smoothened proteins |
US6030945A (en) * | 1996-01-09 | 2000-02-29 | Genentech, Inc. | Apo-2 ligand |
WO2000018806A1 (en) * | 1998-09-25 | 2000-04-06 | Horst Lindhofer | Bispecific and trispecific antibodies which specifically react with inducible surface antigens as operational target structures |
US6121428A (en) * | 1997-06-13 | 2000-09-19 | Genentech, Inc. | Protein recovery |
US6136958A (en) * | 1996-09-30 | 2000-10-24 | Genentech, Inc. | Antibodies to vertebrate smoothened proteins |
US6159462A (en) * | 1996-08-16 | 2000-12-12 | Genentech, Inc. | Uses of Wnt polypeptides |
WO2001029070A2 (en) | 1999-10-20 | 2001-04-26 | Genentech, Inc. | Modulation of t cell differentiation for the treatment of t helper cell mediated diseases |
US6270987B1 (en) | 1997-01-31 | 2001-08-07 | Genentech, Inc. | O-fucosyltransferase |
US6291643B1 (en) | 1997-06-05 | 2001-09-18 | Board Of Reports, The University Of Texas System | Apaf-1 an activator of caspase-3 |
US6342369B1 (en) | 1997-05-15 | 2002-01-29 | Genentech, Inc. | Apo-2-receptor |
WO2002016625A2 (en) | 2000-08-25 | 2002-02-28 | Basf Plant Science Gmbh | Plant polynucleotides encoding prenyl proteases |
WO2002030463A2 (en) | 2000-10-12 | 2002-04-18 | Genentech, Inc. | Reduced-viscosity concentrated protein formulations |
WO2002060485A2 (en) | 2001-01-31 | 2002-08-08 | Idec Pharmaceuticals Corporation | Use of immunoregulatory antibodies in the treatment of neoplastic disorders |
US6462176B1 (en) | 1996-09-23 | 2002-10-08 | Genentech, Inc. | Apo-3 polypeptide |
US6469144B1 (en) | 1996-04-01 | 2002-10-22 | Genentech, Inc. | Apo-2LI and Apo-3 polypeptides |
WO2004010957A2 (en) | 2002-07-31 | 2004-02-05 | Seattle Genetics, Inc. | Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease |
US6723840B1 (en) | 1998-01-23 | 2004-04-20 | The Regents Of The University Of California | Identification and expression of a novel kinesin motor protein |
US6727079B1 (en) | 1998-02-25 | 2004-04-27 | The United States Of America As Represented By The Department Of Health And Human Services | cDNA encoding a gene BOG (B5T Over-expressed Gene) and its protein product |
US6740739B1 (en) | 1998-01-15 | 2004-05-25 | Genentech, Inc. | Substitutional variants of APO-2 ligand |
US6746668B2 (en) | 1996-01-09 | 2004-06-08 | Genentech, Inc. | Apo-2 ligand |
US6764679B2 (en) | 1997-09-18 | 2004-07-20 | Genentech, Inc. | Antibodies to DcR3 Polypeptide, a TNFR Homolog |
WO2004112572A2 (en) | 2003-06-13 | 2004-12-29 | University Of Pittsburgh | Monitoring immunologic, hematologic and inflammatory diseases |
WO2005062972A2 (en) | 2003-12-23 | 2005-07-14 | Tanox, Inc. | Treatment of cancer with novel anti-il 13 monoclonal antibodies |
WO2005070963A1 (en) | 2004-01-12 | 2005-08-04 | Applied Molecular Evolution, Inc | Fc region variants |
WO2005084390A2 (en) | 2004-03-02 | 2005-09-15 | Seattle Genetics, Inc. | Partially loaded antibodies and methods of their conjugation |
WO2006003407A2 (en) | 2004-07-01 | 2006-01-12 | Glaxo Group Limited | Chimeric and humanised monoclonal antibodies against inteleukin- 13 |
WO2006024354A1 (en) * | 2004-08-30 | 2006-03-09 | Schering Aktiengesellschaft | Treatment of hiv infection by t-cell modulation |
WO2006074418A2 (en) | 2005-01-07 | 2006-07-13 | Diadexus, Inc. | Ovr110 antibody compositions and methods of use |
WO2006108273A1 (en) | 2005-04-11 | 2006-10-19 | National Research Council Of Canada | Identification of a beta-1,3-n-acetylgalactosaminyltransferase (cgte) from campylobacter jejuni lio87 |
WO2006113402A1 (en) | 2005-04-14 | 2006-10-26 | Genentech, Inc. | Methods and compositions for modulating and detecting wisp activity |
WO2006132670A2 (en) | 2004-11-12 | 2006-12-14 | Seattle Genetics, Inc. | Auristatins having an aminobenzoic acid unit at the n terminus |
WO2007011968A2 (en) | 2005-07-18 | 2007-01-25 | Seattle Genetics, Inc. | Beta-glucuronide-linker drug conjugates |
WO2007048849A1 (en) * | 2005-10-28 | 2007-05-03 | Novo Nordisk A/S | Fusion proteins that bind effector lymphocytes and target cells |
WO2007068750A2 (en) | 2005-12-16 | 2007-06-21 | Glaxo Group Limited | Immunoglobulins directed against nogo |
WO2007068784A1 (en) | 2005-12-14 | 2007-06-21 | Licentia Ltd | Novel neurotrophic factor protein and uses thereof |
US7235633B2 (en) | 2000-03-21 | 2007-06-26 | Genentech, Inc. | Cytokine receptors and nucleic acids encoding the same |
US7256257B2 (en) | 2001-04-30 | 2007-08-14 | Seattle Genetics, Inc. | Pentapeptide compounds and uses related thereto |
EP1820859A2 (en) | 1998-12-22 | 2007-08-22 | Genentech, Inc. | Methods and compositions for inhibiting neoplastic cell growth |
EP1865061A2 (en) | 1998-05-15 | 2007-12-12 | Genentech, Inc. | IL-17 homologous polypeptides and therapeutic uses thereof |
WO2007141280A2 (en) | 2006-06-06 | 2007-12-13 | Oxford Genome Sciences (Uk) Ltd | Proteins |
US7314623B2 (en) | 2002-07-15 | 2008-01-01 | Wyeth | Methods and compositions for modulating T helper (Th) cell development and function |
WO2008011081A2 (en) | 2006-07-19 | 2008-01-24 | The Trustees Of The University Of Pennsylvania | Wsx-1/p28 as a target for anti-inflammatory responses |
EP1887014A1 (en) | 1997-10-17 | 2008-02-13 | Genentech, Inc. | Human toll homologues |
WO2008021290A2 (en) | 2006-08-09 | 2008-02-21 | Homestead Clinical Corporation | Organ-specific proteins and methods of their use |
WO2008036135A2 (en) | 2006-06-01 | 2008-03-27 | Genentech, Inc. | Crystal structure of crig and c3b: crig complex |
WO2008052187A2 (en) | 2006-10-27 | 2008-05-02 | Genentech. Inc. | Antibodies and immunoconjugates and uses therefor |
WO2008060776A2 (en) | 2006-10-03 | 2008-05-22 | University Of Medicine And Dentistry Of New Jersey | Atap peptides, nucleic acids encoding the same and associated methods of use |
EP1933150A1 (en) | 2002-05-07 | 2008-06-18 | Institut Pasteur | Methods of screening of PP1-interacting polypeptides or proteins, peptides inhibiting PP1c binding to Bcl-2 proteins, BCL-XL and BCL-W, and uses thereof |
EP1941905A1 (en) | 1998-03-27 | 2008-07-09 | Genentech, Inc. | APO-2 Ligand-anti-her-2 antibody synergism |
EP1944317A2 (en) | 2000-09-01 | 2008-07-16 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
EP1947119A2 (en) | 1997-12-12 | 2008-07-23 | Genentech, Inc. | Treatment of cancer with anti-erb2 antibodies in combination with a chemotherapeutic agent |
EP1950300A2 (en) | 1998-11-18 | 2008-07-30 | Genentech, Inc. | Antibody variants with higher binding affinity compared to parent antibodies |
EP1953173A1 (en) | 1999-06-15 | 2008-08-06 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids endoding the same |
EP1961428A1 (en) | 2002-04-02 | 2008-08-27 | Ucb S.A. | SC6 antibody for treatment of cancer |
WO2008103962A2 (en) | 2007-02-22 | 2008-08-28 | Genentech, Inc. | Methods for detecting inflammatory bowel disease |
EP1967587A1 (en) | 1997-10-10 | 2008-09-10 | Genentech, Inc. | APO-3 Ligand |
WO2008118324A2 (en) | 2007-03-26 | 2008-10-02 | Macrogenics, Inc. | Composition and method of treating cancer with an anti-uroplakin ib antibody |
EP1983000A2 (en) | 2003-11-21 | 2008-10-22 | UCB Pharma, S.A. | Method for the treatment of multiple sclerosis by inhibiting IL-17 activity |
EP1992643A2 (en) | 2001-06-20 | 2008-11-19 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP1995321A2 (en) | 2005-08-15 | 2008-11-26 | Genentech, Inc. | Gene disruptions, compositions and methods relating thereto |
WO2008150525A1 (en) | 2007-06-04 | 2008-12-11 | Genentech, Inc. | Anti-notch1 nrr antibodies and methods using same |
EP2002714A1 (en) | 2005-11-21 | 2008-12-17 | Genentech, Inc. | Novel gene disruptions, compositions and methods relating thereto |
EP2011873A2 (en) | 1994-05-27 | 2009-01-07 | Genentech, Inc. | Tumor necrosis factor receptor-associated factors |
EP2011886A2 (en) | 2002-04-16 | 2009-01-07 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP2014298A2 (en) | 2000-08-24 | 2009-01-14 | Genentech, Inc. | Interleukin-22 polypeptides, nucleic acids encoding the same and methods for the treatment of pancreatic disorders |
EP2014677A1 (en) | 1997-11-21 | 2009-01-14 | Genentech, Inc. | A-33 related antigens and their pharmacological uses |
EP2014303A2 (en) | 2000-07-27 | 2009-01-14 | Genentech, Inc. | APO-2L receptor agonist and CPT-11 synergism |
EP2014770A2 (en) | 1997-10-29 | 2009-01-14 | Genentech, Inc. | WNT-1 Iinduced secreted polypeptide WISP-2 |
EP2014675A1 (en) | 2003-08-11 | 2009-01-14 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2016951A1 (en) | 1998-03-17 | 2009-01-21 | Genentech, Inc. | Polypeptides homologous to VEGF and BMP1 |
EP2033970A2 (en) | 1997-10-29 | 2009-03-11 | Genentech, Inc. | WNT-1 inducible genes |
WO2009035791A1 (en) | 2007-08-02 | 2009-03-19 | Arresto Biosciences | Lox and l0xl2 inhibitors and uses thereof |
EP2042597A1 (en) | 2000-06-23 | 2009-04-01 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
WO2009044208A1 (en) | 2007-10-03 | 2009-04-09 | Oxford Genome Sciences (Uk) Limited | Protein |
EP2048154A1 (en) | 2002-02-05 | 2009-04-15 | Genentech, Inc. | Protein purification |
EP2050762A2 (en) | 1998-03-10 | 2009-04-22 | Genentech, Inc. | Novel polypeptides and nucleic acids encoding the same |
EP2050335A1 (en) | 2006-02-17 | 2009-04-22 | Genentech, Inc. | Gene disruptions, compositions and methods relating thereto |
WO2009052081A2 (en) | 2007-10-15 | 2009-04-23 | Sanofi-Aventis | Antibodies that bind il-4 and/or il-13 and their uses |
WO2009052431A2 (en) | 2007-10-19 | 2009-04-23 | Seattle Genetics, Inc. | Cd19 binding agents and uses thereof |
EP2052742A1 (en) | 2000-06-20 | 2009-04-29 | Biogen Idec Inc. | Treatment of B-cell associated diseases such as malignancies and autoimmune diseases using a cold anti-CD20 antibody/radiolabeled anti-CD22 antibody combination |
WO2009054873A2 (en) | 2007-08-02 | 2009-04-30 | Novimmune S.A. | Anti-rantes antibodies and methods of use thereof |
EP2058334A2 (en) | 1998-06-12 | 2009-05-13 | Genentech, Inc. | Monoclonal antibodies, cross-reactive antibodies and method for producing the same |
EP2062916A2 (en) | 2003-04-09 | 2009-05-27 | Genentech, Inc. | Therapy of autoimmune disease in a patient with an inadequate response to a TNF-Alpha inhibitor |
EP2065467A2 (en) | 2001-02-22 | 2009-06-03 | Genentech, Inc. | Anti-interferon-alpha antibodies |
WO2009068649A2 (en) | 2007-11-30 | 2009-06-04 | Glaxo Group Limited | Antigen-binding constructs |
EP2067472A1 (en) | 2002-01-02 | 2009-06-10 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP2075334A1 (en) | 2000-06-23 | 2009-07-01 | Genentech, Inc. | EG-VEGF nucleic acids and polypeptides and methods of use |
EP2075253A1 (en) | 2000-06-23 | 2009-07-01 | Genentech, Inc. | Compositions and methds for the diagnosis and treatment of disorders involving angiogensis |
WO2009086539A2 (en) | 2007-12-28 | 2009-07-09 | Elan Pharmaceuticals, Inc. | Treatment and prophylaxis of amyloidosis |
EP2082645A1 (en) | 2006-04-19 | 2009-07-29 | Genentech, Inc. | Novel gene disruptions, compositions and methods relating thereto |
EP2083079A1 (en) | 1997-06-18 | 2009-07-29 | Genentech, Inc. | Apo-2DcR |
EP2083018A2 (en) | 2003-04-16 | 2009-07-29 | Genentech, Inc. | Compositions and methods relating to STOP-1 |
EP2085096A2 (en) | 2002-09-11 | 2009-08-05 | Genentech, Inc. | Novel composition and methods for the treatment of immune related diseases |
EP2090657A2 (en) | 2000-08-07 | 2009-08-19 | Centocor Ortho Biotech Inc. | Anti-IL-12 antibodies, compositions, methods and uses |
EP2093570A1 (en) | 2003-06-06 | 2009-08-26 | Genentech, Inc. | Modulating the interaction between HGF beta chain and c-met |
WO2009123894A2 (en) | 2008-04-02 | 2009-10-08 | Macrogenics, Inc. | Her2/neu-specific antibodies and methods of using same |
EP2110138A1 (en) | 1999-08-27 | 2009-10-21 | Genentech, Inc. | Dosages for treatment of anti-erbB2 antibodies |
EP2112167A2 (en) | 1999-06-25 | 2009-10-28 | Genentech, Inc. | Humanized ANTI-ERBB2 antibodies and treatment with ANTI-ERBB2 antibodies |
EP2116551A1 (en) | 2002-09-11 | 2009-11-11 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
WO2009151717A2 (en) | 2008-04-02 | 2009-12-17 | Macrogenics, Inc. | Bcr-complex-specific antibodies and methods of using same |
EP2143438A1 (en) | 2001-09-18 | 2010-01-13 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP2159230A1 (en) | 2000-08-07 | 2010-03-03 | Centocor Ortho Biotech Inc. | Anti-TNF antibodies, compositions, methods and uses |
EP2161283A1 (en) | 2003-11-17 | 2010-03-10 | Genentech, Inc. | Compositions comprising antibodies against CD79b conjugated to a growth inhibitory agent or cytotoxic agent and methods for the treatment of tumor of hematopoietic origin |
WO2010027364A1 (en) | 2008-09-07 | 2010-03-11 | Glyconex Inc. | Anti-extended type i glycosphingolipid antibody, derivatives thereof and use |
WO2010030813A2 (en) | 2008-09-10 | 2010-03-18 | Genentech, Inc. | Methods for inhibiting ocular angiogenesis |
WO2010033279A2 (en) | 2008-06-04 | 2010-03-25 | Macrogenics, Inc. | Antibodies with altered binding to fcrn and methods of using same |
WO2010042562A2 (en) | 2008-10-06 | 2010-04-15 | Minerva Biotechnologies Corporation | Muc1* antibodies |
WO2010048446A2 (en) | 2008-10-22 | 2010-04-29 | Genentech, Inc. | Modulation of axon degeneration |
EP2186402A1 (en) | 2005-06-06 | 2010-05-19 | Genentech, Inc. | Knock-out animal models for novel genes and methods of use |
US7727525B2 (en) | 2006-05-11 | 2010-06-01 | City Of Hope | Engineered anti-CD20 antibody fragments for in vivo targeting and therapeutics |
US7736635B2 (en) | 2003-12-23 | 2010-06-15 | Ucb Pharma S.A. | Branched molecular scaffolds for linking polymer residues to biologically active moieties |
WO2010070094A1 (en) | 2008-12-19 | 2010-06-24 | Glaxo Group Limited | Myostatin binding proteins |
WO2010074702A1 (en) | 2008-12-16 | 2010-07-01 | Millipore Corporation | Purification of proteins |
WO2010075548A2 (en) | 2008-12-23 | 2010-07-01 | Genentech, Inc. | Immunoglobulin variants with altered binding to protein a |
WO2010075249A2 (en) | 2008-12-22 | 2010-07-01 | Genentech, Inc. | A method for treating rheumatoid arthritis with b-cell antagonists |
WO2010077634A1 (en) | 2008-12-09 | 2010-07-08 | Genentech, Inc. | Anti-pd-l1 antibodies and their use to enhance t-cell function |
WO2010080528A1 (en) | 2008-12-17 | 2010-07-15 | Genentech, Inc. | Hepatitis c virus combination therapy |
WO2010084408A2 (en) | 2009-01-21 | 2010-07-29 | Oxford Biotherapeutics Ltd. | Pta089 protein |
EP2214014A1 (en) | 2004-05-11 | 2010-08-04 | The University of Pittsburgh | Monitoring immunologic, hematologic and inflammatory diseases |
EP2216650A1 (en) | 2004-04-09 | 2010-08-11 | University of Pittsburgh | Real time method of detecting acute inflammatory conditions |
WO2010097386A1 (en) | 2009-02-24 | 2010-09-02 | Glaxo Group Limited | Antigen-binding constructs |
WO2010097385A1 (en) | 2009-02-24 | 2010-09-02 | Glaxo Group Limited | Antigen-binding constructs |
WO2010097394A1 (en) | 2009-02-24 | 2010-09-02 | Glaxo Group Limited | Multivalent and/or multispecific rankl-binding constructs |
EP2228446A1 (en) | 1999-12-01 | 2010-09-15 | Genentech, Inc. | Secreted and transmembrane polypeptieds and nucleic acids encoding the same |
US7803561B2 (en) | 2006-02-06 | 2010-09-28 | Rhode Island Hospital | GPR30 estrogen receptor in breast cancers |
EP2233149A1 (en) | 2007-10-16 | 2010-09-29 | ZymoGenetics, Inc. | Combination of BLYS inhibition and anti-CD20 agents for treatment of autoimmune disease |
WO2010111254A1 (en) | 2009-03-25 | 2010-09-30 | Genentech, Inc. | Novel anti-alpha5beta1 antibodies and uses thereof |
WO2010111367A1 (en) | 2009-03-25 | 2010-09-30 | Genentech, Inc. | Anti-fgfr3 antibodies and methods using same |
WO2010114859A1 (en) | 2009-04-01 | 2010-10-07 | Genentech, Inc. | Treatment of insulin-resistant disorders |
WO2010118243A2 (en) | 2009-04-08 | 2010-10-14 | Genentech, Inc. | Use of il-27 antagonists to treat lupus |
EP2241622A2 (en) | 1994-03-18 | 2010-10-20 | Genentech, Inc. | Human trk receptors and their derivatives |
WO2010120561A1 (en) | 2009-04-01 | 2010-10-21 | Genentech, Inc. | Anti-fcrh5 antibodies and immunoconjugates and methods of use |
US7820799B2 (en) | 2005-06-17 | 2010-10-26 | Janssen Alzheimer Immunotherapy | Methods of purifying Fc region containing proteins |
EP2248829A1 (en) | 2003-05-30 | 2010-11-10 | Genentech, Inc. | Treatment with anti-VEGF antibodies |
WO2010128407A2 (en) | 2009-05-05 | 2010-11-11 | Novimmune S.A. | Anti-il-17f antibodies and methods of use thereof |
EP2253646A1 (en) | 2000-08-07 | 2010-11-24 | Centocor Ortho Biotech Inc. | Anti-dual integrin antibody and compositions and conjugates comprising said antibody |
EP2258848A1 (en) | 1999-12-23 | 2010-12-08 | Genentech, Inc. | Il-17 homologous polypeptide and therapeutic uses thereof |
EP2260858A2 (en) | 2003-11-06 | 2010-12-15 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
EP2261367A2 (en) | 2007-11-29 | 2010-12-15 | Genentech, Inc. | Gene expression markers for inflammatory bowel disease |
EP2263691A1 (en) | 2002-07-15 | 2010-12-22 | Genentech, Inc. | Treatment of cancer with the recombinant humanized monoclonal anti-erbb2 antibody 2C4 (rhuMAb 2C4) |
EP2266594A1 (en) | 2001-09-19 | 2010-12-29 | Neuronova AB | VEGF for use in the treatment of central nervous system disorders |
EP2267450A2 (en) | 2005-04-29 | 2010-12-29 | The Regents of the University of California | Antibodies against histone modifications for clinical diagnosis and prognosis of cancer |
US7868133B2 (en) | 2002-09-09 | 2011-01-11 | Dana Farber Cancer Institute, Inc. | BH3 peptides and method of use thereof |
EP2272868A2 (en) | 2003-06-05 | 2011-01-12 | Genentech, Inc. | Combination therapy for B cell disorders |
WO2011005715A1 (en) | 2009-07-07 | 2011-01-13 | Genentech, Inc. | Diagnosis and treatment of autoimmune demyelinating diseases |
EP2275119A1 (en) | 1995-07-27 | 2011-01-19 | Genentech, Inc. | Stable isotonic lyophilized protein formulation |
WO2011008990A1 (en) | 2009-07-15 | 2011-01-20 | Prometheus Laboratories Inc. | Drug selection for gastric cancer therapy using antibody-based arrays |
EP2277908A2 (en) | 2003-07-08 | 2011-01-26 | Genentech, Inc. | IL-17A/F heterologous polypeptides, antibodies and therapeutic uses thereof |
WO2011011339A1 (en) | 2009-07-20 | 2011-01-27 | Genentech, Inc. | Gene expression markers for crohn's disease |
WO2011014750A1 (en) | 2009-07-31 | 2011-02-03 | Genentech, Inc. | Inhibition of tumor metastasis using bv8- or g-csf-antagonists |
WO2011014457A1 (en) | 2009-07-27 | 2011-02-03 | Genentech, Inc. | Combination treatments |
EP2283866A2 (en) | 1999-06-25 | 2011-02-16 | Genentech, Inc. | Methods of treatment using anti-ERBB antibody-maytansinoid conjugates |
WO2011019679A1 (en) | 2009-08-11 | 2011-02-17 | Allergan, Inc. | Ccr2 inhibitors for treating conditions of the eye |
WO2011019620A1 (en) | 2009-08-10 | 2011-02-17 | Genentech, Inc. | Antibodies with enhanced adcc function |
WO2011019622A1 (en) | 2009-08-14 | 2011-02-17 | Genentech, Inc. | Cell culture methods to make antibodies with enhanced adcc function |
WO2011019619A1 (en) | 2009-08-11 | 2011-02-17 | Genentech, Inc. | Production of proteins in glutamine-free cell culture media |
EP2286844A2 (en) | 2004-06-01 | 2011-02-23 | Genentech, Inc. | Antibody-drug conjugates and methods |
EP2289942A2 (en) | 2002-04-10 | 2011-03-02 | Genentech, Inc. | Anti-HER2 antibody variants |
WO2011028753A1 (en) | 2009-09-01 | 2011-03-10 | Genentech, Inc. | Enhanced protein purification through a modified protein a elution |
WO2011028950A1 (en) | 2009-09-02 | 2011-03-10 | Genentech, Inc. | Mutant smoothened and methods of using the same |
WO2011031397A1 (en) | 2009-08-06 | 2011-03-17 | Genentech, Inc. | Method to improve virus removal in protein purification |
EP2308968A1 (en) | 2002-11-26 | 2011-04-13 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2308888A1 (en) | 2001-11-14 | 2011-04-13 | Centocor Ortho Biotech Inc. | Anti-IL-6 antibodies, compositions, methods and uses |
WO2011044368A1 (en) | 2009-10-07 | 2011-04-14 | Macrogenics, Inc. | Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use |
EP2311960A2 (en) | 2001-08-29 | 2011-04-20 | Genentech, Inc. | Bv8 nucleic acids and polypeptides with mitogenic activity |
EP2314318A1 (en) | 2001-01-31 | 2011-04-27 | Biogen Idec Inc. | CD80 antibody for use in combination with chemotherapeutics to treat B cell malignancies |
WO2011050194A1 (en) | 2009-10-22 | 2011-04-28 | Genentech, Inc. | Methods and compositions for modulating hepsin activation of macrophage-stimulating protein |
WO2011050188A1 (en) | 2009-10-22 | 2011-04-28 | Genentech, Inc. | Anti-hepsin antibodies and methods using same |
WO2011050069A1 (en) | 2009-10-20 | 2011-04-28 | Prometheus Laboratories Inc. | Proximity-mediated assays for detecting oncogenic fusion proteins |
WO2011054007A1 (en) | 2009-11-02 | 2011-05-05 | Oxford Biotherapeutics Ltd. | Ror1 as therapeutic and diagnostic target |
EP2319929A1 (en) | 1998-12-23 | 2011-05-11 | Genentech, Inc. | IL-1 related polypeptides |
WO2011056502A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Bone morphogenetic protein receptor type ii compositions and methods of use |
WO2011054820A1 (en) | 2009-11-03 | 2011-05-12 | Universidad Del País Vasco | Methods and compositions for the treatment of white matter ischemia |
WO2011057120A1 (en) | 2009-11-05 | 2011-05-12 | Genentech, Inc. | Methods and composition for secretion of heterologous polypeptides |
WO2011056494A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Activin receptor-like kinase-1 antagonist and vegfr3 antagonist combinations |
WO2011056497A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Activin receptor type iib compositions and methods of use |
EP2322201A2 (en) | 2002-10-29 | 2011-05-18 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
WO2011060246A2 (en) | 2009-11-12 | 2011-05-19 | Genentech, Inc. | A method of promoting dendritic spine density |
EP2325208A1 (en) | 2005-12-15 | 2011-05-25 | Genentech, Inc. | Polyubiquitin antibodies |
WO2011066503A2 (en) | 2009-11-30 | 2011-06-03 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP2332996A1 (en) | 2002-09-11 | 2011-06-15 | Genentech, Inc. | Protein Purification |
EP2332956A1 (en) | 2002-07-08 | 2011-06-15 | Genentech, Inc. | Antibody binding to PRO71238 |
EP2333069A2 (en) | 1998-05-15 | 2011-06-15 | Genentech, Inc. | Therapeutic uses of IL-17 homologous polypeptides |
WO2011071577A1 (en) | 2009-12-11 | 2011-06-16 | Genentech, Inc. | Anti-vegf-c antibodies and methods using same |
EP2336178A1 (en) | 2003-12-11 | 2011-06-22 | Genentech, Inc. | Methods and compositions for inhibiting C-Met dimerization and activation |
EP2335725A1 (en) | 2003-04-04 | 2011-06-22 | Genentech, Inc. | High concentration antibody and protein formulations |
EP2338492A1 (en) | 2009-12-24 | 2011-06-29 | Universidad del Pais Vasco | Methods and compositions for the treatment of alzheimer |
WO2011079185A1 (en) | 2009-12-23 | 2011-06-30 | Genentech, Inc. | Anti-bv8 antibodies and uses thereof |
WO2011082187A1 (en) | 2009-12-30 | 2011-07-07 | Genentech, Inc. | Methods for modulating a pdgf-aa mediated biological response |
WO2011080050A2 (en) | 2009-12-11 | 2011-07-07 | Novartis Ag | Binding molecules |
WO2011084750A1 (en) | 2009-12-21 | 2011-07-14 | Genentech, Inc. | Antibody formulation |
US7981418B2 (en) | 2007-03-02 | 2011-07-19 | Genentech, Inc. | Predicting response to a HER inhibitor |
US7982012B2 (en) | 2008-03-10 | 2011-07-19 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of cytomegalovirus |
WO2011094259A2 (en) | 2010-01-28 | 2011-08-04 | Glaxo Group Limited | Cd127 binding proteins |
WO2011094759A2 (en) | 2010-02-01 | 2011-08-04 | The Regents Of The University Of California | Novel diagnostic and therapeutic targets associated with or regulated by n-cadherin expression and/or epithelial to mesenchymal transition (emt) in prostate cancer and other malignancies |
WO2011095506A1 (en) | 2010-02-03 | 2011-08-11 | Ucb Pharma, S.A. | Process for obtaining antibodies |
WO2011100403A1 (en) | 2010-02-10 | 2011-08-18 | Immunogen, Inc | Cd20 antibodies and uses thereof |
WO2011103242A1 (en) | 2010-02-18 | 2011-08-25 | Genentech, Inc. | Neuregulin antagonists and use thereof in treating cancer |
EP2361931A1 (en) | 2004-07-20 | 2011-08-31 | Genentech, Inc. | Inhibitors of angiopoietin-like 4 protein, combinations, and their use |
WO2011106297A2 (en) | 2010-02-23 | 2011-09-01 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
WO2011107480A1 (en) | 2010-03-03 | 2011-09-09 | Glaxo Group Limited | Antigen binding proteins specific for serum amyloid p component |
EP2364997A2 (en) | 1999-01-15 | 2011-09-14 | Genentech, Inc. | Polypeptide variants with altered effector function |
EP2364716A2 (en) | 2002-11-08 | 2011-09-14 | Genentech, Inc. | Compositions and methods for the treatment of natural killer cell related diseases |
EP2366716A2 (en) | 2006-03-21 | 2011-09-21 | Genentech, Inc. | Combinatorial therapy involving alpha5beta1 antagonists |
WO2011119888A2 (en) | 2010-03-24 | 2011-09-29 | The Regents Of The University Of California | N-cadherin: target for cancer diagnosis and therapy |
WO2011119661A1 (en) | 2010-03-24 | 2011-09-29 | Genentech, Inc. | Anti-lrp6 antibodies |
US8030023B2 (en) | 2005-02-02 | 2011-10-04 | Genentech, Inc. | Nucleic acid encoding DR5 antibodies and uses thereof |
EP2371388A2 (en) | 2004-10-20 | 2011-10-05 | Genentech, Inc. | Antibody formulations |
WO2011123507A1 (en) | 2010-03-30 | 2011-10-06 | Centocor Ortho Biotech Inc. | Humanized il-25 antibodies |
EP2377527A1 (en) | 2007-01-22 | 2011-10-19 | Genentech, Inc. | Polyelectrolyte precipitation and purification of antibodies |
WO2011133931A1 (en) | 2010-04-22 | 2011-10-27 | Genentech, Inc. | Use of il-27 antagonists for treating inflammatory bowel disease |
WO2011136911A2 (en) | 2010-04-09 | 2011-11-03 | Aveo Pharmaceuticals, Inc. | Anti-erbb3 antibodies |
WO2011139718A1 (en) | 2010-05-03 | 2011-11-10 | Genentech, Inc. | Compositions and methods useful for reducing the viscosity of protein-containing formulations |
WO2011139985A1 (en) | 2010-05-03 | 2011-11-10 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
US8057796B2 (en) | 2007-11-12 | 2011-11-15 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of influenza |
EP2388265A1 (en) | 2002-02-22 | 2011-11-23 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
WO2011146568A1 (en) | 2010-05-19 | 2011-11-24 | Genentech, Inc. | Predicting response to a her inhibitor |
EP2390666A1 (en) | 2006-03-21 | 2011-11-30 | The Regents of The University of California | N-Cadherin as target for cancer diagnosis and therapy |
EP2389949A1 (en) | 2006-03-23 | 2011-11-30 | Novartis AG | Anti-tumor cell antigen antibody therapeutics |
WO2011147834A1 (en) | 2010-05-26 | 2011-12-01 | Roche Glycart Ag | Antibodies against cd19 and uses thereof |
WO2011150241A2 (en) | 2010-05-28 | 2011-12-01 | Genentech, Inc. | Decreasing lactate level and increasing polypeptide production by downregulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase |
WO2011150110A1 (en) | 2010-05-25 | 2011-12-01 | Genentech, Inc. | Methods of purifying polypeptides |
EP2392353A1 (en) | 2005-01-28 | 2011-12-07 | Janssen Alzheimer Immunotherapy | Anti A beta antibody formulation |
WO2011153346A1 (en) | 2010-06-03 | 2011-12-08 | Genentech, Inc. | Immuno-pet imaging of antibodies and immunoconjugates and uses therefor |
WO2011151432A1 (en) | 2010-06-03 | 2011-12-08 | Glaxo Group Limited | Humanised antigen binding proteins to myostatin6 |
WO2011159655A2 (en) | 2010-06-16 | 2011-12-22 | Allergan, Inc. | IL23p19 ANTIBODY INHIBITOR FOR TREATING OCULAR AND OTHER CONDITIONS |
EP2399605A1 (en) | 2005-02-23 | 2011-12-28 | Genentech, Inc. | Extending time to disease progression or survival in cancer patients |
WO2011161119A1 (en) | 2010-06-22 | 2011-12-29 | F. Hoffmann-La Roche Ag | Antibodies against insulin-like growth factor i receptor and uses thereof |
WO2011161189A1 (en) | 2010-06-24 | 2011-12-29 | F. Hoffmann-La Roche Ag | Anti-hepsin antibodies and methods of use |
EP2402373A2 (en) | 2006-01-05 | 2012-01-04 | Genentech, Inc. | Anti-EphB4 Antibodies and Methods Using Same |
EP2404935A1 (en) | 2004-03-30 | 2012-01-11 | Glaxo Group Limited | Immunoglobulin binding HOSM |
WO2012006503A1 (en) | 2010-07-09 | 2012-01-12 | Genentech, Inc. | Anti-neuropilin antibodies and methods of use |
WO2012010547A1 (en) | 2010-07-19 | 2012-01-26 | F. Hoffmann-La Roche Ag | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
WO2012010582A1 (en) | 2010-07-21 | 2012-01-26 | Roche Glycart Ag | Anti-cxcr5 antibodies and methods of use |
WO2012010549A1 (en) | 2010-07-19 | 2012-01-26 | F. Hoffmann-La Roche Ag | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
US8108030B2 (en) | 2006-10-20 | 2012-01-31 | Board Of Regents, The University Of Texas System | Method and apparatus to identify vulnerable plaques with thermal wave imaging of heated nanoparticles |
WO2012013930A2 (en) | 2010-07-27 | 2012-02-02 | Ucb Pharma S.A. | Process for purifying proteins |
WO2012018771A1 (en) | 2010-08-03 | 2012-02-09 | Genentech, Inc. | Chronic lymphocytic leukemia (cll) biomarkers |
WO2012017003A1 (en) | 2010-08-05 | 2012-02-09 | F. Hoffmann-La Roche Ag | Anti-mhc antibody anti-viral cytokine fusion protein |
WO2012021773A1 (en) | 2010-08-13 | 2012-02-16 | Genentech, Inc. | Antibodies to il-1beta and il-18, for treatment of disease |
WO2012020072A1 (en) | 2010-08-12 | 2012-02-16 | Westfälische Wilhelms-Universität Muenster | Anti-syndecan-4 antibodies |
WO2012020038A1 (en) | 2010-08-13 | 2012-02-16 | Roche Glycart Ag | Anti-tenascin-c a2 antibodies and methods of use |
WO2012020006A2 (en) | 2010-08-13 | 2012-02-16 | Roche Glycart Ag | Anti-fap antibodies and methods of use |
WO2012022734A2 (en) | 2010-08-16 | 2012-02-23 | Medimmune Limited | Anti-icam-1 antibodies and methods of use |
EP2423333A1 (en) | 2006-08-25 | 2012-02-29 | Oncotherapy Science, Inc. | Prognostic markers and therapeutic targets for lung cancer |
WO2012025536A1 (en) | 2010-08-25 | 2012-03-01 | F. Hoffmann-La Roche Ag | Antibodies against il-18r1 and uses thereof |
WO2012031027A1 (en) | 2010-08-31 | 2012-03-08 | Genentech, Inc. | Biomarkers and methods of treatment |
EP2434022A2 (en) | 2002-10-03 | 2012-03-28 | Genentech, Inc. | Use of A33 antigens and JAM-IT |
WO2012047968A2 (en) | 2010-10-05 | 2012-04-12 | Genentech, Inc. | Mutant smoothened and methods of using the same |
EP2441775A1 (en) | 2007-02-26 | 2012-04-18 | Oxford Biotherapeutics Ltd. | Protein |
EP2444409A2 (en) | 2002-09-16 | 2012-04-25 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2446904A2 (en) | 2006-05-30 | 2012-05-02 | Genentech, Inc. | Anti-CD22 antibodies, their immunoconjugates and uses thereof |
EP2447719A1 (en) | 2007-02-26 | 2012-05-02 | Oxford Biotherapeutics Ltd. | Proteins |
EP2450050A1 (en) | 2006-11-29 | 2012-05-09 | Genentech, Inc. | IL-17A/F heterodimeric polypeptides and therapeutic uses thereof |
WO2012061129A1 (en) | 2010-10-25 | 2012-05-10 | Genentech, Inc | Treatment of gastrointestinal inflammation and psoriasis a |
WO2012058726A1 (en) | 2010-11-05 | 2012-05-10 | Transbio Ltd | Markers of endothelial progenitor cells and uses thereof |
WO2012058768A1 (en) | 2010-11-05 | 2012-05-10 | Zymeworks Inc. | Stable heterodimeric antibody design with mutations in the fc domain |
EP2452694A1 (en) | 2005-06-30 | 2012-05-16 | Janssen Biotech, Inc. | Anti-IL-23 antibodies, compositions, methods and uses |
WO2012064836A1 (en) | 2010-11-10 | 2012-05-18 | Genentech, Inc. | Methods and compositions for neural disease immunotherapy |
EP2455404A2 (en) | 2006-08-22 | 2012-05-23 | G2 Inflammation Pty Ltd | Anti-C5AR antibodies with improved properties |
WO2012069557A1 (en) | 2010-11-24 | 2012-05-31 | Glaxo Group Limited | Multispecific antigen binding proteins targeting hgf |
WO2012071436A1 (en) | 2010-11-24 | 2012-05-31 | Genentech, Inc. | Method of treating autoimmune inflammatory disorders using il-23r loss-of-function mutants |
WO2012075037A1 (en) | 2010-11-30 | 2012-06-07 | Genentech, Inc. | Low affinity blood brain barrier receptor antibodies and uses therefor |
EP2468772A2 (en) | 2006-03-16 | 2012-06-27 | Genentech, Inc. | Antibodies to EGFL7 and methods for their use |
WO2012087962A2 (en) | 2010-12-20 | 2012-06-28 | Genentech, Inc. | Anti-mesothelin antibodies and immunoconjugates |
WO2012088313A1 (en) | 2010-12-22 | 2012-06-28 | Genentech, Inc. | Anti-pcsk9 antibodies and methods of use |
WO2012088337A1 (en) | 2010-12-23 | 2012-06-28 | Prometheus Laboratories Inc. | Drug selection for malignant cancer therapy using antibody-based arrays |
US8211434B2 (en) | 2008-11-26 | 2012-07-03 | Allergan, Inc. | KLK-13 antibody inhibitor for treating dry eye |
EP2471815A1 (en) | 2006-07-11 | 2012-07-04 | University Of Medicine And Dentistry Of New Jersey | Proteins, nucleic acids encoding the same and associated methods of use |
WO2012092539A2 (en) | 2010-12-31 | 2012-07-05 | Takeda Pharmaceutical Company Limited | Antibodies to dll4 and uses thereof |
EP2474557A2 (en) | 2007-07-16 | 2012-07-11 | Genentech, Inc. | Anti-CD79b antibodies and immunoconjugates and methods of use |
WO2012093254A1 (en) | 2011-01-07 | 2012-07-12 | Ucb Pharma S.A. | Lipocalin 2 as a biomarker for il-17 inhibitor therapy efficacy |
WO2012095662A1 (en) | 2011-01-14 | 2012-07-19 | Ucb Pharma S.A. | Antibody molecules which bind il-17a and il-17f |
WO2012099566A1 (en) | 2010-11-17 | 2012-07-26 | Sea Lane Biotechnologies, Llc | Influenza virus neutralizing agents that mimic the binding site of an influenza neutralizing antibody |
WO2012100835A1 (en) | 2011-01-28 | 2012-08-02 | Laboratorios Del Dr. Esteve, S.A. | Methods and compositions for the treatment of aids |
WO2012119989A2 (en) | 2011-03-04 | 2012-09-13 | Oryzon Genomics, S.A. | Methods and antibodies for the diagnosis and treatment of cancer |
EP2500438A2 (en) | 2002-09-25 | 2012-09-19 | Genentech, Inc. | Novel compositions and methods for the treatment of psoriasis |
EP2500030A2 (en) | 2005-11-04 | 2012-09-19 | Genentech, Inc. | Use of complement pathway inhibitors to treat ocular diseases |
WO2012125614A1 (en) | 2011-03-15 | 2012-09-20 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of influenza |
EP2503341A2 (en) | 2006-11-14 | 2012-09-26 | Genentech, Inc. | Modulators of Neuronal Regeneration |
WO2012130831A1 (en) | 2011-03-29 | 2012-10-04 | Roche Glycart Ag | Antibody fc variants |
WO2012138997A1 (en) | 2011-04-07 | 2012-10-11 | Amgen Inc. | Novel egfr binding proteins |
WO2012138975A1 (en) | 2011-04-07 | 2012-10-11 | Genentech, Inc. | Anti-fgfr4 antibodies and methods of use |
EP2511299A1 (en) | 2005-04-19 | 2012-10-17 | Seattle Genetics, Inc. | Humanized anti-CD70 binding agents and uses thereof |
EP2514764A2 (en) | 2006-10-18 | 2012-10-24 | UCB Pharma, S.A. | Antibody molecules which bind IL-17A and IL-17F |
WO2012143379A1 (en) | 2011-04-20 | 2012-10-26 | Roche Glycart Ag | Method and constructs for the ph dependent passage of the blood-brain-barrier |
WO2012155019A1 (en) | 2011-05-12 | 2012-11-15 | Genentech, Inc. | Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides |
WO2012158948A1 (en) | 2011-05-17 | 2012-11-22 | The Rockefeller University | Human immunodeficiency virus neutralizing antibodies adn methods of use thereof |
WO2012158704A1 (en) | 2011-05-16 | 2012-11-22 | Genentech, Inc. | Fgfr1 agonists and methods of use |
US8318905B2 (en) | 2004-04-23 | 2012-11-27 | Richard Kroczek | Antibodies for depletion of ICOS-positive cells in vivo |
EP2526960A1 (en) | 2003-03-12 | 2012-11-28 | Genentech, Inc. | Use of BV8 and/or EG-VEGF to promote hematopoiesis |
US8329178B2 (en) | 2005-02-18 | 2012-12-11 | Dana-Farber Cancer Institute, Inc. | Antibodies against CXCR4 and methods of use thereof |
EP2535355A2 (en) | 2005-03-23 | 2012-12-19 | Genmab A/S | Antibodies against CD38 for treatment of multiple myeloma |
WO2012171996A1 (en) | 2011-06-15 | 2012-12-20 | F. Hoffmann-La Roche Ag | Anti-human epo receptor antibodies and methods of use |
WO2013003680A1 (en) | 2011-06-30 | 2013-01-03 | Genentech, Inc. | Anti-c-met antibody formulations |
WO2013001369A2 (en) | 2011-06-28 | 2013-01-03 | Oxford Biotherapeutics Ltd. | Therapeutic and diagnostic target |
US8355776B2 (en) | 2005-05-27 | 2013-01-15 | Board Of Regents, The University Of Texas System | Hemoglobin contrast in magneto-motive optical doppler tomography, optical coherence tomography, and ultrasound imaging methods and apparatus |
EP2548577A1 (en) | 2005-12-29 | 2013-01-23 | Janssen Biotech, Inc. | Human anti-il-23 antibodies, compositions, methods and uses |
WO2013012855A1 (en) | 2011-07-18 | 2013-01-24 | Amgen Inc. | Apelin antigen-binding proteins and uses thereof |
EP2551672A1 (en) | 2006-09-21 | 2013-01-30 | Nestec S.A. | Antibody-based arrays for detecting multiple signal transducers in rare circulating cells |
WO2013025853A1 (en) | 2011-08-17 | 2013-02-21 | Genentech, Inc. | Neuregulin antibodies and uses thereof |
WO2013025944A1 (en) | 2011-08-17 | 2013-02-21 | Genentech, Inc. | Inhibition of angiogenesis in refractory tumors |
WO2013026832A1 (en) | 2011-08-23 | 2013-02-28 | Roche Glycart Ag | Anti-mcsp antibodies |
WO2013033623A1 (en) | 2011-09-02 | 2013-03-07 | Nestec S.A. | Profiling of signal pathway proteins to determine therapeutic efficacy |
WO2013033069A1 (en) | 2011-08-30 | 2013-03-07 | Theraclone Sciences, Inc. | Human rhinovirus (hrv) antibodies |
EP2567975A2 (en) | 2006-11-21 | 2013-03-13 | The Regents of The University of California | Modulation of RHAMM (CD168) for selective adipose tissue development |
WO2013040433A1 (en) | 2011-09-15 | 2013-03-21 | Genentech, Inc. | Methods of promoting differentiation |
EP2573114A1 (en) | 2005-08-10 | 2013-03-27 | MacroGenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
EP2573563A1 (en) | 2007-12-20 | 2013-03-27 | Heptares Therapeutics Limited | Screening |
WO2013043715A1 (en) | 2011-09-19 | 2013-03-28 | Genentech, Inc. | Combination treatments comprising c-met antagonists and b-raf antagonists |
WO2013052155A1 (en) | 2011-10-05 | 2013-04-11 | Genentech, Inc. | Methods of treating liver conditions using notch2 antagonists |
WO2013056148A2 (en) | 2011-10-15 | 2013-04-18 | Genentech, Inc. | Methods of using scd1 antagonists |
WO2013055998A1 (en) | 2011-10-14 | 2013-04-18 | Genentech, Inc. | ANTI-HtrA1 ANTIBODIES AND METHODS OF USE |
WO2013059531A1 (en) | 2011-10-20 | 2013-04-25 | Genentech, Inc. | Anti-gcgr antibodies and uses thereof |
EP2586788A1 (en) | 2007-07-09 | 2013-05-01 | Genentech, Inc. | Prevention of disulfide bond reduction during recombinant production of polypeptides |
WO2013063001A1 (en) | 2011-10-28 | 2013-05-02 | Genentech, Inc. | Therapeutic combinations and methods of treating melanoma |
WO2013067301A1 (en) | 2011-11-02 | 2013-05-10 | Genentech, Inc. | Overload and elute chromatography |
EP2592156A2 (en) | 2007-06-08 | 2013-05-15 | Genentech, Inc. | Gene expression markers of tumor resistance to HER2 inhibitor treatment |
WO2013078170A1 (en) | 2011-11-21 | 2013-05-30 | Genentech, Inc. | Purification of anti-c-met antibodies |
US8454511B2 (en) | 2005-05-27 | 2013-06-04 | Board Of Regents, The University Of Texas System | Magneto-motive ultrasound detection of magnetic nanoparticles |
EP2602623A2 (en) | 2008-02-25 | 2013-06-12 | Nestec S.A. | Mehtod for the detection of intracellular truncated receptors |
WO2013083497A1 (en) | 2011-12-06 | 2013-06-13 | F. Hoffmann-La Roche Ag | Antibody formulation |
WO2013096812A1 (en) | 2011-12-23 | 2013-06-27 | Genentech, Inc. | Articles of manufacture and methods for co-administration of antibodies |
WO2013092743A2 (en) | 2011-12-22 | 2013-06-27 | F. Hoffmann-La Roche Ag | Expression vector element combinations, novel production cell generation methods and their use for the recombinant production of polypeptides |
WO2013092723A1 (en) | 2011-12-22 | 2013-06-27 | F. Hoffmann-La Roche Ag | Expression vector organization, novel production cell generation methods and their use for the recombinant production of polypeptides |
WO2013092720A1 (en) | 2011-12-22 | 2013-06-27 | F. Hoffmann-La Roche Ag | Full length antibody display system for eukaryotic cells and its use |
WO2013096791A1 (en) | 2011-12-23 | 2013-06-27 | Genentech, Inc. | Process for making high concentration protein formulations |
EP2610267A1 (en) | 2006-12-18 | 2013-07-03 | Genentech, Inc. | Antagonist anti-Notch3 antibodies and their use in the prevention and treatment of Notch3-related diseases |
EP2609932A2 (en) | 2006-12-01 | 2013-07-03 | Seattle Genetics, Inc. | Variant target binding agents and uses thereof |
WO2013101771A2 (en) | 2011-12-30 | 2013-07-04 | Genentech, Inc. | Compositions and method for treating autoimmune diseases |
EP2614839A2 (en) | 2006-04-05 | 2013-07-17 | Genentech, Inc. | Method for using BOC/CDO to modulate hedgehog signaling |
WO2013106485A2 (en) | 2012-01-09 | 2013-07-18 | The Scripps Research Institute | Ultralong complementarity determining regions and uses thereof |
WO2013106489A1 (en) | 2012-01-09 | 2013-07-18 | The Scripps Research Institute | Humanized antibodies with ultralong cdr3s |
WO2013109856A2 (en) | 2012-01-18 | 2013-07-25 | Genentech, Inc. | Methods of using fgf19 modulators |
WO2013109819A1 (en) | 2012-01-18 | 2013-07-25 | Genentech, Inc. | Anti-lrp5 antibodies and methods of use |
WO2013110945A1 (en) | 2012-01-26 | 2013-08-01 | Imperial Innovations Ltd | Methods of treating pain by inhibition of vgf activity |
US8501178B2 (en) | 2008-11-25 | 2013-08-06 | Biogen Idec Ma Inc. | Use of DR6 and p75 antagonists to promote survival of cells of the nervous system |
EP2623516A2 (en) | 2005-12-02 | 2013-08-07 | Genentech, Inc. | Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to IL-22 and IL-22R |
WO2013116287A1 (en) | 2012-01-31 | 2013-08-08 | Genentech, Inc. | Anti-ig-e m1' antibodies and methods using same |
WO2013120056A1 (en) | 2012-02-11 | 2013-08-15 | Genentech, Inc. | R-spondin translocations and methods using the same |
WO2013120929A1 (en) | 2012-02-15 | 2013-08-22 | F. Hoffmann-La Roche Ag | Fc-receptor based affinity chromatography |
US8535912B2 (en) | 2009-10-15 | 2013-09-17 | Genentech, Inc. | Chimeric fibroblast growth factors with altered receptor specificity |
EP2639301A2 (en) | 2006-06-30 | 2013-09-18 | Bristol-Myers Squibb Company | Polynucleotides encoding novel PCSK9 variants |
EP2641618A2 (en) | 2007-07-16 | 2013-09-25 | Genentech, Inc. | Humanized anti-CD79B antibodies and immunoconjugates and methods of use |
EP2644205A1 (en) | 2007-04-12 | 2013-10-02 | The Brigham and Women's Hospital, Inc. | Targeting ABCB5 for cancer therapy |
WO2013149111A2 (en) | 2012-03-29 | 2013-10-03 | Novimmune S.A. | Anti-tlr4 antibodies and uses thereof |
WO2013149159A1 (en) | 2012-03-30 | 2013-10-03 | Genentech, Inc. | Anti-lgr5 antibodies and immunoconjugates |
WO2013148315A1 (en) | 2012-03-27 | 2013-10-03 | Genentech, Inc. | Diagnosis and treatments relating to her3 inhibitors |
WO2013148249A1 (en) | 2012-03-27 | 2013-10-03 | Genentech, Inc. | Improved harvest operations for recombinant proteins |
EP2657253A2 (en) | 2008-01-31 | 2013-10-30 | Genentech, Inc. | Anti-CD79b antibodies and immunoconjugates and methods of use |
WO2013165940A1 (en) | 2012-05-01 | 2013-11-07 | Genentech, Inc. | Anti-pmel17 antibodies and immunoconjugates |
WO2013170191A1 (en) | 2012-05-11 | 2013-11-14 | Genentech, Inc. | Methods of using antagonists of nad biosynthesis from nicotinamide |
WO2013177470A1 (en) | 2012-05-23 | 2013-11-28 | Genentech, Inc. | Selection method for therapeutic agents |
WO2013177062A2 (en) | 2012-05-21 | 2013-11-28 | Genentech, Inc. | Methods for improving safety of blood-brain barrier transport |
US8609101B2 (en) | 2009-04-23 | 2013-12-17 | Theraclone Sciences, Inc. | Granulocyte-macrophage colony-stimulating factor (GM-CSF) neutralizing antibodies |
WO2013188448A2 (en) | 2012-06-11 | 2013-12-19 | Amgen Inc. | Dual receptor antagonistic antigen-binding proteins and uses thereof |
WO2014008391A1 (en) | 2012-07-05 | 2014-01-09 | Genentech, Inc. | Expression and secretion system |
WO2014006123A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Anti-biotin antibodies and methods of use |
WO2014006118A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Anti-theophylline antibodies and methods of use |
WO2014006124A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Covalently linked antigen-antibody conjugates |
WO2014011521A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti - cd79b antibodies |
WO2014011518A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd22 antibodies |
WO2014011519A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd79b antibodies |
WO2014011520A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd22 antibodies |
WO2014018554A1 (en) | 2012-07-23 | 2014-01-30 | La Jolla Institute For Allergy And Immunology | Ptprs and proteoglycans in autoimmune disease |
WO2014020331A1 (en) | 2012-08-01 | 2014-02-06 | Oxford Biotherapeutics Ltd. | Therapeutic and diagnostic target |
US8647622B2 (en) | 2007-08-29 | 2014-02-11 | Sanofi | Humanized anti-CXCR5 antibodies, derivatives thereof and their use |
WO2014037899A2 (en) | 2012-09-07 | 2014-03-13 | Novartis Ag | Il-18 binding molecules |
WO2014047311A1 (en) | 2012-09-19 | 2014-03-27 | Genentech, Inc. | Methods and compositions for preventing norleucine misincorporation into proteins |
WO2014049003A1 (en) | 2012-09-25 | 2014-04-03 | Glenmark Pharmaceuticals S.A. | Purification of hetero-dimeric immunoglobulins |
US8691918B2 (en) | 2010-05-17 | 2014-04-08 | Emd Millipore Corporation | Stimulus responsive polymers for the purification of biomolecules |
EP2722051A1 (en) | 2005-07-07 | 2014-04-23 | Seattle Genetics, Inc. | Monomethylvaline compounds having phenylalanine side-chain modifications at the C-terminus |
WO2014069647A1 (en) | 2012-11-05 | 2014-05-08 | 全薬工業株式会社 | Antibody and antibody composition production method |
WO2014072306A1 (en) | 2012-11-08 | 2014-05-15 | F. Hoffmann-La Roche Ag | Her3 antigen binding proteins binding to the beta-hairpin of her3 |
WO2014078268A2 (en) | 2012-11-13 | 2014-05-22 | Genentech, Inc. | Anti-hemagglutinin antibodies and methods of use |
WO2014087248A2 (en) | 2012-12-03 | 2014-06-12 | Novimmune S.A. | Anti-cd47 antibodies and methods of use thereof |
WO2014116749A1 (en) | 2013-01-23 | 2014-07-31 | Genentech, Inc. | Anti-hcv antibodies and methods of using thereof |
WO2014123580A1 (en) | 2013-02-06 | 2014-08-14 | Inhibrx Llc | Non-platelet depleting and non-red blood cell depleting cd47 antibodies and methods of use thereof |
WO2014130064A1 (en) | 2013-02-22 | 2014-08-28 | Abbvie Inc. | Ultrafiltration and diafiltration formulation methods for protein processing |
WO2014128235A1 (en) | 2013-02-22 | 2014-08-28 | F. Hoffmann-La Roche Ag | Methods of treating cancer and preventing drug resistance |
WO2014131715A1 (en) | 2013-02-26 | 2014-09-04 | Roche Glycart Ag | Anti-mcsp antibodies |
WO2014138364A2 (en) | 2013-03-06 | 2014-09-12 | Genentech, Inc. | Methods of treating and preventing cancer drug resistance |
WO2014144871A1 (en) | 2013-03-15 | 2014-09-18 | The Centre For Drug Research And Development | Cytotoxic and anti-mitotic compounds, and methods of using the same |
WO2014145098A1 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Cell culture compositions with antioxidants and methods for polypeptide production |
WO2014144850A1 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Methods of treating cancer and preventing cancer drug resistance |
WO2014144865A2 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Anti-crth2 antibodies and methods of use |
WO2014144763A2 (en) | 2013-03-15 | 2014-09-18 | Memorial Sloan Kettering Cancer Center | High affinity anti-gd2 antibodies |
WO2014151866A1 (en) | 2013-03-15 | 2014-09-25 | Genentech, Inc. | Compositions and methods for diagnosis and treatment of hepatic cancers |
WO2014152358A2 (en) | 2013-03-14 | 2014-09-25 | Genentech, Inc. | Combinations of a mek inhibitor compound with an her3/egfr inhibitor compound and methods of use |
WO2014151006A2 (en) | 2013-03-15 | 2014-09-25 | Genentech, Inc. | Biomarkers and methods of treating pd-1 and pd-l1 related conditions |
WO2014153030A2 (en) | 2013-03-14 | 2014-09-25 | Genentech, Inc. | Methods of treating cancer and preventing cancer drug resistance |
WO2014150877A2 (en) | 2013-03-15 | 2014-09-25 | Ac Immune S.A. | Anti-tau antibodies and methods of use |
WO2014160495A1 (en) | 2013-03-13 | 2014-10-02 | Genentech, Inc. | Formulations with reduced oxidation |
WO2014159835A1 (en) | 2013-03-14 | 2014-10-02 | Genentech, Inc. | Anti-b7-h4 antibodies and immunoconjugates |
WO2014160490A1 (en) | 2013-03-13 | 2014-10-02 | Genetech, Inc. | Antibody formulations |
WO2014159940A1 (en) | 2013-03-14 | 2014-10-02 | Macrogenics, Inc. | Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor |
WO2014160497A1 (en) | 2013-03-13 | 2014-10-02 | Genentech, Inc. | Formulations with reduced oxidation |
US8853369B2 (en) | 2010-06-18 | 2014-10-07 | Genentech, Inc. | Anti-Axl antibodies and methods of use |
WO2014161845A1 (en) | 2013-04-03 | 2014-10-09 | Roche Glycart Ag | Bispecific antibodies specific for fap and dr5, antibodies specific for dr5 and methods of use |
US8858948B2 (en) | 2009-05-20 | 2014-10-14 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of influenza |
WO2014169076A1 (en) | 2013-04-09 | 2014-10-16 | Annexon,,Inc. | Methods of treatment for neuromyelitis optica |
WO2014172661A1 (en) | 2013-04-19 | 2014-10-23 | The Regent Of The University Of California | Lone star virus |
WO2014177461A1 (en) | 2013-04-29 | 2014-11-06 | F. Hoffmann-La Roche Ag | Fcrn-binding abolished anti-igf-1r antibodies and their use in the treatment of vascular eye diseases |
WO2014177460A1 (en) | 2013-04-29 | 2014-11-06 | F. Hoffmann-La Roche Ag | Human fcrn-binding modified antibodies and methods of use |
WO2014188377A2 (en) | 2013-05-24 | 2014-11-27 | Nestec S.A. | Pathway specific assays for predicting irritable bowel syndrome diagnosis |
US8900590B2 (en) | 2010-08-12 | 2014-12-02 | Theraclone Sciences, Inc. | Anti-hemagglutinin antibody compositions and methods of use thereof |
US8916160B2 (en) | 2011-02-14 | 2014-12-23 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of influenza |
WO2015006504A1 (en) | 2013-07-09 | 2015-01-15 | Annexon, Inc. | Anti-complement factor c1q antibodies and uses thereof |
WO2015010100A2 (en) | 2013-07-18 | 2015-01-22 | Fabrus, Inc. | Humanized antibodies with ultralong complementarity determining regions |
WO2015017146A2 (en) | 2013-07-18 | 2015-02-05 | Fabrus, Inc. | Antibodies with ultralong complementarity determining regions |
WO2015023596A1 (en) | 2013-08-12 | 2015-02-19 | Genentech, Inc. | Compositions and method for treating complement-associated conditions |
EP2842968A1 (en) | 2005-04-29 | 2015-03-04 | Janssen Biotech, Inc. | Anti-IL-6 antibodies, compositions, methods and uses |
WO2015031837A1 (en) | 2013-08-29 | 2015-03-05 | City Of Hope | Cell penetrating conjugates and methods of use thereof |
EP2851372A1 (en) | 2007-11-30 | 2015-03-25 | Genentech, Inc. | Anti-VEGF antibodies |
WO2015042108A1 (en) | 2013-09-17 | 2015-03-26 | Genentech, Inc. | Methods of using anti-lgr5 antibodies |
WO2015048520A1 (en) | 2013-09-27 | 2015-04-02 | Genentech, Inc. | Anti-pdl1 antibody formulations |
US8999702B2 (en) | 2008-06-11 | 2015-04-07 | Emd Millipore Corporation | Stirred tank bioreactor |
US9000132B2 (en) | 2013-03-15 | 2015-04-07 | Diadexus, Inc. | Lipoprotein-associated phospholipase A2 antibody compositions and methods of use |
WO2015050959A1 (en) | 2013-10-01 | 2015-04-09 | Yale University | Anti-kit antibodies and methods of use thereof |
WO2015054670A1 (en) | 2013-10-11 | 2015-04-16 | Genentech, Inc. | Nsp4 inhibitors and methods of use |
WO2015058132A2 (en) | 2013-10-18 | 2015-04-23 | Genentech, Inc. | Anti-rspo antibodies and methods of use |
WO2015061441A1 (en) | 2013-10-23 | 2015-04-30 | Genentech, Inc. | Methods of diagnosing and treating eosinophilic disorders |
WO2015069459A1 (en) | 2013-11-05 | 2015-05-14 | Novartis Ag | Organic compounds |
WO2015075011A1 (en) | 2013-11-21 | 2015-05-28 | F. Hoffmann-La Roche Ag | ANTI-alpha-SYNUCLEIN ANTIBODIES AND METHODS OF USE |
US9045541B2 (en) | 2012-02-06 | 2015-06-02 | Inhibrx Llc | CD47 antibodies and methods of use thereof |
WO2015084625A1 (en) | 2013-12-02 | 2015-06-11 | Baylor College Of Medicine | Identification of a new polypeptide hormone for maintenance of optimal body weight and blood glucose |
WO2015089344A1 (en) | 2013-12-13 | 2015-06-18 | Genentech, Inc. | Anti-cd33 antibodies and immunoconjugates |
WO2015089117A1 (en) | 2013-12-09 | 2015-06-18 | Allakos Inc. | Anti-siglec-8 antibodies and methods of use thereof |
WO2015095410A1 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Methods of treating cancer using pd-1 axis binding antagonists and an anti-cd20 antibody |
WO2015095418A1 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies |
WO2015095423A2 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists |
WO2015091656A1 (en) | 2013-12-20 | 2015-06-25 | F. Hoffmann-La Roche Ag | HUMANIZED ANTI-Tau(pS422) ANTIBODIES AND METHODS OF USE |
WO2015097536A2 (en) | 2013-12-24 | 2015-07-02 | Janssen Pharmaceutical Nv | Anti-vista antibodies and fragments |
WO2015095953A1 (en) | 2013-12-27 | 2015-07-02 | The Centre For Drug Research And Development | Sulfonamide-containing linkage systems for drug conjugates |
US9073984B2 (en) | 2007-12-27 | 2015-07-07 | Abbott Laboratories | Anti-T. cruzi antibodies and methods of use |
WO2015101587A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Covalently linked helicar-anti-helicar antibody conjugates and uses thereof |
WO2015101588A1 (en) | 2014-01-06 | 2015-07-09 | F. Hoffmann-La Roche Ag | Monovalent blood brain barrier shuttle modules |
WO2015101586A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles |
WO2015101589A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Covalently linked polypeptide toxin-antibody conjugates |
WO2015107026A1 (en) | 2014-01-15 | 2015-07-23 | F. Hoffmann-La Roche Ag | Fc-region variants with modified fcrn- and maintained protein a-binding properties |
WO2015109180A2 (en) | 2014-01-16 | 2015-07-23 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
US9090930B2 (en) | 2006-06-27 | 2015-07-28 | Emd Millipore Corporation | Method and unit for preparing a sample for the microbiological analysis of a liquid |
WO2015112909A1 (en) | 2014-01-24 | 2015-07-30 | Genentech, Inc. | Methods of using anti-steap1 antibodies and immunoconjugates |
WO2015120075A2 (en) | 2014-02-04 | 2015-08-13 | Genentech, Inc. | Mutant smoothened and methods of using the same |
WO2015120280A1 (en) | 2014-02-08 | 2015-08-13 | Genentech, Inc. | Methods of treating alzheimer's disease |
WO2015120233A1 (en) | 2014-02-08 | 2015-08-13 | Genentech, Inc. | Methods of treating alzheimer's disease |
WO2015127405A2 (en) | 2014-02-21 | 2015-08-27 | Genentech, Inc. | Anti-il-13/il-17 bispecific antibodies and uses thereof |
WO2015124588A1 (en) | 2014-02-18 | 2015-08-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for the treatment of diseases mediated by the nrp-1/obr complex signaling pathway |
WO2015131155A1 (en) | 2014-02-28 | 2015-09-03 | Allakos Inc. | Methods and compositions for treating siglec-8 associated diseases |
US9133524B2 (en) | 2010-07-01 | 2015-09-15 | The Regents Of The University Of California | Protein kinase ck2 gene mutations, amplifications and polymorphisms in human cancers and methods of use |
WO2015139046A1 (en) | 2014-03-14 | 2015-09-17 | Genentech, Inc. | Methods and compositions for secretion of heterologous polypeptides |
WO2015140591A1 (en) | 2014-03-21 | 2015-09-24 | Nordlandssykehuset Hf | Anti-cd14 antibodies and uses thereof |
WO2015148531A1 (en) | 2014-03-24 | 2015-10-01 | Genentech, Inc. | Cancer treatment with c-met antagonists and correlation of the latter with hgf expression |
WO2015148984A2 (en) | 2014-03-27 | 2015-10-01 | Ruiyi Inc. | Antibodies that bind human cannabinoid 1 (cb1) receptor |
WO2015148809A1 (en) | 2014-03-27 | 2015-10-01 | Genentech, Inc. | Methods for diagnosing and treating inflammatory bowel disease |
WO2015147915A1 (en) | 2013-03-24 | 2015-10-01 | Development Center For Biotechnology | Methods for suppressing cancer by inhibition of tmcc3 |
EP2926830A2 (en) | 2010-08-31 | 2015-10-07 | Theraclone Sciences, Inc. | Human immunodeficiency virus (HIV)-neutralizing antibodies |
WO2015153513A1 (en) | 2014-03-31 | 2015-10-08 | Genentech, Inc. | Anti-ox40 antibodies and methods of use |
WO2015153514A1 (en) | 2014-03-31 | 2015-10-08 | Genentech, Inc. | Combination therapy comprising anti-angiogenesis agents and ox40 binding agonists |
WO2015150446A1 (en) | 2014-04-02 | 2015-10-08 | F. Hoffmann-La Roche Ag | Method for detecting multispecific antibody light chain mispairing |
WO2015161267A2 (en) | 2014-04-18 | 2015-10-22 | The Board Of Trustees Of The Leland Stanford Junior University | Humanized and chimeric monoclonal antibodies to cd99 |
WO2015164615A1 (en) | 2014-04-24 | 2015-10-29 | University Of Oslo | Anti-gluten antibodies and uses thereof |
WO2015175375A1 (en) | 2014-05-13 | 2015-11-19 | Short Jay M | Conditionally active biological proteins |
WO2015179835A2 (en) | 2014-05-23 | 2015-11-26 | Genentech, Inc. | Mit biomarkers and methods using the same |
WO2015179658A2 (en) | 2014-05-22 | 2015-11-26 | Genentech, Inc. | Anti-gpc3 antibodies and immunoconjugates |
WO2015191986A1 (en) | 2014-06-13 | 2015-12-17 | Genentech, Inc. | Methods of treating and preventing cancer drug resistance |
WO2015191715A1 (en) | 2014-06-11 | 2015-12-17 | Genentech, Inc. | Anti-lgr5 antibodies and uses thereof |
WO2015195917A1 (en) | 2014-06-18 | 2015-12-23 | Mersana Therapeutics, Inc. | Monoclonal antibodies against her2 epitope and methods of use thereof |
WO2015195835A2 (en) | 2014-06-17 | 2015-12-23 | The Regents Of The University Of California | Improved alpha-v beta-8 antibodies |
EP2962697A1 (en) | 2006-11-27 | 2016-01-06 | diaDexus, Inc. | Ovr110 antibody compositions and methods of use |
WO2016001140A1 (en) | 2014-06-30 | 2016-01-07 | Affiris Ag | Vaccines and monoclonal antibodies targeting truncated variants of osteopontin and uses thereof |
WO2016007775A1 (en) | 2014-07-11 | 2016-01-14 | Genentech, Inc. | Notch pathway inhibition |
WO2016007235A1 (en) | 2014-07-11 | 2016-01-14 | Genentech, Inc. | Anti-pd-l1 antibodies and diagnostic uses thereof |
EP2975048A2 (en) | 2008-04-23 | 2016-01-20 | UCB Biopharma SPRL | Epitopes of il-17a and il-17f and antibodies specific thereto |
EP2980100A1 (en) | 2007-06-08 | 2016-02-03 | Australian Poultry CRC Pty Ltd | Clostridial toxin netb |
US9266961B2 (en) | 2012-06-15 | 2016-02-23 | Genentech, Inc. | Anti-PCSK9 antibodies, formulations, dosing, and methods of use |
US9267112B2 (en) | 2011-05-10 | 2016-02-23 | The Regents Of The University Of California | Adenovirus isolated from Titi Monkeys |
WO2016029079A2 (en) | 2014-08-21 | 2016-02-25 | Walter Reed Army Institute Of Research Department Of The Army | Monoclonal antibodies for treatment of microbial infections |
WO2016033331A1 (en) | 2014-08-28 | 2016-03-03 | Bioatla, Llc | Conditionally active chimeric antigen receptors for modified t-cells |
US9278131B2 (en) | 2012-08-10 | 2016-03-08 | Adocia | Process for lowering the viscosity of highly concentrated protein solutions |
US9286673B2 (en) | 2012-10-05 | 2016-03-15 | Volcano Corporation | Systems for correcting distortions in a medical image and methods of use thereof |
WO2016040856A2 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Cysteine engineered antibodies and conjugates |
WO2016040868A1 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Anti-cll-1 antibodies and immunoconjugates |
US9292918B2 (en) | 2012-10-05 | 2016-03-22 | Volcano Corporation | Methods and systems for transforming luminal images |
WO2016041082A1 (en) | 2014-09-17 | 2016-03-24 | CDRD Ventures, Inc. | Cytotoxic and anti-mitotic compounds, and methods of using the same |
WO2016044396A1 (en) | 2014-09-17 | 2016-03-24 | Genentech, Inc. | Immunoconjugates comprising anti-her2 antibodies and pyrrolobenzodiazepines |
US9301687B2 (en) | 2013-03-13 | 2016-04-05 | Volcano Corporation | System and method for OCT depth calibration |
US9307926B2 (en) | 2012-10-05 | 2016-04-12 | Volcano Corporation | Automatic stent detection |
WO2016061389A2 (en) | 2014-10-16 | 2016-04-21 | Genentech, Inc. | Anti-alpha-synuclein antibodies and methods of use |
WO2016059602A2 (en) | 2014-10-16 | 2016-04-21 | Glaxo Group Limited | Methods of treating cancer and related compositions |
US9324141B2 (en) | 2012-10-05 | 2016-04-26 | Volcano Corporation | Removal of A-scan streaking artifact |
EP3011970A2 (en) | 2009-10-22 | 2016-04-27 | F. Hoffmann-La Roche AG | Modulation of axon degeneration |
WO2016073791A1 (en) | 2014-11-05 | 2016-05-12 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
WO2016073794A1 (en) | 2014-11-05 | 2016-05-12 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
WO2016073685A1 (en) | 2014-11-05 | 2016-05-12 | Annexon, Inc. | Humanized anti-complement factor c1q antibodies and uses thereof |
WO2016073157A1 (en) | 2014-11-06 | 2016-05-12 | Genentech, Inc. | Anti-ang2 antibodies and methods of use thereof |
WO2016073378A1 (en) | 2014-11-03 | 2016-05-12 | Genentech, Inc. | Assays for detecting t cell immune subsets and methods of use thereof |
WO2016077369A1 (en) | 2014-11-10 | 2016-05-19 | Genentech, Inc. | Animal model for nephropathy and agents for treating the same |
WO2016077381A1 (en) | 2014-11-10 | 2016-05-19 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
WO2016081384A1 (en) | 2014-11-17 | 2016-05-26 | Genentech, Inc. | Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists |
WO2016079708A1 (en) | 2014-11-19 | 2016-05-26 | Nestec S.A. | Antibodies against serotonin, tryptophan and kynurenine metabolites and uses thereof |
WO2016081639A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Antibodies against bace1 and use thereof for neural disease immunotherapy |
WO2016081640A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Anti-transferrin receptor / anti-bace1 multispecific antibodies and methods of use |
WO2016081643A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Anti-transferrin receptor antibodies and methods of use |
US9360630B2 (en) | 2011-08-31 | 2016-06-07 | Volcano Corporation | Optical-electrical rotary joint and methods of use |
WO2016090210A1 (en) | 2014-12-05 | 2016-06-09 | Genentech, Inc. | ANTI-CD79b ANTIBODIES AND METHODS OF USE |
WO2016087514A1 (en) | 2014-12-02 | 2016-06-09 | Cemm - Forschungszentrum Für Molekulare Medizin Gmbh | Anti-mutant calreticulin antibodies and their use in the diagnosis and therapy of myeloid malignancies |
US9367965B2 (en) | 2012-10-05 | 2016-06-14 | Volcano Corporation | Systems and methods for generating images of tissue |
WO2016094566A2 (en) | 2014-12-10 | 2016-06-16 | Genentech, Inc. | Blood brain barrier receptor antibodies and methods of use |
WO2016098356A1 (en) | 2014-12-19 | 2016-06-23 | Chugai Seiyaku Kabushiki Kaisha | Anti-c5 antibodies and methods of use |
US9376464B2 (en) | 2006-12-21 | 2016-06-28 | Emd Millipore Corporation | Purification of proteins |
US9383263B2 (en) | 2012-12-21 | 2016-07-05 | Volcano Corporation | Systems and methods for narrowing a wavelength emission of light |
EP3043181A1 (en) | 2008-01-15 | 2016-07-13 | The Board of Trustees of The Leland Stanford Junior University | Markers of acute myeloid leukemia stem cells |
WO2016115275A1 (en) | 2015-01-13 | 2016-07-21 | City Of Hope | Ctla4-binding protein peptide-linker masks |
WO2016114819A1 (en) | 2015-01-16 | 2016-07-21 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
WO2016118961A1 (en) | 2015-01-24 | 2016-07-28 | Academia Sinica | Cancer markers and methods of use thereof |
WO2016117346A1 (en) | 2015-01-22 | 2016-07-28 | Chugai Seiyaku Kabushiki Kaisha | A combination of two or more anti-c5 antibodies and methods of use |
US9403855B2 (en) | 2010-05-10 | 2016-08-02 | Academia Sinica | Zanamivir phosphonate congeners with anti-influenza activity and determining oseltamivir susceptibility of influenza viruses |
WO2016123329A2 (en) | 2015-01-28 | 2016-08-04 | Genentech, Inc. | Gene expression markers and treatment of multiple sclerosis |
WO2016123593A1 (en) | 2015-01-30 | 2016-08-04 | Academia Sinica | Compositions and methods relating to universal glycoforms for enhanced antibody efficacy |
WO2016125495A1 (en) | 2015-02-05 | 2016-08-11 | Chugai Seiyaku Kabushiki Kaisha | Antibodies comprising an ion concentration dependent antigen-binding domain, fc region variants, il-8-binding antibodies, and uses therof |
WO2016126972A1 (en) | 2015-02-04 | 2016-08-11 | Genentech, Inc. | Mutant smoothened and methods of using the same |
WO2016138207A1 (en) | 2015-02-26 | 2016-09-01 | Genentech, Inc. | Integrin beta7 antagonists and methods of treating crohn's disease |
US9441035B2 (en) | 2013-03-15 | 2016-09-13 | Genentech, Inc. | Cell culture media and methods of antibody production |
WO2016144824A1 (en) | 2015-03-06 | 2016-09-15 | Genentech, Inc. | Ultrapurified dsba and dsbc and methods of making and using the same |
WO2016146833A1 (en) | 2015-03-19 | 2016-09-22 | F. Hoffmann-La Roche Ag | Biomarkers for nad(+)-diphthamide adp ribosyltransferase resistance |
WO2016149276A1 (en) | 2015-03-16 | 2016-09-22 | Genentech, Inc. | Methods of detecting and quantifying il-13 and uses in diagnosing and treating th2-associated diseases |
KR20160116056A (en) | 2008-08-14 | 2016-10-06 | 테바 파마슈티컬즈 오스트레일리아 피티와이 엘티디 | Anti-il-12/il-23 antibodies |
US9465029B2 (en) | 2004-04-16 | 2016-10-11 | Glaxo Group Limited | Methods for detecting LP-PLA2 activity and inhibition of LP-PLA2 activity |
WO2016164497A1 (en) | 2015-04-06 | 2016-10-13 | Acceleron Pharma Inc. | Alk4:actriib heteromultimers and uses thereof |
WO2016164503A1 (en) | 2015-04-06 | 2016-10-13 | Acceleron Pharma Inc. | Alk7:actriib heteromultimers and uses thereof |
WO2016164480A1 (en) | 2015-04-07 | 2016-10-13 | Genentech, Inc. | Antigen binding complex having agonistic activity and methods of use |
WO2016166348A1 (en) | 2015-04-17 | 2016-10-20 | Elsalys Biotech | Anti-tyro3 antibodies and uses thereof |
US9478940B2 (en) | 2012-10-05 | 2016-10-25 | Volcano Corporation | Systems and methods for amplifying light |
WO2016172551A2 (en) | 2015-04-24 | 2016-10-27 | Genentech, Inc. | Methods of identifying bacteria comprising binding polypeptides |
US9486143B2 (en) | 2012-12-21 | 2016-11-08 | Volcano Corporation | Intravascular forward imaging device |
US9499634B2 (en) | 2012-06-25 | 2016-11-22 | Zymeworks Inc. | Process and methods for efficient manufacturing of highly pure asymmetric antibodies in mammalian cells |
EP3095463A2 (en) | 2008-09-16 | 2016-11-23 | F. Hoffmann-La Roche AG | Methods for treating progressive multiple sclerosis |
EP3095793A1 (en) | 2003-07-28 | 2016-11-23 | Genentech, Inc. | Reducing protein a leaching during protein a affinity chromatography |
WO2016187158A1 (en) | 2015-05-15 | 2016-11-24 | City Of Hope | Chimeric antigen receptor compositions |
WO2016189045A1 (en) | 2015-05-27 | 2016-12-01 | Ucb Biopharma Sprl | Method for the treatment of neurological disease |
WO2016189118A1 (en) | 2015-05-28 | 2016-12-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods of prognosis and treatment of patients suffering from acute myeloid leukemia |
WO2016189091A1 (en) | 2015-05-26 | 2016-12-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions (ntsr1 inhibitors) for the treatment of hepatocellular carcinomas |
WO2016191750A1 (en) | 2015-05-28 | 2016-12-01 | Genentech, Inc. | Cell-based assay for detecting anti-cd3 homodimers |
WO2016196726A1 (en) | 2015-06-05 | 2016-12-08 | Genentech, Inc. | Anti-tau antibodies and methods of use |
WO2016196381A1 (en) | 2015-05-29 | 2016-12-08 | Genentech, Inc. | Pd-l1 promoter methylation in cancer |
WO2016196298A1 (en) | 2015-05-29 | 2016-12-08 | Genentech, Inc. | Therapeutic and diagnolstic methods for cancer |
WO2016196679A1 (en) | 2015-06-02 | 2016-12-08 | Genentech, Inc. | Compositions and methods for using anti-il-34 antibodies to treat neurological diseases |
WO2016196343A1 (en) | 2015-05-29 | 2016-12-08 | Genentech, Inc. | Humanized anti-ebola virus glycoprotein antibodies and methods of use |
WO2016201389A2 (en) | 2015-06-12 | 2016-12-15 | Alector Llc | Anti-cd33 antibodies and methods of use thereof |
WO2016200836A1 (en) | 2015-06-08 | 2016-12-15 | Genentech, Inc. | Methods of treating cancer using anti-ox40 antibodies |
WO2016200835A1 (en) | 2015-06-08 | 2016-12-15 | Genentech, Inc. | Methods of treating cancer using anti-ox40 antibodies and pd-1 axis binding antagonists |
WO2016201388A2 (en) | 2015-06-12 | 2016-12-15 | Alector Llc | Anti-cd33 antibodies and methods of use thereof |
WO2016204966A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Anti-cd3 antibodies and methods of use |
WO2016205200A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Anti-cll-1 antibodies and methods of use |
WO2016205320A1 (en) | 2015-06-17 | 2016-12-22 | Genentech, Inc. | Methods of treating locally advanced or metastatic breast cancers using pd-1 axis binding antagonists and taxanes |
WO2016205531A2 (en) | 2015-06-17 | 2016-12-22 | Genentech, Inc. | Anti-her2 antibodies and methods of use |
WO2016205520A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Humanized and affinity matured antibodies to fcrh5 and methods of use |
WO2016205176A1 (en) | 2015-06-15 | 2016-12-22 | Genentech, Inc. | Antibodies and immunoconjugates |
WO2016207717A1 (en) | 2015-06-24 | 2016-12-29 | Janssen Pharmaceutica Nv | Anti-vista antibodies and fragments |
WO2016207124A1 (en) | 2015-06-25 | 2016-12-29 | F. Hoffmann-La Roche Ag | Cell based assay for determining antibody or ligand binding and function |
EP3112468A1 (en) | 1998-05-15 | 2017-01-04 | Genentech, Inc. | Il-17 homologous polypeptides and therapeutic uses thereof |
WO2017004091A1 (en) | 2015-06-29 | 2017-01-05 | Genentech, Inc. | Type ii anti-cd20 antibody for use in organ transplantation |
US9540674B2 (en) | 2006-03-31 | 2017-01-10 | Dana-Farber Cancer Institute, Inc. | Methods of determining cellular chemosensitivity |
US9547009B2 (en) | 2012-08-21 | 2017-01-17 | Academia Sinica | Benzocyclooctyne compounds and uses thereof |
US9562097B2 (en) | 2011-07-01 | 2017-02-07 | Genentech, Inc. | Use of anti-CD83 agonist antibodies for treating autoimmune diseases |
US9562099B2 (en) | 2013-03-14 | 2017-02-07 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
WO2017024238A1 (en) | 2015-08-06 | 2017-02-09 | City Of Hope | Cell penetrating protein-antibody conjugates and methods of use |
EP3130349A1 (en) | 2004-06-04 | 2017-02-15 | Genentech, Inc. | Method for treating multiple sclerosis |
US9574010B2 (en) | 2011-11-04 | 2017-02-21 | Zymeworks Inc. | Stable heterodimeric antibody design with mutations in the Fc domain |
WO2017040195A1 (en) | 2015-08-28 | 2017-03-09 | The Trustees Of The University Of Pennsylvania | Methods and compositions for cells expressing a chimeric intracellular signaling molecule |
WO2017041004A1 (en) | 2015-09-02 | 2017-03-09 | The Regents Of The University Of Colorado, A Body Corporate | Compositions and methods for modulating t-cell mediated immune response |
WO2017040301A1 (en) | 2015-08-28 | 2017-03-09 | Alector Llc | Anti-siglec-7 antibodies and methods of use thereof |
US9592289B2 (en) | 2012-03-26 | 2017-03-14 | Sanofi | Stable IgG4 based binding agent formulations |
US9596993B2 (en) | 2007-07-12 | 2017-03-21 | Volcano Corporation | Automatic calibration systems and methods of use |
WO2017046994A1 (en) | 2015-09-18 | 2017-03-23 | Chugai Seiyaku Kabushiki Kaisha | Il-8-binding antibodies and uses thereof |
WO2017053906A1 (en) | 2015-09-24 | 2017-03-30 | Abvitro Llc | Hiv antibody compositions and methods of use |
WO2017050729A1 (en) | 2015-09-22 | 2017-03-30 | Spring Bioscience Corporation | Anti-ox40 antibodies and diagnostic uses thereof |
WO2017053807A2 (en) | 2015-09-23 | 2017-03-30 | Genentech, Inc. | Optimized variants of anti-vegf antibodies |
US9612105B2 (en) | 2012-12-21 | 2017-04-04 | Volcano Corporation | Polarization sensitive optical coherence tomography system |
WO2017055399A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Cellular based fret assay for the determination of simultaneous binding |
WO2017055443A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Anti-pd1 antibodies and methods of use |
WO2017058771A1 (en) | 2015-09-30 | 2017-04-06 | Bird Rock Bio, Inc. | Antibodies that bind human cannabinoid 1 (cb1) recetor |
WO2017059289A1 (en) | 2015-10-02 | 2017-04-06 | Genentech, Inc. | Pyrrolobenzodiazepine antibody drug conjugates and methods of use |
WO2017062672A2 (en) | 2015-10-06 | 2017-04-13 | Alector Llc | Anti-trem2 antibodies and methods of use thereof |
WO2017062682A2 (en) | 2015-10-06 | 2017-04-13 | Genentech, Inc. | Method for treating multiple sclerosis |
US9622706B2 (en) | 2007-07-12 | 2017-04-18 | Volcano Corporation | Catheter for in vivo imaging |
WO2017064675A1 (en) | 2015-10-16 | 2017-04-20 | Genentech, Inc. | Hindered disulfide drug conjugates |
WO2017064034A1 (en) | 2015-10-12 | 2017-04-20 | INSERM (Institut National de la Santé et de la Recherche Médicale) | An agent capable of depleting cd8 t cells for the treatment of myocardial infarction or acute myocardial infarction |
WO2017068511A1 (en) | 2015-10-20 | 2017-04-27 | Genentech, Inc. | Calicheamicin-antibody-drug conjugates and methods of use |
WO2017072210A1 (en) | 2015-10-29 | 2017-05-04 | F. Hoffmann-La Roche Ag | Anti-variant fc-region antibodies and methods of use |
WO2017075173A2 (en) | 2015-10-30 | 2017-05-04 | Genentech, Inc. | Anti-factor d antibodies and conjugates |
WO2017075432A2 (en) | 2015-10-29 | 2017-05-04 | Alector Llc | Anti-siglec-9 antibodies and methods of use thereof |
EP3165237A1 (en) | 2015-11-03 | 2017-05-10 | Industrial Technology Research Institute | Antibody-drug conjugate (adc) and method for forming the same |
WO2017079768A1 (en) | 2015-11-08 | 2017-05-11 | Genentech, Inc. | Methods of screening for multispecific antibodies |
WO2017088734A1 (en) | 2015-11-23 | 2017-06-01 | 四川科伦博泰生物医药股份有限公司 | Anti-erbb2 antibody-drug conjugate and composition thereof, preparation method therefor, and application thereof |
EP3176185A1 (en) | 2013-11-04 | 2017-06-07 | Glenmark Pharmaceuticals S.A. | Production of t cell retargeting hetero-dimeric immunoglobulins |
EP3178848A1 (en) | 2015-12-09 | 2017-06-14 | F. Hoffmann-La Roche AG | Type ii anti-cd20 antibody for reducing formation of anti-drug antibodies |
WO2017100714A1 (en) | 2015-12-10 | 2017-06-15 | City Of Hope | Cell penetrating cyanine-coupled antibodies |
US9684000B2 (en) | 2010-12-16 | 2017-06-20 | Genentech, Inc. | Diagnosis and treatments relating to TH2 inhibition |
WO2017104779A1 (en) | 2015-12-18 | 2017-06-22 | Chugai Seiyaku Kabushiki Kaisha | Anti-c5 antibodies and methods of use |
EP3184547A1 (en) | 2015-10-29 | 2017-06-28 | F. Hoffmann-La Roche AG | Anti-tpbg antibodies and methods of use |
WO2017112917A1 (en) | 2015-12-24 | 2017-06-29 | Corvus Pharmaceuticals, Inc. | Methods of treating cancer |
US9695233B2 (en) | 2012-07-13 | 2017-07-04 | Roche Glycart Ag | Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases |
WO2017117311A1 (en) | 2015-12-30 | 2017-07-06 | Genentech, Inc. | Formulations with reduced degradation of polysorbate |
WO2017117304A1 (en) | 2015-12-30 | 2017-07-06 | Genentech, Inc. | Use of tryptophan derivatives for protein formulations |
EP3189831A1 (en) | 2007-11-30 | 2017-07-12 | AbbVie Biotechnology Ltd | Protein formulations and methods of making same |
US9708410B2 (en) | 2003-05-30 | 2017-07-18 | Janssen Biotech, Inc. | Anti-tissue factor antibodies and compositions |
US9709379B2 (en) | 2012-12-20 | 2017-07-18 | Volcano Corporation | Optical coherence tomography system that is reconfigurable between different imaging modes |
WO2017122098A2 (en) | 2016-01-10 | 2017-07-20 | Neotx Therapeutics Ltd. | Methods and compositions for enhancing the potency of superantigen mediated cancer immunotherapy. |
WO2017127764A1 (en) | 2016-01-20 | 2017-07-27 | Genentech, Inc. | High dose treatments for alzheimer's disease |
WO2017132279A1 (en) | 2016-01-25 | 2017-08-03 | Genentech, Inc. | Methods for assaying t-cell dependent bispecific antibodies |
WO2017136558A1 (en) | 2016-02-04 | 2017-08-10 | Curis, Inc. | Mutant smoothened and methods of using the same |
US9730613B2 (en) | 2012-12-20 | 2017-08-15 | Volcano Corporation | Locating intravascular images |
WO2017137830A1 (en) | 2016-02-12 | 2017-08-17 | Janssen Pharmaceutica Nv | Anti-vista (b7h5) antibodies |
EP3208612A1 (en) | 2008-04-09 | 2017-08-23 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP3211008A1 (en) | 2008-08-29 | 2017-08-30 | F. Hoffmann-La Roche AG | Cross-reactive and bispecific anti-il-17a/f antibodies |
WO2017151502A1 (en) | 2016-02-29 | 2017-09-08 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2017152102A2 (en) | 2016-03-04 | 2017-09-08 | Alector Llc | Anti-trem1 antibodies and methods of use thereof |
US9759726B2 (en) | 2014-03-27 | 2017-09-12 | Academia Sinica | Reactive labelling compounds and uses thereof |
US9765156B2 (en) | 2012-07-13 | 2017-09-19 | The Trustees Of The University Of Pennsylvania | Enhancing activity of CAR T cells by co-introducing a bispecific antibody |
US9770172B2 (en) | 2013-03-07 | 2017-09-26 | Volcano Corporation | Multimodal segmentation in intravascular images |
WO2017165683A1 (en) | 2016-03-23 | 2017-09-28 | Novartis Ag | Cell secreted minibodies and uses thereof |
WO2017165734A1 (en) | 2016-03-25 | 2017-09-28 | Genentech, Inc. | Multiplexed total antibody and antibody-conjugated drug quantification assay |
WO2017173302A2 (en) | 2016-04-01 | 2017-10-05 | The Regents Of The University Of California | Inhibitors of integrin alpha 5 beta 1 and methods of use |
WO2017172771A2 (en) | 2016-03-29 | 2017-10-05 | Janssen Biotech, Inc. | Method of treating psoriasis with increased interval dosing of anti-il12/23 antibody |
US9782476B2 (en) | 2013-09-06 | 2017-10-10 | Academia Sinica | Human iNKT cell activation using glycolipids with altered glycosyl groups |
WO2017175058A1 (en) | 2016-04-07 | 2017-10-12 | Janssen Pharmaceutica Nv | Anti-vista antibodies and fragments, uses thereof, and methods of identifying same |
WO2017180864A1 (en) | 2016-04-14 | 2017-10-19 | Genentech, Inc. | Anti-rspo3 antibodies and methods of use |
WO2017181111A2 (en) | 2016-04-15 | 2017-10-19 | Genentech, Inc. | Methods for monitoring and treating cancer |
WO2017181079A2 (en) | 2016-04-15 | 2017-10-19 | Genentech, Inc. | Methods for monitoring and treating cancer |
US9803165B2 (en) | 2008-12-16 | 2017-10-31 | Emd Millipore Corporation | Stirred tank reactor and method |
US9810670B2 (en) | 2012-11-15 | 2017-11-07 | Genentech, Inc. | Ionic strength-mediated pH gradient ion exchange chromatography |
WO2017191101A1 (en) | 2016-05-02 | 2017-11-09 | F. Hoffmann-La Roche Ag | The contorsbody - a single chain target binder |
US9816981B2 (en) | 2007-03-23 | 2017-11-14 | Academia Sinica | Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells |
WO2017194441A1 (en) | 2016-05-11 | 2017-11-16 | F. Hoffmann-La Roche Ag | Modified anti-tenascin antibodies and methods of use |
WO2017197234A1 (en) | 2016-05-13 | 2017-11-16 | Bioatla, Llc | Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof |
WO2017201036A1 (en) | 2016-05-17 | 2017-11-23 | Genentech, Inc. | Stromal gene signatures for diagnosis and use in immunotherapy |
WO2017201449A1 (en) | 2016-05-20 | 2017-11-23 | Genentech, Inc. | Protac antibody conjugates and methods of use |
WO2017205741A1 (en) | 2016-05-27 | 2017-11-30 | Genentech, Inc. | Bioanalytical method for the characterization of site-specific antibody-drug conjugates |
EP3252078A1 (en) | 2016-06-02 | 2017-12-06 | F. Hoffmann-La Roche AG | Type ii anti-cd20 antibody and anti-cd20/cd3 bispecific antibody for treatment of cancer |
WO2017214024A1 (en) | 2016-06-06 | 2017-12-14 | Genentech, Inc. | Silvestrol antibody-drug conjugates and methods of use |
WO2017218977A2 (en) | 2016-06-17 | 2017-12-21 | Genentech, Inc. | Purification of multispecific antibodies |
EP3260136A1 (en) | 2009-03-17 | 2017-12-27 | Theraclone Sciences, Inc. | Human immunodeficiency virus (hiv) -neutralizing antibodies |
WO2017223405A1 (en) | 2016-06-24 | 2017-12-28 | Genentech, Inc. | Anti-polyubiquitin multispecific antibodies |
US9858668B2 (en) | 2012-10-05 | 2018-01-02 | Volcano Corporation | Guidewire artifact removal in images |
EP3263581A1 (en) | 2005-05-17 | 2018-01-03 | University of Connecticut | Compositions and methods for immunomodulation in an organism |
US9867530B2 (en) | 2006-08-14 | 2018-01-16 | Volcano Corporation | Telescopic side port catheter device with imaging system and method for accessing side branch occlusions |
WO2018011691A1 (en) | 2016-07-12 | 2018-01-18 | Nestec S.A. | Competitive immunoassay methods |
WO2018013936A1 (en) | 2016-07-15 | 2018-01-18 | Acceleron Pharma Inc. | Compositions and methods for treating pulmonary hypertension |
US9873748B2 (en) | 2013-12-23 | 2018-01-23 | Genentech, Inc. | Bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1 |
US9873742B2 (en) | 2012-10-05 | 2018-01-23 | Genentech, Inc. | Methods for diagnosing and treating inflammatory bowel disease |
US9879042B2 (en) | 2014-09-08 | 2018-01-30 | Academia Sinica | Human iNKT cell activation using glycolipids |
WO2018021450A1 (en) | 2016-07-29 | 2018-02-01 | 中外製薬株式会社 | Bispecific antibody exhibiting increased alternative fviii-cofactor-function activity |
WO2018022762A1 (en) | 2016-07-27 | 2018-02-01 | Acceleron Pharma Inc. | Methods and compositions for treating myelofibrosis |
WO2018027204A1 (en) | 2016-08-05 | 2018-02-08 | Genentech, Inc. | Multivalent and multiepitopic anitibodies having agonistic activity and methods of use |
WO2018031662A1 (en) | 2016-08-11 | 2018-02-15 | Genentech, Inc. | Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof |
WO2018029124A1 (en) | 2016-08-08 | 2018-02-15 | F. Hoffmann-La Roche Ag | Therapeutic and diagnostic methods for cancer |
WO2018035025A1 (en) | 2016-08-15 | 2018-02-22 | Genentech, Inc. | Chromatography method for quantifying a non-ionic surfactant in a composition comprising the non-ionic surfactant and a polypeptide |
WO2018038046A1 (en) | 2016-08-22 | 2018-03-01 | 中外製薬株式会社 | Gene-modified non-human animal expressing human gpc3 polypeptide |
WO2018045379A1 (en) | 2016-09-02 | 2018-03-08 | Dana-Farber Cancer Institute, Inc. | Composition and methods of treating b cell disorders |
US9914956B2 (en) | 2012-08-18 | 2018-03-13 | Academia Sinica | Cell-permeable probes for identification and imaging of sialidases |
US9914785B2 (en) | 2012-11-28 | 2018-03-13 | Zymeworks Inc. | Engineered immunoglobulin heavy chain-light chain pairs and uses thereof |
WO2018049248A1 (en) | 2016-09-09 | 2018-03-15 | Icellhealth Consulting Llc | Oncolytic virus equipped with bispecific engager molecules |
WO2018050878A1 (en) | 2016-09-19 | 2018-03-22 | F. Hoffmann-La Roche Ag | Complement factor based affinity chromatography |
WO2018057849A1 (en) | 2016-09-23 | 2018-03-29 | Genentech, Inc. | Uses of il-13 antagonists for treating atopic dermatitis |
WO2018064436A1 (en) | 2016-09-30 | 2018-04-05 | Janssen Biotech, Inc. | Safe and effective method of treating psoriasis with anti-il23 specific antibody |
WO2018060462A1 (en) | 2016-09-29 | 2018-04-05 | Nascient Ltd | Tenascin epitope and antibodies thereto |
WO2018060035A1 (en) | 2016-09-30 | 2018-04-05 | F. Hoffmann-La Roche Ag | Spr-based dual-binding assay for the functional analysis of multispecific molecules |
WO2018064478A1 (en) | 2016-09-29 | 2018-04-05 | The Regents Of The University Of California | NEUTRALIZING ANTIBODIES TO THE αVβ8 INTEGRIN COMPLEX FOR IMMUNOTHERAPY |
WO2018068028A1 (en) | 2016-10-06 | 2018-04-12 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2018065501A1 (en) | 2016-10-05 | 2018-04-12 | F. Hoffmann-La Roche Ag | Methods for preparing antibody drug conjugates |
WO2018081648A2 (en) | 2016-10-29 | 2018-05-03 | Genentech, Inc. | Anti-mic antibidies and methods of use |
WO2018081649A1 (en) | 2016-10-28 | 2018-05-03 | Banyan Biomarkers, Inc. | Antibodies to ubiquitin c-terminal hydrolase l1 (uch-l1) and glial fibrillary acidic protein (gfap) and related methods |
WO2018083535A1 (en) | 2016-11-04 | 2018-05-11 | Novimmune Sa | Anti-cd19 antibodies and methods of use thereof |
WO2018089967A1 (en) | 2016-11-14 | 2018-05-17 | Virginia Commonwealth University | Inhibitors of cancer invasion, attachment, and/or metastasis |
US9975965B2 (en) | 2015-01-16 | 2018-05-22 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
EP3323830A1 (en) | 2010-06-19 | 2018-05-23 | Memorial Sloan-Kettering Cancer Center | Anti-gd2 antibodies |
WO2018094300A1 (en) | 2016-11-19 | 2018-05-24 | Potenza Therapeutics, Inc. | Anti-gitr antigen-binding proteins and methods of use thereof |
WO2018093841A1 (en) | 2016-11-16 | 2018-05-24 | Janssen Biotech, Inc. | Method of treating psoriasis with anti-il-23 specific antibody |
WO2018091580A1 (en) | 2016-11-18 | 2018-05-24 | F. Hoffmann-La Roche Ag | Anti-hla-g antibodies and use thereof |
WO2018093821A1 (en) | 2016-11-15 | 2018-05-24 | Genentech, Inc. | Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies |
US9981030B2 (en) | 2013-06-27 | 2018-05-29 | Academia Sinica | Glycan conjugates and use thereof |
WO2018098363A2 (en) | 2016-11-23 | 2018-05-31 | Bioverativ Therapeutics Inc. | Bispecific antibodies binding to coagulation factor ix and coagulation factor x |
US9995746B2 (en) | 2014-04-02 | 2018-06-12 | The United States Of America, As Represented By The Secretary Of The Army | Rapid dual direct fluorescent antibody assay for the identification of Bacillus antrhacis |
WO2018106776A2 (en) | 2016-12-07 | 2018-06-14 | Genentech, Inc. | Anti-tau antibodies and methods of use |
WO2018106781A1 (en) | 2016-12-07 | 2018-06-14 | Genentech, Inc | Anti-tau antibodies and methods of use |
WO2018108759A1 (en) | 2016-12-13 | 2018-06-21 | F. Hoffmann-La Roche Ag | Method to determine the presence of a target antigen in a tumor sample |
US10005847B2 (en) | 2014-05-27 | 2018-06-26 | Academia Sinica | Anti-HER2 glycoantibodies and uses thereof |
WO2018115231A2 (en) | 2016-12-22 | 2018-06-28 | Boehringer Ingelheim International Gmbh | Binding molecules for the treatment of cancer |
WO2018114877A1 (en) | 2016-12-21 | 2018-06-28 | F. Hoffmann-La Roche Ag | In vitro glycoengineering of antibodies |
WO2018114772A1 (en) | 2016-12-21 | 2018-06-28 | F. Hoffmann-La Roche Ag | Assay for determining antibody or ligand binding and function |
WO2018114754A1 (en) | 2016-12-19 | 2018-06-28 | F. Hoffmann-La Roche Ag | Combination therapy with targeted 4-1bb (cd137) agonists |
WO2018114878A1 (en) | 2016-12-21 | 2018-06-28 | F. Hoffmann-La Roche Ag | Re-use of enzymes in in vitro glycoengineering of antibodies |
WO2018114879A1 (en) | 2016-12-21 | 2018-06-28 | F. Hoffmann-La Roche Ag | Method for in vitro glycoengineering of antibodies |
WO2018114748A1 (en) | 2016-12-20 | 2018-06-28 | F. Hoffmann-La Roche Ag | Combination therapy of anti-cd20/anti-cd3 bispecific antibodies and 4-1bb (cd137) agonists |
US10011658B2 (en) | 2015-04-03 | 2018-07-03 | Eureka Therapeutics, Inc. | Constructs targeting AFP peptide/MHC complexes and uses thereof |
WO2018129029A1 (en) | 2017-01-04 | 2018-07-12 | Immunogen, Inc. | Met antibodies and immunoconjugates and uses thereof |
US10023892B2 (en) | 2014-05-27 | 2018-07-17 | Academia Sinica | Compositions and methods relating to universal glycoforms for enhanced antibody efficacy |
EP3348277A1 (en) | 2009-11-20 | 2018-07-18 | The Regents of The University of California | Epithelial membrane protein-2 (emp2) and proliferative vitreoretinopathy (pvr) |
EP3360567A1 (en) | 2007-11-07 | 2018-08-15 | Genentech, Inc. | Amp for use in treating microbial disorders |
WO2018148585A1 (en) | 2017-02-10 | 2018-08-16 | Genentech, Inc. | Anti-tryptase antibodies, compositions thereof, and uses thereof |
WO2018152496A1 (en) | 2017-02-17 | 2018-08-23 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Compositions and methods for the diagnosis and treatment of zika virus infection |
US10059768B2 (en) | 2014-09-12 | 2018-08-28 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
US10058284B2 (en) | 2012-12-21 | 2018-08-28 | Volcano Corporation | Simultaneous imaging, monitoring, and therapy |
WO2018160841A1 (en) | 2017-03-01 | 2018-09-07 | Genentech, Inc. | Diagnostic and therapeutic methods for cancer |
US10070827B2 (en) | 2012-10-05 | 2018-09-11 | Volcano Corporation | Automatic image playback |
US10077304B2 (en) | 2013-08-14 | 2018-09-18 | The Governing Council Of The University Of Toronto | Antibodies against frizzled receptor |
WO2018175752A1 (en) | 2017-03-22 | 2018-09-27 | Genentech, Inc. | Optimized antibody compositions for treatment of ocular disorders |
WO2018175788A1 (en) | 2017-03-22 | 2018-09-27 | Genentech, Inc. | Hydrogel cross-linked hyaluronic acid prodrug compositions and methods |
US10087255B2 (en) | 2015-04-07 | 2018-10-02 | Alector Llc | Anti-sortilin antibodies and methods of use thereof |
US10087236B2 (en) | 2009-12-02 | 2018-10-02 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
US10086054B2 (en) | 2013-06-26 | 2018-10-02 | Academia Sinica | RM2 antigens and use thereof |
WO2018183175A1 (en) | 2017-03-28 | 2018-10-04 | Genentech, Inc. | Methods of treating neurodegenerative diseases |
WO2018195472A1 (en) | 2017-04-21 | 2018-10-25 | Genentech, Inc. | Use of klk5 antagonists for treatment of a disease |
WO2018194496A2 (en) | 2017-04-17 | 2018-10-25 | Закрытое Акционерное Общество "Биокад" | Monoclonal antibody to pd-l1 |
WO2018200742A1 (en) | 2017-04-25 | 2018-11-01 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Antibodies and methods for the diagnosis and treatment of epstein barr virus infection |
US10118969B2 (en) | 2014-05-27 | 2018-11-06 | Academia Sinica | Compositions and methods relating to universal glycoforms for enhanced antibody efficacy |
EP3401335A1 (en) | 2008-01-30 | 2018-11-14 | Genentech, Inc. | Composition comprising antibody that binds to domain ii of her2 and acidic variants thereof |
US10130714B2 (en) | 2012-04-14 | 2018-11-20 | Academia Sinica | Enhanced anti-influenza agents conjugated with anti-inflammatory activity |
US10132797B2 (en) | 2016-12-19 | 2018-11-20 | Tolero Pharmaceuticals, Inc. | Profiling peptides and methods for sensitivity profiling |
US10131658B2 (en) | 2013-09-30 | 2018-11-20 | The Regents Of The University Of California | Anti-alphavbeta1 integrin compounds and methods |
WO2018213316A1 (en) | 2017-05-16 | 2018-11-22 | Alector Llc | Anti-siglec-5 antibodies and methods of use thereof |
WO2018215835A1 (en) | 2017-05-26 | 2018-11-29 | Novimmune Sa | Anti-cd47 x anti-mesothelin antibodies and methods of use thereof |
WO2018215535A1 (en) | 2017-05-23 | 2018-11-29 | Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) | Novel cd73 antibody, preparation and uses thereof |
WO2018220099A1 (en) | 2017-06-02 | 2018-12-06 | F. Hoffmann-La Roche Ag | Type ii anti-cd20 antibody and anti-cd20/cd3 bispecific antibody for treatment of cancer |
US10150818B2 (en) | 2014-01-16 | 2018-12-11 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
EP3412309A1 (en) | 2011-03-31 | 2018-12-12 | F. Hoffmann-La Roche AG | Methods of administering beta7 integrin antagonists |
US10166003B2 (en) | 2012-12-21 | 2019-01-01 | Volcano Corporation | Ultrasound imaging with variable line density |
EP3428190A1 (en) | 2014-02-12 | 2019-01-16 | F. Hoffmann-La Roche AG | Anti-jagged1 antibodies and methods of use |
WO2019018757A1 (en) | 2017-07-21 | 2019-01-24 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2019018629A1 (en) | 2017-07-19 | 2019-01-24 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Antibodies and methods for the diagnosis and treatment of hepatitis b virus infection |
US10191220B2 (en) | 2012-12-21 | 2019-01-29 | Volcano Corporation | Power-efficient optical circuit |
WO2019023347A1 (en) | 2017-07-26 | 2019-01-31 | Forty Seven, Inc. | Anti-sirp-alpha antibodies and related methods |
WO2019028292A1 (en) | 2017-08-03 | 2019-02-07 | Alector Llc | Anti-trem2 antibodies and methods of use thereof |
WO2019028283A1 (en) | 2017-08-03 | 2019-02-07 | Alector Llc | Anti-cd33 antibodies and methods of use thereof |
US10208120B2 (en) | 2014-11-05 | 2019-02-19 | Genentech, Inc. | Anti-FGFR2/3 antibodies and methods using same |
US10208349B2 (en) | 2011-01-07 | 2019-02-19 | Ucb Biopharma Sprl | Lipocalin 2 as a biomarker for IL-17 inhibitor therapy efficacy |
US10214522B2 (en) | 2015-03-10 | 2019-02-26 | The Regents Of The University Of California | Anti-alphavbeta1 integrin inhibitors and methods of use |
EP3447075A2 (en) | 2015-05-15 | 2019-02-27 | The General Hospital Corporation | Antagonistic anti-tumor necrosis factor receptor superfamily antibodies |
US10221218B2 (en) | 2011-05-10 | 2019-03-05 | The Regents Of The University Of California | Adenovirus isolated from titi monkeys |
US10219887B2 (en) | 2013-03-14 | 2019-03-05 | Volcano Corporation | Filters with echogenic characteristics |
US10219780B2 (en) | 2007-07-12 | 2019-03-05 | Volcano Corporation | OCT-IVUS catheter for concurrent luminal imaging |
EP3450459A2 (en) | 2009-12-28 | 2019-03-06 | OncoTherapy Science, Inc. | Anti-cdh3 antibodies and uses thereof |
US10226597B2 (en) | 2013-03-07 | 2019-03-12 | Volcano Corporation | Guidewire with centering mechanism |
US10233211B2 (en) | 2006-12-21 | 2019-03-19 | Emd Millipore Corporation | Purification of proteins |
US10238367B2 (en) | 2012-12-13 | 2019-03-26 | Volcano Corporation | Devices, systems, and methods for targeted cannulation |
WO2019067015A1 (en) | 2017-09-29 | 2019-04-04 | City Of Hope | Chimeric antigen receptors and bispecific antibodies for treatment of mantle cell lymphoma |
WO2019065795A1 (en) | 2017-09-29 | 2019-04-04 | 中外製薬株式会社 | Multispecific antigen-binding molecule having blood coagulation factor viii (fviii) cofactor function-substituting activity, and pharmaceutical formulation containing said molecule as active ingredient |
US10251952B2 (en) | 2014-06-26 | 2019-04-09 | Hoffmann-La Roche Inc. | Humanized anti-tau(pS422) antibody brain shuttles and use thereof |
WO2019070164A1 (en) | 2017-10-03 | 2019-04-11 | Закрытое Акционерное Общество "Биокад" | MONOCLONAL ANTIBODY TO IL-5Rα |
US10259835B2 (en) | 2015-05-18 | 2019-04-16 | Tolero Pharmaceuticals, Inc. | Alvocidib prodrugs having increased bioavailability |
US10274466B2 (en) | 2013-07-12 | 2019-04-30 | Genentech, Inc. | Elucidation of ion exchange chromatography input optimization |
US10274488B2 (en) | 2008-07-15 | 2019-04-30 | Academia Sinica | Glycan arrays on PTFE-like aluminum coated glass slides and related methods |
WO2019086497A2 (en) | 2017-11-01 | 2019-05-09 | F. Hoffmann-La Roche Ag | Combination therapy with targeted ox40 agonists |
WO2019090263A1 (en) | 2017-11-06 | 2019-05-09 | Genentech, Inc. | Diagnostic and therapeutic methods for cancer |
WO2019086395A1 (en) | 2017-11-01 | 2019-05-09 | F. Hoffmann-La Roche Ag | Trifab-contorsbody |
WO2019086331A2 (en) | 2017-11-02 | 2019-05-09 | Bayer Aktiengesellschaft | Bispecific antibodies binding alk-1 and bmpr-2 |
US10292677B2 (en) | 2013-03-14 | 2019-05-21 | Volcano Corporation | Endoluminal filter having enhanced echogenic properties |
EP3495814A2 (en) | 2013-03-27 | 2019-06-12 | F. Hoffmann-La Roche AG | Use of biomarkers for assessing treatment of gastrointestinal inflammatory disorders with beta7 integrin antagonists |
US10332228B2 (en) | 2012-12-21 | 2019-06-25 | Volcano Corporation | System and method for graphical processing of medical data |
WO2019125846A1 (en) | 2017-12-19 | 2019-06-27 | The Rockefeller University | HUMAN IgG Fc DOMAIN VARIANTS WITH IMPROVED EFFECTOR FUNCTION |
WO2019122054A1 (en) | 2017-12-22 | 2019-06-27 | F. Hoffmann-La Roche Ag | Depletion of light chain mispaired antibody variants by hydrophobic interaction chromatography |
WO2019126472A1 (en) | 2017-12-22 | 2019-06-27 | Genentech, Inc. | Use of pilra binding agents for treatment of a disease |
US10336784B2 (en) | 2016-03-08 | 2019-07-02 | Academia Sinica | Methods for modular synthesis of N-glycans and arrays thereof |
US10338069B2 (en) | 2010-04-12 | 2019-07-02 | Academia Sinica | Glycan arrays for high throughput screening of viruses |
WO2019133512A1 (en) | 2017-12-29 | 2019-07-04 | Alector Llc | Anti-tmem106b antibodies and methods of use thereof |
WO2019129211A1 (en) | 2017-12-28 | 2019-07-04 | Nanjing Legend Biotech Co., Ltd. | Antibodies and variants thereof against pd-l1 |
US10342858B2 (en) | 2015-01-24 | 2019-07-09 | Academia Sinica | Glycan conjugates and methods of use thereof |
EP3511344A1 (en) | 2004-12-10 | 2019-07-17 | NovImmune S.A. | Neutralizing antibodies and methods of use thereof |
US10357488B2 (en) | 2015-04-20 | 2019-07-23 | Tolero Pharmaceuticals, Inc. | Predicting response to alvocidib by mitochondrial profiling |
EP3514174A1 (en) | 2015-06-29 | 2019-07-24 | Ventana Medical Systems, Inc. | Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin |
WO2019143636A1 (en) | 2018-01-16 | 2019-07-25 | Lakepharma, Inc. | Bispecific antibody that binds cd3 and another target |
WO2019145475A2 (en) | 2018-01-25 | 2019-08-01 | Acm Biolabs Pte Ltd | Polymersomes comprising a soluble encapsulated antigen as well as methods of making and uses thereof |
US10370455B2 (en) | 2014-12-05 | 2019-08-06 | Immunext, Inc. | Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists |
WO2019152715A1 (en) | 2018-01-31 | 2019-08-08 | Alector Llc | Anti-ms4a4a antibodies and methods of use thereof |
EP3524620A1 (en) | 2008-10-14 | 2019-08-14 | Genentech, Inc. | Immunoglobulin variants and uses thereof |
WO2019157358A1 (en) | 2018-02-09 | 2019-08-15 | Genentech, Inc. | Therapeutic and diagnostic methods for mast cell-mediated inflammatory diseases |
US10393733B2 (en) | 2012-09-19 | 2019-08-27 | Dana-Farber Cancer Institute, Inc. | Dynamic BH3 profiling |
US10406197B2 (en) | 2014-07-10 | 2019-09-10 | Affiris Ag | Substances and methods for the use in prevention and/or treatment in Huntington's disease |
WO2019171252A1 (en) | 2018-03-05 | 2019-09-12 | Janssen Biotech, Inc. | Methods of treating crohn's disease with anti-il23 specific antibody |
US10414814B2 (en) | 2014-07-03 | 2019-09-17 | City Of Hope | Tumor-selective CTLA-4 antagonists |
US10413317B2 (en) | 2012-12-21 | 2019-09-17 | Volcano Corporation | System and method for catheter steering and operation |
WO2019175071A1 (en) | 2018-03-13 | 2019-09-19 | F. Hoffmann-La Roche Ag | Therapeutic combination of 4-1 bb agonists with anti-cd20 antibodies |
WO2019175658A1 (en) | 2018-03-14 | 2019-09-19 | Novimmune Sa | Anti-cd3 epsilon antibodies and methods of use thereof |
WO2019178316A1 (en) | 2018-03-14 | 2019-09-19 | Genentech, Inc. | Anti-klk5 antibodies and methods of use |
WO2019175125A1 (en) | 2018-03-13 | 2019-09-19 | F. Hoffmann-La Roche Ag | Combination therapy with targeted 4-1bb (cd137) agonists |
US10420530B2 (en) | 2012-12-21 | 2019-09-24 | Volcano Corporation | System and method for multipath processing of image signals |
US10426590B2 (en) | 2013-03-14 | 2019-10-01 | Volcano Corporation | Filters with echogenic characteristics |
WO2019195514A1 (en) | 2018-04-04 | 2019-10-10 | Genentech, Inc. | Methods for detecting and quantifying fgf21 |
WO2019192432A1 (en) | 2018-04-02 | 2019-10-10 | 上海博威生物医药有限公司 | Lymphocyte activation gene-3 (lag-3) binding antibody and use thereof |
US10450379B2 (en) | 2005-11-15 | 2019-10-22 | Genetech, Inc. | Method for treating joint damage |
WO2019202040A1 (en) | 2018-04-18 | 2019-10-24 | F. Hoffmann-La Roche Ag | Anti-hla-g antibodies and use thereof |
WO2019213416A1 (en) | 2018-05-02 | 2019-11-07 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Antibodies and methods for the diagnosis, prevention, and treatment of epstein barr virus infection |
WO2019215701A1 (en) | 2018-05-11 | 2019-11-14 | Janssen Biotech, Inc. | Methods of treating depression using il-23 antibodies |
WO2019224385A2 (en) | 2018-05-24 | 2019-11-28 | Glenmark Pharmaceuticals S.A. | Combined bispecific antibody and immuno-oncology therapies |
WO2019226973A1 (en) | 2018-05-25 | 2019-11-28 | Alector Llc | Anti-sirpa antibodies and methods of use thereof |
US10495645B2 (en) | 2015-01-16 | 2019-12-03 | Academia Sinica | Cancer markers and methods of use thereof |
WO2019234220A1 (en) | 2018-06-09 | 2019-12-12 | Boehringer Ingelheim International Gmbh | Dll3-cd3 bispecific antibodies |
WO2019236965A1 (en) | 2018-06-08 | 2019-12-12 | Alector Llc | Anti-siglec-7 antibodies and methods of use thereof |
US10513699B2 (en) | 2014-09-03 | 2019-12-24 | Bioatla, Llc | Discovering and producing conditionally active biologic proteins in the same eukaryotic cell production hosts |
WO2019246557A1 (en) | 2018-06-23 | 2019-12-26 | Genentech, Inc. | Methods of treating lung cancer with a pd-1 axis binding antagonist, a platinum agent, and a topoisomerase ii inhibitor |
WO2020006568A1 (en) | 2018-06-29 | 2020-01-02 | City Of Hope | Cd6 targeted chimeric antigen receptors for treatent of certain autoimmune disorders |
WO2020006374A2 (en) | 2018-06-29 | 2020-01-02 | Alector Llc | Anti-sirp-beta1 antibodies and methods of use thereof |
EP3594240A1 (en) | 2013-05-20 | 2020-01-15 | F. Hoffmann-La Roche AG | Anti-transferrin receptor antibodies and methods of use |
WO2020014617A1 (en) | 2018-07-13 | 2020-01-16 | Alector Llc | Anti-sortilin antibodies and methods of use thereof |
WO2020014306A1 (en) | 2018-07-10 | 2020-01-16 | Immunogen, Inc. | Met antibodies and immunoconjugates and uses thereof |
US10538592B2 (en) | 2016-08-22 | 2020-01-21 | Cho Pharma, Inc. | Antibodies, binding fragments, and methods of use |
WO2020018789A1 (en) | 2018-07-18 | 2020-01-23 | Genentech, Inc. | Methods of treating lung cancer with a pd-1 axis binding antagonist, an antimetabolite, and a platinum agent |
WO2020016838A2 (en) | 2018-07-18 | 2020-01-23 | Janssen Biotech, Inc. | Sustained response predictors after treatment with anti-il23 specific antibody |
WO2020023920A1 (en) | 2018-07-27 | 2020-01-30 | Alector Llc | Anti-siglec-5 antibodies and methods of use thereof |
WO2020027330A1 (en) | 2018-08-03 | 2020-02-06 | 中外製薬株式会社 | Antigen-binding molecule containing two antigen-binding domains that are linked to each other |
EP3608674A1 (en) | 2018-08-09 | 2020-02-12 | Regeneron Pharmaceuticals, Inc. | Methods for assessing binding affinity of an antibody variant to the neonatal fc receptor |
WO2020032230A1 (en) | 2018-08-10 | 2020-02-13 | 中外製薬株式会社 | Anti-cd137 antigen-binding molecule and utilization thereof |
WO2020033485A1 (en) | 2018-08-08 | 2020-02-13 | Genentech, Inc. | Use of tryptophan derivatives and l-methionine for protein formulation |
EP3611188A1 (en) | 2014-11-06 | 2020-02-19 | F. Hoffmann-La Roche AG | Fc-region variants with modified fcrn-binding and methods of use |
WO2020035577A1 (en) | 2018-08-16 | 2020-02-20 | Cantargia Ab | Anti-il1rap antibody compositions |
WO2020037154A1 (en) | 2018-08-17 | 2020-02-20 | 23Andme, Inc. | Anti-il1rap antibodies and methods of use thereof |
US10568887B2 (en) | 2015-08-03 | 2020-02-25 | Tolero Pharmaceuticals, Inc. | Combination therapies for treatment of cancer |
US10568586B2 (en) | 2012-10-05 | 2020-02-25 | Volcano Corporation | Systems for indicating parameters in an imaging data set and methods of use |
EP3613433A1 (en) | 2014-05-30 | 2020-02-26 | Henlix Biotech Co., Ltd. | Anti-epidermal growth factor receptor (egfr) antibodies |
WO2020041758A1 (en) | 2018-08-24 | 2020-02-27 | City Of Hope | Masked cytokine conjugates |
WO2020041541A2 (en) | 2018-08-23 | 2020-02-27 | Seattle Genetics, Inc. | Anti-tigit antibodies |
WO2020047374A1 (en) | 2018-08-31 | 2020-03-05 | Alector Llc | Anti-cd33 antibodies and methods of use thereof |
WO2020049286A1 (en) | 2018-09-03 | 2020-03-12 | Femtogenix Limited | Polycyclic amides as cytotoxic agents |
WO2020053325A1 (en) | 2018-09-12 | 2020-03-19 | Acm Biolabs Pte Ltd | Polymersomes comprising a covalently bound antigen as well as methods of making and uses thereof |
US10595820B2 (en) | 2012-12-20 | 2020-03-24 | Philips Image Guided Therapy Corporation | Smooth transition catheters |
WO2020061060A1 (en) | 2018-09-19 | 2020-03-26 | Genentech, Inc. | Therapeutic and diagnostic methods for bladder cancer |
WO2020061381A1 (en) | 2018-09-19 | 2020-03-26 | La Jolla Institute For Immunology | Ptprs and proteoglycans in rheumatoid arthritis |
WO2020061349A1 (en) | 2018-09-21 | 2020-03-26 | Genentech, Inc. | Diagnostic methods for triple-negative breast cancer |
US10604561B2 (en) | 2016-09-16 | 2020-03-31 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use |
US10604577B2 (en) | 2015-10-22 | 2020-03-31 | Allakos Inc. | Methods and compositions for treating systemic mastocytosis |
EP3633371A1 (en) | 2014-12-18 | 2020-04-08 | F. Hoffmann-La Roche AG | Assay and method for determining cdc eliciting antibodies |
WO2020081767A1 (en) | 2018-10-18 | 2020-04-23 | Genentech, Inc. | Diagnostic and therapeutic methods for sarcomatoid kidney cancer |
WO2020086858A1 (en) | 2018-10-24 | 2020-04-30 | Genentech, Inc. | Conjugated chemical inducers of degradation and methods of use |
US10640508B2 (en) | 2017-10-13 | 2020-05-05 | Massachusetts Institute Of Technology | Diazene directed modular synthesis of compounds with quaternary carbon centers |
US10638939B2 (en) | 2013-03-12 | 2020-05-05 | Philips Image Guided Therapy Corporation | Systems and methods for diagnosing coronary microvascular disease |
WO2020092455A2 (en) | 2018-10-29 | 2020-05-07 | The Broad Institute, Inc. | Car t cell transcriptional atlas |
WO2020096959A1 (en) | 2018-11-05 | 2020-05-14 | Genentech, Inc. | Methods of producing two chain proteins in prokaryotic host cells |
US10653779B2 (en) | 2013-03-13 | 2020-05-19 | Genentech, Inc. | Formulations with reduced oxidation |
EP3653641A1 (en) | 2004-02-19 | 2020-05-20 | Genentech, Inc. | Cdr-repaired antibodies |
WO2020104943A2 (en) | 2018-11-20 | 2020-05-28 | Janssen Biotech, Inc. | Safe and effective method of treating psoriasis with anti-il-23 specific antibody |
WO2020104496A1 (en) | 2018-11-20 | 2020-05-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Bispecific antibody targeting transferrin receptor 1 and soluble antigen |
WO2020117257A1 (en) | 2018-12-06 | 2020-06-11 | Genentech, Inc. | Combination therapy of diffuse large b-cell lymphoma comprising an anti-cd79b immunoconjugates, an alkylating agent and an anti-cd20 antibody |
WO2020123275A1 (en) | 2018-12-10 | 2020-06-18 | Genentech, Inc. | Photocrosslinking peptides for site specific conjugation to fc-containing proteins |
WO2020132231A1 (en) | 2018-12-21 | 2020-06-25 | Genentech, Inc. | Methods of producing polypeptides using a cell line resistant to apoptosis |
WO2020132034A1 (en) | 2018-12-20 | 2020-06-25 | 23Andme, Inc. | Anti-cd96 antibodies and methods of use thereof |
WO2020132220A1 (en) | 2018-12-21 | 2020-06-25 | 23Andme, Inc. | Anti-il-36 antibodies and methods of use thereof |
WO2020132230A2 (en) | 2018-12-20 | 2020-06-25 | Genentech, Inc. | Modified antibody fcs and methods of use |
WO2020139926A2 (en) | 2018-12-26 | 2020-07-02 | Akrevia Therapeutics Inc. | Anti-ctla4 antibodies and methods of use thereof |
WO2020141117A1 (en) | 2018-12-30 | 2020-07-09 | F. Hoffmann-La Roche Ag | Ph-gradient spr-based binding assay |
US10717778B2 (en) | 2014-09-29 | 2020-07-21 | Duke University | Bispecific molecules comprising an HIV-1 envelope targeting arm |
US10724082B2 (en) | 2012-10-22 | 2020-07-28 | Bio-Rad Laboratories, Inc. | Methods for analyzing DNA |
WO2020153467A1 (en) | 2019-01-24 | 2020-07-30 | 中外製薬株式会社 | Novel cancer antigens and antibodies of said antigens |
WO2020154410A1 (en) | 2019-01-23 | 2020-07-30 | Genentech, Inc. | Methods of producing multimeric proteins in eukaryotic host cells |
EP3689910A2 (en) | 2014-09-23 | 2020-08-05 | F. Hoffmann-La Roche AG | Method of using anti-cd79b immunoconjugates |
WO2020157491A1 (en) | 2019-01-29 | 2020-08-06 | Femtogenix Limited | G-a crosslinking cytotoxic agents |
US10739333B2 (en) | 2013-09-19 | 2020-08-11 | Dana-Farber Cancer Institute, Inc. | Methods of BH3 profiling |
US10745467B2 (en) | 2010-03-26 | 2020-08-18 | The Trustees Of Dartmouth College | VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders |
EP3698807A1 (en) | 2005-01-21 | 2020-08-26 | Genentech, Inc. | Fixed dosing of her antibodies |
US10758207B2 (en) | 2013-03-13 | 2020-09-01 | Philips Image Guided Therapy Corporation | Systems and methods for producing an image from a rotational intravascular ultrasound device |
US10761086B2 (en) | 2015-04-27 | 2020-09-01 | Dana-Farber Cancer Institute, Inc. | High throughput BH3 profiling: a rapid and scalable technology to BH3 profile on low numbers of cells |
US10767232B2 (en) | 2014-11-03 | 2020-09-08 | Genentech, Inc. | Methods and biomarkers for predicting efficacy and evaluation of an OX40 agonist treatment |
US10774145B2 (en) | 2015-06-17 | 2020-09-15 | Allakos Inc. | Methods and compositions for treating fibrotic diseases |
WO2020185535A1 (en) | 2019-03-08 | 2020-09-17 | Genentech, Inc. | Methods for detecting and quantifying membrane-associated proteins on extracellular vesicles |
WO2020186176A1 (en) | 2019-03-14 | 2020-09-17 | Genentech, Inc. | Treatment of cancer with her2xcd3 bispecific antibodies in combination with anti-her2 mab |
US10781254B2 (en) | 2010-03-26 | 2020-09-22 | The Trustees Of Dartmouth College | VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof |
US10793593B2 (en) | 2006-12-21 | 2020-10-06 | Emd Millipore Corporation | Purification of proteins |
WO2020200941A1 (en) | 2019-03-29 | 2020-10-08 | F. Hoffmann-La Roche Ag | Spr-based binding assay for the functional analysis of multivalent molecules |
WO2020200944A1 (en) | 2019-03-29 | 2020-10-08 | F. Hoffmann-La Roche Ag | Method for generating avid-binding multispecific antibodies |
WO2020213724A1 (en) | 2019-04-19 | 2020-10-22 | 中外製薬株式会社 | Chimeric receptor recognizing modification site of antibody |
WO2020214963A1 (en) | 2019-04-18 | 2020-10-22 | Genentech, Inc. | Antibody potency assay |
WO2020214995A1 (en) | 2019-04-19 | 2020-10-22 | Genentech, Inc. | Anti-mertk antibodies and their methods of use |
US10822402B2 (en) | 2015-06-24 | 2020-11-03 | Hoffmann-La Roche Inc. | Humanized anti-tau(pS422) antibodies and methods of use |
US10828353B2 (en) | 2015-01-31 | 2020-11-10 | The Trustees Of The University Of Pennsylvania | Compositions and methods for T cell delivery of therapeutic molecules |
EP3736293A1 (en) | 2013-02-12 | 2020-11-11 | Boehringer Ingelheim International Gmbh | Therapeutic and diagnostic target for cancer comprising dll3 binding reagents |
WO2020232169A1 (en) | 2019-05-14 | 2020-11-19 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat follicular lymphoma |
WO2020230142A1 (en) | 2019-05-15 | 2020-11-19 | Neotx Therapeutics Ltd. | Cancer treatment |
WO2020232295A1 (en) | 2019-05-16 | 2020-11-19 | Procisedx Inc. | An assay method for the detection of vcam-1 and alpha-2-macroglobulin in blood |
WO2020232262A1 (en) | 2019-05-16 | 2020-11-19 | Procisedx Inc. | Assay detection methods for vcam-1 and calprotectin |
WO2020229378A1 (en) | 2019-05-13 | 2020-11-19 | F. Hoffmann-La Roche Ag | Interference-suppressed pharmacokinetic immunoassay |
WO2020229982A1 (en) | 2019-05-10 | 2020-11-19 | Takeda Pharmaceutical Company Limited | Antibody drug conjugates |
WO2020236528A1 (en) | 2019-05-23 | 2020-11-26 | Procisedx Inc. | Assay methods for the detection of human serum albumin, vitamin d, c-reactive protein, and anti-transglutaminase autoantibody |
WO2020247634A1 (en) | 2019-06-05 | 2020-12-10 | Genentech, Inc. | A method for regeneration of an overload chromatography column |
WO2020245677A1 (en) | 2019-06-03 | 2020-12-10 | Janssen Biotech, Inc. | Anti-tnf antibodies, compositions, and methods for the treatment of active ankylosing spondylitis |
WO2020247159A1 (en) | 2019-06-06 | 2020-12-10 | Procisedx Inc. | DETECTION OF HEMOGLOBIN A1C (HbA1c) IN BLOOD |
WO2020250915A1 (en) | 2019-06-10 | 2020-12-17 | 中外製薬株式会社 | Anti-t cell antigen-binding molecule to be used in combination with cytokine inhibitor |
WO2020252066A1 (en) | 2019-06-11 | 2020-12-17 | Alector Llc | Anti-sortilin antibodies for use in therapy |
US10870701B2 (en) | 2016-03-15 | 2020-12-22 | Generon (Shanghai) Corporation Ltd. | Multispecific fab fusion proteins and use thereof |
WO2020254356A1 (en) | 2019-06-19 | 2020-12-24 | F. Hoffmann-La Roche Ag | Method for the generation of a multivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization |
WO2020254352A1 (en) | 2019-06-19 | 2020-12-24 | F. Hoffmann-La Roche Ag | Method for the generation of a trivalent antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization |
WO2020254351A1 (en) | 2019-06-19 | 2020-12-24 | F. Hoffmann-La Roche Ag | Method for the generation of a multivalent, multispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization |
WO2020254357A1 (en) | 2019-06-19 | 2020-12-24 | F. Hoffmann-La Roche Ag | Method for the generation of a protein expressing cell by targeted integration using cre mrna |
WO2020254355A1 (en) | 2019-06-19 | 2020-12-24 | F. Hoffmann-La Roche Ag | Method for the generation of a bivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization |
WO2020260327A1 (en) | 2019-06-26 | 2020-12-30 | F. Hoffmann-La Roche Ag | Mammalian cell lines with sirt-1 gene knockout |
WO2020263450A1 (en) | 2019-06-25 | 2020-12-30 | Procisedx Inc. | Detection of anti-tnf alpha drug biologics and anti-drug antibodies |
WO2020264300A1 (en) | 2019-06-28 | 2020-12-30 | Genentech, Inc. | Composition and methods for stabilizing liquid protein formulations |
WO2021010326A1 (en) | 2019-07-12 | 2021-01-21 | 中外製薬株式会社 | Anti-mutation type fgfr3 antibody and use therefor |
WO2021011673A2 (en) | 2019-07-16 | 2021-01-21 | Ming Jin | Neutralizing anti-amyloid beta antibodies for the treatment of alzheimer's disease |
WO2021021605A1 (en) | 2019-07-26 | 2021-02-04 | Vanderbilt University | Human monoclonal antibodies to enterovirus d68 |
WO2021022083A2 (en) | 2019-07-31 | 2021-02-04 | Alector Llc | Anti-ms4a4a antibodies and methods of use thereof |
WO2021017892A1 (en) | 2019-07-26 | 2021-02-04 | 上海复宏汉霖生物技术股份有限公司 | Method and composition for anti-cd73 antibodies and variants |
WO2021024209A1 (en) | 2019-08-06 | 2021-02-11 | Aprinoia Therapeutics Inc. | Antibodies that bind to pathological tau species and uses thereof |
US10918735B2 (en) | 2012-12-04 | 2021-02-16 | Massachusetts Institute Of Technology | Substituted pyrazino[1′,2′:1,5]pyrrolo[2,3-b]indole-1,4-diones for cancer treatment |
US10918627B2 (en) | 2016-05-11 | 2021-02-16 | Massachusetts Institute Of Technology | Convergent and enantioselective total synthesis of Communesin analogs |
WO2021028752A1 (en) | 2019-08-15 | 2021-02-18 | Janssen Biotech, Inc. | Anti-tfn antibodies for treating type i diabetes |
WO2021030251A1 (en) | 2019-08-12 | 2021-02-18 | Purinomia Biotech, Inc. | Methods and compositions for promoting and potentiating t-cell mediated immune responses through adcc targeting of cd39 expressing cells |
US10927342B2 (en) | 2015-08-04 | 2021-02-23 | Regeneran Pharmaceuticals, Inc. | Taurine supplemented cell culture medium and methods of use |
EP3783018A1 (en) | 2012-10-18 | 2021-02-24 | The Rockefeller University | Broadly-neutralizing anti-hiv antibodies |
EP3783029A1 (en) | 2015-05-12 | 2021-02-24 | F. Hoffmann-La Roche AG | Therapeutic and diagnostic methods for cancer |
EP3782654A1 (en) | 2014-09-12 | 2021-02-24 | Genentech, Inc. | Anti-her2 antibodies and immunoconjugates |
US10933115B2 (en) | 2012-06-22 | 2021-03-02 | The Trustees Of Dartmouth College | VISTA antagonist and methods of use |
US10935544B2 (en) | 2015-09-04 | 2021-03-02 | Obi Pharma, Inc. | Glycan arrays and method of use |
US10939826B2 (en) | 2012-12-20 | 2021-03-09 | Philips Image Guided Therapy Corporation | Aspirating and removing biological material |
US10940401B2 (en) | 2013-09-05 | 2021-03-09 | Genentech, Inc. | Method for chromatography reuse |
US10942022B2 (en) | 2012-12-20 | 2021-03-09 | Philips Image Guided Therapy Corporation | Manual calibration of imaging system |
EP3789402A1 (en) | 2014-11-20 | 2021-03-10 | F. Hoffmann-La Roche AG | Combination therapy of t cell activating bispecific antigen binding molecules and pd-1 axis binding antagonists |
EP3789036A1 (en) | 2013-07-16 | 2021-03-10 | F. Hoffmann-La Roche AG | Methods of treating cancer using pd-1 axis binding antagonists and tigit inhibitors |
WO2021050645A1 (en) | 2019-09-12 | 2021-03-18 | Genentech, Inc. | Compositions and methods of treating lupus nephritis |
EP3795168A1 (en) | 2015-01-16 | 2021-03-24 | City of Hope | Cell penetrating antibodies |
WO2021055694A1 (en) | 2019-09-20 | 2021-03-25 | Genentech, Inc. | Dosing for anti-tryptase antibodies |
WO2021057978A1 (en) | 2019-09-27 | 2021-04-01 | 南京金斯瑞生物科技有限公司 | Anti-vhh domain antibodies and use thereof |
WO2021064137A2 (en) | 2019-10-02 | 2021-04-08 | Boehringer Ingelheim International Gmbh | Multi-specific binding proteins for cancer treatment |
US10980894B2 (en) | 2016-03-29 | 2021-04-20 | Obi Pharma, Inc. | Antibodies, pharmaceutical compositions and methods |
WO2021076196A1 (en) | 2019-10-18 | 2021-04-22 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma |
US10993694B2 (en) | 2012-12-21 | 2021-05-04 | Philips Image Guided Therapy Corporation | Rotational ultrasound imaging catheter with extended catheter body telescope |
US11000601B2 (en) | 2016-11-21 | 2021-05-11 | Obi Pharma, Inc. | Conjugated biological molecules, pharmaceutical compositions and methods |
US11008389B2 (en) | 2011-03-16 | 2021-05-18 | Sanofi | Uses of a dual V region antibody-like protein |
US11014987B2 (en) | 2013-12-24 | 2021-05-25 | Janssen Pharmaceutics Nv | Anti-vista antibodies and fragments, uses thereof, and methods of identifying same |
US11014982B2 (en) | 2017-02-07 | 2021-05-25 | Janssen Biotech, Inc. | Anti-TNF antibodies, compositions, and methods for the treatment of active ankylosing spondylitis |
US11013800B2 (en) | 2011-05-16 | 2021-05-25 | Evive Biotech Ltd. | Multi-specific Fab fusion proteins comprising a CD3-binding Fab fragment with N-terminal fusion to binding domains and methods of use |
US11026591B2 (en) | 2013-03-13 | 2021-06-08 | Philips Image Guided Therapy Corporation | Intravascular pressure sensor calibration |
US11034710B2 (en) | 2018-12-04 | 2021-06-15 | Sumitomo Dainippon Pharma Oncology, Inc. | CDK9 inhibitors and polymorphs thereof for use as agents for treatment of cancer |
US11034770B2 (en) | 2019-07-19 | 2021-06-15 | Oncoresponse, Inc. | Immunomodulatory antibodies and methods of use thereof |
WO2021119400A1 (en) | 2019-12-12 | 2021-06-17 | Alector Llc | Methods of use of anti-cd33 antibodies |
WO2021119505A1 (en) | 2019-12-13 | 2021-06-17 | Genentech, Inc. | Anti-ly6g6d antibodies and methods of use |
US11040140B2 (en) | 2010-12-31 | 2021-06-22 | Philips Image Guided Therapy Corporation | Deep vein thrombosis therapeutic methods |
US11041017B2 (en) | 2016-03-29 | 2021-06-22 | Obi Pharma, Inc. | Antibodies, pharmaceutical compositions and methods |
US11041020B2 (en) | 2017-01-30 | 2021-06-22 | Janssen Biotech, Inc. | Methods for the treatment of active Psoriatic Arthritis |
EP3842453A1 (en) | 2014-11-06 | 2021-06-30 | F. Hoffmann-La Roche AG | Fc-region variants with modified fcrn- and protein a-binding properties |
WO2021131021A1 (en) | 2019-12-27 | 2021-07-01 | 中外製薬株式会社 | Anti-ctla-4 antibody and use thereof |
US11053294B2 (en) | 2018-09-27 | 2021-07-06 | Xilio Development, Inc. | Masked cytokine polypeptides |
US11053308B2 (en) | 2016-08-05 | 2021-07-06 | Chugai Seiyaku Kabushiki Kaisha | Method for treating IL-8-related diseases |
WO2021138264A1 (en) | 2019-12-30 | 2021-07-08 | Seagen Inc. | Methods of treating cancer with nonfucosylated anti-cd70 antibodies |
WO2021136772A1 (en) | 2020-01-02 | 2021-07-08 | F. Hoffmann-La Roche Ag | Method for determining the amount of a therapeutic antibody in the brain |
WO2021138454A1 (en) | 2019-12-30 | 2021-07-08 | City Of Hope | Methods of making and using regulatory t cells and effector t cells having chimeric antigen receptors targeted to cd6, cd19, and/or an il-13r for treatment of autoimmune disorders and cancers |
WO2021139777A1 (en) | 2020-01-10 | 2021-07-15 | 上海复宏汉霖生物技术股份有限公司 | Anti-tigit antibodies and usage method |
WO2021152186A2 (en) | 2020-06-26 | 2021-08-05 | Bayer Aktiengesellschaft | Ccr8 antibodies for therapeutic applications |
US11084875B2 (en) | 2014-08-08 | 2021-08-10 | Alector Llc | Anti-TREM2 antibodies and methods of use thereof |
EP3862365A1 (en) | 2016-01-08 | 2021-08-11 | F. Hoffmann-La Roche AG | Methods of treating cea-positive cancers using pd-1 axis binding antagonists and anti-cea/anti-cd3 bispecific antibodies |
WO2021163265A1 (en) | 2020-02-11 | 2021-08-19 | Vanderbilt University | Human monoclonal antibodies to severe acute respiratory syndrome coronavirus 2 (sars-cov- 2) |
WO2021162020A1 (en) | 2020-02-12 | 2021-08-19 | 中外製薬株式会社 | Anti-cd137 antigen-binding molecule for use in cancer treatment |
WO2021160155A1 (en) | 2020-02-10 | 2021-08-19 | 上海诗健生物科技有限公司 | Claudin 18.2 antibody and use thereof |
WO2021160154A1 (en) | 2020-02-10 | 2021-08-19 | 上海诗健生物科技有限公司 | Cldn18.2 antibody and use thereof |
WO2021170082A1 (en) | 2020-02-28 | 2021-09-02 | 南京圣和药业股份有限公司 | Anti-cd47/anti-pd-l1 antibody and applications thereof |
US11111288B2 (en) | 2014-08-28 | 2021-09-07 | Bioatla, Inc. | Conditionally active chimeric antigen receptors for modified t-cells |
EP3878866A1 (en) | 2013-04-29 | 2021-09-15 | F. Hoffmann-La Roche AG | Fc-receptor binding modified asymmetric antibodies and methods of use |
WO2021183849A1 (en) | 2020-03-13 | 2021-09-16 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
US11123426B2 (en) | 2014-06-11 | 2021-09-21 | The Trustees Of Dartmouth College | Use of vista agonists and antagonists to suppress or enhance humoral immunity |
WO2021188749A1 (en) | 2020-03-19 | 2021-09-23 | Genentech, Inc. | Isoform-selective anti-tgf-beta antibodies and methods of use |
WO2021195385A1 (en) | 2020-03-26 | 2021-09-30 | Vanderbilt University | HUMAN MONOCLONAL ANTIBODIES TO SEVERE ACUTE RESPIRATORY SYNDROME CORONAVIRUS 2 (SARS-GoV-2) |
WO2021194913A1 (en) | 2020-03-24 | 2021-09-30 | Genentech, Inc. | Tie2-binding agents and methods of use |
WO2021195418A1 (en) | 2020-03-26 | 2021-09-30 | Vanderbilt University | Human monoclonal antibodies to severe acute respiratory syndrome coronavirus 2 (sars-cov-2) |
WO2021201202A1 (en) | 2020-04-02 | 2021-10-07 | 中外製薬株式会社 | Analysis method for impurity molecules in composition containing multi-specific antigen-binding molecules |
WO2021202959A1 (en) | 2020-04-03 | 2021-10-07 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
US11141063B2 (en) | 2010-12-23 | 2021-10-12 | Philips Image Guided Therapy Corporation | Integrated system architectures and methods of use |
US11149088B2 (en) | 2016-04-15 | 2021-10-19 | Bioatla, Inc. | Anti-Axl antibodies, antibody fragments and their immunoconjugates and uses thereof |
EP3896091A1 (en) | 2015-08-11 | 2021-10-20 | Legend Biotech Ireland Limited | Chimeric antigen receptors targeting bcma and methods of use thereof |
US11154313B2 (en) | 2013-03-12 | 2021-10-26 | The Volcano Corporation | Vibrating guidewire torquer and methods of use |
WO2021217051A1 (en) | 2020-04-24 | 2021-10-28 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates |
WO2021222533A1 (en) | 2020-04-30 | 2021-11-04 | Procisedx Inc. | Methods of detecting antibodies to sars-cov-2 |
WO2021222167A1 (en) | 2020-04-28 | 2021-11-04 | Genentech, Inc. | Methods and compositions for non-small cell lung cancer immunotherapy |
WO2021225892A1 (en) | 2020-05-03 | 2021-11-11 | Levena (Suzhou) Biopharma Co., Ltd. | Antibody-drug conjugates (adcs) comprising an anti-trop-2 antibody, compositions comprising such adcs, as well as methods of making and using the same |
US11180557B2 (en) | 2012-06-22 | 2021-11-23 | King's College London | Vista modulators for diagnosis and treatment of cancer |
WO2021236658A1 (en) | 2020-05-19 | 2021-11-25 | Boehringer Ingelheim International Gmbh | Binding molecules for the treatment of cancer |
WO2021243204A1 (en) | 2020-05-29 | 2021-12-02 | 23Andme, Inc. | Anti-cd200r1 antibodies and methods of use thereof |
EP3922649A1 (en) | 2015-10-30 | 2021-12-15 | F. Hoffmann-La Roche AG | Anti-htra1 antibodies and methods of use thereof |
WO2021252977A1 (en) | 2020-06-12 | 2021-12-16 | Genentech, Inc. | Methods and compositions for cancer immunotherapy |
US11203645B2 (en) | 2018-06-27 | 2021-12-21 | Obi Pharma, Inc. | Glycosynthase variants for glycoprotein engineering and methods of use |
US11203638B2 (en) | 2017-05-05 | 2021-12-21 | Allakos Inc. | Methods and compositions for treating perennial allergic conjunctivitis and keratoconjunctivitis |
WO2021256555A1 (en) | 2020-06-19 | 2021-12-23 | 中外製薬株式会社 | Anti-t cell antigen-binding molecule for use in combination with angiogenesis inhibitor |
WO2021257503A1 (en) | 2020-06-16 | 2021-12-23 | Genentech, Inc. | Methods and compositions for treating triple-negative breast cancer |
WO2021259880A1 (en) | 2020-06-22 | 2021-12-30 | Almirall, S.A. | Anti-il-36 antibodies and methods of use thereof |
US11214619B2 (en) | 2018-07-20 | 2022-01-04 | Surface Oncology, Inc. | Anti-CD112R compositions and methods |
EP3936524A2 (en) | 2015-05-11 | 2022-01-12 | F. Hoffmann-La Roche AG | Compositions and methods of treating lupus nephritis |
WO2022016119A1 (en) | 2020-07-17 | 2022-01-20 | Simurx, Inc. | Chimeric myd88 receptors for redirecting immunosuppressive signaling and related compositions and methods |
WO2022020288A1 (en) | 2020-07-21 | 2022-01-27 | Genentech, Inc. | Antibody-conjugated chemical inducers of degradation of brm and methods thereof |
WO2022025220A1 (en) | 2020-07-31 | 2022-02-03 | 中外製薬株式会社 | Pharmaceutical composition including cell expressing chimeric receptor |
WO2022023735A1 (en) | 2020-07-28 | 2022-02-03 | Femtogenix Limited | Cytotoxic agents |
US11241417B2 (en) | 2018-06-21 | 2022-02-08 | Yumanity Therapeutics, Inc. | Compositions and methods for the treatment and prevention of neurological disorders |
US11272845B2 (en) | 2012-10-05 | 2022-03-15 | Philips Image Guided Therapy Corporation | System and method for instant and automatic border detection |
US11274157B2 (en) | 2017-01-12 | 2022-03-15 | Eureka Therapeutics, Inc. | Constructs targeting histone H3 peptide/MHC complexes and uses thereof |
US11279694B2 (en) | 2016-11-18 | 2022-03-22 | Sumitomo Dainippon Pharma Oncology, Inc. | Alvocidib prodrugs and their use as protein kinase inhibitors |
WO2022057651A1 (en) | 2020-09-16 | 2022-03-24 | 四川科伦博泰生物医药股份有限公司 | Anti-nectin-4 antibody, conjugate including same, and application thereof |
WO2022061214A1 (en) | 2020-09-21 | 2022-03-24 | Genentech, Inc. | Purification of multispecific antibodies |
US11286300B2 (en) | 2015-10-01 | 2022-03-29 | Hoffmann-La Roche Inc. | Humanized anti-human CD19 antibodies and methods of use |
DE102020125457A1 (en) | 2020-09-29 | 2022-03-31 | Immatics Biotechnologies Gmbh | Amidated peptides and their deamidated counterparts presented by HLA-A*02 molecules for use in immunotherapy against various types of cancer |
WO2022063100A1 (en) | 2020-09-22 | 2022-03-31 | 南京圣和药业股份有限公司 | Anti-tigit antibody and double antibody and their application |
WO2022063877A1 (en) | 2020-09-24 | 2022-03-31 | F. Hoffmann-La Roche Ag | Mammalian cell lines with gene knockout |
DE102020125465A1 (en) | 2020-09-29 | 2022-03-31 | Immatics Biotechnologies Gmbh | Amidated peptides and their deamidated counterparts presented by non-HLA-A*02 molecules for use in immunotherapy against various types of cancer |
WO2022069579A2 (en) | 2020-09-29 | 2022-04-07 | Immatics Biotechnologies Gmbh | Amidated peptides and their deamidated counterparts displayed by non-hla-a*02 for use in immunotherapy against different types of cancers |
WO2022076462A1 (en) | 2020-10-05 | 2022-04-14 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2022084355A2 (en) | 2020-10-21 | 2022-04-28 | Boehringer Ingelheim International Gmbh | Agonistic trkb binding molecules for the treatment of eye diseases |
WO2022084210A1 (en) | 2020-10-20 | 2022-04-28 | F. Hoffmann-La Roche Ag | Combination therapy of pd-1 axis binding antagonists and lrrk2 inhitibors |
US11319526B2 (en) | 2008-05-02 | 2022-05-03 | Seagen Inc. | Methods and compositions for making antibodies and antibody derivatives with reduced core fucosylation |
WO2022097117A1 (en) | 2020-11-09 | 2022-05-12 | Takeda Pharmaceutical Company Ltd. | Antibody drug conjugates |
WO2022098972A1 (en) | 2020-11-08 | 2022-05-12 | Seagen Inc. | Combination-therapy antibody drug conjugate with immune cell inhibitor |
US11332523B2 (en) | 2014-05-28 | 2022-05-17 | Academia Sinica | Anti-TNF-alpha glycoantibodies and uses thereof |
US11332533B2 (en) | 2007-09-26 | 2022-05-17 | Chugai Seiyaku Kabushiki Kaisha | Modified antibody constant region |
WO2022101458A1 (en) | 2020-11-16 | 2022-05-19 | F. Hoffmann-La Roche Ag | Combination therapy with fap-targeted cd40 agonists |
WO2022100613A1 (en) | 2020-11-10 | 2022-05-19 | 上海齐鲁制药研究中心有限公司 | Bispecific antibody for claudin 18a2 and cd3 and application of bispecific antibody |
US11352403B2 (en) | 2018-05-14 | 2022-06-07 | Werewolf Therapeutics, Inc. | Activatable interleukin-2 polypeptides and methods of use thereof |
WO2022120352A1 (en) | 2020-12-02 | 2022-06-09 | Alector Llc | Methods of use of anti-sortilin antibodies |
US11370833B2 (en) | 2014-09-15 | 2022-06-28 | Genentech, Inc. | Antibody formulations |
WO2022136140A1 (en) | 2020-12-22 | 2022-06-30 | F. Hoffmann-La Roche Ag | Oligonucleotides targeting xbp1 |
US11377485B2 (en) | 2009-12-02 | 2022-07-05 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
EP4026556A1 (en) | 2016-10-05 | 2022-07-13 | Acceleron Pharma Inc. | Compositions and method for treating kidney disease |
EP4026848A1 (en) | 2015-12-09 | 2022-07-13 | F. Hoffmann-La Roche AG | Type ii anti-cd20 antibody for reducing the cytokine release syndrome |
US11390685B2 (en) | 2017-01-06 | 2022-07-19 | Biosion, Inc. | ErbB2 antibodies and uses therefore |
WO2022152880A1 (en) | 2021-01-15 | 2022-07-21 | Immatics Biotechnologies Gmbh | Peptides displayed by hla for use in immunotherapy against different types of cancers |
WO2022157094A2 (en) | 2021-01-22 | 2022-07-28 | Bayer Aktiengesellschaft | Lrrc15 antibodies and conjugates thereof |
WO2022159349A1 (en) | 2021-01-20 | 2022-07-28 | Oncoresponse, Inc. | Immunomodulatory antibodies and uses thereof |
US11406498B2 (en) | 2012-12-20 | 2022-08-09 | Philips Image Guided Therapy Corporation | Implant delivery system and implants |
WO2022169825A1 (en) | 2021-02-03 | 2022-08-11 | Mozart Therapeutics, Inc. | Binding agents and methods of using the same |
WO2022175217A1 (en) | 2021-02-18 | 2022-08-25 | F. Hoffmann-La Roche Ag | Method for resolving complex, multistep antibody interactions |
WO2022177393A1 (en) | 2021-02-19 | 2022-08-25 | (주)샤페론 | Single domain antibody against pd-l1 and use thereof |
WO2022177392A1 (en) | 2021-02-19 | 2022-08-25 | (주)샤페론 | Single domain antibody against cd47 and use thereof |
WO2022187270A1 (en) | 2021-03-01 | 2022-09-09 | Xilio Development, Inc. | Combination of ctla4 and pd1/pdl1 antibodies for treating cancer |
WO2022184082A1 (en) | 2021-03-03 | 2022-09-09 | Sorrento Therapeutics, Inc. | Antibody-drug conjugates comprising an anti-bcma antibody |
WO2022187272A1 (en) | 2021-03-01 | 2022-09-09 | Xilio Development, Inc. | Combination of masked ctla4 and pd1/pdl1 antibodies for treating cancer |
WO2022190034A1 (en) | 2021-03-12 | 2022-09-15 | Janssen Biotech, Inc. | Method of treating psoriatic arthritis patients with inadequate response to tnf therapy with anti-il23 specific antibody |
WO2022190033A1 (en) | 2021-03-12 | 2022-09-15 | Janssen Biotech, Inc. | Safe and effective method of treating psoriatic arthritis with anti-il23 specific antibody |
US11447573B2 (en) | 2016-07-20 | 2022-09-20 | Nanjing Legend Biotech Co., Ltd. | Multispecific antigen binding proteins and methods of use thereof |
US11447564B2 (en) | 2017-04-26 | 2022-09-20 | Eureka Therapeutics, Inc. | Constructs specifically recognizing glypican 3 and uses thereof |
WO2022198192A1 (en) | 2021-03-15 | 2022-09-22 | Genentech, Inc. | Compositions and methods of treating lupus nephritis |
WO2022197877A1 (en) | 2021-03-19 | 2022-09-22 | Genentech, Inc. | Methods and compositions for time delayed bio-orthogonal release of cytotoxic agents |
WO2022197947A1 (en) | 2021-03-18 | 2022-09-22 | Alector Llc | Anti-tmem106b antibodies and methods of use thereof |
US11453710B2 (en) | 2018-05-14 | 2022-09-27 | Werewolf Therapeutics, Inc. | Activatable interleukin 12 polypeptides and methods of use thereof |
WO2022201122A1 (en) | 2021-03-26 | 2022-09-29 | Janssen Biotech, Inc. | Humanized antibodies against paired helical filament tau and uses thereof |
WO2022204274A1 (en) | 2021-03-23 | 2022-09-29 | Alector Llc | Anti-tmem106b antibodies for treating and preventing coronavirus infections |
WO2022200387A1 (en) | 2021-03-22 | 2022-09-29 | Novimmune S.A. | Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof |
WO2022200389A1 (en) | 2021-03-22 | 2022-09-29 | Novimmune S.A. | Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof |
WO2022217022A1 (en) | 2021-04-10 | 2022-10-13 | Profoundbio Us Co. | Folr1 binding agents, conjugates thereof and methods of using the same |
WO2022214565A1 (en) | 2021-04-09 | 2022-10-13 | F. Hoffmann-La Roche Ag | Process for selecting cell clones expressing a heterologous polypeptide |
WO2022217026A1 (en) | 2021-04-09 | 2022-10-13 | Seagen Inc. | Methods of treating cancer with anti-tigit antibodies |
US11472881B2 (en) | 2016-10-11 | 2022-10-18 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against CTLA-4 |
WO2022220275A1 (en) | 2021-04-15 | 2022-10-20 | 中外製薬株式会社 | ANTI-C1s ANTIBODY |
WO2022218957A1 (en) | 2021-04-12 | 2022-10-20 | Acm Biolabs Pte Ltd | Polymersomes comprising a soluble encapsulated polynucleotide and an ionizable lipid as well as methods of making and uses thereof |
WO2022226317A1 (en) | 2021-04-23 | 2022-10-27 | Profoundbio Us Co. | Anti-cd70 antibodies, conjugates thereof and methods of using the same |
WO2022228705A1 (en) | 2021-04-30 | 2022-11-03 | F. Hoffmann-La Roche Ag | Dosing for combination treatment with anti-cd20/anti-cd3 bispecific antibody and anti-cd79b antibody drug conjugate |
WO2022228706A1 (en) | 2021-04-30 | 2022-11-03 | F. Hoffmann-La Roche Ag | Dosing for treatment with anti-cd20/anti-cd3 bispecific antibody |
US11492396B2 (en) | 2015-10-27 | 2022-11-08 | UCB Biopharma SRL | Methods of treatment using anti-IL-17A/F antibodies |
US11497756B2 (en) | 2017-09-12 | 2022-11-15 | Sumitomo Pharma Oncology, Inc. | Treatment regimen for cancers that are insensitive to BCL-2 inhibitors using the MCL-1 inhibitor alvocidib |
WO2022241082A1 (en) | 2021-05-14 | 2022-11-17 | Genentech, Inc. | Agonists of trem2 |
WO2022238481A1 (en) | 2021-05-11 | 2022-11-17 | Modiquest B.V. | Antibodies |
WO2022241446A1 (en) | 2021-05-12 | 2022-11-17 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma |
WO2022247030A1 (en) | 2021-05-27 | 2022-12-01 | 江苏荃信生物医药股份有限公司 | ANTI-HUMAN INTERFERON α RECEPTOR 1 MONOCLONAL ANTIBODY AND APPLICATION THEREOF |
US11525000B2 (en) | 2016-04-15 | 2022-12-13 | Immunext, Inc. | Anti-human VISTA antibodies and use thereof |
WO2022258600A1 (en) | 2021-06-09 | 2022-12-15 | F. Hoffmann-La Roche Ag | Combination of a particular braf inhibitor (paradox breaker) and a pd-1 axis binding antagonist for use in the treatment of cancer |
US11529416B2 (en) | 2012-09-07 | 2022-12-20 | Kings College London | Vista modulators for diagnosis and treatment of cancer |
WO2022263507A1 (en) | 2021-06-17 | 2022-12-22 | Boehringer Ingelheim International Gmbh | Novel tri-specific binding molecules |
WO2022270612A1 (en) | 2021-06-25 | 2022-12-29 | 中外製薬株式会社 | Use of anti-ctla-4 antibody |
WO2022270611A1 (en) | 2021-06-25 | 2022-12-29 | 中外製薬株式会社 | Anti–ctla-4 antibody |
WO2023278377A1 (en) | 2021-06-29 | 2023-01-05 | Seagen Inc. | Methods of treating cancer with a combination of a nonfucosylated anti-cd70 antibody and a cd47 antagonist |
WO2023280227A2 (en) | 2021-07-06 | 2023-01-12 | Profoundbio Us Co. | Linkers, drug linkers and conjugates thereof and methods of using the same |
WO2023004386A1 (en) | 2021-07-22 | 2023-01-26 | Genentech, Inc. | Brain targeting compositions and methods of use thereof |
US11578372B2 (en) | 2012-11-05 | 2023-02-14 | Foundation Medicine, Inc. | NTRK1 fusion molecules and uses thereof |
US11578426B2 (en) | 2017-08-21 | 2023-02-14 | Adagene Inc. | Dynamic human heavy chain antibody libraries |
WO2023019239A1 (en) | 2021-08-13 | 2023-02-16 | Genentech, Inc. | Dosing for anti-tryptase antibodies |
US11585014B2 (en) | 2017-08-21 | 2023-02-21 | Adagene Inc. | Dynamic human antibody light chain libraries |
US11583577B2 (en) | 2016-04-22 | 2023-02-21 | Obi Pharma, Inc. | Cancer immunotherapy by immune activation or immune modulation via Globo series antigens |
WO2023028591A1 (en) | 2021-08-27 | 2023-03-02 | Genentech, Inc. | Methods of treating tau pathologies |
US11596620B2 (en) | 2013-03-13 | 2023-03-07 | F. Hoffmann-La Roche Ag | Formulations with reduced oxidation |
US11597774B2 (en) | 2017-05-04 | 2023-03-07 | City Of Hope | Antibody variable domains and antibody constructs |
US11597727B2 (en) | 2018-03-13 | 2023-03-07 | The Regents Of The University Of California | Inhibitors of integrin alpha 2 beta 1 and methods of use |
WO2023029280A1 (en) | 2021-09-03 | 2023-03-09 | 江苏荃信生物医药股份有限公司 | Anti-human interleukin-33 monoclonal antibody and use thereof |
WO2023029281A1 (en) | 2021-09-03 | 2023-03-09 | 江苏荃信生物医药股份有限公司 | Anti-human tslp monoclonal antibody and use thereof |
WO2023034750A1 (en) | 2021-08-30 | 2023-03-09 | Genentech, Inc. | Anti-polyubiquitin multispecific antibodies |
EP4155321A1 (en) | 2021-06-04 | 2023-03-29 | Chugai Seiyaku Kabushiki Kaisha | Anti-ddr2 antibodies and uses thereof |
WO2023058723A1 (en) | 2021-10-08 | 2023-04-13 | 中外製薬株式会社 | Method for preparing prefilled syringe formulation |
WO2023064947A1 (en) | 2021-10-15 | 2023-04-20 | Regenxbio Inc. | Antibodies and methods of using thereof |
WO2023073615A1 (en) | 2021-10-29 | 2023-05-04 | Janssen Biotech, Inc. | Methods of treating crohn's disease with anti-il23 specific antibody |
WO2023076876A1 (en) | 2021-10-26 | 2023-05-04 | Mozart Therapeutics, Inc. | Modulation of immune responses to viral vectors |
US11643388B2 (en) | 2020-05-01 | 2023-05-09 | The Regents Of The University Of California | Inhibitors of alpha 2 beta 1 integrin and methods of use thereof |
US11642400B2 (en) | 2016-07-27 | 2023-05-09 | Obi Pharma, Inc. | Immunogenic/therapeutic glycan compositions and uses thereof |
US11643456B2 (en) | 2016-07-29 | 2023-05-09 | Obi Pharma, Inc. | Human antibodies, pharmaceutical compositions and methods |
WO2023081898A1 (en) | 2021-11-08 | 2023-05-11 | Alector Llc | Soluble cd33 as a biomarker for anti-cd33 efficacy |
WO2023084488A1 (en) | 2021-11-15 | 2023-05-19 | Janssen Biotech, Inc. | Methods of treating crohn's disease with anti-il23 specific antibody |
WO2023086807A1 (en) | 2021-11-10 | 2023-05-19 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
WO2023095000A1 (en) | 2021-11-23 | 2023-06-01 | Janssen Biotech, Inc. | Method of treating ulcerative colitis with anti-il23 specific antibody |
WO2023094282A1 (en) | 2021-11-25 | 2023-06-01 | F. Hoffmann-La Roche Ag | Quantification of low amounts of antibody sideproducts |
US11673968B2 (en) | 2014-06-26 | 2023-06-13 | Hoffmann-La Roche Inc. | Anti-BRDU antibodies and methods of use |
WO2023117325A1 (en) | 2021-12-21 | 2023-06-29 | F. Hoffmann-La Roche Ag | Method for the determination of hydrolytic activity |
US11713353B2 (en) | 2018-01-15 | 2023-08-01 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against PD-1 |
EP4219560A2 (en) | 2010-02-18 | 2023-08-02 | The Regents of The University of California | Integrin alpha v beta 8 neutralizing antibody |
WO2023147328A1 (en) | 2022-01-26 | 2023-08-03 | Genentech, Inc. | Antibody-conjugated chemical inducers of degradation with hydolysable maleimide linkers and methods thereof |
WO2023147329A1 (en) | 2022-01-26 | 2023-08-03 | Genentech, Inc. | Antibody-conjugated chemical inducers of degradation and methods thereof |
US11730822B2 (en) | 2017-03-24 | 2023-08-22 | Seagen Inc. | Process for the preparation of glucuronide drug-linkers and intermediates thereof |
US11739132B2 (en) | 2019-05-14 | 2023-08-29 | Werewolf Therapeutics, Inc. | Separation moieties and methods of use thereof |
WO2023170295A1 (en) | 2022-03-11 | 2023-09-14 | Janssen Pharmaceutica Nv | Multispecific antibodies and uses thereof |
WO2023170291A1 (en) | 2022-03-11 | 2023-09-14 | Janssen Pharmaceutica Nv | Multispecific antibodies and uses thereof |
WO2023173026A1 (en) | 2022-03-10 | 2023-09-14 | Sorrento Therapeutics, Inc. | Antibody-drug conjugates and uses thereof |
WO2023170290A1 (en) | 2022-03-11 | 2023-09-14 | Janssen Pharmaceutica Nv | Multispecific antibodies and uses thereof |
WO2023178357A1 (en) | 2022-03-18 | 2023-09-21 | Evolveimmune Therapeutics, Inc. | Bispecific antibody fusion molecules and methods of use thereof |
WO2023180353A1 (en) | 2022-03-23 | 2023-09-28 | F. Hoffmann-La Roche Ag | Combination treatment of an anti-cd20/anti-cd3 bispecific antibody and chemotherapy |
US11771698B2 (en) | 2013-01-18 | 2023-10-03 | Foundation Medicine, Inc. | Methods of treating cholangiocarcinoma |
WO2023187707A1 (en) | 2022-03-30 | 2023-10-05 | Janssen Biotech, Inc. | Method of treating mild to moderate psoriasis with il-23 specific antibody |
WO2023187407A1 (en) | 2022-04-01 | 2023-10-05 | Bradcode Limited | Human monoclonal antibodies binding to sars-cov-2 and methods of use thereof |
WO2023191816A1 (en) | 2022-04-01 | 2023-10-05 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2023192622A1 (en) | 2022-04-01 | 2023-10-05 | Genentech, Inc. | Hydroxypropyl methyl cellulose derivatives to stabilize polypeptides |
US11780911B2 (en) | 2019-05-23 | 2023-10-10 | Janssen Biotech, Inc. | Method of treating inflammatory bowel disease with a combination therapy of antibodies to IL-23 and TNF alpha |
WO2023198727A1 (en) | 2022-04-13 | 2023-10-19 | F. Hoffmann-La Roche Ag | Pharmaceutical compositions of anti-cd20/anti-cd3 bispecific antibodies and methods of use |
WO2023201299A1 (en) | 2022-04-13 | 2023-10-19 | Genentech, Inc. | Pharmaceutical compositions of therapeutic proteins and methods of use |
US11793802B2 (en) | 2019-03-20 | 2023-10-24 | Sumitomo Pharma Oncology, Inc. | Treatment of acute myeloid leukemia (AML) with venetoclax failure |
WO2023202967A1 (en) | 2022-04-19 | 2023-10-26 | F. Hoffmann-La Roche Ag | Improved production cells |
EP4268831A2 (en) | 2018-09-12 | 2023-11-01 | Fred Hutchinson Cancer Center | Reducing cd33 expression to selectively protect therapeutic cells |
WO2023215737A1 (en) | 2022-05-03 | 2023-11-09 | Genentech, Inc. | Anti-ly6e antibodies, immunoconjugates, and uses thereof |
WO2023215498A2 (en) | 2022-05-05 | 2023-11-09 | Modernatx, Inc. | Compositions and methods for cd28 antagonism |
WO2023219613A1 (en) | 2022-05-11 | 2023-11-16 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2023223265A1 (en) | 2022-05-18 | 2023-11-23 | Janssen Biotech, Inc. | Method for evaluating and treating psoriatic arthritis with il23 antibody |
WO2023232961A1 (en) | 2022-06-03 | 2023-12-07 | F. Hoffmann-La Roche Ag | Improved production cells |
US11840567B2 (en) | 2017-10-03 | 2023-12-12 | Joint Stock Company “Biocad” | Bispecific antibodies with specific binding to CD47 and PD-L1 |
US11844839B2 (en) | 2016-03-25 | 2023-12-19 | Seagen Inc. | Process for the preparation of pegylated drug-linkers and intermediates thereof |
WO2023245105A1 (en) | 2022-06-17 | 2023-12-21 | Genentech, Inc. | Use of kosmotropes to enhance yield of an affinity chromatography purification step |
WO2024015897A1 (en) | 2022-07-13 | 2024-01-18 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2024013315A1 (en) | 2022-07-15 | 2024-01-18 | Boehringer Ingelheim International Gmbh | Binding molecules for the treatment of cancer |
WO2024020432A1 (en) | 2022-07-19 | 2024-01-25 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2024020579A1 (en) | 2022-07-22 | 2024-01-25 | Bristol-Myers Squibb Company | Antibodies binding to human pad4 and uses thereof |
US11884739B2 (en) | 2014-05-27 | 2024-01-30 | Academia Sinica | Anti-CD20 glycoantibodies and uses thereof |
US11890301B2 (en) | 2015-08-28 | 2024-02-06 | The Trustees Of The University Of Pennsylvania | Methods and compositions for cells expressing a chimeric intracellular signaling molecule |
US11891432B2 (en) | 2018-03-15 | 2024-02-06 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies having cross-reactivity to Zika virus and methods of use |
WO2024030956A2 (en) | 2022-08-03 | 2024-02-08 | Mozart Therapeutics, Inc. | Cd39-specific binding agents and methods of using the same |
US11897952B2 (en) | 2015-03-30 | 2024-02-13 | City Of Hope | Mechanically interlocking complexes |
US11905327B2 (en) | 2017-12-28 | 2024-02-20 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against TIGIT |
US11912754B2 (en) | 2017-10-12 | 2024-02-27 | Immunowake Inc. | VEGFR-antibody light chain fusion protein |
WO2024049949A1 (en) | 2022-09-01 | 2024-03-07 | Genentech, Inc. | Therapeutic and diagnostic methods for bladder cancer |
EP4339615A2 (en) | 2016-09-16 | 2024-03-20 | Shanghai Henlius Biotech, Inc. | Anti-pd-1 antibodies |
US11958903B2 (en) | 2018-03-30 | 2024-04-16 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies against LAG-3 and uses thereof |
WO2024079069A1 (en) | 2022-10-12 | 2024-04-18 | F. Hoffmann-La Roche Ag | Method for classifying cells |
-
1992
- 1992-11-04 WO PCT/US1992/009550 patent/WO1993008829A1/en active Application Filing
Non-Patent Citations (3)
Title |
---|
CLIN. EXP. IMMUNOLOL., Volume 79, issued 1990, S. SONGSIVILAI et al., "Bispecific Antibody: A Tool for Diagnosis and Treatment of Disease", pages 315-321. * |
INT. J. CANCER, Volume 43, issued 1989, J. VAN DUK et al., "Induction of Tumor-Cell Lysis by Bi-Specific Monoclonal Antibodies Recognizing Renal-Cell Carcinoma and CD3 Antigen", pages 344-349. * |
NATURE, 337, issued 09 February 1989, (London, GB), D.J. CAPON et al., "Designing CD4 Immunoadhesins for AIDS Therapy", pages 525-530. * |
Cited By (1684)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2241622A2 (en) | 1994-03-18 | 2010-10-20 | Genentech, Inc. | Human trk receptors and their derivatives |
EP2011873A2 (en) | 1994-05-27 | 2009-01-07 | Genentech, Inc. | Tumor necrosis factor receptor-associated factors |
EP0871726A1 (en) * | 1995-02-06 | 1998-10-21 | Cell Genesys, Inc. | Multispecific chimeric receptors |
EP0871726A4 (en) * | 1995-02-06 | 2000-10-04 | Cell Genesys Inc | Multispecific chimeric receptors |
EP2275119A1 (en) | 1995-07-27 | 2011-01-19 | Genentech, Inc. | Stable isotonic lyophilized protein formulation |
US6998116B1 (en) | 1996-01-09 | 2006-02-14 | Genentech, Inc. | Apo-2 ligand |
US6746668B2 (en) | 1996-01-09 | 2004-06-08 | Genentech, Inc. | Apo-2 ligand |
US7285533B2 (en) | 1996-01-09 | 2007-10-23 | Genentech, Inc. | Apo-2 ligand |
US6030945A (en) * | 1996-01-09 | 2000-02-29 | Genentech, Inc. | Apo-2 ligand |
US6469144B1 (en) | 1996-04-01 | 2002-10-22 | Genentech, Inc. | Apo-2LI and Apo-3 polypeptides |
US6159462A (en) * | 1996-08-16 | 2000-12-12 | Genentech, Inc. | Uses of Wnt polypeptides |
US5851984A (en) * | 1996-08-16 | 1998-12-22 | Genentech, Inc. | Method of enhancing proliferation or differentiation of hematopoietic stem cells using Wnt polypeptides |
US6462176B1 (en) | 1996-09-23 | 2002-10-08 | Genentech, Inc. | Apo-3 polypeptide |
US5990281A (en) * | 1996-09-30 | 1999-11-23 | Genentech, Inc. | Vertebrate smoothened proteins |
US6136958A (en) * | 1996-09-30 | 2000-10-24 | Genentech, Inc. | Antibodies to vertebrate smoothened proteins |
US6492139B1 (en) | 1996-09-30 | 2002-12-10 | Genentech, Inc. | Vertebrate smoothened proteins |
US6407216B1 (en) | 1996-09-30 | 2002-06-18 | Genentech, Inc. | Vertebrate smoothened antibodies |
US6270987B1 (en) | 1997-01-31 | 2001-08-07 | Genentech, Inc. | O-fucosyltransferase |
US7595046B2 (en) | 1997-05-15 | 2009-09-29 | Genentech, Inc. | Treatment of cancer using anti-Apo-2 antibodies |
US6342369B1 (en) | 1997-05-15 | 2002-01-29 | Genentech, Inc. | Apo-2-receptor |
US7314619B2 (en) | 1997-05-15 | 2008-01-01 | Genentech, Inc. | Inducing apoptosis using anti-Apo-2 antibodies |
US7750118B2 (en) | 1997-05-15 | 2010-07-06 | Genentech, Inc. | Apo-2 receptor polypeptides |
US7749755B2 (en) | 1997-05-15 | 2010-07-06 | Genentech, Inc. | Apo-2 receptor polynucleotides |
US6291643B1 (en) | 1997-06-05 | 2001-09-18 | Board Of Reports, The University Of Texas System | Apaf-1 an activator of caspase-3 |
US6121428A (en) * | 1997-06-13 | 2000-09-19 | Genentech, Inc. | Protein recovery |
US6716598B2 (en) | 1997-06-13 | 2004-04-06 | Genentech, Inc. | Protein recovery |
US6322997B1 (en) | 1997-06-13 | 2001-11-27 | Genentech, Inc. | Protein recovery |
EP2083079A1 (en) | 1997-06-18 | 2009-07-29 | Genentech, Inc. | Apo-2DcR |
US6764679B2 (en) | 1997-09-18 | 2004-07-20 | Genentech, Inc. | Antibodies to DcR3 Polypeptide, a TNFR Homolog |
EP1967587A1 (en) | 1997-10-10 | 2008-09-10 | Genentech, Inc. | APO-3 Ligand |
EP1887014A1 (en) | 1997-10-17 | 2008-02-13 | Genentech, Inc. | Human toll homologues |
EP2033970A2 (en) | 1997-10-29 | 2009-03-11 | Genentech, Inc. | WNT-1 inducible genes |
EP2014770A2 (en) | 1997-10-29 | 2009-01-14 | Genentech, Inc. | WNT-1 Iinduced secreted polypeptide WISP-2 |
EP2014677A1 (en) | 1997-11-21 | 2009-01-14 | Genentech, Inc. | A-33 related antigens and their pharmacological uses |
EP1947119A2 (en) | 1997-12-12 | 2008-07-23 | Genentech, Inc. | Treatment of cancer with anti-erb2 antibodies in combination with a chemotherapeutic agent |
EP2017341A2 (en) | 1998-01-15 | 2009-01-21 | Genentech, Inc. | Apo-2 ligand |
US6740739B1 (en) | 1998-01-15 | 2004-05-25 | Genentech, Inc. | Substitutional variants of APO-2 ligand |
US6764830B1 (en) | 1998-01-23 | 2004-07-20 | The Regents Of The University Of California | Thermomyces lanuginosus kinesin motor protein and methods of screening for modulators of kinesin proteins |
US6723840B1 (en) | 1998-01-23 | 2004-04-20 | The Regents Of The University Of California | Identification and expression of a novel kinesin motor protein |
US6815169B1 (en) | 1998-01-23 | 2004-11-09 | The Regents Of The University Of California | Identification and expression of a novel kinesin motor protein |
US7342099B2 (en) | 1998-02-25 | 2008-03-11 | The United States Of America As Represented By The Secretary, Department Of Health And Human Services | cDNA encoding a gene BOG (B5T over-expressed gene) and its protein product |
US6727079B1 (en) | 1998-02-25 | 2004-04-27 | The United States Of America As Represented By The Department Of Health And Human Services | cDNA encoding a gene BOG (B5T Over-expressed Gene) and its protein product |
EP2050762A2 (en) | 1998-03-10 | 2009-04-22 | Genentech, Inc. | Novel polypeptides and nucleic acids encoding the same |
EP2016951A1 (en) | 1998-03-17 | 2009-01-21 | Genentech, Inc. | Polypeptides homologous to VEGF and BMP1 |
EP1941905A1 (en) | 1998-03-27 | 2008-07-09 | Genentech, Inc. | APO-2 Ligand-anti-her-2 antibody synergism |
EP1865061A2 (en) | 1998-05-15 | 2007-12-12 | Genentech, Inc. | IL-17 homologous polypeptides and therapeutic uses thereof |
EP3112468A1 (en) | 1998-05-15 | 2017-01-04 | Genentech, Inc. | Il-17 homologous polypeptides and therapeutic uses thereof |
EP2333069A2 (en) | 1998-05-15 | 2011-06-15 | Genentech, Inc. | Therapeutic uses of IL-17 homologous polypeptides |
EP2058334A2 (en) | 1998-06-12 | 2009-05-13 | Genentech, Inc. | Monoclonal antibodies, cross-reactive antibodies and method for producing the same |
WO2000018806A1 (en) * | 1998-09-25 | 2000-04-06 | Horst Lindhofer | Bispecific and trispecific antibodies which specifically react with inducible surface antigens as operational target structures |
EP1950300A2 (en) | 1998-11-18 | 2008-07-30 | Genentech, Inc. | Antibody variants with higher binding affinity compared to parent antibodies |
EP1820859A2 (en) | 1998-12-22 | 2007-08-22 | Genentech, Inc. | Methods and compositions for inhibiting neoplastic cell growth |
EP2075335A2 (en) | 1998-12-22 | 2009-07-01 | Genentech, Inc. | Methods and compositions for inhibiting neoplastic cell growth |
EP2319929A1 (en) | 1998-12-23 | 2011-05-11 | Genentech, Inc. | IL-1 related polypeptides |
EP2330198A1 (en) | 1998-12-23 | 2011-06-08 | Genentech, Inc. | IL-1 related polypeptides |
EP2364997A2 (en) | 1999-01-15 | 2011-09-14 | Genentech, Inc. | Polypeptide variants with altered effector function |
EP2366713A2 (en) | 1999-01-15 | 2011-09-21 | Genentech, Inc. | Polypeptide variants with altered effector function |
EP2386574A2 (en) | 1999-01-15 | 2011-11-16 | Genentech, Inc. | Polypeptide variants with altered effector function |
EP1956030A1 (en) | 1999-06-15 | 2008-08-13 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids endoding the same |
EP1953173A1 (en) | 1999-06-15 | 2008-08-06 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids endoding the same |
EP2283866A2 (en) | 1999-06-25 | 2011-02-16 | Genentech, Inc. | Methods of treatment using anti-ERBB antibody-maytansinoid conjugates |
EP2112167A2 (en) | 1999-06-25 | 2009-10-28 | Genentech, Inc. | Humanized ANTI-ERBB2 antibodies and treatment with ANTI-ERBB2 antibodies |
EP2283867A2 (en) | 1999-06-25 | 2011-02-16 | Genentech, Inc. | Methods of treatment using anti-ERBB antibody-maytansinoid conjugates |
EP2803367A1 (en) | 1999-06-25 | 2014-11-19 | ImmunoGen, Inc. | Methods of treatment using anti-ERBB antibody-maytansinoid conjugates |
EP2977063A1 (en) | 1999-06-25 | 2016-01-27 | Genentech, Inc. | Methods of treatment using anti-ErbB antibody-maytansinoid conjugates |
EP2111870A1 (en) | 1999-08-27 | 2009-10-28 | Genentech, Inc. | Dosages for treatment of anti-erbB2 antibodies |
EP2110138A1 (en) | 1999-08-27 | 2009-10-21 | Genentech, Inc. | Dosages for treatment of anti-erbB2 antibodies |
WO2001029070A2 (en) | 1999-10-20 | 2001-04-26 | Genentech, Inc. | Modulation of t cell differentiation for the treatment of t helper cell mediated diseases |
EP2228446A1 (en) | 1999-12-01 | 2010-09-15 | Genentech, Inc. | Secreted and transmembrane polypeptieds and nucleic acids encoding the same |
EP2258848A1 (en) | 1999-12-23 | 2010-12-08 | Genentech, Inc. | Il-17 homologous polypeptide and therapeutic uses thereof |
EP2290081A2 (en) | 1999-12-23 | 2011-03-02 | Genentech, Inc. | IL-17 homologous polypeptide and therapeutic uses thereof |
US7235633B2 (en) | 2000-03-21 | 2007-06-26 | Genentech, Inc. | Cytokine receptors and nucleic acids encoding the same |
EP2052742A1 (en) | 2000-06-20 | 2009-04-29 | Biogen Idec Inc. | Treatment of B-cell associated diseases such as malignancies and autoimmune diseases using a cold anti-CD20 antibody/radiolabeled anti-CD22 antibody combination |
EP2077276A1 (en) | 2000-06-23 | 2009-07-08 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of disorders involving angiogensis |
EP2075334A1 (en) | 2000-06-23 | 2009-07-01 | Genentech, Inc. | EG-VEGF nucleic acids and polypeptides and methods of use |
EP2168980A1 (en) | 2000-06-23 | 2010-03-31 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of disorders involving angiogensis |
EP2042597A1 (en) | 2000-06-23 | 2009-04-01 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
EP2075253A1 (en) | 2000-06-23 | 2009-07-01 | Genentech, Inc. | Compositions and methds for the diagnosis and treatment of disorders involving angiogensis |
EP2275549A1 (en) | 2000-06-23 | 2011-01-19 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
EP2792747A1 (en) | 2000-06-23 | 2014-10-22 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis |
EP2014303A2 (en) | 2000-07-27 | 2009-01-14 | Genentech, Inc. | APO-2L receptor agonist and CPT-11 synergism |
EP3118318A1 (en) | 2000-08-07 | 2017-01-18 | Janssen Biotech, Inc. | Anti-tnf antibodies, compositions, methods and uses |
EP2253646A1 (en) | 2000-08-07 | 2010-11-24 | Centocor Ortho Biotech Inc. | Anti-dual integrin antibody and compositions and conjugates comprising said antibody |
EP2330129A2 (en) | 2000-08-07 | 2011-06-08 | Centocor Ortho Biotech Inc. | Anti-TNF antibodies, compositions, methods and uses |
EP2305817A2 (en) | 2000-08-07 | 2011-04-06 | Centocor Ortho Biotech Inc. | Anti-IL-12 antibodies, compositions, methods and uses |
EP2159230A1 (en) | 2000-08-07 | 2010-03-03 | Centocor Ortho Biotech Inc. | Anti-TNF antibodies, compositions, methods and uses |
EP2090657A2 (en) | 2000-08-07 | 2009-08-19 | Centocor Ortho Biotech Inc. | Anti-IL-12 antibodies, compositions, methods and uses |
EP3597752A1 (en) | 2000-08-07 | 2020-01-22 | Janssen Biotech, Inc. | Anti-il-12 antibodies, compositions, methods and uses |
EP2014298A2 (en) | 2000-08-24 | 2009-01-14 | Genentech, Inc. | Interleukin-22 polypeptides, nucleic acids encoding the same and methods for the treatment of pancreatic disorders |
WO2002016625A2 (en) | 2000-08-25 | 2002-02-28 | Basf Plant Science Gmbh | Plant polynucleotides encoding prenyl proteases |
EP1944317A2 (en) | 2000-09-01 | 2008-07-16 | Genentech, Inc. | Secreted and transmembrane polypeptides and nucleic acids encoding the same |
WO2002030463A2 (en) | 2000-10-12 | 2002-04-18 | Genentech, Inc. | Reduced-viscosity concentrated protein formulations |
EP2314318A1 (en) | 2001-01-31 | 2011-04-27 | Biogen Idec Inc. | CD80 antibody for use in combination with chemotherapeutics to treat B cell malignancies |
WO2002060485A2 (en) | 2001-01-31 | 2002-08-08 | Idec Pharmaceuticals Corporation | Use of immunoregulatory antibodies in the treatment of neoplastic disorders |
EP2065467A2 (en) | 2001-02-22 | 2009-06-03 | Genentech, Inc. | Anti-interferon-alpha antibodies |
EP2292301A2 (en) | 2001-02-22 | 2011-03-09 | Genentech, Inc. | Anti-interferon-alpha antibodies |
US7256257B2 (en) | 2001-04-30 | 2007-08-14 | Seattle Genetics, Inc. | Pentapeptide compounds and uses related thereto |
US7423116B2 (en) | 2001-04-30 | 2008-09-09 | Seattle Genetics Inc. | Pentapeptide compounds and uses related thereto |
EP2000545A1 (en) | 2001-06-20 | 2008-12-10 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP2000148A1 (en) | 2001-06-20 | 2008-12-10 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of prostate cancer |
EP2000482A1 (en) | 2001-06-20 | 2008-12-10 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP1992643A2 (en) | 2001-06-20 | 2008-11-19 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP2311960A2 (en) | 2001-08-29 | 2011-04-20 | Genentech, Inc. | Bv8 nucleic acids and polypeptides with mitogenic activity |
EP2143438A1 (en) | 2001-09-18 | 2010-01-13 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP2151244A1 (en) | 2001-09-18 | 2010-02-10 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP2153843A1 (en) | 2001-09-18 | 2010-02-17 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP2266594A1 (en) | 2001-09-19 | 2010-12-29 | Neuronova AB | VEGF for use in the treatment of central nervous system disorders |
EP2289537A1 (en) | 2001-09-19 | 2011-03-02 | Neuronova AB | PDGF for use in the treatment of central nervous system disorders |
EP2308888A1 (en) | 2001-11-14 | 2011-04-13 | Centocor Ortho Biotech Inc. | Anti-IL-6 antibodies, compositions, methods and uses |
EP2067472A1 (en) | 2002-01-02 | 2009-06-10 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP2048154A1 (en) | 2002-02-05 | 2009-04-15 | Genentech, Inc. | Protein purification |
EP2388265A1 (en) | 2002-02-22 | 2011-11-23 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP1961428A1 (en) | 2002-04-02 | 2008-08-27 | Ucb S.A. | SC6 antibody for treatment of cancer |
EP2289942A2 (en) | 2002-04-10 | 2011-03-02 | Genentech, Inc. | Anti-HER2 antibody variants |
EP2011886A2 (en) | 2002-04-16 | 2009-01-07 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP1933150A1 (en) | 2002-05-07 | 2008-06-18 | Institut Pasteur | Methods of screening of PP1-interacting polypeptides or proteins, peptides inhibiting PP1c binding to Bcl-2 proteins, BCL-XL and BCL-W, and uses thereof |
EP2332956A1 (en) | 2002-07-08 | 2011-06-15 | Genentech, Inc. | Antibody binding to PRO71238 |
EP2263691A1 (en) | 2002-07-15 | 2010-12-22 | Genentech, Inc. | Treatment of cancer with the recombinant humanized monoclonal anti-erbb2 antibody 2C4 (rhuMAb 2C4) |
US7731946B2 (en) | 2002-07-15 | 2010-06-08 | Wyeth Llc | Methods and compositions for modulating T helper (TH) cell development and function |
US7314623B2 (en) | 2002-07-15 | 2008-01-01 | Wyeth | Methods and compositions for modulating T helper (Th) cell development and function |
EP2357006A2 (en) | 2002-07-31 | 2011-08-17 | Seattle Genetics, Inc. | Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease |
EP2353611A2 (en) | 2002-07-31 | 2011-08-10 | Seattle Genetics, Inc. | Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease |
WO2004010957A2 (en) | 2002-07-31 | 2004-02-05 | Seattle Genetics, Inc. | Drug conjugates and their use for treating cancer, an autoimmune disease or an infectious disease |
US11225511B2 (en) | 2002-09-09 | 2022-01-18 | Howard Hughes Medical Institute | BH3 peptides and methods of use thereof |
US9902759B2 (en) | 2002-09-09 | 2018-02-27 | Dana-Farber Cancer Institute, Inc. | BH3 peptides and methods of use thereof |
US9856303B2 (en) | 2002-09-09 | 2018-01-02 | Dana-Farber Cancer Institute, Inc. | BH3 peptides and method of use thereof |
US7868133B2 (en) | 2002-09-09 | 2011-01-11 | Dana Farber Cancer Institute, Inc. | BH3 peptides and method of use thereof |
EP3388452A2 (en) | 2002-09-11 | 2018-10-17 | Genentech, Inc. | Protein purification |
EP2332996A1 (en) | 2002-09-11 | 2011-06-15 | Genentech, Inc. | Protein Purification |
EP2116551A1 (en) | 2002-09-11 | 2009-11-11 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2085096A2 (en) | 2002-09-11 | 2009-08-05 | Genentech, Inc. | Novel composition and methods for the treatment of immune related diseases |
EP2444409A2 (en) | 2002-09-16 | 2012-04-25 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2500438A2 (en) | 2002-09-25 | 2012-09-19 | Genentech, Inc. | Novel compositions and methods for the treatment of psoriasis |
EP2434022A2 (en) | 2002-10-03 | 2012-03-28 | Genentech, Inc. | Use of A33 antigens and JAM-IT |
EP2322202A2 (en) | 2002-10-29 | 2011-05-18 | Genentech, Inc. | Compositions and methods for the treatment of immune diseases |
EP2322200A2 (en) | 2002-10-29 | 2011-05-18 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2322203A2 (en) | 2002-10-29 | 2011-05-18 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2322201A2 (en) | 2002-10-29 | 2011-05-18 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2364716A2 (en) | 2002-11-08 | 2011-09-14 | Genentech, Inc. | Compositions and methods for the treatment of natural killer cell related diseases |
EP2311870A1 (en) | 2002-11-26 | 2011-04-20 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2311868A1 (en) | 2002-11-26 | 2011-04-20 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2308968A1 (en) | 2002-11-26 | 2011-04-13 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2314676A1 (en) | 2002-11-26 | 2011-04-27 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2526960A1 (en) | 2003-03-12 | 2012-11-28 | Genentech, Inc. | Use of BV8 and/or EG-VEGF to promote hematopoiesis |
EP2335725A1 (en) | 2003-04-04 | 2011-06-22 | Genentech, Inc. | High concentration antibody and protein formulations |
EP3178492A1 (en) | 2003-04-04 | 2017-06-14 | Genentech, Inc. | High concentration antibody and protein formulations |
EP2062916A2 (en) | 2003-04-09 | 2009-05-27 | Genentech, Inc. | Therapy of autoimmune disease in a patient with an inadequate response to a TNF-Alpha inhibitor |
EP2083018A2 (en) | 2003-04-16 | 2009-07-29 | Genentech, Inc. | Compositions and methods relating to STOP-1 |
EP2311875A1 (en) | 2003-05-30 | 2011-04-20 | Genentech, Inc. | Treatment with anti-VEGF antibodies |
EP2248829A1 (en) | 2003-05-30 | 2010-11-10 | Genentech, Inc. | Treatment with anti-VEGF antibodies |
US9708410B2 (en) | 2003-05-30 | 2017-07-18 | Janssen Biotech, Inc. | Anti-tissue factor antibodies and compositions |
EP2251355A1 (en) | 2003-05-30 | 2010-11-17 | Genentech, Inc. | Treatment with anti-VEGF antibodies |
EP2272868A2 (en) | 2003-06-05 | 2011-01-12 | Genentech, Inc. | Combination therapy for B cell disorders |
EP2093570A1 (en) | 2003-06-06 | 2009-08-26 | Genentech, Inc. | Modulating the interaction between HGF beta chain and c-met |
WO2004112572A2 (en) | 2003-06-13 | 2004-12-29 | University Of Pittsburgh | Monitoring immunologic, hematologic and inflammatory diseases |
EP2277908A2 (en) | 2003-07-08 | 2011-01-26 | Genentech, Inc. | IL-17A/F heterologous polypeptides, antibodies and therapeutic uses thereof |
EP2784084A1 (en) | 2003-07-08 | 2014-10-01 | Genentech, Inc. | IL-17 A/F heterologous polypeptides and therapeutics uses thereof |
EP3594228A1 (en) | 2003-07-08 | 2020-01-15 | Genentech, Inc. | Il-17a/f heterologous polypedtides and therapeutic uses thereof |
EP3095793A1 (en) | 2003-07-28 | 2016-11-23 | Genentech, Inc. | Reducing protein a leaching during protein a affinity chromatography |
EP3722309A1 (en) | 2003-07-28 | 2020-10-14 | Genentech, Inc. | Reducing protein a leaching during protein a affinity chromatography |
EP2014675A1 (en) | 2003-08-11 | 2009-01-14 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2486933A1 (en) | 2003-11-06 | 2012-08-15 | Seattle Genetics, Inc. | Monomethylvaline compounds conjugated with antibodies |
EP2478912A1 (en) | 2003-11-06 | 2012-07-25 | Seattle Genetics, Inc. | Auristatin conjugates with anti-HER2 or anti-CD22 antibodies and their use in therapy |
EP2489364A1 (en) | 2003-11-06 | 2012-08-22 | Seattle Genetics, Inc. | Monomethylvaline compounds onjugated to antibodies |
EP2260858A2 (en) | 2003-11-06 | 2010-12-15 | Seattle Genetics, Inc. | Monomethylvaline compounds capable of conjugation to ligands |
EP3858387A1 (en) | 2003-11-06 | 2021-08-04 | Seagen Inc. | Monomethylvaline compounds capable of conjugation to ligands |
EP3120861A1 (en) | 2003-11-06 | 2017-01-25 | Seattle Genetics, Inc. | Intermediate for conjugate preparation comprising auristatin derivatives and a linker |
EP3434275A1 (en) | 2003-11-06 | 2019-01-30 | Seattle Genetics, Inc. | Assay for cancer cells based on the use of auristatin conjugates with antibodies |
EP2161283A1 (en) | 2003-11-17 | 2010-03-10 | Genentech, Inc. | Compositions comprising antibodies against CD79b conjugated to a growth inhibitory agent or cytotoxic agent and methods for the treatment of tumor of hematopoietic origin |
EP2295073A1 (en) | 2003-11-17 | 2011-03-16 | Genentech, Inc. | Antibody against CD22 for the treatment of tumour of hematopoietic origin |
EP2301568A1 (en) | 2003-11-17 | 2011-03-30 | Genentech, Inc. | Antibody against IRTA2 for the treatment of tumour of hematopoietic origin |
US7931900B2 (en) | 2003-11-21 | 2011-04-26 | Ucb Pharma S.A. | Method for the treatment of multiple sclerosis by inhibiting IL-17 activity |
EP1983000A2 (en) | 2003-11-21 | 2008-10-22 | UCB Pharma, S.A. | Method for the treatment of multiple sclerosis by inhibiting IL-17 activity |
EP2974742A1 (en) | 2003-11-21 | 2016-01-20 | UCB Biopharma SPRL | Method for the treatment of multiple sclerosis by inhibiting il-17 activity |
EP2336178A1 (en) | 2003-12-11 | 2011-06-22 | Genentech, Inc. | Methods and compositions for inhibiting C-Met dimerization and activation |
EP2332575A1 (en) | 2003-12-23 | 2011-06-15 | Genentech, Inc. | Treatment of cancer with novel anti-IL 13 monoclonal antibodies |
EP3718564A1 (en) | 2003-12-23 | 2020-10-07 | Genentech, Inc. | Novel anti-il 13 antibodies and uses thereof |
EP2351584A1 (en) | 2003-12-23 | 2011-08-03 | Genentech, Inc. | Novel anti-IL 13 antibodies and uses thereof |
EP2805728A1 (en) | 2003-12-23 | 2014-11-26 | Genentech, Inc. | Novel anti-IL 13 antibodies and uses thereof |
WO2005062972A2 (en) | 2003-12-23 | 2005-07-14 | Tanox, Inc. | Treatment of cancer with novel anti-il 13 monoclonal antibodies |
US7736635B2 (en) | 2003-12-23 | 2010-06-15 | Ucb Pharma S.A. | Branched molecular scaffolds for linking polymer residues to biologically active moieties |
WO2005070963A1 (en) | 2004-01-12 | 2005-08-04 | Applied Molecular Evolution, Inc | Fc region variants |
EP3653641A1 (en) | 2004-02-19 | 2020-05-20 | Genentech, Inc. | Cdr-repaired antibodies |
WO2005084390A2 (en) | 2004-03-02 | 2005-09-15 | Seattle Genetics, Inc. | Partially loaded antibodies and methods of their conjugation |
EP2404935A1 (en) | 2004-03-30 | 2012-01-11 | Glaxo Group Limited | Immunoglobulin binding HOSM |
EP2216650A1 (en) | 2004-04-09 | 2010-08-11 | University of Pittsburgh | Real time method of detecting acute inflammatory conditions |
US9465029B2 (en) | 2004-04-16 | 2016-10-11 | Glaxo Group Limited | Methods for detecting LP-PLA2 activity and inhibition of LP-PLA2 activity |
US8916155B2 (en) | 2004-04-23 | 2014-12-23 | Bundesrepublik Deutschland letztvertreten durch das Robert-Koch-Institut vertreten durch seinen Präsidenten | Method for the treatment of T cell mediated conditions by depletion of ICOS-positive cells in vivo |
US8318905B2 (en) | 2004-04-23 | 2012-11-27 | Richard Kroczek | Antibodies for depletion of ICOS-positive cells in vivo |
EP2214014A1 (en) | 2004-05-11 | 2010-08-04 | The University of Pittsburgh | Monitoring immunologic, hematologic and inflammatory diseases |
EP2286844A2 (en) | 2004-06-01 | 2011-02-23 | Genentech, Inc. | Antibody-drug conjugates and methods |
EP3130349A1 (en) | 2004-06-04 | 2017-02-15 | Genentech, Inc. | Method for treating multiple sclerosis |
EP2436697A1 (en) | 2004-07-01 | 2012-04-04 | Glaxo Group Limited | Chimeric and humanised monoclonal antibodies against interleukin-13 |
WO2006003407A2 (en) | 2004-07-01 | 2006-01-12 | Glaxo Group Limited | Chimeric and humanised monoclonal antibodies against inteleukin- 13 |
EP2361931A1 (en) | 2004-07-20 | 2011-08-31 | Genentech, Inc. | Inhibitors of angiopoietin-like 4 protein, combinations, and their use |
WO2006024354A1 (en) * | 2004-08-30 | 2006-03-09 | Schering Aktiengesellschaft | Treatment of hiv infection by t-cell modulation |
EP2371388A2 (en) | 2004-10-20 | 2011-10-05 | Genentech, Inc. | Antibody formulations |
EP3498294A1 (en) | 2004-10-20 | 2019-06-19 | Genentech, Inc. | Antibody formulations |
EP3505191A1 (en) | 2004-11-12 | 2019-07-03 | Seattle Genetics, Inc. | Auristatins having an aminobenzoic acid unit at the n terminus |
WO2006132670A2 (en) | 2004-11-12 | 2006-12-14 | Seattle Genetics, Inc. | Auristatins having an aminobenzoic acid unit at the n terminus |
EP3511344A1 (en) | 2004-12-10 | 2019-07-17 | NovImmune S.A. | Neutralizing antibodies and methods of use thereof |
EP2230517A1 (en) | 2005-01-07 | 2010-09-22 | Diadexus, Inc. | OVR110 antibody compositions and methods of use |
WO2006074418A2 (en) | 2005-01-07 | 2006-07-13 | Diadexus, Inc. | Ovr110 antibody compositions and methods of use |
EP3698807A1 (en) | 2005-01-21 | 2020-08-26 | Genentech, Inc. | Fixed dosing of her antibodies |
EP2392353A1 (en) | 2005-01-28 | 2011-12-07 | Janssen Alzheimer Immunotherapy | Anti A beta antibody formulation |
US8409570B2 (en) | 2005-02-02 | 2013-04-02 | Genentech, Inc. | Method of inducing apoptosis using anti-DR5 antibodies |
US8029783B2 (en) | 2005-02-02 | 2011-10-04 | Genentech, Inc. | DR5 antibodies and articles of manufacture containing same |
US8030023B2 (en) | 2005-02-02 | 2011-10-04 | Genentech, Inc. | Nucleic acid encoding DR5 antibodies and uses thereof |
US8329178B2 (en) | 2005-02-18 | 2012-12-11 | Dana-Farber Cancer Institute, Inc. | Antibodies against CXCR4 and methods of use thereof |
EP2399605A1 (en) | 2005-02-23 | 2011-12-28 | Genentech, Inc. | Extending time to disease progression or survival in cancer patients |
EP2535355A2 (en) | 2005-03-23 | 2012-12-19 | Genmab A/S | Antibodies against CD38 for treatment of multiple myeloma |
EP3153525A1 (en) | 2005-03-23 | 2017-04-12 | Genmab A/S | Antibodies against cd38 for treatment of multiple myeloma |
EP2567976A2 (en) | 2005-03-23 | 2013-03-13 | Genmab A/S | Antibodies against CD38 for treatment of multiple myeloma |
EP2551282A2 (en) | 2005-03-23 | 2013-01-30 | Genmab A/S | Antibodies against CD38 for treatment of multiple myeloma |
EP3312196A1 (en) | 2005-03-23 | 2018-04-25 | Genmab A/S | Antibodies against cd38 for treatment of multiple myeloma |
WO2006108273A1 (en) | 2005-04-11 | 2006-10-19 | National Research Council Of Canada | Identification of a beta-1,3-n-acetylgalactosaminyltransferase (cgte) from campylobacter jejuni lio87 |
WO2006113402A1 (en) | 2005-04-14 | 2006-10-26 | Genentech, Inc. | Methods and compositions for modulating and detecting wisp activity |
EP2511299A1 (en) | 2005-04-19 | 2012-10-17 | Seattle Genetics, Inc. | Humanized anti-CD70 binding agents and uses thereof |
EP2842968A1 (en) | 2005-04-29 | 2015-03-04 | Janssen Biotech, Inc. | Anti-IL-6 antibodies, compositions, methods and uses |
EP2267450A2 (en) | 2005-04-29 | 2010-12-29 | The Regents of the University of California | Antibodies against histone modifications for clinical diagnosis and prognosis of cancer |
EP3263581A1 (en) | 2005-05-17 | 2018-01-03 | University of Connecticut | Compositions and methods for immunomodulation in an organism |
EP3805245A1 (en) | 2005-05-17 | 2021-04-14 | University of Connecticut | Compositions and methods for immunomodulation in an organism |
US8355776B2 (en) | 2005-05-27 | 2013-01-15 | Board Of Regents, The University Of Texas System | Hemoglobin contrast in magneto-motive optical doppler tomography, optical coherence tomography, and ultrasound imaging methods and apparatus |
US9687153B2 (en) | 2005-05-27 | 2017-06-27 | Board Of Regents, The University Of Texas System | Hemoglobin contrast in magneto-motive optical doppler tomography, optical coherence tomography, and ultrasound imaging methods and apparatus |
US9198596B2 (en) | 2005-05-27 | 2015-12-01 | Board Of Regents, The University Of Texas System | Hemoglobin contrast in magneto-motive optical doppler tomography, optical coherence tomography, and ultrasound imaging methods and apparatus |
US8454511B2 (en) | 2005-05-27 | 2013-06-04 | Board Of Regents, The University Of Texas System | Magneto-motive ultrasound detection of magnetic nanoparticles |
EP2186402A1 (en) | 2005-06-06 | 2010-05-19 | Genentech, Inc. | Knock-out animal models for novel genes and methods of use |
US8440799B2 (en) | 2005-06-17 | 2013-05-14 | Janssen Alzheimer Immunotherapy | Methods of purifying anti A β antibodies |
EP2388274A1 (en) | 2005-06-17 | 2011-11-23 | Janssen Alzheimer Immunotherapy | Methods of purifying anti A Beta antibodies |
US7825223B2 (en) | 2005-06-17 | 2010-11-02 | Janssen Alzheimer Immunotherapy | Methods of purifying anti A β antibodies |
US7820799B2 (en) | 2005-06-17 | 2010-10-26 | Janssen Alzheimer Immunotherapy | Methods of purifying Fc region containing proteins |
EP3501537A1 (en) | 2005-06-30 | 2019-06-26 | Janssen Biotech, Inc. | Anti-il23 antibodies, compositions, methods and uses |
EP2452694A1 (en) | 2005-06-30 | 2012-05-16 | Janssen Biotech, Inc. | Anti-IL-23 antibodies, compositions, methods and uses |
EP3498289A1 (en) | 2005-07-07 | 2019-06-19 | Seattle Genetics, Inc. | Monomethylvaline compounds having phenylalanine side-chain modifications at the c-terminus |
EP2722051A1 (en) | 2005-07-07 | 2014-04-23 | Seattle Genetics, Inc. | Monomethylvaline compounds having phenylalanine side-chain modifications at the C-terminus |
EP3248613A1 (en) | 2005-07-18 | 2017-11-29 | Seattle Genetics, Inc. | Beta-glucuronide drug linker conjugates |
WO2007011968A2 (en) | 2005-07-18 | 2007-01-25 | Seattle Genetics, Inc. | Beta-glucuronide-linker drug conjugates |
EP4026840A1 (en) | 2005-07-18 | 2022-07-13 | Seagen Inc. | Beta-glucuronide-linker drug conjugates |
EP2573114A1 (en) | 2005-08-10 | 2013-03-27 | MacroGenics, Inc. | Identification and engineering of antibodies with variant Fc regions and methods of using same |
EP1995321A2 (en) | 2005-08-15 | 2008-11-26 | Genentech, Inc. | Gene disruptions, compositions and methods relating thereto |
WO2007048849A1 (en) * | 2005-10-28 | 2007-05-03 | Novo Nordisk A/S | Fusion proteins that bind effector lymphocytes and target cells |
EP3299027A1 (en) | 2005-11-04 | 2018-03-28 | Genentech, Inc. | Use of complement pathway inhibitors to treat ocular diseases |
EP2998318A1 (en) | 2005-11-04 | 2016-03-23 | Genentech, Inc. | Use of complement pathway inhibitors to treat ocular diseases |
EP2500030A2 (en) | 2005-11-04 | 2012-09-19 | Genentech, Inc. | Use of complement pathway inhibitors to treat ocular diseases |
US10450379B2 (en) | 2005-11-15 | 2019-10-22 | Genetech, Inc. | Method for treating joint damage |
US10654940B2 (en) | 2005-11-15 | 2020-05-19 | Genentech, Inc. | Method for treating joint damage |
EP2002714A1 (en) | 2005-11-21 | 2008-12-17 | Genentech, Inc. | Novel gene disruptions, compositions and methods relating thereto |
EP3006466A2 (en) | 2005-12-02 | 2016-04-13 | Genentech, Inc. | Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to il-22 and il-22r |
EP2623516A2 (en) | 2005-12-02 | 2013-08-07 | Genentech, Inc. | Compositions and methods for the treatment of diseases and disorders associated with cytokine signaling involving antibodies that bind to IL-22 and IL-22R |
WO2007068784A1 (en) | 2005-12-14 | 2007-06-21 | Licentia Ltd | Novel neurotrophic factor protein and uses thereof |
WO2007068803A1 (en) | 2005-12-14 | 2007-06-21 | Licentia Ltd | Novel neurotrophic factor protein and uses thereof |
EP3309170A1 (en) | 2005-12-15 | 2018-04-18 | Genentech, Inc. | Polyubiquitin antibodies |
EP2325208A1 (en) | 2005-12-15 | 2011-05-25 | Genentech, Inc. | Polyubiquitin antibodies |
WO2007068750A2 (en) | 2005-12-16 | 2007-06-21 | Glaxo Group Limited | Immunoglobulins directed against nogo |
EP2228391A2 (en) | 2005-12-16 | 2010-09-15 | Glaxo Group Limited | Immunoglobulins directed against Nogo |
EP3760230A1 (en) | 2005-12-29 | 2021-01-06 | Janssen Biotech, Inc. | Human anti-il-23 antibodies, compositions, methods and uses |
EP3219328A1 (en) | 2005-12-29 | 2017-09-20 | Janssen Biotech, Inc. | Human anti-il-23 antibodies, compositions, method and uses |
EP2548577A1 (en) | 2005-12-29 | 2013-01-23 | Janssen Biotech, Inc. | Human anti-il-23 antibodies, compositions, methods and uses |
EP3156418A1 (en) | 2006-01-05 | 2017-04-19 | Genentech, Inc. | Anti-ephb4 antibodies and methods using same |
EP2402373A2 (en) | 2006-01-05 | 2012-01-04 | Genentech, Inc. | Anti-EphB4 Antibodies and Methods Using Same |
US7803561B2 (en) | 2006-02-06 | 2010-09-28 | Rhode Island Hospital | GPR30 estrogen receptor in breast cancers |
EP2050335A1 (en) | 2006-02-17 | 2009-04-22 | Genentech, Inc. | Gene disruptions, compositions and methods relating thereto |
EP2468772A2 (en) | 2006-03-16 | 2012-06-27 | Genentech, Inc. | Antibodies to EGFL7 and methods for their use |
EP2366716A2 (en) | 2006-03-21 | 2011-09-21 | Genentech, Inc. | Combinatorial therapy involving alpha5beta1 antagonists |
EP2390666A1 (en) | 2006-03-21 | 2011-11-30 | The Regents of The University of California | N-Cadherin as target for cancer diagnosis and therapy |
EP2389946A1 (en) | 2006-03-23 | 2011-11-30 | Novartis AG | Anti-tumor cell antigen antibody therapeutics |
EP2389951A1 (en) | 2006-03-23 | 2011-11-30 | Novartis AG | Anti-tumor cell antigen antibody therapeutics |
EP2389947A1 (en) | 2006-03-23 | 2011-11-30 | Novartis AG | Anti-tumor cell antigen antibody therapeutics |
EP2389950A1 (en) | 2006-03-23 | 2011-11-30 | Novartis AG | Anti-tumor cell antigen antibody therapeutics |
EP2389948A1 (en) | 2006-03-23 | 2011-11-30 | Novartis AG | Anti-tumor cell antigen antibody therapeutics |
EP2389949A1 (en) | 2006-03-23 | 2011-11-30 | Novartis AG | Anti-tumor cell antigen antibody therapeutics |
US9540674B2 (en) | 2006-03-31 | 2017-01-10 | Dana-Farber Cancer Institute, Inc. | Methods of determining cellular chemosensitivity |
US11215608B2 (en) | 2006-03-31 | 2022-01-04 | Dana-Farber Cancer Institute, Inc. | Methods of determining cellular chemosensitivity |
EP2614839A2 (en) | 2006-04-05 | 2013-07-17 | Genentech, Inc. | Method for using BOC/CDO to modulate hedgehog signaling |
EP2082645A1 (en) | 2006-04-19 | 2009-07-29 | Genentech, Inc. | Novel gene disruptions, compositions and methods relating thereto |
US7727525B2 (en) | 2006-05-11 | 2010-06-01 | City Of Hope | Engineered anti-CD20 antibody fragments for in vivo targeting and therapeutics |
EP2446904A2 (en) | 2006-05-30 | 2012-05-02 | Genentech, Inc. | Anti-CD22 antibodies, their immunoconjugates and uses thereof |
EP2447282A2 (en) | 2006-05-30 | 2012-05-02 | Genentech, Inc. | Anti-CD22 Antibodies, their Immunoconjugates and uses thereof |
WO2008036135A2 (en) | 2006-06-01 | 2008-03-27 | Genentech, Inc. | Crystal structure of crig and c3b: crig complex |
EP2375255A1 (en) | 2006-06-06 | 2011-10-12 | Oxford Biotherapeutics Ltd. | Proteins |
WO2007141280A2 (en) | 2006-06-06 | 2007-12-13 | Oxford Genome Sciences (Uk) Ltd | Proteins |
US9090930B2 (en) | 2006-06-27 | 2015-07-28 | Emd Millipore Corporation | Method and unit for preparing a sample for the microbiological analysis of a liquid |
US9410181B2 (en) | 2006-06-27 | 2016-08-09 | Emd Millipore Corporation | Method and unit for preparing a sample for the microbiological analysis of a liquid |
EP2671946A1 (en) | 2006-06-30 | 2013-12-11 | Bristol-Myers Squibb Company | Polynucleotides encoding novel PCSK9 variants |
EP2639301A2 (en) | 2006-06-30 | 2013-09-18 | Bristol-Myers Squibb Company | Polynucleotides encoding novel PCSK9 variants |
EP2471815A1 (en) | 2006-07-11 | 2012-07-04 | University Of Medicine And Dentistry Of New Jersey | Proteins, nucleic acids encoding the same and associated methods of use |
EP2471809A1 (en) | 2006-07-11 | 2012-07-04 | University Of Medicine And Dentistry Of New Jersey | Proteins, nucleic acids encoding the same and associated methods of use |
WO2008011081A2 (en) | 2006-07-19 | 2008-01-24 | The Trustees Of The University Of Pennsylvania | Wsx-1/p28 as a target for anti-inflammatory responses |
WO2008021290A2 (en) | 2006-08-09 | 2008-02-21 | Homestead Clinical Corporation | Organ-specific proteins and methods of their use |
EP2520935A2 (en) | 2006-08-09 | 2012-11-07 | Homestead Clinical Corporation | Organ-specific proteins and methods of their use |
US9867530B2 (en) | 2006-08-14 | 2018-01-16 | Volcano Corporation | Telescopic side port catheter device with imaging system and method for accessing side branch occlusions |
EP2455404A2 (en) | 2006-08-22 | 2012-05-23 | G2 Inflammation Pty Ltd | Anti-C5AR antibodies with improved properties |
EP2423332A1 (en) | 2006-08-25 | 2012-02-29 | Oncotherapy Science, Inc. | Prognostic markers and therapeutic targets for lung cancer |
EP2423333A1 (en) | 2006-08-25 | 2012-02-29 | Oncotherapy Science, Inc. | Prognostic markers and therapeutic targets for lung cancer |
EP3023789A1 (en) | 2006-09-21 | 2016-05-25 | Nestec S.A. | Antibody-based arrays for detecting multiple signal transducers in rare circulating cells |
EP2551672A1 (en) | 2006-09-21 | 2013-01-30 | Nestec S.A. | Antibody-based arrays for detecting multiple signal transducers in rare circulating cells |
WO2008060776A2 (en) | 2006-10-03 | 2008-05-22 | University Of Medicine And Dentistry Of New Jersey | Atap peptides, nucleic acids encoding the same and associated methods of use |
EP3524623A1 (en) | 2006-10-18 | 2019-08-14 | UCB Biopharma SPRL | Antibody molecules which bind il-17a and il-17f |
EP2514764A2 (en) | 2006-10-18 | 2012-10-24 | UCB Pharma, S.A. | Antibody molecules which bind IL-17A and IL-17F |
US9289131B2 (en) | 2006-10-20 | 2016-03-22 | Board Of Regents, The University Of Texas System | Method and apparatus to identify vulnerable plaques with thermal wave imaging of heated nanoparticles |
US8108030B2 (en) | 2006-10-20 | 2012-01-31 | Board Of Regents, The University Of Texas System | Method and apparatus to identify vulnerable plaques with thermal wave imaging of heated nanoparticles |
WO2008052187A2 (en) | 2006-10-27 | 2008-05-02 | Genentech. Inc. | Antibodies and immunoconjugates and uses therefor |
EP2845866A1 (en) | 2006-10-27 | 2015-03-11 | Genentech, Inc. | Antibodies and immunoconjugates and uses therefor |
EP2503341A2 (en) | 2006-11-14 | 2012-09-26 | Genentech, Inc. | Modulators of Neuronal Regeneration |
EP2567975A2 (en) | 2006-11-21 | 2013-03-13 | The Regents of The University of California | Modulation of RHAMM (CD168) for selective adipose tissue development |
EP2962697A1 (en) | 2006-11-27 | 2016-01-06 | diaDexus, Inc. | Ovr110 antibody compositions and methods of use |
EP3181147A1 (en) | 2006-11-29 | 2017-06-21 | Genentech, Inc. | Il-17a/f heterodimeric polypeptides and therapeutic thereof |
EP2450050A1 (en) | 2006-11-29 | 2012-05-09 | Genentech, Inc. | IL-17A/F heterodimeric polypeptides and therapeutic uses thereof |
EP2609932A2 (en) | 2006-12-01 | 2013-07-03 | Seattle Genetics, Inc. | Variant target binding agents and uses thereof |
EP2610267A1 (en) | 2006-12-18 | 2013-07-03 | Genentech, Inc. | Antagonist anti-Notch3 antibodies and their use in the prevention and treatment of Notch3-related diseases |
US9376464B2 (en) | 2006-12-21 | 2016-06-28 | Emd Millipore Corporation | Purification of proteins |
US10233211B2 (en) | 2006-12-21 | 2019-03-19 | Emd Millipore Corporation | Purification of proteins |
US10793593B2 (en) | 2006-12-21 | 2020-10-06 | Emd Millipore Corporation | Purification of proteins |
EP2377527A1 (en) | 2007-01-22 | 2011-10-19 | Genentech, Inc. | Polyelectrolyte precipitation and purification of antibodies |
EP2436781A1 (en) | 2007-02-22 | 2012-04-04 | Genentech, Inc. | Methods for detecting inflammatory bowel disease |
WO2008103962A2 (en) | 2007-02-22 | 2008-08-28 | Genentech, Inc. | Methods for detecting inflammatory bowel disease |
EP3118220A1 (en) | 2007-02-26 | 2017-01-18 | Oxford BioTherapeutics Ltd | Protein |
EP2447719A1 (en) | 2007-02-26 | 2012-05-02 | Oxford Biotherapeutics Ltd. | Proteins |
EP3118221A1 (en) | 2007-02-26 | 2017-01-18 | Oxford BioTherapeutics Ltd | Proteins |
EP2441775A1 (en) | 2007-02-26 | 2012-04-18 | Oxford Biotherapeutics Ltd. | Protein |
EP2899541A1 (en) | 2007-03-02 | 2015-07-29 | Genentech, Inc. | Predicting response to a HER dimerisation inhbitor based on low HER3 expression |
US8940302B2 (en) | 2007-03-02 | 2015-01-27 | Genentech, Inc. | Predicting response to a HER inhibitor |
US7981418B2 (en) | 2007-03-02 | 2011-07-19 | Genentech, Inc. | Predicting response to a HER inhibitor |
US10317393B2 (en) | 2007-03-23 | 2019-06-11 | Academia Sinica | Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells |
US9816981B2 (en) | 2007-03-23 | 2017-11-14 | Academia Sinica | Alkynyl sugar analogs for labeling and visualization of glycoconjugates in cells |
WO2008118324A2 (en) | 2007-03-26 | 2008-10-02 | Macrogenics, Inc. | Composition and method of treating cancer with an anti-uroplakin ib antibody |
EP3431103A1 (en) | 2007-04-12 | 2019-01-23 | The Brigham and Women's Hospital, Inc. | Targeting abcb5 for cancer therapy |
EP2644205A1 (en) | 2007-04-12 | 2013-10-02 | The Brigham and Women's Hospital, Inc. | Targeting ABCB5 for cancer therapy |
WO2008150525A1 (en) | 2007-06-04 | 2008-12-11 | Genentech, Inc. | Anti-notch1 nrr antibodies and methods using same |
EP2980100A1 (en) | 2007-06-08 | 2016-02-03 | Australian Poultry CRC Pty Ltd | Clostridial toxin netb |
EP2592156A2 (en) | 2007-06-08 | 2013-05-15 | Genentech, Inc. | Gene expression markers of tumor resistance to HER2 inhibitor treatment |
EP4335863A2 (en) | 2007-07-09 | 2024-03-13 | Genentech, Inc. | Prevention of disulfide bond reduction during recombinant production of polypeptides |
EP4219522A2 (en) | 2007-07-09 | 2023-08-02 | Genentech, Inc. | Prevention of disulfide bond reduction during recombinant production of polypeptides |
EP4245766A2 (en) | 2007-07-09 | 2023-09-20 | Genentech, Inc. | Prevention of disulfide bond reduction during recombinant production of polypeptides |
EP3327026A1 (en) | 2007-07-09 | 2018-05-30 | Genentech, Inc. | Prevention of disulfide bond reduction during recombinant production of polypeptides |
EP2586788A1 (en) | 2007-07-09 | 2013-05-01 | Genentech, Inc. | Prevention of disulfide bond reduction during recombinant production of polypeptides |
US11350906B2 (en) | 2007-07-12 | 2022-06-07 | Philips Image Guided Therapy Corporation | OCT-IVUS catheter for concurrent luminal imaging |
US9596993B2 (en) | 2007-07-12 | 2017-03-21 | Volcano Corporation | Automatic calibration systems and methods of use |
US10219780B2 (en) | 2007-07-12 | 2019-03-05 | Volcano Corporation | OCT-IVUS catheter for concurrent luminal imaging |
US9622706B2 (en) | 2007-07-12 | 2017-04-18 | Volcano Corporation | Catheter for in vivo imaging |
EP2502937A2 (en) | 2007-07-16 | 2012-09-26 | Genentech, Inc. | Anti-CD 79b Antibodies And Immunoconjugates And Methods Of Use |
EP2474557A2 (en) | 2007-07-16 | 2012-07-11 | Genentech, Inc. | Anti-CD79b antibodies and immunoconjugates and methods of use |
EP2641618A2 (en) | 2007-07-16 | 2013-09-25 | Genentech, Inc. | Humanized anti-CD79B antibodies and immunoconjugates and methods of use |
WO2009035791A1 (en) | 2007-08-02 | 2009-03-19 | Arresto Biosciences | Lox and l0xl2 inhibitors and uses thereof |
WO2009054873A2 (en) | 2007-08-02 | 2009-04-30 | Novimmune S.A. | Anti-rantes antibodies and methods of use thereof |
EP2537529A1 (en) | 2007-08-02 | 2012-12-26 | Gilead Biologics, Inc. | Lox and loxl2 inhibitors antibodies and uses thereof |
US9243067B2 (en) | 2007-08-29 | 2016-01-26 | Sanofi | Humanized anti-CXCR5 antibodies, derivatives thereof and their use |
US9228019B2 (en) | 2007-08-29 | 2016-01-05 | Sanofi | Humanized anti-CXCR5 antibodies, derivatives thereof and their use |
US9175087B2 (en) | 2007-08-29 | 2015-11-03 | Sanofi | Humanized anti-CXCR5 antibodies, derivatives thereof and their use |
US8980262B2 (en) | 2007-08-29 | 2015-03-17 | Sanofi | Humanized anti-CXCR5 antibodies, derivatives thereof and their use |
US9815902B2 (en) | 2007-08-29 | 2017-11-14 | Sanofi | Humanized anti-CXCR5 antibodies, derivatives thereof and their uses |
US8647622B2 (en) | 2007-08-29 | 2014-02-11 | Sanofi | Humanized anti-CXCR5 antibodies, derivatives thereof and their use |
US11332533B2 (en) | 2007-09-26 | 2022-05-17 | Chugai Seiyaku Kabushiki Kaisha | Modified antibody constant region |
WO2009044208A1 (en) | 2007-10-03 | 2009-04-09 | Oxford Genome Sciences (Uk) Limited | Protein |
EP2573116A1 (en) | 2007-10-15 | 2013-03-27 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
EP2574626A1 (en) | 2007-10-15 | 2013-04-03 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
US10759871B2 (en) | 2007-10-15 | 2020-09-01 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
US8388965B2 (en) | 2007-10-15 | 2013-03-05 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
EP2574630A1 (en) | 2007-10-15 | 2013-04-03 | Sanofi | Antibodies that bind il-4 and/or il-13 and their uses |
US9738728B2 (en) | 2007-10-15 | 2017-08-22 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
US9732162B2 (en) | 2007-10-15 | 2017-08-15 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
EP2573115A1 (en) | 2007-10-15 | 2013-03-27 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
EP2574629A1 (en) | 2007-10-15 | 2013-04-03 | Sanofi | Antibodies that bind il-4 and/or il-13 and their uses |
WO2009052081A2 (en) | 2007-10-15 | 2009-04-23 | Sanofi-Aventis | Antibodies that bind il-4 and/or il-13 and their uses |
EP2573118A1 (en) | 2007-10-15 | 2013-03-27 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
EP3686220A1 (en) | 2007-10-15 | 2020-07-29 | Sanofi | Antibodies that bind il-4 and/or il-13 and their uses |
EP2573117A1 (en) | 2007-10-15 | 2013-03-27 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
EP2573119A1 (en) | 2007-10-15 | 2013-03-27 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
EP2573121A1 (en) | 2007-10-15 | 2013-03-27 | Sanofi | Antibodies that bind il-4 and/or il-13 and their uses |
US11453727B2 (en) | 2007-10-15 | 2022-09-27 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
EP2233149A1 (en) | 2007-10-16 | 2010-09-29 | ZymoGenetics, Inc. | Combination of BLYS inhibition and anti-CD20 agents for treatment of autoimmune disease |
WO2009052431A2 (en) | 2007-10-19 | 2009-04-23 | Seattle Genetics, Inc. | Cd19 binding agents and uses thereof |
EP3360567A1 (en) | 2007-11-07 | 2018-08-15 | Genentech, Inc. | Amp for use in treating microbial disorders |
US8460671B2 (en) | 2007-11-12 | 2013-06-11 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of influenza |
US8114402B2 (en) | 2007-11-12 | 2012-02-14 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of influenza |
US8057796B2 (en) | 2007-11-12 | 2011-11-15 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of influenza |
EP2261367A2 (en) | 2007-11-29 | 2010-12-15 | Genentech, Inc. | Gene expression markers for inflammatory bowel disease |
EP2851372A1 (en) | 2007-11-30 | 2015-03-25 | Genentech, Inc. | Anti-VEGF antibodies |
EP2641919A2 (en) | 2007-11-30 | 2013-09-25 | Glaxo Group Limited | Antigen-binding constructs |
EP3189831A1 (en) | 2007-11-30 | 2017-07-12 | AbbVie Biotechnology Ltd | Protein formulations and methods of making same |
EP2615115A2 (en) | 2007-11-30 | 2013-07-17 | Glaxo Group Limited | Antigen-binding constructs |
EP3173425A1 (en) | 2007-11-30 | 2017-05-31 | Genentech, Inc. | Anti-vegf antibodies |
DE112008003232T5 (en) | 2007-11-30 | 2011-02-24 | Glaxo Group Limited, Greenford | Antigen-binding constructs |
WO2009068649A2 (en) | 2007-11-30 | 2009-06-04 | Glaxo Group Limited | Antigen-binding constructs |
EP2573563A1 (en) | 2007-12-20 | 2013-03-27 | Heptares Therapeutics Limited | Screening |
US10215754B2 (en) | 2007-12-27 | 2019-02-26 | Abbott Laboratories | Anti-T. cruzi antibodies and methods of use |
US9482667B2 (en) | 2007-12-27 | 2016-11-01 | Abbott Laboratories | Anti-T. cruzi antibodies and methods of use |
US9073984B2 (en) | 2007-12-27 | 2015-07-07 | Abbott Laboratories | Anti-T. cruzi antibodies and methods of use |
EP3693470A1 (en) | 2007-12-28 | 2020-08-12 | Prothena Therapeutics Limited | Treatment and prophylaxis of amyloidosis |
EP2730659A2 (en) | 2007-12-28 | 2014-05-14 | Elan Pharmaceuticals Inc. | Treatment and Prophylaxis of Amyloidosis |
WO2009086539A2 (en) | 2007-12-28 | 2009-07-09 | Elan Pharmaceuticals, Inc. | Treatment and prophylaxis of amyloidosis |
EP3043181A1 (en) | 2008-01-15 | 2016-07-13 | The Board of Trustees of The Leland Stanford Junior University | Markers of acute myeloid leukemia stem cells |
EP3722317A1 (en) | 2008-01-15 | 2020-10-14 | The Board of Trustees of the Leland Stanford Junior University | Markers of acute myeloid leukemia stem cells |
EP4160212A1 (en) | 2008-01-15 | 2023-04-05 | The Board of Trustees of the Leland Stanford Junior University | Markers of acute myeloid leukemia stem cells |
EP4119583A1 (en) | 2008-01-30 | 2023-01-18 | Genentech, Inc. | Composition comprising antibody that binds to domain ii of her2 and acidic variants thereof |
EP3401335A1 (en) | 2008-01-30 | 2018-11-14 | Genentech, Inc. | Composition comprising antibody that binds to domain ii of her2 and acidic variants thereof |
EP2657253A2 (en) | 2008-01-31 | 2013-10-30 | Genentech, Inc. | Anti-CD79b antibodies and immunoconjugates and methods of use |
EP2618146A2 (en) | 2008-02-25 | 2013-07-24 | Nestec S.A. | Drug selection for breast cancer therapy using antibody-based arrays |
EP2602623A2 (en) | 2008-02-25 | 2013-06-12 | Nestec S.A. | Mehtod for the detection of intracellular truncated receptors |
US7982012B2 (en) | 2008-03-10 | 2011-07-19 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of cytomegalovirus |
US8268309B2 (en) | 2008-03-10 | 2012-09-18 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of cytomegalovirus |
US8852594B2 (en) | 2008-03-10 | 2014-10-07 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of cytomegalovirus infections |
EP3045475A1 (en) | 2008-04-02 | 2016-07-20 | MacroGenics, Inc. | Bcr-complex-specific antibodies and methods of using same |
EP3067063A1 (en) | 2008-04-02 | 2016-09-14 | MacroGenics, Inc. | Her2/neu-specific antibodies and methods of using same |
WO2009123894A2 (en) | 2008-04-02 | 2009-10-08 | Macrogenics, Inc. | Her2/neu-specific antibodies and methods of using same |
WO2009151717A2 (en) | 2008-04-02 | 2009-12-17 | Macrogenics, Inc. | Bcr-complex-specific antibodies and methods of using same |
EP3605088A1 (en) | 2008-04-09 | 2020-02-05 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP3208612A1 (en) | 2008-04-09 | 2017-08-23 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
EP2975048A2 (en) | 2008-04-23 | 2016-01-20 | UCB Biopharma SPRL | Epitopes of il-17a and il-17f and antibodies specific thereto |
US11319526B2 (en) | 2008-05-02 | 2022-05-03 | Seagen Inc. | Methods and compositions for making antibodies and antibody derivatives with reduced core fucosylation |
WO2010033279A2 (en) | 2008-06-04 | 2010-03-25 | Macrogenics, Inc. | Antibodies with altered binding to fcrn and methods of using same |
US8999702B2 (en) | 2008-06-11 | 2015-04-07 | Emd Millipore Corporation | Stirred tank bioreactor |
US10274488B2 (en) | 2008-07-15 | 2019-04-30 | Academia Sinica | Glycan arrays on PTFE-like aluminum coated glass slides and related methods |
KR20160116056A (en) | 2008-08-14 | 2016-10-06 | 테바 파마슈티컬즈 오스트레일리아 피티와이 엘티디 | Anti-il-12/il-23 antibodies |
EP3211008A1 (en) | 2008-08-29 | 2017-08-30 | F. Hoffmann-La Roche AG | Cross-reactive and bispecific anti-il-17a/f antibodies |
WO2010027364A1 (en) | 2008-09-07 | 2010-03-11 | Glyconex Inc. | Anti-extended type i glycosphingolipid antibody, derivatives thereof and use |
WO2010030813A2 (en) | 2008-09-10 | 2010-03-18 | Genentech, Inc. | Methods for inhibiting ocular angiogenesis |
EP3747464A1 (en) | 2008-09-16 | 2020-12-09 | F. Hoffmann-La Roche AG | Methods for treating progessive multiple sclerosis using an anti-cd20 antibody |
EP3095463A2 (en) | 2008-09-16 | 2016-11-23 | F. Hoffmann-La Roche AG | Methods for treating progressive multiple sclerosis |
WO2010042562A2 (en) | 2008-10-06 | 2010-04-15 | Minerva Biotechnologies Corporation | Muc1* antibodies |
EP4083072A1 (en) | 2008-10-06 | 2022-11-02 | Minerva Biotechnologies Corporation | Muc1* antibodies |
US11560435B2 (en) | 2008-10-06 | 2023-01-24 | Minerva Biotechnologies Corporation | MUC1* antibodies |
EP3130607A2 (en) | 2008-10-06 | 2017-02-15 | Minerva Biotechnologies Corporation | Muc1* antibodies |
EP3524620A1 (en) | 2008-10-14 | 2019-08-14 | Genentech, Inc. | Immunoglobulin variants and uses thereof |
WO2010048446A2 (en) | 2008-10-22 | 2010-04-29 | Genentech, Inc. | Modulation of axon degeneration |
US8894999B2 (en) | 2008-11-25 | 2014-11-25 | Biogen Idec Ma Inc. | Use of DR6 and p75 antagonists to promote survival of cells of the nervous system |
US8501178B2 (en) | 2008-11-25 | 2013-08-06 | Biogen Idec Ma Inc. | Use of DR6 and p75 antagonists to promote survival of cells of the nervous system |
US8491905B2 (en) | 2008-11-26 | 2013-07-23 | Allergan, Inc. | KLK-13 antibody inhibitor for treating dry eye |
US8211434B2 (en) | 2008-11-26 | 2012-07-03 | Allergan, Inc. | KLK-13 antibody inhibitor for treating dry eye |
US8821874B2 (en) | 2008-11-26 | 2014-09-02 | Allergan, Inc. | KLK-13 antibody inhibitor for treating dry eye |
EP3929216A1 (en) | 2008-12-09 | 2021-12-29 | F. Hoffmann-La Roche AG | Anti-pd-l1 antibodies and their use to enhance t-cell function |
EP4331604A2 (en) | 2008-12-09 | 2024-03-06 | F. Hoffmann-La Roche AG | Anti-pd-l1 antibodies and their use to enhance t-cell function |
EP4169951A1 (en) | 2008-12-09 | 2023-04-26 | F. Hoffmann-La Roche AG | Anti-pd-l1 antibodies and their use to enhance t-cell function |
EP3447073A1 (en) | 2008-12-09 | 2019-02-27 | F. Hoffmann-La Roche AG | Anti-pd-l1 antibodies and their use to enhance t-cell function |
EP4209510A1 (en) | 2008-12-09 | 2023-07-12 | F. Hoffmann-La Roche AG | Anti-pd-l1 antibodies and their use to enhance t-cell function |
EP3255060A1 (en) | 2008-12-09 | 2017-12-13 | F. Hoffmann-La Roche AG | Anti-pd-l1 antibodies and their use to enhance t-cell function |
WO2010077634A1 (en) | 2008-12-09 | 2010-07-08 | Genentech, Inc. | Anti-pd-l1 antibodies and their use to enhance t-cell function |
WO2010074702A1 (en) | 2008-12-16 | 2010-07-01 | Millipore Corporation | Purification of proteins |
US9803165B2 (en) | 2008-12-16 | 2017-10-31 | Emd Millipore Corporation | Stirred tank reactor and method |
WO2010080528A1 (en) | 2008-12-17 | 2010-07-15 | Genentech, Inc. | Hepatitis c virus combination therapy |
WO2010070094A1 (en) | 2008-12-19 | 2010-06-24 | Glaxo Group Limited | Myostatin binding proteins |
WO2010075249A2 (en) | 2008-12-22 | 2010-07-01 | Genentech, Inc. | A method for treating rheumatoid arthritis with b-cell antagonists |
EP3318573A1 (en) | 2008-12-23 | 2018-05-09 | F. Hoffmann-La Roche AG | Mmunoglobulin variants with altered binding to protein a |
WO2010075548A2 (en) | 2008-12-23 | 2010-07-01 | Genentech, Inc. | Immunoglobulin variants with altered binding to protein a |
WO2010084408A2 (en) | 2009-01-21 | 2010-07-29 | Oxford Biotherapeutics Ltd. | Pta089 protein |
WO2010097386A1 (en) | 2009-02-24 | 2010-09-02 | Glaxo Group Limited | Antigen-binding constructs |
WO2010097394A1 (en) | 2009-02-24 | 2010-09-02 | Glaxo Group Limited | Multivalent and/or multispecific rankl-binding constructs |
WO2010097385A1 (en) | 2009-02-24 | 2010-09-02 | Glaxo Group Limited | Antigen-binding constructs |
EP3323427A1 (en) | 2009-03-17 | 2018-05-23 | Theraclone Sciences, Inc. | Human immunodeficiency virus (hiv)-neutralizing antibodies |
EP3260136A1 (en) | 2009-03-17 | 2017-12-27 | Theraclone Sciences, Inc. | Human immunodeficiency virus (hiv) -neutralizing antibodies |
EP4085925A1 (en) | 2009-03-17 | 2022-11-09 | International AIDS Vaccine Initiative | Human immunodeficiency virus (hiv)-neutralizing antibodies |
US9161977B2 (en) | 2009-03-25 | 2015-10-20 | F. Hoffmann-La Roche Ag | Anti-FGFR3 antibodies and methods using same |
US11401333B2 (en) | 2009-03-25 | 2022-08-02 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
WO2010111254A1 (en) | 2009-03-25 | 2010-09-30 | Genentech, Inc. | Novel anti-alpha5beta1 antibodies and uses thereof |
US8710189B2 (en) | 2009-03-25 | 2014-04-29 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
US8410250B2 (en) | 2009-03-25 | 2013-04-02 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
WO2010111367A1 (en) | 2009-03-25 | 2010-09-30 | Genentech, Inc. | Anti-fgfr3 antibodies and methods using same |
US9499623B2 (en) | 2009-03-25 | 2016-11-22 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
US10000571B2 (en) | 2009-03-25 | 2018-06-19 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
US10287356B2 (en) | 2009-03-25 | 2019-05-14 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
EP2679600A1 (en) | 2009-03-25 | 2014-01-01 | Genentech, Inc. | Anti-FGFR3 antibodies and methods using same |
WO2010120561A1 (en) | 2009-04-01 | 2010-10-21 | Genentech, Inc. | Anti-fcrh5 antibodies and immunoconjugates and methods of use |
WO2010114859A1 (en) | 2009-04-01 | 2010-10-07 | Genentech, Inc. | Treatment of insulin-resistant disorders |
WO2010118243A2 (en) | 2009-04-08 | 2010-10-14 | Genentech, Inc. | Use of il-27 antagonists to treat lupus |
US8609101B2 (en) | 2009-04-23 | 2013-12-17 | Theraclone Sciences, Inc. | Granulocyte-macrophage colony-stimulating factor (GM-CSF) neutralizing antibodies |
WO2010128407A2 (en) | 2009-05-05 | 2010-11-11 | Novimmune S.A. | Anti-il-17f antibodies and methods of use thereof |
US8858948B2 (en) | 2009-05-20 | 2014-10-14 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of influenza |
WO2011005715A1 (en) | 2009-07-07 | 2011-01-13 | Genentech, Inc. | Diagnosis and treatment of autoimmune demyelinating diseases |
WO2011008990A1 (en) | 2009-07-15 | 2011-01-20 | Prometheus Laboratories Inc. | Drug selection for gastric cancer therapy using antibody-based arrays |
EP2584049A2 (en) | 2009-07-20 | 2013-04-24 | Genentech, Inc. | Gene expression markers for Crohn's disease |
WO2011011339A1 (en) | 2009-07-20 | 2011-01-27 | Genentech, Inc. | Gene expression markers for crohn's disease |
EP2757160A2 (en) | 2009-07-20 | 2014-07-23 | Genentech, Inc. | Gene expression markers for Crohn's disease |
WO2011014457A1 (en) | 2009-07-27 | 2011-02-03 | Genentech, Inc. | Combination treatments |
WO2011014750A1 (en) | 2009-07-31 | 2011-02-03 | Genentech, Inc. | Inhibition of tumor metastasis using bv8- or g-csf-antagonists |
US10662237B2 (en) | 2009-08-06 | 2020-05-26 | Genentech, Inc. | Method to improve virus filtration capacity |
WO2011031397A1 (en) | 2009-08-06 | 2011-03-17 | Genentech, Inc. | Method to improve virus removal in protein purification |
EP3309168A1 (en) | 2009-08-06 | 2018-04-18 | F. Hoffmann-La Roche AG | Method to improve virus removal in protein purification |
US11225513B2 (en) | 2009-08-06 | 2022-01-18 | Genentech, Inc. | Method to improve virus filtration capacity |
WO2011019620A1 (en) | 2009-08-10 | 2011-02-17 | Genentech, Inc. | Antibodies with enhanced adcc function |
WO2011019679A1 (en) | 2009-08-11 | 2011-02-17 | Allergan, Inc. | Ccr2 inhibitors for treating conditions of the eye |
WO2011019619A1 (en) | 2009-08-11 | 2011-02-17 | Genentech, Inc. | Production of proteins in glutamine-free cell culture media |
EP3760712A1 (en) | 2009-08-11 | 2021-01-06 | F. Hoffmann-La Roche AG | Production of proteins in glutamine-free cell culture media |
WO2011019622A1 (en) | 2009-08-14 | 2011-02-17 | Genentech, Inc. | Cell culture methods to make antibodies with enhanced adcc function |
WO2011028753A1 (en) | 2009-09-01 | 2011-03-10 | Genentech, Inc. | Enhanced protein purification through a modified protein a elution |
US9428548B2 (en) | 2009-09-01 | 2016-08-30 | Genentech, Inc. | Enhanced protein purification through a modified protein A elution |
EP3736338A1 (en) | 2009-09-01 | 2020-11-11 | F. Hoffmann-La Roche AG | Enhanced protein purification through a modified protein a elution |
WO2011028950A1 (en) | 2009-09-02 | 2011-03-10 | Genentech, Inc. | Mutant smoothened and methods of using the same |
US9096877B2 (en) | 2009-10-07 | 2015-08-04 | Macrogenics, Inc. | Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use |
WO2011044368A1 (en) | 2009-10-07 | 2011-04-14 | Macrogenics, Inc. | Fc region-containing polypeptides that exhibit improved effector function due to alterations of the extent of fucosylation, and methods for their use |
US8535912B2 (en) | 2009-10-15 | 2013-09-17 | Genentech, Inc. | Chimeric fibroblast growth factors with altered receptor specificity |
WO2011050069A1 (en) | 2009-10-20 | 2011-04-28 | Prometheus Laboratories Inc. | Proximity-mediated assays for detecting oncogenic fusion proteins |
WO2011050194A1 (en) | 2009-10-22 | 2011-04-28 | Genentech, Inc. | Methods and compositions for modulating hepsin activation of macrophage-stimulating protein |
WO2011050188A1 (en) | 2009-10-22 | 2011-04-28 | Genentech, Inc. | Anti-hepsin antibodies and methods using same |
EP3011970A2 (en) | 2009-10-22 | 2016-04-27 | F. Hoffmann-La Roche AG | Modulation of axon degeneration |
US8697386B2 (en) | 2009-10-22 | 2014-04-15 | Genentech, Inc. | Methods and compositions for modulating hepsin activation of macrophage-stimulating protein |
WO2011056494A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Activin receptor-like kinase-1 antagonist and vegfr3 antagonist combinations |
WO2011056497A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Activin receptor type iib compositions and methods of use |
WO2011056502A1 (en) | 2009-10-26 | 2011-05-12 | Genentech, Inc. | Bone morphogenetic protein receptor type ii compositions and methods of use |
WO2011054007A1 (en) | 2009-11-02 | 2011-05-05 | Oxford Biotherapeutics Ltd. | Ror1 as therapeutic and diagnostic target |
WO2011054820A1 (en) | 2009-11-03 | 2011-05-12 | Universidad Del País Vasco | Methods and compositions for the treatment of white matter ischemia |
EP2322149A1 (en) | 2009-11-03 | 2011-05-18 | Universidad del Pais Vasco | Methods and compositions for the treatment of ischemia |
WO2011057120A1 (en) | 2009-11-05 | 2011-05-12 | Genentech, Inc. | Methods and composition for secretion of heterologous polypeptides |
WO2011060246A2 (en) | 2009-11-12 | 2011-05-19 | Genentech, Inc. | A method of promoting dendritic spine density |
EP3348277A1 (en) | 2009-11-20 | 2018-07-18 | The Regents of The University of California | Epithelial membrane protein-2 (emp2) and proliferative vitreoretinopathy (pvr) |
WO2011066503A2 (en) | 2009-11-30 | 2011-06-03 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP3002297A2 (en) | 2009-11-30 | 2016-04-06 | F. Hoffmann-La Roche AG | Antibodies for treating and diagnosing tumors expressing slc34a2 (tat211) |
US10087236B2 (en) | 2009-12-02 | 2018-10-02 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
US11377485B2 (en) | 2009-12-02 | 2022-07-05 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
US11267870B2 (en) | 2009-12-02 | 2022-03-08 | Academia Sinica | Methods for modifying human antibodies by glycan engineering |
WO2011071577A1 (en) | 2009-12-11 | 2011-06-16 | Genentech, Inc. | Anti-vegf-c antibodies and methods using same |
WO2011080050A2 (en) | 2009-12-11 | 2011-07-07 | Novartis Ag | Binding molecules |
EP3616719A1 (en) | 2009-12-21 | 2020-03-04 | F. Hoffmann-La Roche AG | Antibody formulation |
WO2011084750A1 (en) | 2009-12-21 | 2011-07-14 | Genentech, Inc. | Antibody formulation |
US9266948B2 (en) | 2009-12-23 | 2016-02-23 | Genentech, Inc. | Anti-Bv8 antibodies and uses thereof |
WO2011079185A1 (en) | 2009-12-23 | 2011-06-30 | Genentech, Inc. | Anti-bv8 antibodies and uses thereof |
EP2338492A1 (en) | 2009-12-24 | 2011-06-29 | Universidad del Pais Vasco | Methods and compositions for the treatment of alzheimer |
WO2011076946A2 (en) | 2009-12-24 | 2011-06-30 | Universidad Del País Vasco | Methods and compositions for the treatment of alzheimer |
EP3450459A2 (en) | 2009-12-28 | 2019-03-06 | OncoTherapy Science, Inc. | Anti-cdh3 antibodies and uses thereof |
WO2011082187A1 (en) | 2009-12-30 | 2011-07-07 | Genentech, Inc. | Methods for modulating a pdgf-aa mediated biological response |
WO2011094259A2 (en) | 2010-01-28 | 2011-08-04 | Glaxo Group Limited | Cd127 binding proteins |
WO2011094759A2 (en) | 2010-02-01 | 2011-08-04 | The Regents Of The University Of California | Novel diagnostic and therapeutic targets associated with or regulated by n-cadherin expression and/or epithelial to mesenchymal transition (emt) in prostate cancer and other malignancies |
WO2011095506A1 (en) | 2010-02-03 | 2011-08-11 | Ucb Pharma, S.A. | Process for obtaining antibodies |
WO2011100403A1 (en) | 2010-02-10 | 2011-08-18 | Immunogen, Inc | Cd20 antibodies and uses thereof |
WO2011103242A1 (en) | 2010-02-18 | 2011-08-25 | Genentech, Inc. | Neuregulin antagonists and use thereof in treating cancer |
EP4219560A2 (en) | 2010-02-18 | 2023-08-02 | The Regents of The University of California | Integrin alpha v beta 8 neutralizing antibody |
WO2011106297A2 (en) | 2010-02-23 | 2011-09-01 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
EP3025729A1 (en) | 2010-03-03 | 2016-06-01 | Glaxo Group Limited | Antigen binding proteins specific for serum amyloid p component |
WO2011107480A1 (en) | 2010-03-03 | 2011-09-09 | Glaxo Group Limited | Antigen binding proteins specific for serum amyloid p component |
WO2011119661A1 (en) | 2010-03-24 | 2011-09-29 | Genentech, Inc. | Anti-lrp6 antibodies |
WO2011119888A2 (en) | 2010-03-24 | 2011-09-29 | The Regents Of The University Of California | N-cadherin: target for cancer diagnosis and therapy |
US10745467B2 (en) | 2010-03-26 | 2020-08-18 | The Trustees Of Dartmouth College | VISTA-Ig for treatment of autoimmune, allergic and inflammatory disorders |
US10781254B2 (en) | 2010-03-26 | 2020-09-22 | The Trustees Of Dartmouth College | VISTA regulatory T cell mediator protein, VISTA binding agents and use thereof |
WO2011123507A1 (en) | 2010-03-30 | 2011-10-06 | Centocor Ortho Biotech Inc. | Humanized il-25 antibodies |
WO2011136911A2 (en) | 2010-04-09 | 2011-11-03 | Aveo Pharmaceuticals, Inc. | Anti-erbb3 antibodies |
US10338069B2 (en) | 2010-04-12 | 2019-07-02 | Academia Sinica | Glycan arrays for high throughput screening of viruses |
WO2011133931A1 (en) | 2010-04-22 | 2011-10-27 | Genentech, Inc. | Use of il-27 antagonists for treating inflammatory bowel disease |
WO2011139985A1 (en) | 2010-05-03 | 2011-11-10 | Genentech, Inc. | Compositions and methods for the diagnosis and treatment of tumor |
WO2011139718A1 (en) | 2010-05-03 | 2011-11-10 | Genentech, Inc. | Compositions and methods useful for reducing the viscosity of protein-containing formulations |
US9403855B2 (en) | 2010-05-10 | 2016-08-02 | Academia Sinica | Zanamivir phosphonate congeners with anti-influenza activity and determining oseltamivir susceptibility of influenza viruses |
US9874562B2 (en) | 2010-05-10 | 2018-01-23 | Academia Sinica | Zanamivir phosphonate congeners with anti-influenza activity and determining oseltamivir susceptibility of influenza viruses |
US8691918B2 (en) | 2010-05-17 | 2014-04-08 | Emd Millipore Corporation | Stimulus responsive polymers for the purification of biomolecules |
US9731288B2 (en) | 2010-05-17 | 2017-08-15 | Emd Millipore Corporation | Stimulus responsive polymers for the purification of biomolecules |
US9217048B2 (en) | 2010-05-17 | 2015-12-22 | Emd Millipore Corporation | Stimulus responsive polymers for the purification of biomolecules |
WO2011146568A1 (en) | 2010-05-19 | 2011-11-24 | Genentech, Inc. | Predicting response to a her inhibitor |
EP3299380A1 (en) | 2010-05-25 | 2018-03-28 | F. Hoffmann-La Roche AG | Methods of purifying polypeptides |
WO2011150110A1 (en) | 2010-05-25 | 2011-12-01 | Genentech, Inc. | Methods of purifying polypeptides |
WO2011147834A1 (en) | 2010-05-26 | 2011-12-01 | Roche Glycart Ag | Antibodies against cd19 and uses thereof |
US10011856B2 (en) | 2010-05-28 | 2018-07-03 | Genentech, Inc. | Decreasing lactate level and increasing polypeptide production by downregulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase |
WO2011150241A2 (en) | 2010-05-28 | 2011-12-01 | Genentech, Inc. | Decreasing lactate level and increasing polypeptide production by downregulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase |
US9487809B2 (en) | 2010-05-28 | 2016-11-08 | Genentech, Inc. | Decreasing lactate level and increasing polypeptide production by downregulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase |
US11046987B2 (en) | 2010-05-28 | 2021-06-29 | Genentech, Inc. | Decreasing lactate level and increasing polypeptide production by downregulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase |
US10704071B2 (en) | 2010-05-28 | 2020-07-07 | Genentech, Inc. | Decreasing lactate level and increasing polypeptide production by down regulating the expression of lactate dehydrogenase and pyruvate dehydrogenase kinase |
WO2011153346A1 (en) | 2010-06-03 | 2011-12-08 | Genentech, Inc. | Immuno-pet imaging of antibodies and immunoconjugates and uses therefor |
US8771966B2 (en) | 2010-06-03 | 2014-07-08 | Genentech, Inc. | Immuno-PET imaging of antibodies and immunoconjugates and uses therefor |
WO2011151432A1 (en) | 2010-06-03 | 2011-12-08 | Glaxo Group Limited | Humanised antigen binding proteins to myostatin6 |
WO2011159655A2 (en) | 2010-06-16 | 2011-12-22 | Allergan, Inc. | IL23p19 ANTIBODY INHIBITOR FOR TREATING OCULAR AND OTHER CONDITIONS |
USRE47761E1 (en) | 2010-06-18 | 2019-12-10 | Genentech, Inc. | Anti-axl antibodies and methods of use |
EP3098240A2 (en) | 2010-06-18 | 2016-11-30 | F. Hoffmann-La Roche AG | Anti-axl antibodies and methods of use |
US8853369B2 (en) | 2010-06-18 | 2014-10-07 | Genentech, Inc. | Anti-Axl antibodies and methods of use |
EP3323830A1 (en) | 2010-06-19 | 2018-05-23 | Memorial Sloan-Kettering Cancer Center | Anti-gd2 antibodies |
EP4269563A2 (en) | 2010-06-19 | 2023-11-01 | Memorial Sloan-Kettering Cancer Center | Anti-gd2 antibodies |
WO2011161119A1 (en) | 2010-06-22 | 2011-12-29 | F. Hoffmann-La Roche Ag | Antibodies against insulin-like growth factor i receptor and uses thereof |
WO2011161189A1 (en) | 2010-06-24 | 2011-12-29 | F. Hoffmann-La Roche Ag | Anti-hepsin antibodies and methods of use |
US9133524B2 (en) | 2010-07-01 | 2015-09-15 | The Regents Of The University Of California | Protein kinase ck2 gene mutations, amplifications and polymorphisms in human cancers and methods of use |
WO2012006503A1 (en) | 2010-07-09 | 2012-01-12 | Genentech, Inc. | Anti-neuropilin antibodies and methods of use |
EP2848939A1 (en) | 2010-07-19 | 2015-03-18 | F. Hoffmann-La Roche AG | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
EP2866032A1 (en) | 2010-07-19 | 2015-04-29 | F. Hoffmann-La Roche AG | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
EP2824457A1 (en) | 2010-07-19 | 2015-01-14 | F. Hoffmann-La Roche AG | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
EP2848940A1 (en) | 2010-07-19 | 2015-03-18 | F. Hoffmann-La Roche AG | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
WO2012010548A1 (en) | 2010-07-19 | 2012-01-26 | F. Hoffmann-La Roche Ag | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
EP2801826A1 (en) | 2010-07-19 | 2014-11-12 | F. Hoffmann-La Roche AG | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
WO2012010547A1 (en) | 2010-07-19 | 2012-01-26 | F. Hoffmann-La Roche Ag | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
WO2012010549A1 (en) | 2010-07-19 | 2012-01-26 | F. Hoffmann-La Roche Ag | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
WO2012010550A1 (en) | 2010-07-19 | 2012-01-26 | F. Hoffmann-La Roche Ag | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
WO2012010551A1 (en) | 2010-07-19 | 2012-01-26 | F. Hoffmann-La Roche Ag | Method to identify a patient with an increased likelihood of responding to an anti-cancer therapy |
WO2012010582A1 (en) | 2010-07-21 | 2012-01-26 | Roche Glycart Ag | Anti-cxcr5 antibodies and methods of use |
WO2012013930A2 (en) | 2010-07-27 | 2012-02-02 | Ucb Pharma S.A. | Process for purifying proteins |
WO2012018771A1 (en) | 2010-08-03 | 2012-02-09 | Genentech, Inc. | Chronic lymphocytic leukemia (cll) biomarkers |
WO2012017003A1 (en) | 2010-08-05 | 2012-02-09 | F. Hoffmann-La Roche Ag | Anti-mhc antibody anti-viral cytokine fusion protein |
US8900590B2 (en) | 2010-08-12 | 2014-12-02 | Theraclone Sciences, Inc. | Anti-hemagglutinin antibody compositions and methods of use thereof |
WO2012020072A1 (en) | 2010-08-12 | 2012-02-16 | Westfälische Wilhelms-Universität Muenster | Anti-syndecan-4 antibodies |
WO2012020006A2 (en) | 2010-08-13 | 2012-02-16 | Roche Glycart Ag | Anti-fap antibodies and methods of use |
EP2420250A1 (en) | 2010-08-13 | 2012-02-22 | Universitätsklinikum Münster | Anti-Syndecan-4 antibodies |
WO2012020038A1 (en) | 2010-08-13 | 2012-02-16 | Roche Glycart Ag | Anti-tenascin-c a2 antibodies and methods of use |
WO2012021773A1 (en) | 2010-08-13 | 2012-02-16 | Genentech, Inc. | Antibodies to il-1beta and il-18, for treatment of disease |
EP3333194A1 (en) | 2010-08-13 | 2018-06-13 | Roche Glycart AG | Anti-fap antibodies and methods of use |
WO2012022734A2 (en) | 2010-08-16 | 2012-02-23 | Medimmune Limited | Anti-icam-1 antibodies and methods of use |
US8883975B2 (en) | 2010-08-25 | 2014-11-11 | Hoffmann-La Roche, Inc. | Antibodies against IL-18R1 and uses thereof |
WO2012025536A1 (en) | 2010-08-25 | 2012-03-01 | F. Hoffmann-La Roche Ag | Antibodies against il-18r1 and uses thereof |
EP3264089A1 (en) | 2010-08-31 | 2018-01-03 | Genentech, Inc. | Biomarkers and methods of treatment |
EP3556396A1 (en) | 2010-08-31 | 2019-10-23 | Theraclone Science, Int. | Human immunodeficiency virus (hiv)-neutralizing antibodies |
EP4085924A1 (en) | 2010-08-31 | 2022-11-09 | Theraclone Sciences, Inc. | Human immunodeficiency virus (hiv)-neutralizing antibodies |
WO2012031027A1 (en) | 2010-08-31 | 2012-03-08 | Genentech, Inc. | Biomarkers and methods of treatment |
EP2926830A2 (en) | 2010-08-31 | 2015-10-07 | Theraclone Sciences, Inc. | Human immunodeficiency virus (HIV)-neutralizing antibodies |
EP4226935A2 (en) | 2010-08-31 | 2023-08-16 | Theraclone Sciences, Inc. | Human immunodeficiency virus (hiv)-neutralizing antibodies |
WO2012047968A2 (en) | 2010-10-05 | 2012-04-12 | Genentech, Inc. | Mutant smoothened and methods of using the same |
WO2012061129A1 (en) | 2010-10-25 | 2012-05-10 | Genentech, Inc | Treatment of gastrointestinal inflammation and psoriasis a |
EP3214442A1 (en) | 2010-10-25 | 2017-09-06 | F. Hoffmann-La Roche AG | Treatment of gastrointestinal inflammation and psoriasis and asthmainflammation and psoriasis a |
WO2012058768A1 (en) | 2010-11-05 | 2012-05-10 | Zymeworks Inc. | Stable heterodimeric antibody design with mutations in the fc domain |
WO2012058726A1 (en) | 2010-11-05 | 2012-05-10 | Transbio Ltd | Markers of endothelial progenitor cells and uses thereof |
US9562109B2 (en) | 2010-11-05 | 2017-02-07 | Zymeworks Inc. | Stable heterodimeric antibody design with mutations in the Fc domain |
US10875931B2 (en) | 2010-11-05 | 2020-12-29 | Zymeworks, Inc. | Stable heterodimeric antibody design with mutations in the Fc domain |
WO2012064836A1 (en) | 2010-11-10 | 2012-05-18 | Genentech, Inc. | Methods and compositions for neural disease immunotherapy |
EP3176184A1 (en) | 2010-11-10 | 2017-06-07 | F. Hoffmann-La Roche AG | Methods and compositions for neural disease immunotherapy |
WO2012099566A1 (en) | 2010-11-17 | 2012-07-26 | Sea Lane Biotechnologies, Llc | Influenza virus neutralizing agents that mimic the binding site of an influenza neutralizing antibody |
EP2853542A1 (en) | 2010-11-24 | 2015-04-01 | Glaxo Group Limited | Multispecific antigen binding proteins targeting HGF |
WO2012071436A1 (en) | 2010-11-24 | 2012-05-31 | Genentech, Inc. | Method of treating autoimmune inflammatory disorders using il-23r loss-of-function mutants |
WO2012069557A1 (en) | 2010-11-24 | 2012-05-31 | Glaxo Group Limited | Multispecific antigen binding proteins targeting hgf |
WO2012075037A1 (en) | 2010-11-30 | 2012-06-07 | Genentech, Inc. | Low affinity blood brain barrier receptor antibodies and uses therefor |
EP3208282A1 (en) | 2010-11-30 | 2017-08-23 | F. Hoffmann-La Roche AG | Low affinity anti transferrin receptor and their use to transfer therapeutic scfv across the blood brain barrier |
EP3447491A2 (en) | 2010-12-16 | 2019-02-27 | F. Hoffmann-La Roche AG | Diagnosis and treatments relating to th2 inhibition |
US9684000B2 (en) | 2010-12-16 | 2017-06-20 | Genentech, Inc. | Diagnosis and treatments relating to TH2 inhibition |
US9995755B2 (en) | 2010-12-16 | 2018-06-12 | Genentech, Inc. | Diagnosis and treatments relating to TH2 inhibition |
US11226341B2 (en) | 2010-12-16 | 2022-01-18 | Genentech, Inc. | Method of treating asthma using an IL-13 antibody |
EP3296321A1 (en) | 2010-12-20 | 2018-03-21 | F. Hoffmann-La Roche AG | Anti-mesothelin antibodies and immunoconjugates |
WO2012087962A2 (en) | 2010-12-20 | 2012-06-28 | Genentech, Inc. | Anti-mesothelin antibodies and immunoconjugates |
WO2012088313A1 (en) | 2010-12-22 | 2012-06-28 | Genentech, Inc. | Anti-pcsk9 antibodies and methods of use |
US11141063B2 (en) | 2010-12-23 | 2021-10-12 | Philips Image Guided Therapy Corporation | Integrated system architectures and methods of use |
WO2012088337A1 (en) | 2010-12-23 | 2012-06-28 | Prometheus Laboratories Inc. | Drug selection for malignant cancer therapy using antibody-based arrays |
WO2012092539A2 (en) | 2010-12-31 | 2012-07-05 | Takeda Pharmaceutical Company Limited | Antibodies to dll4 and uses thereof |
US11040140B2 (en) | 2010-12-31 | 2021-06-22 | Philips Image Guided Therapy Corporation | Deep vein thrombosis therapeutic methods |
WO2012093254A1 (en) | 2011-01-07 | 2012-07-12 | Ucb Pharma S.A. | Lipocalin 2 as a biomarker for il-17 inhibitor therapy efficacy |
US11466324B2 (en) | 2011-01-07 | 2022-10-11 | UCB Biopharma SRL | Lipocalin 2 as a biomarker for IL-17 inhibitor therapy efficacy |
EP3534159A1 (en) | 2011-01-07 | 2019-09-04 | UCB Biopharma SPRL | Lipocalin 2 as a biomarker for il-17 inhibitor therapy efficacy |
US10208349B2 (en) | 2011-01-07 | 2019-02-19 | Ucb Biopharma Sprl | Lipocalin 2 as a biomarker for IL-17 inhibitor therapy efficacy |
US9034600B2 (en) | 2011-01-14 | 2015-05-19 | Ucb Biopharma Sprl | DNA encoding antibody molecules which bind IL-17A and IL-17F |
US9988446B2 (en) | 2011-01-14 | 2018-06-05 | Ucb Biopharma Sprl | Methods of treatment using antibodies which bind IL-17A and IL-17F |
US8580265B2 (en) | 2011-01-14 | 2013-11-12 | Ucb Pharma S.A. | Antibody molecules which bind IL-17A and IL-17F |
EP3219728A1 (en) | 2011-01-14 | 2017-09-20 | UCB Biopharma SPRL | Antibody molecules which bind il-17a and il-17f |
WO2012095662A1 (en) | 2011-01-14 | 2012-07-19 | Ucb Pharma S.A. | Antibody molecules which bind il-17a and il-17f |
US11919950B2 (en) | 2011-01-14 | 2024-03-05 | UCB Biopharma SRL | Expression vector encoding antibody molecule which binds IL-17A and IL-17F |
WO2012100835A1 (en) | 2011-01-28 | 2012-08-02 | Laboratorios Del Dr. Esteve, S.A. | Methods and compositions for the treatment of aids |
US8916160B2 (en) | 2011-02-14 | 2014-12-23 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of influenza |
WO2012119989A2 (en) | 2011-03-04 | 2012-09-13 | Oryzon Genomics, S.A. | Methods and antibodies for the diagnosis and treatment of cancer |
WO2012125614A1 (en) | 2011-03-15 | 2012-09-20 | Theraclone Sciences, Inc. | Compositions and methods for the therapy and diagnosis of influenza |
US11008389B2 (en) | 2011-03-16 | 2021-05-18 | Sanofi | Uses of a dual V region antibody-like protein |
WO2012130831A1 (en) | 2011-03-29 | 2012-10-04 | Roche Glycart Ag | Antibody fc variants |
EP3590965A1 (en) | 2011-03-29 | 2020-01-08 | Roche Glycart AG | Antibody fc variants |
EP3412309A1 (en) | 2011-03-31 | 2018-12-12 | F. Hoffmann-La Roche AG | Methods of administering beta7 integrin antagonists |
WO2012138997A1 (en) | 2011-04-07 | 2012-10-11 | Amgen Inc. | Novel egfr binding proteins |
WO2012138975A1 (en) | 2011-04-07 | 2012-10-11 | Genentech, Inc. | Anti-fgfr4 antibodies and methods of use |
WO2012143379A1 (en) | 2011-04-20 | 2012-10-26 | Roche Glycart Ag | Method and constructs for the ph dependent passage of the blood-brain-barrier |
US9267112B2 (en) | 2011-05-10 | 2016-02-23 | The Regents Of The University Of California | Adenovirus isolated from Titi Monkeys |
US10221218B2 (en) | 2011-05-10 | 2019-03-05 | The Regents Of The University Of California | Adenovirus isolated from titi monkeys |
WO2012155019A1 (en) | 2011-05-12 | 2012-11-15 | Genentech, Inc. | Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides |
WO2012158704A1 (en) | 2011-05-16 | 2012-11-22 | Genentech, Inc. | Fgfr1 agonists and methods of use |
EP3219730A1 (en) | 2011-05-16 | 2017-09-20 | F. Hoffmann-La Roche AG | Fgfr1 agonists and methods of use |
US11013800B2 (en) | 2011-05-16 | 2021-05-25 | Evive Biotech Ltd. | Multi-specific Fab fusion proteins comprising a CD3-binding Fab fragment with N-terminal fusion to binding domains and methods of use |
WO2012158948A1 (en) | 2011-05-17 | 2012-11-22 | The Rockefeller University | Human immunodeficiency virus neutralizing antibodies adn methods of use thereof |
EP3865507A1 (en) | 2011-05-17 | 2021-08-18 | The Rockefeller University | Human immunodeficiency virus neutralizing antibodies and methods of use thereof |
WO2012171996A1 (en) | 2011-06-15 | 2012-12-20 | F. Hoffmann-La Roche Ag | Anti-human epo receptor antibodies and methods of use |
WO2013001369A2 (en) | 2011-06-28 | 2013-01-03 | Oxford Biotherapeutics Ltd. | Therapeutic and diagnostic target |
WO2013003680A1 (en) | 2011-06-30 | 2013-01-03 | Genentech, Inc. | Anti-c-met antibody formulations |
US9562097B2 (en) | 2011-07-01 | 2017-02-07 | Genentech, Inc. | Use of anti-CD83 agonist antibodies for treating autoimmune diseases |
WO2013012855A1 (en) | 2011-07-18 | 2013-01-24 | Amgen Inc. | Apelin antigen-binding proteins and uses thereof |
WO2013025944A1 (en) | 2011-08-17 | 2013-02-21 | Genentech, Inc. | Inhibition of angiogenesis in refractory tumors |
WO2013025853A1 (en) | 2011-08-17 | 2013-02-21 | Genentech, Inc. | Neuregulin antibodies and uses thereof |
WO2013026832A1 (en) | 2011-08-23 | 2013-02-28 | Roche Glycart Ag | Anti-mcsp antibodies |
WO2013033069A1 (en) | 2011-08-30 | 2013-03-07 | Theraclone Sciences, Inc. | Human rhinovirus (hrv) antibodies |
US8822651B2 (en) | 2011-08-30 | 2014-09-02 | Theraclone Sciences, Inc. | Human rhinovirus (HRV) antibodies |
US9360630B2 (en) | 2011-08-31 | 2016-06-07 | Volcano Corporation | Optical-electrical rotary joint and methods of use |
WO2013033623A1 (en) | 2011-09-02 | 2013-03-07 | Nestec S.A. | Profiling of signal pathway proteins to determine therapeutic efficacy |
WO2013040433A1 (en) | 2011-09-15 | 2013-03-21 | Genentech, Inc. | Methods of promoting differentiation |
WO2013043715A1 (en) | 2011-09-19 | 2013-03-28 | Genentech, Inc. | Combination treatments comprising c-met antagonists and b-raf antagonists |
WO2013052155A1 (en) | 2011-10-05 | 2013-04-11 | Genentech, Inc. | Methods of treating liver conditions using notch2 antagonists |
WO2013055998A1 (en) | 2011-10-14 | 2013-04-18 | Genentech, Inc. | ANTI-HtrA1 ANTIBODIES AND METHODS OF USE |
EP3461839A1 (en) | 2011-10-14 | 2019-04-03 | F. Hoffmann-La Roche AG | Anti-htra1 antibodies and methods of use |
WO2013056148A2 (en) | 2011-10-15 | 2013-04-18 | Genentech, Inc. | Methods of using scd1 antagonists |
WO2013059531A1 (en) | 2011-10-20 | 2013-04-25 | Genentech, Inc. | Anti-gcgr antibodies and uses thereof |
WO2013063001A1 (en) | 2011-10-28 | 2013-05-02 | Genentech, Inc. | Therapeutic combinations and methods of treating melanoma |
EP3257564A1 (en) | 2011-11-02 | 2017-12-20 | F. Hoffmann-La Roche AG | Overload and elute chromatography |
WO2013067301A1 (en) | 2011-11-02 | 2013-05-10 | Genentech, Inc. | Overload and elute chromatography |
EP3527274A1 (en) | 2011-11-02 | 2019-08-21 | F. Hoffmann-La Roche AG | Overload and elute chromatography |
US10457742B2 (en) | 2011-11-04 | 2019-10-29 | Zymeworks Inc. | Stable heterodimeric antibody design with mutations in the Fc domain |
US9574010B2 (en) | 2011-11-04 | 2017-02-21 | Zymeworks Inc. | Stable heterodimeric antibody design with mutations in the Fc domain |
US9988460B2 (en) | 2011-11-04 | 2018-06-05 | Zymeworks Inc. | Crystal structures of heterodimeric Fc domains |
US9732155B2 (en) | 2011-11-04 | 2017-08-15 | Zymeworks Inc. | Crystal structures of heterodimeric Fc domains |
WO2013078170A1 (en) | 2011-11-21 | 2013-05-30 | Genentech, Inc. | Purification of anti-c-met antibodies |
WO2013083497A1 (en) | 2011-12-06 | 2013-06-13 | F. Hoffmann-La Roche Ag | Antibody formulation |
WO2013092743A2 (en) | 2011-12-22 | 2013-06-27 | F. Hoffmann-La Roche Ag | Expression vector element combinations, novel production cell generation methods and their use for the recombinant production of polypeptides |
WO2013092720A1 (en) | 2011-12-22 | 2013-06-27 | F. Hoffmann-La Roche Ag | Full length antibody display system for eukaryotic cells and its use |
WO2013092723A1 (en) | 2011-12-22 | 2013-06-27 | F. Hoffmann-La Roche Ag | Expression vector organization, novel production cell generation methods and their use for the recombinant production of polypeptides |
US10882910B2 (en) | 2011-12-22 | 2021-01-05 | Hoffmann-La Roche Inc. | Expression vector organization, novel production cell generation methods and their use for the recombinant production of polypeptides |
WO2013096791A1 (en) | 2011-12-23 | 2013-06-27 | Genentech, Inc. | Process for making high concentration protein formulations |
WO2013096812A1 (en) | 2011-12-23 | 2013-06-27 | Genentech, Inc. | Articles of manufacture and methods for co-administration of antibodies |
WO2013101771A2 (en) | 2011-12-30 | 2013-07-04 | Genentech, Inc. | Compositions and method for treating autoimmune diseases |
EP3663314A1 (en) | 2012-01-09 | 2020-06-10 | The Scripps Research Institute | Humanized antibodies with ultralong cdr3s |
WO2013106489A1 (en) | 2012-01-09 | 2013-07-18 | The Scripps Research Institute | Humanized antibodies with ultralong cdr3s |
WO2013106485A2 (en) | 2012-01-09 | 2013-07-18 | The Scripps Research Institute | Ultralong complementarity determining regions and uses thereof |
WO2013109856A2 (en) | 2012-01-18 | 2013-07-25 | Genentech, Inc. | Methods of using fgf19 modulators |
WO2013109819A1 (en) | 2012-01-18 | 2013-07-25 | Genentech, Inc. | Anti-lrp5 antibodies and methods of use |
US9718879B2 (en) | 2012-01-26 | 2017-08-01 | Imperial Innovations Ltd. | Methods of treating pain by inhibition of VGF activity |
WO2013110945A1 (en) | 2012-01-26 | 2013-08-01 | Imperial Innovations Ltd | Methods of treating pain by inhibition of vgf activity |
WO2013116287A1 (en) | 2012-01-31 | 2013-08-08 | Genentech, Inc. | Anti-ig-e m1' antibodies and methods using same |
EP3578569A1 (en) | 2012-02-06 | 2019-12-11 | Inhibrx, Inc. | Cd47 antibodies and methods of use thereof |
US9663575B2 (en) | 2012-02-06 | 2017-05-30 | Inhibrx, Lp | CD47 antibodies and methods of use thereof |
US9045541B2 (en) | 2012-02-06 | 2015-06-02 | Inhibrx Llc | CD47 antibodies and methods of use thereof |
WO2013120056A1 (en) | 2012-02-11 | 2013-08-15 | Genentech, Inc. | R-spondin translocations and methods using the same |
US11814409B2 (en) | 2012-02-15 | 2023-11-14 | Hoffmann-La Roche Inc. | Fc-receptor based affinity chromatography |
WO2013120929A1 (en) | 2012-02-15 | 2013-08-22 | F. Hoffmann-La Roche Ag | Fc-receptor based affinity chromatography |
US10525130B2 (en) | 2012-03-26 | 2020-01-07 | Sanofi | Stable IGG4 based binding agent formulations |
US9592289B2 (en) | 2012-03-26 | 2017-03-14 | Sanofi | Stable IgG4 based binding agent formulations |
WO2013148249A1 (en) | 2012-03-27 | 2013-10-03 | Genentech, Inc. | Improved harvest operations for recombinant proteins |
WO2013148315A1 (en) | 2012-03-27 | 2013-10-03 | Genentech, Inc. | Diagnosis and treatments relating to her3 inhibitors |
WO2013149111A2 (en) | 2012-03-29 | 2013-10-03 | Novimmune S.A. | Anti-tlr4 antibodies and uses thereof |
WO2013149159A1 (en) | 2012-03-30 | 2013-10-03 | Genentech, Inc. | Anti-lgr5 antibodies and immunoconjugates |
US9175089B2 (en) | 2012-03-30 | 2015-11-03 | Genentech, Inc. | Anti-LGR5 antibodies and immunoconjugates |
US10130714B2 (en) | 2012-04-14 | 2018-11-20 | Academia Sinica | Enhanced anti-influenza agents conjugated with anti-inflammatory activity |
US9056910B2 (en) | 2012-05-01 | 2015-06-16 | Genentech, Inc. | Anti-PMEL17 antibodies and immunoconjugates |
US10196454B2 (en) | 2012-05-01 | 2019-02-05 | Genentech, Inc. | Anti-PMEL17 antibodies and immunoconjugates |
WO2013165940A1 (en) | 2012-05-01 | 2013-11-07 | Genentech, Inc. | Anti-pmel17 antibodies and immunoconjugates |
US9597411B2 (en) | 2012-05-01 | 2017-03-21 | Genentech, Inc. | Anti-PMEL17 antibodies and immunoconjugates |
WO2013170191A1 (en) | 2012-05-11 | 2013-11-14 | Genentech, Inc. | Methods of using antagonists of nad biosynthesis from nicotinamide |
WO2013177062A2 (en) | 2012-05-21 | 2013-11-28 | Genentech, Inc. | Methods for improving safety of blood-brain barrier transport |
EP3594239A1 (en) | 2012-05-21 | 2020-01-15 | F. Hoffmann-La Roche AG | Methods for improving safety of blood-brain barrier transport |
EP3605090A1 (en) | 2012-05-23 | 2020-02-05 | F. Hoffmann-La Roche AG | Selection method for therapeutic agents |
WO2013177470A1 (en) | 2012-05-23 | 2013-11-28 | Genentech, Inc. | Selection method for therapeutic agents |
EP3540070A1 (en) | 2012-06-11 | 2019-09-18 | Amgen Inc. | Dual receptor antagonistic antigen-binding proteins and uses thereof |
WO2013188448A2 (en) | 2012-06-11 | 2013-12-19 | Amgen Inc. | Dual receptor antagonistic antigen-binding proteins and uses thereof |
EP3498857A1 (en) | 2012-06-11 | 2019-06-19 | Amgen, Inc. | Dual receptor antagonistic antigen-binding proteins and uses thereof |
US9266961B2 (en) | 2012-06-15 | 2016-02-23 | Genentech, Inc. | Anti-PCSK9 antibodies, formulations, dosing, and methods of use |
US11180557B2 (en) | 2012-06-22 | 2021-11-23 | King's College London | Vista modulators for diagnosis and treatment of cancer |
US11752189B2 (en) | 2012-06-22 | 2023-09-12 | The Trustees Of Dartmouth College | Vista antagonist and methods of use |
US10933115B2 (en) | 2012-06-22 | 2021-03-02 | The Trustees Of Dartmouth College | VISTA antagonist and methods of use |
US10508154B2 (en) | 2012-06-25 | 2019-12-17 | Zymeworks Inc. | Process and methods for efficient manufacturing of highly pure asymmetric antibodies in mammalian cells |
US9499634B2 (en) | 2012-06-25 | 2016-11-22 | Zymeworks Inc. | Process and methods for efficient manufacturing of highly pure asymmetric antibodies in mammalian cells |
WO2014006118A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Anti-theophylline antibodies and methods of use |
WO2014006124A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Covalently linked antigen-antibody conjugates |
US9765153B2 (en) | 2012-07-04 | 2017-09-19 | Hoffmann-La Roche Inc. | Anti-biotin antibodies and methods of use |
US10517945B2 (en) | 2012-07-04 | 2019-12-31 | Hoffman-La Roche Inc. | Covalently linked antigen-antibody conjugates |
US9925272B2 (en) | 2012-07-04 | 2018-03-27 | Hoffmann-La Roche Inc. | Anti-theophylline antibodies and methods of use |
WO2014006123A1 (en) | 2012-07-04 | 2014-01-09 | F. Hoffmann-La Roche Ag | Anti-biotin antibodies and methods of use |
EP3578660A1 (en) | 2012-07-05 | 2019-12-11 | F. Hoffmann-La Roche AG | Expression and secretion system |
WO2014008391A1 (en) | 2012-07-05 | 2014-01-09 | Genentech, Inc. | Expression and secretion system |
WO2014011520A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd22 antibodies |
WO2014011521A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti - cd79b antibodies |
WO2014011518A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd22 antibodies |
WO2014011519A1 (en) | 2012-07-09 | 2014-01-16 | Genentech, Inc. | Immunoconjugates comprising anti-cd79b antibodies |
US10696749B2 (en) | 2012-07-13 | 2020-06-30 | The Trustees Of The University Of Pennsylvania | Enhancing activity of CAR T cells by co-introducing a bispecific antibody |
US11795240B2 (en) | 2012-07-13 | 2023-10-24 | The Trustees Of The University Of Pennsylvania | Enhancing activity of CAR T cells by co-introducing a bispecific antibody |
US9765156B2 (en) | 2012-07-13 | 2017-09-19 | The Trustees Of The University Of Pennsylvania | Enhancing activity of CAR T cells by co-introducing a bispecific antibody |
US10683345B2 (en) | 2012-07-13 | 2020-06-16 | Roche Glycart Ag | Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases |
EP3730512A1 (en) | 2012-07-13 | 2020-10-28 | The Trustees of the University of Pennsylvania | Enhancing activity of car t cells by co-introducing a bispecific antibody |
US9695233B2 (en) | 2012-07-13 | 2017-07-04 | Roche Glycart Ag | Bispecific anti-VEGF/anti-ANG-2 antibodies and their use in the treatment of ocular vascular diseases |
WO2014018554A1 (en) | 2012-07-23 | 2014-01-30 | La Jolla Institute For Allergy And Immunology | Ptprs and proteoglycans in autoimmune disease |
WO2014020331A1 (en) | 2012-08-01 | 2014-02-06 | Oxford Biotherapeutics Ltd. | Therapeutic and diagnostic target |
US9278131B2 (en) | 2012-08-10 | 2016-03-08 | Adocia | Process for lowering the viscosity of highly concentrated protein solutions |
US9914956B2 (en) | 2012-08-18 | 2018-03-13 | Academia Sinica | Cell-permeable probes for identification and imaging of sialidases |
US10214765B2 (en) | 2012-08-18 | 2019-02-26 | Academia Sinica | Cell-permeable probes for identification and imaging of sialidases |
US9547009B2 (en) | 2012-08-21 | 2017-01-17 | Academia Sinica | Benzocyclooctyne compounds and uses thereof |
WO2014037899A2 (en) | 2012-09-07 | 2014-03-13 | Novartis Ag | Il-18 binding molecules |
EP3725805A1 (en) | 2012-09-07 | 2020-10-21 | Novartis AG | Il-18 binding molecules |
US11529416B2 (en) | 2012-09-07 | 2022-12-20 | Kings College London | Vista modulators for diagnosis and treatment of cancer |
US10393733B2 (en) | 2012-09-19 | 2019-08-27 | Dana-Farber Cancer Institute, Inc. | Dynamic BH3 profiling |
WO2014047311A1 (en) | 2012-09-19 | 2014-03-27 | Genentech, Inc. | Methods and compositions for preventing norleucine misincorporation into proteins |
EP3502267A1 (en) | 2012-09-19 | 2019-06-26 | F. Hoffmann-La Roche AG | Methods and compositions for preventing norleucine misincorporation into proteins |
US11815508B2 (en) | 2012-09-19 | 2023-11-14 | Dana-Farber Cancer Institute, Inc. | Dynamic BH3 profiling |
WO2014049003A1 (en) | 2012-09-25 | 2014-04-03 | Glenmark Pharmaceuticals S.A. | Purification of hetero-dimeric immunoglobulins |
EP3401337A1 (en) | 2012-09-25 | 2018-11-14 | Glenmark Pharmaceuticals S.A. | Purification of hetero-dimeric immunoglobulins |
US9286673B2 (en) | 2012-10-05 | 2016-03-15 | Volcano Corporation | Systems for correcting distortions in a medical image and methods of use thereof |
US9478940B2 (en) | 2012-10-05 | 2016-10-25 | Volcano Corporation | Systems and methods for amplifying light |
US11091551B2 (en) | 2012-10-05 | 2021-08-17 | Genentech, Inc. | Methods for diagnosing and treating inflammatory bowel disease |
US10070827B2 (en) | 2012-10-05 | 2018-09-11 | Volcano Corporation | Automatic image playback |
US9307926B2 (en) | 2012-10-05 | 2016-04-12 | Volcano Corporation | Automatic stent detection |
US11272845B2 (en) | 2012-10-05 | 2022-03-15 | Philips Image Guided Therapy Corporation | System and method for instant and automatic border detection |
US9292918B2 (en) | 2012-10-05 | 2016-03-22 | Volcano Corporation | Methods and systems for transforming luminal images |
US11864870B2 (en) | 2012-10-05 | 2024-01-09 | Philips Image Guided Therapy Corporation | System and method for instant and automatic border detection |
US9324141B2 (en) | 2012-10-05 | 2016-04-26 | Volcano Corporation | Removal of A-scan streaking artifact |
US9858668B2 (en) | 2012-10-05 | 2018-01-02 | Volcano Corporation | Guidewire artifact removal in images |
US9873742B2 (en) | 2012-10-05 | 2018-01-23 | Genentech, Inc. | Methods for diagnosing and treating inflammatory bowel disease |
US11510632B2 (en) | 2012-10-05 | 2022-11-29 | Philips Image Guided Therapy Corporation | Systems for indicating parameters in an imaging data set and methods of use |
US11890117B2 (en) | 2012-10-05 | 2024-02-06 | Philips Image Guided Therapy Corporation | Systems for indicating parameters in an imaging data set and methods of use |
US9367965B2 (en) | 2012-10-05 | 2016-06-14 | Volcano Corporation | Systems and methods for generating images of tissue |
US10568586B2 (en) | 2012-10-05 | 2020-02-25 | Volcano Corporation | Systems for indicating parameters in an imaging data set and methods of use |
EP3783018A1 (en) | 2012-10-18 | 2021-02-24 | The Rockefeller University | Broadly-neutralizing anti-hiv antibodies |
US10724082B2 (en) | 2012-10-22 | 2020-07-28 | Bio-Rad Laboratories, Inc. | Methods for analyzing DNA |
WO2014069647A1 (en) | 2012-11-05 | 2014-05-08 | 全薬工業株式会社 | Antibody and antibody composition production method |
US11578372B2 (en) | 2012-11-05 | 2023-02-14 | Foundation Medicine, Inc. | NTRK1 fusion molecules and uses thereof |
WO2014072306A1 (en) | 2012-11-08 | 2014-05-15 | F. Hoffmann-La Roche Ag | Her3 antigen binding proteins binding to the beta-hairpin of her3 |
WO2014078268A2 (en) | 2012-11-13 | 2014-05-22 | Genentech, Inc. | Anti-hemagglutinin antibodies and methods of use |
EP3461501A1 (en) | 2012-11-13 | 2019-04-03 | F. Hoffmann-La Roche AG | Anti-hemagglutinin antibodies and methods of use |
US9810670B2 (en) | 2012-11-15 | 2017-11-07 | Genentech, Inc. | Ionic strength-mediated pH gradient ion exchange chromatography |
US10712322B2 (en) | 2012-11-15 | 2020-07-14 | Genentech, Inc. | Ionic strength-mediated pH gradient ion exchange chromatography |
US11078296B2 (en) | 2012-11-28 | 2021-08-03 | Zymeworks Inc. | Engineered immunoglobulin heavy chain-light chain pairs and uses thereof |
US9914785B2 (en) | 2012-11-28 | 2018-03-13 | Zymeworks Inc. | Engineered immunoglobulin heavy chain-light chain pairs and uses thereof |
WO2014087248A2 (en) | 2012-12-03 | 2014-06-12 | Novimmune S.A. | Anti-cd47 antibodies and methods of use thereof |
EP3725807A1 (en) | 2012-12-03 | 2020-10-21 | NovImmune SA | Anti-cd47 antibodies and methods of use thereof |
US11059910B2 (en) | 2012-12-03 | 2021-07-13 | Novimmune Sa | Anti-CD47 antibodies and methods of use thereof |
US11840553B2 (en) | 2012-12-03 | 2023-12-12 | Novimmune Sa | Anti-CD47 antibodies and methods of use thereof |
US10918735B2 (en) | 2012-12-04 | 2021-02-16 | Massachusetts Institute Of Technology | Substituted pyrazino[1′,2′:1,5]pyrrolo[2,3-b]indole-1,4-diones for cancer treatment |
US10238367B2 (en) | 2012-12-13 | 2019-03-26 | Volcano Corporation | Devices, systems, and methods for targeted cannulation |
US9730613B2 (en) | 2012-12-20 | 2017-08-15 | Volcano Corporation | Locating intravascular images |
US10942022B2 (en) | 2012-12-20 | 2021-03-09 | Philips Image Guided Therapy Corporation | Manual calibration of imaging system |
US11141131B2 (en) | 2012-12-20 | 2021-10-12 | Philips Image Guided Therapy Corporation | Smooth transition catheters |
US10939826B2 (en) | 2012-12-20 | 2021-03-09 | Philips Image Guided Therapy Corporation | Aspirating and removing biological material |
US11892289B2 (en) | 2012-12-20 | 2024-02-06 | Philips Image Guided Therapy Corporation | Manual calibration of imaging system |
US9709379B2 (en) | 2012-12-20 | 2017-07-18 | Volcano Corporation | Optical coherence tomography system that is reconfigurable between different imaging modes |
US11406498B2 (en) | 2012-12-20 | 2022-08-09 | Philips Image Guided Therapy Corporation | Implant delivery system and implants |
US10595820B2 (en) | 2012-12-20 | 2020-03-24 | Philips Image Guided Therapy Corporation | Smooth transition catheters |
US10166003B2 (en) | 2012-12-21 | 2019-01-01 | Volcano Corporation | Ultrasound imaging with variable line density |
US11253225B2 (en) | 2012-12-21 | 2022-02-22 | Philips Image Guided Therapy Corporation | System and method for multipath processing of image signals |
US11786213B2 (en) | 2012-12-21 | 2023-10-17 | Philips Image Guided Therapy Corporation | System and method for multipath processing of image signals |
US10993694B2 (en) | 2012-12-21 | 2021-05-04 | Philips Image Guided Therapy Corporation | Rotational ultrasound imaging catheter with extended catheter body telescope |
US9383263B2 (en) | 2012-12-21 | 2016-07-05 | Volcano Corporation | Systems and methods for narrowing a wavelength emission of light |
US10191220B2 (en) | 2012-12-21 | 2019-01-29 | Volcano Corporation | Power-efficient optical circuit |
US10058284B2 (en) | 2012-12-21 | 2018-08-28 | Volcano Corporation | Simultaneous imaging, monitoring, and therapy |
US9612105B2 (en) | 2012-12-21 | 2017-04-04 | Volcano Corporation | Polarization sensitive optical coherence tomography system |
US10413317B2 (en) | 2012-12-21 | 2019-09-17 | Volcano Corporation | System and method for catheter steering and operation |
US10332228B2 (en) | 2012-12-21 | 2019-06-25 | Volcano Corporation | System and method for graphical processing of medical data |
US10420530B2 (en) | 2012-12-21 | 2019-09-24 | Volcano Corporation | System and method for multipath processing of image signals |
US9486143B2 (en) | 2012-12-21 | 2016-11-08 | Volcano Corporation | Intravascular forward imaging device |
US11771698B2 (en) | 2013-01-18 | 2023-10-03 | Foundation Medicine, Inc. | Methods of treating cholangiocarcinoma |
WO2014116749A1 (en) | 2013-01-23 | 2014-07-31 | Genentech, Inc. | Anti-hcv antibodies and methods of using thereof |
WO2014123580A1 (en) | 2013-02-06 | 2014-08-14 | Inhibrx Llc | Non-platelet depleting and non-red blood cell depleting cd47 antibodies and methods of use thereof |
EP4137518A1 (en) | 2013-02-06 | 2023-02-22 | Inhibrx, Inc. | Non-platelet depleting and non-red blood cell depleting cd47 antibodies and methods of use thereof |
EP3736293A1 (en) | 2013-02-12 | 2020-11-11 | Boehringer Ingelheim International Gmbh | Therapeutic and diagnostic target for cancer comprising dll3 binding reagents |
WO2014128235A1 (en) | 2013-02-22 | 2014-08-28 | F. Hoffmann-La Roche Ag | Methods of treating cancer and preventing drug resistance |
WO2014130064A1 (en) | 2013-02-22 | 2014-08-28 | Abbvie Inc. | Ultrafiltration and diafiltration formulation methods for protein processing |
WO2014131715A1 (en) | 2013-02-26 | 2014-09-04 | Roche Glycart Ag | Anti-mcsp antibodies |
WO2014138364A2 (en) | 2013-03-06 | 2014-09-12 | Genentech, Inc. | Methods of treating and preventing cancer drug resistance |
US9770172B2 (en) | 2013-03-07 | 2017-09-26 | Volcano Corporation | Multimodal segmentation in intravascular images |
US10226597B2 (en) | 2013-03-07 | 2019-03-12 | Volcano Corporation | Guidewire with centering mechanism |
US11154313B2 (en) | 2013-03-12 | 2021-10-26 | The Volcano Corporation | Vibrating guidewire torquer and methods of use |
US10638939B2 (en) | 2013-03-12 | 2020-05-05 | Philips Image Guided Therapy Corporation | Systems and methods for diagnosing coronary microvascular disease |
WO2014160495A1 (en) | 2013-03-13 | 2014-10-02 | Genentech, Inc. | Formulations with reduced oxidation |
WO2014160490A1 (en) | 2013-03-13 | 2014-10-02 | Genetech, Inc. | Antibody formulations |
US10653779B2 (en) | 2013-03-13 | 2020-05-19 | Genentech, Inc. | Formulations with reduced oxidation |
US11026591B2 (en) | 2013-03-13 | 2021-06-08 | Philips Image Guided Therapy Corporation | Intravascular pressure sensor calibration |
US10758207B2 (en) | 2013-03-13 | 2020-09-01 | Philips Image Guided Therapy Corporation | Systems and methods for producing an image from a rotational intravascular ultrasound device |
US10010611B2 (en) | 2013-03-13 | 2018-07-03 | Genentech, Inc. | Antibody formulations |
WO2014160497A1 (en) | 2013-03-13 | 2014-10-02 | Genentech, Inc. | Formulations with reduced oxidation |
US11596620B2 (en) | 2013-03-13 | 2023-03-07 | F. Hoffmann-La Roche Ag | Formulations with reduced oxidation |
US9301687B2 (en) | 2013-03-13 | 2016-04-05 | Volcano Corporation | System and method for OCT depth calibration |
US10925966B2 (en) | 2013-03-13 | 2021-02-23 | Genentech, Inc. | Antibody formulations |
EP3744345A1 (en) | 2013-03-13 | 2020-12-02 | F. Hoffmann-La Roche AG | Antibody formulations |
EP3299391A1 (en) | 2013-03-14 | 2018-03-28 | Genentech, Inc. | Anti-b7-h4 antibodies and immunoconjugates |
US10219887B2 (en) | 2013-03-14 | 2019-03-05 | Volcano Corporation | Filters with echogenic characteristics |
US11421031B2 (en) | 2013-03-14 | 2022-08-23 | Macrogenics, Inc. | Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof |
US10292677B2 (en) | 2013-03-14 | 2019-05-21 | Volcano Corporation | Endoluminal filter having enhanced echogenic properties |
US10730947B2 (en) | 2013-03-14 | 2020-08-04 | Macrogenics, Inc. | Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof |
AU2014244286B2 (en) * | 2013-03-14 | 2018-11-08 | Duke University | Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor |
US10150813B2 (en) | 2013-03-14 | 2018-12-11 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
WO2014159940A1 (en) | 2013-03-14 | 2014-10-02 | Macrogenics, Inc. | Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor |
US11230600B2 (en) | 2013-03-14 | 2022-01-25 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
WO2014159835A1 (en) | 2013-03-14 | 2014-10-02 | Genentech, Inc. | Anti-b7-h4 antibodies and immunoconjugates |
US10426590B2 (en) | 2013-03-14 | 2019-10-01 | Volcano Corporation | Filters with echogenic characteristics |
US9908938B2 (en) | 2013-03-14 | 2018-03-06 | Macrogenics, Inc. | Bispecific molecules that are immunoreactive with immune effector cells that express an activating receptor and an antigen expressed by a cell infected by a virus and uses thereof |
US9562099B2 (en) | 2013-03-14 | 2017-02-07 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
WO2014153030A2 (en) | 2013-03-14 | 2014-09-25 | Genentech, Inc. | Methods of treating cancer and preventing cancer drug resistance |
WO2014152358A2 (en) | 2013-03-14 | 2014-09-25 | Genentech, Inc. | Combinations of a mek inhibitor compound with an her3/egfr inhibitor compound and methods of use |
EP3590922A1 (en) | 2013-03-15 | 2020-01-08 | Zymeworks Inc. | Cytotoxic and anti-mitotic compounds, and methods of using the same |
US9441035B2 (en) | 2013-03-15 | 2016-09-13 | Genentech, Inc. | Cell culture media and methods of antibody production |
US10676710B2 (en) | 2013-03-15 | 2020-06-09 | Genentech, Inc. | Cell culture compositions with antioxidants and methods for polypeptide production |
WO2014151866A1 (en) | 2013-03-15 | 2014-09-25 | Genentech, Inc. | Compositions and methods for diagnosis and treatment of hepatic cancers |
WO2014144763A2 (en) | 2013-03-15 | 2014-09-18 | Memorial Sloan Kettering Cancer Center | High affinity anti-gd2 antibodies |
WO2014144865A2 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Anti-crth2 antibodies and methods of use |
EP3633377A1 (en) | 2013-03-15 | 2020-04-08 | F. Hoffmann-La Roche AG | Biomarkers and methods of treating pd-1 and pd-l1 related conditions |
WO2014144850A1 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Methods of treating cancer and preventing cancer drug resistance |
WO2014145098A1 (en) | 2013-03-15 | 2014-09-18 | Genentech, Inc. | Cell culture compositions with antioxidants and methods for polypeptide production |
WO2014150877A2 (en) | 2013-03-15 | 2014-09-25 | Ac Immune S.A. | Anti-tau antibodies and methods of use |
WO2014144871A1 (en) | 2013-03-15 | 2014-09-18 | The Centre For Drug Research And Development | Cytotoxic and anti-mitotic compounds, and methods of using the same |
US10131873B2 (en) | 2013-03-15 | 2018-11-20 | Genentech, Inc. | Cell culture compositions with antioxidants and methods for polypeptide production |
EP3712252A1 (en) | 2013-03-15 | 2020-09-23 | F. Hoffmann-La Roche AG | Cell culture compositions with antioxidants and methods for polypeptide production |
EP4356960A2 (en) | 2013-03-15 | 2024-04-24 | F. Hoffmann-La Roche AG | Biomarkers and methods of treating pd-1 and pd-l1 related conditions |
US10829732B2 (en) | 2013-03-15 | 2020-11-10 | Genentech, Inc. | Cell culture compositions with antioxidants and methods for polypeptide production |
WO2014151006A2 (en) | 2013-03-15 | 2014-09-25 | Genentech, Inc. | Biomarkers and methods of treating pd-1 and pd-l1 related conditions |
US9000132B2 (en) | 2013-03-15 | 2015-04-07 | Diadexus, Inc. | Lipoprotein-associated phospholipase A2 antibody compositions and methods of use |
US10017732B2 (en) | 2013-03-15 | 2018-07-10 | Genentech, Inc. | Cell culture compositions with antioxidants and methods for polypeptide production |
WO2015147915A1 (en) | 2013-03-24 | 2015-10-01 | Development Center For Biotechnology | Methods for suppressing cancer by inhibition of tmcc3 |
EP3933401A2 (en) | 2013-03-27 | 2022-01-05 | F. Hoffmann-La Roche AG | Use of biomarkers for assessing treatment of gastrointestinal inflammatory disorders with beta7 integrin antagonists |
EP3495814A2 (en) | 2013-03-27 | 2019-06-12 | F. Hoffmann-La Roche AG | Use of biomarkers for assessing treatment of gastrointestinal inflammatory disorders with beta7 integrin antagonists |
WO2014161845A1 (en) | 2013-04-03 | 2014-10-09 | Roche Glycart Ag | Bispecific antibodies specific for fap and dr5, antibodies specific for dr5 and methods of use |
WO2014169076A1 (en) | 2013-04-09 | 2014-10-16 | Annexon,,Inc. | Methods of treatment for neuromyelitis optica |
WO2014172661A1 (en) | 2013-04-19 | 2014-10-23 | The Regent Of The University Of California | Lone star virus |
EP3628685A1 (en) | 2013-04-29 | 2020-04-01 | F. Hoffmann-La Roche AG | Human fcrn-binding modified antibodies and methods of use |
WO2014177461A1 (en) | 2013-04-29 | 2014-11-06 | F. Hoffmann-La Roche Ag | Fcrn-binding abolished anti-igf-1r antibodies and their use in the treatment of vascular eye diseases |
WO2014177460A1 (en) | 2013-04-29 | 2014-11-06 | F. Hoffmann-La Roche Ag | Human fcrn-binding modified antibodies and methods of use |
EP3878866A1 (en) | 2013-04-29 | 2021-09-15 | F. Hoffmann-La Roche AG | Fc-receptor binding modified asymmetric antibodies and methods of use |
EP4324480A2 (en) | 2013-05-20 | 2024-02-21 | F. Hoffmann-La Roche AG | Anti-transferrin receptor antibodies and methods of use |
EP3594240A1 (en) | 2013-05-20 | 2020-01-15 | F. Hoffmann-La Roche AG | Anti-transferrin receptor antibodies and methods of use |
WO2014188377A2 (en) | 2013-05-24 | 2014-11-27 | Nestec S.A. | Pathway specific assays for predicting irritable bowel syndrome diagnosis |
US10086054B2 (en) | 2013-06-26 | 2018-10-02 | Academia Sinica | RM2 antigens and use thereof |
US9981030B2 (en) | 2013-06-27 | 2018-05-29 | Academia Sinica | Glycan conjugates and use thereof |
WO2015006504A1 (en) | 2013-07-09 | 2015-01-15 | Annexon, Inc. | Anti-complement factor c1q antibodies and uses thereof |
EP4252769A2 (en) | 2013-07-09 | 2023-10-04 | Annexon, Inc. | Anti-complement factor c1q antibodies and uses thereof |
US10921297B2 (en) | 2013-07-12 | 2021-02-16 | Genentech, Inc. | Elucidation of ion exchange chromatography input optimization |
US10274466B2 (en) | 2013-07-12 | 2019-04-30 | Genentech, Inc. | Elucidation of ion exchange chromatography input optimization |
EP3536699A1 (en) | 2013-07-12 | 2019-09-11 | F. Hoffmann-La Roche AG | Elucidation of ion exchange chromatography input optimization |
EP3789036A1 (en) | 2013-07-16 | 2021-03-10 | F. Hoffmann-La Roche AG | Methods of treating cancer using pd-1 axis binding antagonists and tigit inhibitors |
WO2015017146A2 (en) | 2013-07-18 | 2015-02-05 | Fabrus, Inc. | Antibodies with ultralong complementarity determining regions |
WO2015010100A2 (en) | 2013-07-18 | 2015-01-22 | Fabrus, Inc. | Humanized antibodies with ultralong complementarity determining regions |
WO2015023596A1 (en) | 2013-08-12 | 2015-02-19 | Genentech, Inc. | Compositions and method for treating complement-associated conditions |
EP3705494A2 (en) | 2013-08-14 | 2020-09-09 | Sachdev Sidhu | Antibodies against frizzled proteins and methods of use thereof |
US10077304B2 (en) | 2013-08-14 | 2018-09-18 | The Governing Council Of The University Of Toronto | Antibodies against frizzled receptor |
US10689442B2 (en) | 2013-08-14 | 2020-06-23 | Sachdev Sidhu | Antibodies against Frizzled receptor |
WO2015031837A1 (en) | 2013-08-29 | 2015-03-05 | City Of Hope | Cell penetrating conjugates and methods of use thereof |
US10940401B2 (en) | 2013-09-05 | 2021-03-09 | Genentech, Inc. | Method for chromatography reuse |
US10111951B2 (en) | 2013-09-06 | 2018-10-30 | Academia Sinica | Human iNKT cell activation using glycolipids with altered glycosyl groups |
US10918714B2 (en) | 2013-09-06 | 2021-02-16 | Academia Sinica | Human iNKT cell activation using glycolipids with altered glycosyl groups |
US9782476B2 (en) | 2013-09-06 | 2017-10-10 | Academia Sinica | Human iNKT cell activation using glycolipids with altered glycosyl groups |
US10246515B2 (en) | 2013-09-17 | 2019-04-02 | Genentech, Inc. | Methods of treating hedgehog-related diseases with an anti-LGR5 antibody |
WO2015042108A1 (en) | 2013-09-17 | 2015-03-26 | Genentech, Inc. | Methods of using anti-lgr5 antibodies |
US10739333B2 (en) | 2013-09-19 | 2020-08-11 | Dana-Farber Cancer Institute, Inc. | Methods of BH3 profiling |
US11867687B2 (en) | 2013-09-19 | 2024-01-09 | Dana-Farber Cancer Institute, Inc. | Methods of BH3 profiling |
WO2015048520A1 (en) | 2013-09-27 | 2015-04-02 | Genentech, Inc. | Anti-pdl1 antibody formulations |
EP3626742A1 (en) | 2013-09-27 | 2020-03-25 | F. Hoffmann-La Roche AG | Anti-pdl1 antibody formulations |
US10131658B2 (en) | 2013-09-30 | 2018-11-20 | The Regents Of The University Of California | Anti-alphavbeta1 integrin compounds and methods |
WO2015050959A1 (en) | 2013-10-01 | 2015-04-09 | Yale University | Anti-kit antibodies and methods of use thereof |
WO2015054670A1 (en) | 2013-10-11 | 2015-04-16 | Genentech, Inc. | Nsp4 inhibitors and methods of use |
US10246519B2 (en) | 2013-10-11 | 2019-04-02 | Genentech, Inc. | NSP4 inhibitors and methods of use |
US9975963B2 (en) | 2013-10-11 | 2018-05-22 | Genentech, Inc. | NSP4 inhibitors and methods of use |
WO2015058132A2 (en) | 2013-10-18 | 2015-04-23 | Genentech, Inc. | Anti-rspo antibodies and methods of use |
WO2015061441A1 (en) | 2013-10-23 | 2015-04-30 | Genentech, Inc. | Methods of diagnosing and treating eosinophilic disorders |
EP3176185A1 (en) | 2013-11-04 | 2017-06-07 | Glenmark Pharmaceuticals S.A. | Production of t cell retargeting hetero-dimeric immunoglobulins |
WO2015069459A1 (en) | 2013-11-05 | 2015-05-14 | Novartis Ag | Organic compounds |
WO2015075011A1 (en) | 2013-11-21 | 2015-05-28 | F. Hoffmann-La Roche Ag | ANTI-alpha-SYNUCLEIN ANTIBODIES AND METHODS OF USE |
WO2015084625A1 (en) | 2013-12-02 | 2015-06-11 | Baylor College Of Medicine | Identification of a new polypeptide hormone for maintenance of optimal body weight and blood glucose |
US9546215B2 (en) | 2013-12-09 | 2017-01-17 | Allakos Inc. | Anti-Siglec-8 antibodies and methods of use thereof |
WO2015089117A1 (en) | 2013-12-09 | 2015-06-18 | Allakos Inc. | Anti-siglec-8 antibodies and methods of use thereof |
EP3611191A1 (en) | 2013-12-09 | 2020-02-19 | Allakos Inc. | Anti-siglec-8 antibodies and methods of use thereof |
EP3461845A1 (en) | 2013-12-13 | 2019-04-03 | Genentech, Inc. | Anti-cd33 antibodies and immunoconjugates |
WO2015089344A1 (en) | 2013-12-13 | 2015-06-18 | Genentech, Inc. | Anti-cd33 antibodies and immunoconjugates |
WO2015095423A2 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists |
EP3680254A1 (en) | 2013-12-17 | 2020-07-15 | F. Hoffmann-La Roche AG | Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies |
WO2015095418A1 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Methods of treating her2-positive cancers using pd-1 axis binding antagonists and anti-her2 antibodies |
WO2015095410A1 (en) | 2013-12-17 | 2015-06-25 | Genentech, Inc. | Methods of treating cancer using pd-1 axis binding antagonists and an anti-cd20 antibody |
EP3527587A1 (en) | 2013-12-17 | 2019-08-21 | F. Hoffmann-La Roche AG | Combination therapy comprising ox40 binding agonists and pd-l1 binding antagonists |
EP3647324A1 (en) | 2013-12-17 | 2020-05-06 | F. Hoffmann-La Roche AG | Methods of treating cancers using pd-1 axis binding antagonists and taxanes |
WO2015091656A1 (en) | 2013-12-20 | 2015-06-25 | F. Hoffmann-La Roche Ag | HUMANIZED ANTI-Tau(pS422) ANTIBODIES AND METHODS OF USE |
US10465000B2 (en) | 2013-12-20 | 2019-11-05 | Hoffmann-La Roche Inc. | Humanized anti-Tau(pS422) antibodies and methods of use |
US10882921B2 (en) | 2013-12-23 | 2021-01-05 | Genentech, Inc. | Host cell comprising nucleic acids encoding bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1 and antibody production |
US9884919B2 (en) | 2013-12-23 | 2018-02-06 | Genentech, Inc. | Methods of treatment with bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1 |
US9873748B2 (en) | 2013-12-23 | 2018-01-23 | Genentech, Inc. | Bispecific antibodies binding to beta-klotho and fibroblast growth factor receptor 1 |
EP4219555A1 (en) | 2013-12-23 | 2023-08-02 | F. Hoffmann-La Roche AG | Antibodies and methods of use |
US10246518B2 (en) | 2013-12-23 | 2019-04-02 | Genentech, Inc. | Nucleic acids encoding bispecific antibodies binding to beta-Klotho and fibroblast growth factor receptor 1 |
EP3712174A1 (en) | 2013-12-24 | 2020-09-23 | Janssen Pharmaceutica NV | Anti-vista antibodies and fragments |
EP4043493A1 (en) | 2013-12-24 | 2022-08-17 | Janssen Pharmaceutica NV | Anti-vista antibodies and fragments |
WO2015097536A2 (en) | 2013-12-24 | 2015-07-02 | Janssen Pharmaceutical Nv | Anti-vista antibodies and fragments |
US11014987B2 (en) | 2013-12-24 | 2021-05-25 | Janssen Pharmaceutics Nv | Anti-vista antibodies and fragments, uses thereof, and methods of identifying same |
US11242392B2 (en) | 2013-12-24 | 2022-02-08 | Janssen Pharmaceutica Nv | Anti-vista antibodies and fragments |
WO2015095953A1 (en) | 2013-12-27 | 2015-07-02 | The Centre For Drug Research And Development | Sulfonamide-containing linkage systems for drug conjugates |
US10519249B2 (en) | 2014-01-03 | 2019-12-31 | Hoffmann-La Roche Inc. | Covalently linked polypeptide toxin-antibody conjugates |
WO2015101589A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Covalently linked polypeptide toxin-antibody conjugates |
WO2015101586A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles |
WO2015101587A1 (en) | 2014-01-03 | 2015-07-09 | F. Hoffmann-La Roche Ag | Covalently linked helicar-anti-helicar antibody conjugates and uses thereof |
US10561737B2 (en) | 2014-01-03 | 2020-02-18 | Hoffmann-La Roche Inc. | Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles |
US10407511B2 (en) | 2014-01-03 | 2019-09-10 | Hoffmann-La Roche Inc. | Covalently linked helicar-anti-helicar antibody conjugates and uses thereof |
WO2015101588A1 (en) | 2014-01-06 | 2015-07-09 | F. Hoffmann-La Roche Ag | Monovalent blood brain barrier shuttle modules |
EP3835318A1 (en) | 2014-01-15 | 2021-06-16 | F. Hoffmann-La Roche AG | Fc-region variants with modified fcrn- and maintained protein a-binding properties |
WO2015107026A1 (en) | 2014-01-15 | 2015-07-23 | F. Hoffmann-La Roche Ag | Fc-region variants with modified fcrn- and maintained protein a-binding properties |
WO2015109180A2 (en) | 2014-01-16 | 2015-07-23 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
US10150818B2 (en) | 2014-01-16 | 2018-12-11 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
US9982041B2 (en) | 2014-01-16 | 2018-05-29 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
WO2015112909A1 (en) | 2014-01-24 | 2015-07-30 | Genentech, Inc. | Methods of using anti-steap1 antibodies and immunoconjugates |
WO2015120075A2 (en) | 2014-02-04 | 2015-08-13 | Genentech, Inc. | Mutant smoothened and methods of using the same |
WO2015120280A1 (en) | 2014-02-08 | 2015-08-13 | Genentech, Inc. | Methods of treating alzheimer's disease |
EP3718563A1 (en) | 2014-02-08 | 2020-10-07 | F. Hoffmann-La Roche AG | Methods of treating alzheimer's disease |
WO2015120233A1 (en) | 2014-02-08 | 2015-08-13 | Genentech, Inc. | Methods of treating alzheimer's disease |
EP3900738A1 (en) | 2014-02-08 | 2021-10-27 | F. Hoffmann-La Roche AG | Methods of treating alzheimer's disease |
EP3825332A1 (en) | 2014-02-12 | 2021-05-26 | F. Hoffmann-La Roche AG | Anti-jagged1 antibodies and methods of use |
EP3428190A1 (en) | 2014-02-12 | 2019-01-16 | F. Hoffmann-La Roche AG | Anti-jagged1 antibodies and methods of use |
WO2015124588A1 (en) | 2014-02-18 | 2015-08-27 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions for the treatment of diseases mediated by the nrp-1/obr complex signaling pathway |
WO2015127405A2 (en) | 2014-02-21 | 2015-08-27 | Genentech, Inc. | Anti-il-13/il-17 bispecific antibodies and uses thereof |
EP4014995A1 (en) | 2014-02-28 | 2022-06-22 | Allakos Inc. | Methods and compositions for treating siglec-8 associated diseases |
US10183996B2 (en) | 2014-02-28 | 2019-01-22 | Allakos Inc. | Methods and compositions for treating Siglec-8 associated diseases |
WO2015131155A1 (en) | 2014-02-28 | 2015-09-03 | Allakos Inc. | Methods and compositions for treating siglec-8 associated diseases |
WO2015139046A1 (en) | 2014-03-14 | 2015-09-17 | Genentech, Inc. | Methods and compositions for secretion of heterologous polypeptides |
WO2015140591A1 (en) | 2014-03-21 | 2015-09-24 | Nordlandssykehuset Hf | Anti-cd14 antibodies and uses thereof |
WO2015148531A1 (en) | 2014-03-24 | 2015-10-01 | Genentech, Inc. | Cancer treatment with c-met antagonists and correlation of the latter with hgf expression |
US10240207B2 (en) | 2014-03-24 | 2019-03-26 | Genentech, Inc. | Cancer treatment with c-met antagonists and correlation of the latter with HGF expression |
US11566069B2 (en) | 2014-03-27 | 2023-01-31 | Bird Rock Bio, Inc. | Treatment of disease responsive to modulation of cannabanoid 1(CB1) receptor signaling |
US10119972B2 (en) | 2014-03-27 | 2018-11-06 | Academia Sinica | Reactive labelling compounds and uses thereof |
WO2015148809A1 (en) | 2014-03-27 | 2015-10-01 | Genentech, Inc. | Methods for diagnosing and treating inflammatory bowel disease |
WO2015148984A2 (en) | 2014-03-27 | 2015-10-01 | Ruiyi Inc. | Antibodies that bind human cannabinoid 1 (cb1) receptor |
EP4159761A1 (en) | 2014-03-27 | 2023-04-05 | Bird Rock Bio, Inc. | Antibodies that bind human cannabinoid 1 (cb1) receptor |
US9759726B2 (en) | 2014-03-27 | 2017-09-12 | Academia Sinica | Reactive labelling compounds and uses thereof |
US10308712B2 (en) | 2014-03-27 | 2019-06-04 | Bird Rock Bio, Inc. | Antibodies that bind human cannabinoid 1 (CB1) receptor |
EP3632934A1 (en) | 2014-03-31 | 2020-04-08 | F. Hoffmann-La Roche AG | Anti-ox40 antibodies and methods of use |
WO2015153514A1 (en) | 2014-03-31 | 2015-10-08 | Genentech, Inc. | Combination therapy comprising anti-angiogenesis agents and ox40 binding agonists |
US10730951B2 (en) | 2014-03-31 | 2020-08-04 | Genentech, Inc. | Anti-OX40 antibodies and methods of use |
WO2015153513A1 (en) | 2014-03-31 | 2015-10-08 | Genentech, Inc. | Anti-ox40 antibodies and methods of use |
US9975957B2 (en) | 2014-03-31 | 2018-05-22 | Genentech, Inc. | Anti-OX40 antibodies and methods of use |
US9995746B2 (en) | 2014-04-02 | 2018-06-12 | The United States Of America, As Represented By The Secretary Of The Army | Rapid dual direct fluorescent antibody assay for the identification of Bacillus antrhacis |
US10330679B2 (en) | 2014-04-02 | 2019-06-25 | The United States Of America, As Represented By The Secretary Of The Army | Rapid dual direct fluorescent antibody assay for the identification of Bacillus anthracis |
WO2015150446A1 (en) | 2014-04-02 | 2015-10-08 | F. Hoffmann-La Roche Ag | Method for detecting multispecific antibody light chain mispairing |
WO2015161267A2 (en) | 2014-04-18 | 2015-10-22 | The Board Of Trustees Of The Leland Stanford Junior University | Humanized and chimeric monoclonal antibodies to cd99 |
WO2015164615A1 (en) | 2014-04-24 | 2015-10-29 | University Of Oslo | Anti-gluten antibodies and uses thereof |
US10329556B2 (en) | 2014-05-13 | 2019-06-25 | Bioatla, Llc | Conditionally active biological proteins |
WO2015175375A1 (en) | 2014-05-13 | 2015-11-19 | Short Jay M | Conditionally active biological proteins |
WO2015179658A2 (en) | 2014-05-22 | 2015-11-26 | Genentech, Inc. | Anti-gpc3 antibodies and immunoconjugates |
WO2015179835A2 (en) | 2014-05-23 | 2015-11-26 | Genentech, Inc. | Mit biomarkers and methods using the same |
US11319567B2 (en) | 2014-05-27 | 2022-05-03 | Academia Sinica | Fucosidase from bacteroides and methods using the same |
US11884739B2 (en) | 2014-05-27 | 2024-01-30 | Academia Sinica | Anti-CD20 glycoantibodies and uses thereof |
US10118969B2 (en) | 2014-05-27 | 2018-11-06 | Academia Sinica | Compositions and methods relating to universal glycoforms for enhanced antibody efficacy |
US10023892B2 (en) | 2014-05-27 | 2018-07-17 | Academia Sinica | Compositions and methods relating to universal glycoforms for enhanced antibody efficacy |
US10005847B2 (en) | 2014-05-27 | 2018-06-26 | Academia Sinica | Anti-HER2 glycoantibodies and uses thereof |
US10618973B2 (en) | 2014-05-27 | 2020-04-14 | Academia Sinica | Anti-HER2 glycoantibodies and uses thereof |
US11332523B2 (en) | 2014-05-28 | 2022-05-17 | Academia Sinica | Anti-TNF-alpha glycoantibodies and uses thereof |
EP3613433A1 (en) | 2014-05-30 | 2020-02-26 | Henlix Biotech Co., Ltd. | Anti-epidermal growth factor receptor (egfr) antibodies |
US10584171B2 (en) | 2014-05-30 | 2020-03-10 | Henlix Biotech Co., Ltd. | Anti-epidermal growth factor receptor (EGFR) antibodies |
US11261255B2 (en) | 2014-05-30 | 2022-03-01 | Shanghai Henlius Biotech, Inc. | Anti-epidermal growth factor receptor (EGFR) antibodies |
WO2015191715A1 (en) | 2014-06-11 | 2015-12-17 | Genentech, Inc. | Anti-lgr5 antibodies and uses thereof |
US11123426B2 (en) | 2014-06-11 | 2021-09-21 | The Trustees Of Dartmouth College | Use of vista agonists and antagonists to suppress or enhance humoral immunity |
WO2015191986A1 (en) | 2014-06-13 | 2015-12-17 | Genentech, Inc. | Methods of treating and preventing cancer drug resistance |
WO2015195835A2 (en) | 2014-06-17 | 2015-12-23 | The Regents Of The University Of California | Improved alpha-v beta-8 antibodies |
EP4285917A2 (en) | 2014-06-18 | 2023-12-06 | Mersana Therapeutics, Inc. | Monoclonal antibodies against her2 epitope and methods of use thereof |
WO2015195917A1 (en) | 2014-06-18 | 2015-12-23 | Mersana Therapeutics, Inc. | Monoclonal antibodies against her2 epitope and methods of use thereof |
US11673968B2 (en) | 2014-06-26 | 2023-06-13 | Hoffmann-La Roche Inc. | Anti-BRDU antibodies and methods of use |
US10251952B2 (en) | 2014-06-26 | 2019-04-09 | Hoffmann-La Roche Inc. | Humanized anti-tau(pS422) antibody brain shuttles and use thereof |
WO2016001140A1 (en) | 2014-06-30 | 2016-01-07 | Affiris Ag | Vaccines and monoclonal antibodies targeting truncated variants of osteopontin and uses thereof |
US11279752B2 (en) | 2014-07-03 | 2022-03-22 | City Of Hope | Tumor-selective CTLA-4 antagonists |
US10414814B2 (en) | 2014-07-03 | 2019-09-17 | City Of Hope | Tumor-selective CTLA-4 antagonists |
US10406197B2 (en) | 2014-07-10 | 2019-09-10 | Affiris Ag | Substances and methods for the use in prevention and/or treatment in Huntington's disease |
WO2016007775A1 (en) | 2014-07-11 | 2016-01-14 | Genentech, Inc. | Notch pathway inhibition |
EP3309174A1 (en) | 2014-07-11 | 2018-04-18 | Genentech, Inc. | Anti-pd-l1 antibodies and diagnostic uses thereof |
WO2016007235A1 (en) | 2014-07-11 | 2016-01-14 | Genentech, Inc. | Anti-pd-l1 antibodies and diagnostic uses thereof |
US11084875B2 (en) | 2014-08-08 | 2021-08-10 | Alector Llc | Anti-TREM2 antibodies and methods of use thereof |
EP4066859A1 (en) | 2014-08-08 | 2022-10-05 | Alector LLC | Anti-trem2 antibodies and methods of use thereof |
WO2016029079A2 (en) | 2014-08-21 | 2016-02-25 | Walter Reed Army Institute Of Research Department Of The Army | Monoclonal antibodies for treatment of microbial infections |
WO2016033331A1 (en) | 2014-08-28 | 2016-03-03 | Bioatla, Llc | Conditionally active chimeric antigen receptors for modified t-cells |
US11111288B2 (en) | 2014-08-28 | 2021-09-07 | Bioatla, Inc. | Conditionally active chimeric antigen receptors for modified t-cells |
EP4074735A1 (en) | 2014-08-28 | 2022-10-19 | BioAtla, Inc. | Conditionally active chimeric antigen receptors for modified t-cells |
US11584927B2 (en) | 2014-08-28 | 2023-02-21 | Bioatla, Inc. | Conditionally active chimeric antigen receptors for modified T-cells |
US10513699B2 (en) | 2014-09-03 | 2019-12-24 | Bioatla, Llc | Discovering and producing conditionally active biologic proteins in the same eukaryotic cell production hosts |
US10533034B2 (en) | 2014-09-08 | 2020-01-14 | Academia Sinica | Human iNKT cell activation using glycolipids |
US9879042B2 (en) | 2014-09-08 | 2018-01-30 | Academia Sinica | Human iNKT cell activation using glycolipids |
EP3782654A1 (en) | 2014-09-12 | 2021-02-24 | Genentech, Inc. | Anti-her2 antibodies and immunoconjugates |
WO2016040868A1 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Anti-cll-1 antibodies and immunoconjugates |
WO2016040856A2 (en) | 2014-09-12 | 2016-03-17 | Genentech, Inc. | Cysteine engineered antibodies and conjugates |
EP3693391A1 (en) | 2014-09-12 | 2020-08-12 | Genentech, Inc. | Anti-cll-1 antibodies and immunoconjugates |
US10059768B2 (en) | 2014-09-12 | 2018-08-28 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
US11286302B2 (en) | 2014-09-12 | 2022-03-29 | Genentech, Inc. | Anti-B7-H4 antibodies and immunoconjugates |
US11370833B2 (en) | 2014-09-15 | 2022-06-28 | Genentech, Inc. | Antibody formulations |
WO2016044396A1 (en) | 2014-09-17 | 2016-03-24 | Genentech, Inc. | Immunoconjugates comprising anti-her2 antibodies and pyrrolobenzodiazepines |
WO2016041082A1 (en) | 2014-09-17 | 2016-03-24 | CDRD Ventures, Inc. | Cytotoxic and anti-mitotic compounds, and methods of using the same |
EP4029873A1 (en) | 2014-09-17 | 2022-07-20 | Zymeworks Inc. | Cytotoxic and anti-mitotic compounds, and methods of using the same |
EP3689910A2 (en) | 2014-09-23 | 2020-08-05 | F. Hoffmann-La Roche AG | Method of using anti-cd79b immunoconjugates |
US10717778B2 (en) | 2014-09-29 | 2020-07-21 | Duke University | Bispecific molecules comprising an HIV-1 envelope targeting arm |
WO2016061389A2 (en) | 2014-10-16 | 2016-04-21 | Genentech, Inc. | Anti-alpha-synuclein antibodies and methods of use |
WO2016059602A2 (en) | 2014-10-16 | 2016-04-21 | Glaxo Group Limited | Methods of treating cancer and related compositions |
US10767232B2 (en) | 2014-11-03 | 2020-09-08 | Genentech, Inc. | Methods and biomarkers for predicting efficacy and evaluation of an OX40 agonist treatment |
US10845364B2 (en) | 2014-11-03 | 2020-11-24 | Genentech, Inc. | Assays for detecting T cell immune subsets and methods of use thereof |
WO2016073378A1 (en) | 2014-11-03 | 2016-05-12 | Genentech, Inc. | Assays for detecting t cell immune subsets and methods of use thereof |
WO2016073685A1 (en) | 2014-11-05 | 2016-05-12 | Annexon, Inc. | Humanized anti-complement factor c1q antibodies and uses thereof |
WO2016073794A1 (en) | 2014-11-05 | 2016-05-12 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
US10208120B2 (en) | 2014-11-05 | 2019-02-19 | Genentech, Inc. | Anti-FGFR2/3 antibodies and methods using same |
WO2016073791A1 (en) | 2014-11-05 | 2016-05-12 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
US10066002B2 (en) | 2014-11-05 | 2018-09-04 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
US10112994B2 (en) | 2014-11-05 | 2018-10-30 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
EP4295911A2 (en) | 2014-11-05 | 2023-12-27 | Annexon, Inc. | Humanized anti-complement factor c1q antibodies and uses thereof |
US11091530B2 (en) | 2014-11-05 | 2021-08-17 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
US11299539B2 (en) | 2014-11-05 | 2022-04-12 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
EP3753948A1 (en) | 2014-11-05 | 2020-12-23 | Genentech, Inc. | Methods of producing two chain proteins in bacteria |
WO2016073157A1 (en) | 2014-11-06 | 2016-05-12 | Genentech, Inc. | Anti-ang2 antibodies and methods of use thereof |
EP3611188A1 (en) | 2014-11-06 | 2020-02-19 | F. Hoffmann-La Roche AG | Fc-region variants with modified fcrn-binding and methods of use |
EP3842453A1 (en) | 2014-11-06 | 2021-06-30 | F. Hoffmann-La Roche AG | Fc-region variants with modified fcrn- and protein a-binding properties |
EP3783023A1 (en) | 2014-11-10 | 2021-02-24 | H. Hoffnabb-La Roche Ag | Anti-interleukin-33 antibodies and uses thereof |
EP3552488A1 (en) | 2014-11-10 | 2019-10-16 | F. Hoffmann-La Roche AG | Animal model for nephropathy and agents for treating the same |
WO2016077369A1 (en) | 2014-11-10 | 2016-05-19 | Genentech, Inc. | Animal model for nephropathy and agents for treating the same |
WO2016077381A1 (en) | 2014-11-10 | 2016-05-19 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
WO2016081384A1 (en) | 2014-11-17 | 2016-05-26 | Genentech, Inc. | Combination therapy comprising ox40 binding agonists and pd-1 axis binding antagonists |
WO2016079708A1 (en) | 2014-11-19 | 2016-05-26 | Nestec S.A. | Antibodies against serotonin, tryptophan and kynurenine metabolites and uses thereof |
EP3845565A2 (en) | 2014-11-19 | 2021-07-07 | Genentech, Inc. | Antibodies against bace1 and use thereof for neural disease immunotherapy |
WO2016081639A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Antibodies against bace1 and use thereof for neural disease immunotherapy |
WO2016081640A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Anti-transferrin receptor / anti-bace1 multispecific antibodies and methods of use |
WO2016081643A1 (en) | 2014-11-19 | 2016-05-26 | Genentech, Inc. | Anti-transferrin receptor antibodies and methods of use |
EP4141032A1 (en) | 2014-11-20 | 2023-03-01 | F. Hoffmann-La Roche AG | Combination therapy of t cell activating bispecific antigen binding molecules and pd-1 axis binding antagonists |
EP3789402A1 (en) | 2014-11-20 | 2021-03-10 | F. Hoffmann-La Roche AG | Combination therapy of t cell activating bispecific antigen binding molecules and pd-1 axis binding antagonists |
WO2016087514A1 (en) | 2014-12-02 | 2016-06-09 | Cemm - Forschungszentrum Für Molekulare Medizin Gmbh | Anti-mutant calreticulin antibodies and their use in the diagnosis and therapy of myeloid malignancies |
US10370455B2 (en) | 2014-12-05 | 2019-08-06 | Immunext, Inc. | Identification of VSIG8 as the putative VISTA receptor (V-R) and use thereof to produce VISTA/VSIG8 agonists and antagonists |
WO2016090210A1 (en) | 2014-12-05 | 2016-06-09 | Genentech, Inc. | ANTI-CD79b ANTIBODIES AND METHODS OF USE |
WO2016094566A2 (en) | 2014-12-10 | 2016-06-16 | Genentech, Inc. | Blood brain barrier receptor antibodies and methods of use |
EP3633371A1 (en) | 2014-12-18 | 2020-04-08 | F. Hoffmann-La Roche AG | Assay and method for determining cdc eliciting antibodies |
EP3981794A1 (en) | 2014-12-19 | 2022-04-13 | Chugai Seiyaku Kabushiki Kaisha | Anti-c5 antibodies and methods of use |
WO2016098356A1 (en) | 2014-12-19 | 2016-06-23 | Chugai Seiyaku Kabushiki Kaisha | Anti-c5 antibodies and methods of use |
US11926652B2 (en) | 2015-01-13 | 2024-03-12 | City Of Hope | CTLA4-binding protein peptide-linker masks |
WO2016115275A1 (en) | 2015-01-13 | 2016-07-21 | City Of Hope | Ctla4-binding protein peptide-linker masks |
EP3733696A1 (en) | 2015-01-13 | 2020-11-04 | City of Hope | Ctla4-binding protein peptide-linker masks |
US10689423B2 (en) | 2015-01-13 | 2020-06-23 | City Of Hope | CTLA4-binding protein peptide-linker masks |
EP3795168A1 (en) | 2015-01-16 | 2021-03-24 | City of Hope | Cell penetrating antibodies |
US10495645B2 (en) | 2015-01-16 | 2019-12-03 | Academia Sinica | Cancer markers and methods of use thereof |
US9975965B2 (en) | 2015-01-16 | 2018-05-22 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
WO2016114819A1 (en) | 2015-01-16 | 2016-07-21 | Academia Sinica | Compositions and methods for treatment and detection of cancers |
WO2016117346A1 (en) | 2015-01-22 | 2016-07-28 | Chugai Seiyaku Kabushiki Kaisha | A combination of two or more anti-c5 antibodies and methods of use |
US10342858B2 (en) | 2015-01-24 | 2019-07-09 | Academia Sinica | Glycan conjugates and methods of use thereof |
WO2016118961A1 (en) | 2015-01-24 | 2016-07-28 | Academia Sinica | Cancer markers and methods of use thereof |
US11236391B2 (en) | 2015-01-28 | 2022-02-01 | Genentech, Inc. | Gene expression markers and treatment of multiple sclerosis |
WO2016123329A2 (en) | 2015-01-28 | 2016-08-04 | Genentech, Inc. | Gene expression markers and treatment of multiple sclerosis |
WO2016123593A1 (en) | 2015-01-30 | 2016-08-04 | Academia Sinica | Compositions and methods relating to universal glycoforms for enhanced antibody efficacy |
EP4223873A2 (en) | 2015-01-31 | 2023-08-09 | The Trustees of the University of Pennsylvania | Compositions and methods for t cell delivery of therapeutic molecules |
US10828353B2 (en) | 2015-01-31 | 2020-11-10 | The Trustees Of The University Of Pennsylvania | Compositions and methods for T cell delivery of therapeutic molecules |
WO2016126972A1 (en) | 2015-02-04 | 2016-08-11 | Genentech, Inc. | Mutant smoothened and methods of using the same |
EP3816179A2 (en) | 2015-02-05 | 2021-05-05 | Chugai Seiyaku Kabushiki Kaisha | Fc region variant comprising a modified fcrn-binding domain |
US11180548B2 (en) | 2015-02-05 | 2021-11-23 | Chugai Seiyaku Kabushiki Kaisha | Methods of neutralizing IL-8 biological activity |
WO2016125495A1 (en) | 2015-02-05 | 2016-08-11 | Chugai Seiyaku Kabushiki Kaisha | Antibodies comprising an ion concentration dependent antigen-binding domain, fc region variants, il-8-binding antibodies, and uses therof |
WO2016138207A1 (en) | 2015-02-26 | 2016-09-01 | Genentech, Inc. | Integrin beta7 antagonists and methods of treating crohn's disease |
EP3978530A1 (en) | 2015-02-26 | 2022-04-06 | F. Hoffmann-La Roche AG | Integrin beta7 antagonists and methods of treating crohn's disease |
US10073098B2 (en) | 2015-03-06 | 2018-09-11 | Genentech, Inc. | Ultrapurified DsbA and DsbC and methods of making and using the same |
EP3636749A1 (en) | 2015-03-06 | 2020-04-15 | F. Hoffmann-La Roche AG | Ultrapurified dsba and dsbc and methods of making and using the same |
US10690671B2 (en) | 2015-03-06 | 2020-06-23 | Genentech, Inc. | Ultrapurified DsbA and DsbC and methods of making and using the same |
WO2016144824A1 (en) | 2015-03-06 | 2016-09-15 | Genentech, Inc. | Ultrapurified dsba and dsbc and methods of making and using the same |
US10214522B2 (en) | 2015-03-10 | 2019-02-26 | The Regents Of The University Of California | Anti-alphavbeta1 integrin inhibitors and methods of use |
WO2016149276A1 (en) | 2015-03-16 | 2016-09-22 | Genentech, Inc. | Methods of detecting and quantifying il-13 and uses in diagnosing and treating th2-associated diseases |
WO2016146833A1 (en) | 2015-03-19 | 2016-09-22 | F. Hoffmann-La Roche Ag | Biomarkers for nad(+)-diphthamide adp ribosyltransferase resistance |
US11897952B2 (en) | 2015-03-30 | 2024-02-13 | City Of Hope | Mechanically interlocking complexes |
US10011658B2 (en) | 2015-04-03 | 2018-07-03 | Eureka Therapeutics, Inc. | Constructs targeting AFP peptide/MHC complexes and uses thereof |
EP3929211A1 (en) | 2015-04-06 | 2021-12-29 | Acceleron Pharma Inc. | Alk4:actriib heteromultimers and uses thereof |
WO2016164497A1 (en) | 2015-04-06 | 2016-10-13 | Acceleron Pharma Inc. | Alk4:actriib heteromultimers and uses thereof |
WO2016164503A1 (en) | 2015-04-06 | 2016-10-13 | Acceleron Pharma Inc. | Alk7:actriib heteromultimers and uses thereof |
EP3828199A1 (en) | 2015-04-06 | 2021-06-02 | Acceleron Pharma Inc. | Alk7: actriib heteromultimers and uses thereof |
WO2016164480A1 (en) | 2015-04-07 | 2016-10-13 | Genentech, Inc. | Antigen binding complex having agonistic activity and methods of use |
US10428150B2 (en) | 2015-04-07 | 2019-10-01 | Alector Llc | Anti-sortilin antibodies and methods of use thereof |
US10087255B2 (en) | 2015-04-07 | 2018-10-02 | Alector Llc | Anti-sortilin antibodies and methods of use thereof |
US11339223B2 (en) | 2015-04-07 | 2022-05-24 | Alector Llc | Methods of use of anti-Sortilin antibodies for treating a disease, disorder, or injury |
US11208488B2 (en) | 2015-04-07 | 2021-12-28 | Alector Llc | Methods of increasing progranulin levels using anti-Sortilin antibodies |
US11186645B2 (en) | 2015-04-07 | 2021-11-30 | Alector Llc | Isolated nucleic acids encoding anti-sortilin antibodies |
US10308718B2 (en) | 2015-04-07 | 2019-06-04 | Alector Llc | Anti-sortilin antibodies and methods of use thereof |
EP3991748A2 (en) | 2015-04-07 | 2022-05-04 | Alector LLC | Anti-sortilin antibodies and methods of use thereof |
US10865248B2 (en) | 2015-04-07 | 2020-12-15 | Genentech, Inc. | Antigen binding complex having agonistic activity and methods of use |
WO2016166348A1 (en) | 2015-04-17 | 2016-10-20 | Elsalys Biotech | Anti-tyro3 antibodies and uses thereof |
US10357488B2 (en) | 2015-04-20 | 2019-07-23 | Tolero Pharmaceuticals, Inc. | Predicting response to alvocidib by mitochondrial profiling |
US10624880B2 (en) | 2015-04-20 | 2020-04-21 | Tolero Pharmaceuticals, Inc. | Predicting response to alvocidib by mitochondrial profiling |
EP3913052A1 (en) | 2015-04-24 | 2021-11-24 | F. Hoffmann-La Roche AG | Methods of identifying bacteria comprising binding polypeptides |
WO2016172551A2 (en) | 2015-04-24 | 2016-10-27 | Genentech, Inc. | Methods of identifying bacteria comprising binding polypeptides |
US11867688B2 (en) | 2015-04-27 | 2024-01-09 | Dana-Farber Cancer Institute, Inc. | High throughput BH3 profiling: a rapid and scalable technology to BH3 profile on low numbers of cells |
US10761086B2 (en) | 2015-04-27 | 2020-09-01 | Dana-Farber Cancer Institute, Inc. | High throughput BH3 profiling: a rapid and scalable technology to BH3 profile on low numbers of cells |
EP3936524A2 (en) | 2015-05-11 | 2022-01-12 | F. Hoffmann-La Roche AG | Compositions and methods of treating lupus nephritis |
EP4238994A2 (en) | 2015-05-11 | 2023-09-06 | F. Hoffmann-La Roche AG | Compositions and methods of treating lupus nephritis |
EP3783029A1 (en) | 2015-05-12 | 2021-02-24 | F. Hoffmann-La Roche AG | Therapeutic and diagnostic methods for cancer |
WO2016187158A1 (en) | 2015-05-15 | 2016-11-24 | City Of Hope | Chimeric antigen receptor compositions |
EP3842448A1 (en) | 2015-05-15 | 2021-06-30 | City of Hope | Chimeric antigen receptor compositions |
EP4292664A2 (en) | 2015-05-15 | 2023-12-20 | The General Hospital Corporation | Antagonistic anti-tumor necrosis factor receptor superfamily antibodies |
EP3447075A2 (en) | 2015-05-15 | 2019-02-27 | The General Hospital Corporation | Antagonistic anti-tumor necrosis factor receptor superfamily antibodies |
US10562925B2 (en) | 2015-05-18 | 2020-02-18 | Tolero Pharmaceuticals, Inc. | Alvocidib prodrugs having increased bioavailability |
US10259835B2 (en) | 2015-05-18 | 2019-04-16 | Tolero Pharmaceuticals, Inc. | Alvocidib prodrugs having increased bioavailability |
WO2016189091A1 (en) | 2015-05-26 | 2016-12-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods and pharmaceutical compositions (ntsr1 inhibitors) for the treatment of hepatocellular carcinomas |
WO2016189045A1 (en) | 2015-05-27 | 2016-12-01 | Ucb Biopharma Sprl | Method for the treatment of neurological disease |
WO2016191750A1 (en) | 2015-05-28 | 2016-12-01 | Genentech, Inc. | Cell-based assay for detecting anti-cd3 homodimers |
WO2016189118A1 (en) | 2015-05-28 | 2016-12-01 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods of prognosis and treatment of patients suffering from acute myeloid leukemia |
US10690678B2 (en) | 2015-05-28 | 2020-06-23 | Genentech, Inc. | Cell-based assay for detecting anti-CD3 homodimers |
EP3795679A1 (en) | 2015-05-28 | 2021-03-24 | Genentech, Inc. | Cell-based assay for detecting anti-cd3 homodimers |
WO2016196298A1 (en) | 2015-05-29 | 2016-12-08 | Genentech, Inc. | Therapeutic and diagnolstic methods for cancer |
WO2016196381A1 (en) | 2015-05-29 | 2016-12-08 | Genentech, Inc. | Pd-l1 promoter methylation in cancer |
EP3763827A1 (en) | 2015-05-29 | 2021-01-13 | F. Hoffmann-La Roche AG | Pd-l1 promoter methylation in cancer |
EP3708681A1 (en) | 2015-05-29 | 2020-09-16 | F. Hoffmann-La Roche AG | Therapeutic and diagnostic methods for cancer |
EP4335931A2 (en) | 2015-05-29 | 2024-03-13 | F. Hoffmann-La Roche AG | Therapeutic and diagnostic methods for cancer |
WO2016196343A1 (en) | 2015-05-29 | 2016-12-08 | Genentech, Inc. | Humanized anti-ebola virus glycoprotein antibodies and methods of use |
US11254987B2 (en) | 2015-05-29 | 2022-02-22 | Genentech, Inc. | PD-L1 promoter methylation in cancer |
WO2016196679A1 (en) | 2015-06-02 | 2016-12-08 | Genentech, Inc. | Compositions and methods for using anti-il-34 antibodies to treat neurological diseases |
WO2016196726A1 (en) | 2015-06-05 | 2016-12-08 | Genentech, Inc. | Anti-tau antibodies and methods of use |
WO2016200835A1 (en) | 2015-06-08 | 2016-12-15 | Genentech, Inc. | Methods of treating cancer using anti-ox40 antibodies and pd-1 axis binding antagonists |
WO2016200836A1 (en) | 2015-06-08 | 2016-12-15 | Genentech, Inc. | Methods of treating cancer using anti-ox40 antibodies |
WO2016201388A2 (en) | 2015-06-12 | 2016-12-15 | Alector Llc | Anti-cd33 antibodies and methods of use thereof |
WO2016201389A2 (en) | 2015-06-12 | 2016-12-15 | Alector Llc | Anti-cd33 antibodies and methods of use thereof |
US11174313B2 (en) | 2015-06-12 | 2021-11-16 | Alector Llc | Anti-CD33 antibodies and methods of use thereof |
US11136390B2 (en) | 2015-06-12 | 2021-10-05 | Alector Llc | Anti-CD33 antibodies and methods of use thereof |
WO2016205176A1 (en) | 2015-06-15 | 2016-12-22 | Genentech, Inc. | Antibodies and immunoconjugates |
EP3916018A1 (en) | 2015-06-16 | 2021-12-01 | Genentech, Inc. | Anti-cd3 antibodies and methods of use |
EP4299073A2 (en) | 2015-06-16 | 2024-01-03 | F. Hoffmann-La Roche AG | Humanized and affinity matured antibodies to fcrh5 and methods of use |
WO2016204966A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Anti-cd3 antibodies and methods of use |
WO2016205520A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Humanized and affinity matured antibodies to fcrh5 and methods of use |
WO2016205200A1 (en) | 2015-06-16 | 2016-12-22 | Genentech, Inc. | Anti-cll-1 antibodies and methods of use |
WO2016205320A1 (en) | 2015-06-17 | 2016-12-22 | Genentech, Inc. | Methods of treating locally advanced or metastatic breast cancers using pd-1 axis binding antagonists and taxanes |
US10774145B2 (en) | 2015-06-17 | 2020-09-15 | Allakos Inc. | Methods and compositions for treating fibrotic diseases |
WO2016205531A2 (en) | 2015-06-17 | 2016-12-22 | Genentech, Inc. | Anti-her2 antibodies and methods of use |
EP3722314A1 (en) | 2015-06-24 | 2020-10-14 | Janssen Pharmaceutica NV | Anti-vista antibodies and fragments |
US11009509B2 (en) | 2015-06-24 | 2021-05-18 | Janssen Pharmaceutica Nv | Anti-VISTA antibodies and fragments |
WO2016207717A1 (en) | 2015-06-24 | 2016-12-29 | Janssen Pharmaceutica Nv | Anti-vista antibodies and fragments |
US10822402B2 (en) | 2015-06-24 | 2020-11-03 | Hoffmann-La Roche Inc. | Humanized anti-tau(pS422) antibodies and methods of use |
WO2016207124A1 (en) | 2015-06-25 | 2016-12-29 | F. Hoffmann-La Roche Ag | Cell based assay for determining antibody or ligand binding and function |
EP3514174A1 (en) | 2015-06-29 | 2019-07-24 | Ventana Medical Systems, Inc. | Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin |
EP3978525A1 (en) | 2015-06-29 | 2022-04-06 | Ventana Medical Systems, Inc. | Materials and methods for performing histochemical assays for human pro-epiregulin and amphiregulin |
WO2017004091A1 (en) | 2015-06-29 | 2017-01-05 | Genentech, Inc. | Type ii anti-cd20 antibody for use in organ transplantation |
US10682356B2 (en) | 2015-08-03 | 2020-06-16 | Tolero Pharmaceuticals, Inc. | Combination therapies for treatment of cancer |
US10568887B2 (en) | 2015-08-03 | 2020-02-25 | Tolero Pharmaceuticals, Inc. | Combination therapies for treatment of cancer |
US10835537B2 (en) | 2015-08-03 | 2020-11-17 | Sumitomo Dainippon Pharma Oncology, Inc. | Combination therapies for treatment of cancer |
US11312936B2 (en) | 2015-08-04 | 2022-04-26 | Regeneron Pharmaceuticals, Inc. | Taurine supplemented cell culture medium and methods of use |
US10927342B2 (en) | 2015-08-04 | 2021-02-23 | Regeneran Pharmaceuticals, Inc. | Taurine supplemented cell culture medium and methods of use |
US11661463B2 (en) | 2015-08-06 | 2023-05-30 | City Of Hope | Cell penetrating protein-antibody conjugates and methods of use |
WO2017024238A1 (en) | 2015-08-06 | 2017-02-09 | City Of Hope | Cell penetrating protein-antibody conjugates and methods of use |
EP3896091A1 (en) | 2015-08-11 | 2021-10-20 | Legend Biotech Ireland Limited | Chimeric antigen receptors targeting bcma and methods of use thereof |
EP4063397A1 (en) | 2015-08-11 | 2022-09-28 | Legend Biotech Ireland Limited | Chimeric antigen receptors based on single-domain antibodies and methods of use thereof |
EP4282877A2 (en) | 2015-08-11 | 2023-11-29 | Legend Biotech Ireland Limited | Chimeric antigen receptors targeting bcma and methods of use thereof |
EP4282878A2 (en) | 2015-08-11 | 2023-11-29 | Legend Biotech Ireland Limited | Chimeric antigen receptors targeting bcma and methods of use thereof |
US11649435B2 (en) | 2015-08-28 | 2023-05-16 | The Trustees Of The University Of Pennsylvania | Methods and compositions for cells expressing a chimeric intracellular signaling molecule |
WO2017040195A1 (en) | 2015-08-28 | 2017-03-09 | The Trustees Of The University Of Pennsylvania | Methods and compositions for cells expressing a chimeric intracellular signaling molecule |
WO2017040301A1 (en) | 2015-08-28 | 2017-03-09 | Alector Llc | Anti-siglec-7 antibodies and methods of use thereof |
US10590198B2 (en) | 2015-08-28 | 2020-03-17 | Alector Llc | Anti-siglec-7 antibodies and methods of use thereof |
US11890301B2 (en) | 2015-08-28 | 2024-02-06 | The Trustees Of The University Of Pennsylvania | Methods and compositions for cells expressing a chimeric intracellular signaling molecule |
US11390680B2 (en) | 2015-08-28 | 2022-07-19 | Alector Llc | Anti-Siglec-7 antibodies and methods of use thereof |
EP4223784A2 (en) | 2015-09-02 | 2023-08-09 | The Regents of the University of Colorado, a body corporate | Compositions and methods for modulating t-cell mediated immune response |
WO2017041004A1 (en) | 2015-09-02 | 2017-03-09 | The Regents Of The University Of Colorado, A Body Corporate | Compositions and methods for modulating t-cell mediated immune response |
US10935544B2 (en) | 2015-09-04 | 2021-03-02 | Obi Pharma, Inc. | Glycan arrays and method of use |
WO2017046994A1 (en) | 2015-09-18 | 2017-03-23 | Chugai Seiyaku Kabushiki Kaisha | Il-8-binding antibodies and uses thereof |
WO2017050729A1 (en) | 2015-09-22 | 2017-03-30 | Spring Bioscience Corporation | Anti-ox40 antibodies and diagnostic uses thereof |
WO2017053807A2 (en) | 2015-09-23 | 2017-03-30 | Genentech, Inc. | Optimized variants of anti-vegf antibodies |
EP3662930A1 (en) | 2015-09-24 | 2020-06-10 | AbVitro LLC | Hiv antibody compositions and methods of use |
WO2017053906A1 (en) | 2015-09-24 | 2017-03-30 | Abvitro Llc | Hiv antibody compositions and methods of use |
US11421026B2 (en) | 2015-09-30 | 2022-08-23 | Bird Rock Bio, Inc. | Antibodies that bind human cannabinoid 1 (CB1) receptor |
WO2017058771A1 (en) | 2015-09-30 | 2017-04-06 | Bird Rock Bio, Inc. | Antibodies that bind human cannabinoid 1 (cb1) recetor |
US11286300B2 (en) | 2015-10-01 | 2022-03-29 | Hoffmann-La Roche Inc. | Humanized anti-human CD19 antibodies and methods of use |
WO2017055399A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Cellular based fret assay for the determination of simultaneous binding |
WO2017059289A1 (en) | 2015-10-02 | 2017-04-06 | Genentech, Inc. | Pyrrolobenzodiazepine antibody drug conjugates and methods of use |
WO2017055443A1 (en) | 2015-10-02 | 2017-04-06 | F. Hoffmann-La Roche Ag | Anti-pd1 antibodies and methods of use |
WO2017062682A2 (en) | 2015-10-06 | 2017-04-13 | Genentech, Inc. | Method for treating multiple sclerosis |
WO2017062672A2 (en) | 2015-10-06 | 2017-04-13 | Alector Llc | Anti-trem2 antibodies and methods of use thereof |
WO2017064034A1 (en) | 2015-10-12 | 2017-04-20 | INSERM (Institut National de la Santé et de la Recherche Médicale) | An agent capable of depleting cd8 t cells for the treatment of myocardial infarction or acute myocardial infarction |
WO2017064675A1 (en) | 2015-10-16 | 2017-04-20 | Genentech, Inc. | Hindered disulfide drug conjugates |
WO2017068511A1 (en) | 2015-10-20 | 2017-04-27 | Genentech, Inc. | Calicheamicin-antibody-drug conjugates and methods of use |
US10604577B2 (en) | 2015-10-22 | 2020-03-31 | Allakos Inc. | Methods and compositions for treating systemic mastocytosis |
US11492396B2 (en) | 2015-10-27 | 2022-11-08 | UCB Biopharma SRL | Methods of treatment using anti-IL-17A/F antibodies |
US10800844B2 (en) | 2015-10-29 | 2020-10-13 | Alector Llc | Anti-Siglec-9 antibodies and methods of use thereof |
WO2017075432A2 (en) | 2015-10-29 | 2017-05-04 | Alector Llc | Anti-siglec-9 antibodies and methods of use thereof |
EP3184547A1 (en) | 2015-10-29 | 2017-06-28 | F. Hoffmann-La Roche AG | Anti-tpbg antibodies and methods of use |
WO2017072210A1 (en) | 2015-10-29 | 2017-05-04 | F. Hoffmann-La Roche Ag | Anti-variant fc-region antibodies and methods of use |
US11667710B2 (en) | 2015-10-29 | 2023-06-06 | Alector Llc | Anti-Siglec-9 antibodies and methods of use thereof |
EP3922649A1 (en) | 2015-10-30 | 2021-12-15 | F. Hoffmann-La Roche AG | Anti-htra1 antibodies and methods of use thereof |
WO2017075173A2 (en) | 2015-10-30 | 2017-05-04 | Genentech, Inc. | Anti-factor d antibodies and conjugates |
EP3165532A2 (en) | 2015-11-03 | 2017-05-10 | Industrial Technology Research Institute | Auristatin derivatives, linker-drugs and ligand-drug conjugates |
EP3165237A1 (en) | 2015-11-03 | 2017-05-10 | Industrial Technology Research Institute | Antibody-drug conjugate (adc) and method for forming the same |
WO2017079768A1 (en) | 2015-11-08 | 2017-05-11 | Genentech, Inc. | Methods of screening for multispecific antibodies |
WO2017088734A1 (en) | 2015-11-23 | 2017-06-01 | 四川科伦博泰生物医药股份有限公司 | Anti-erbb2 antibody-drug conjugate and composition thereof, preparation method therefor, and application thereof |
EP3178848A1 (en) | 2015-12-09 | 2017-06-14 | F. Hoffmann-La Roche AG | Type ii anti-cd20 antibody for reducing formation of anti-drug antibodies |
EP4026848A1 (en) | 2015-12-09 | 2022-07-13 | F. Hoffmann-La Roche AG | Type ii anti-cd20 antibody for reducing the cytokine release syndrome |
WO2017100714A1 (en) | 2015-12-10 | 2017-06-15 | City Of Hope | Cell penetrating cyanine-coupled antibodies |
EP4342529A2 (en) | 2015-12-18 | 2024-03-27 | Chugai Seiyaku Kabushiki Kaisha | Anti-c5 antibodies and methods of use |
WO2017104779A1 (en) | 2015-12-18 | 2017-06-22 | Chugai Seiyaku Kabushiki Kaisha | Anti-c5 antibodies and methods of use |
WO2017112917A1 (en) | 2015-12-24 | 2017-06-29 | Corvus Pharmaceuticals, Inc. | Methods of treating cancer |
US10525137B2 (en) | 2015-12-30 | 2020-01-07 | Genentech, Inc. | Formulations with reduced degradation of polysorbate |
WO2017117311A1 (en) | 2015-12-30 | 2017-07-06 | Genentech, Inc. | Formulations with reduced degradation of polysorbate |
WO2017117304A1 (en) | 2015-12-30 | 2017-07-06 | Genentech, Inc. | Use of tryptophan derivatives for protein formulations |
US10933141B2 (en) | 2015-12-30 | 2021-03-02 | Genentech, Inc. | Formulations with reduced degradation of polysorbate |
EP3862365A1 (en) | 2016-01-08 | 2021-08-11 | F. Hoffmann-La Roche AG | Methods of treating cea-positive cancers using pd-1 axis binding antagonists and anti-cea/anti-cd3 bispecific antibodies |
WO2017122098A2 (en) | 2016-01-10 | 2017-07-20 | Neotx Therapeutics Ltd. | Methods and compositions for enhancing the potency of superantigen mediated cancer immunotherapy. |
WO2017127764A1 (en) | 2016-01-20 | 2017-07-27 | Genentech, Inc. | High dose treatments for alzheimer's disease |
US11513127B2 (en) | 2016-01-25 | 2022-11-29 | Genentech, Inc. | Methods for assaying T-cell dependent bispecific antibodies |
WO2017132279A1 (en) | 2016-01-25 | 2017-08-03 | Genentech, Inc. | Methods for assaying t-cell dependent bispecific antibodies |
WO2017136558A1 (en) | 2016-02-04 | 2017-08-10 | Curis, Inc. | Mutant smoothened and methods of using the same |
WO2017137830A1 (en) | 2016-02-12 | 2017-08-17 | Janssen Pharmaceutica Nv | Anti-vista (b7h5) antibodies |
US10899836B2 (en) | 2016-02-12 | 2021-01-26 | Janssen Pharmaceutica Nv | Method of identifying anti-VISTA antibodies |
EP4155415A1 (en) | 2016-02-29 | 2023-03-29 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2017151502A1 (en) | 2016-02-29 | 2017-09-08 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2017152102A2 (en) | 2016-03-04 | 2017-09-08 | Alector Llc | Anti-trem1 antibodies and methods of use thereof |
US10336784B2 (en) | 2016-03-08 | 2019-07-02 | Academia Sinica | Methods for modular synthesis of N-glycans and arrays thereof |
US10870701B2 (en) | 2016-03-15 | 2020-12-22 | Generon (Shanghai) Corporation Ltd. | Multispecific fab fusion proteins and use thereof |
WO2017165683A1 (en) | 2016-03-23 | 2017-09-28 | Novartis Ag | Cell secreted minibodies and uses thereof |
WO2017165734A1 (en) | 2016-03-25 | 2017-09-28 | Genentech, Inc. | Multiplexed total antibody and antibody-conjugated drug quantification assay |
US11844839B2 (en) | 2016-03-25 | 2023-12-19 | Seagen Inc. | Process for the preparation of pegylated drug-linkers and intermediates thereof |
EP4273551A2 (en) | 2016-03-25 | 2023-11-08 | F. Hoffmann-La Roche AG | Multiplexed total antibody and antibody-conjugated drug quantification assay |
US11041017B2 (en) | 2016-03-29 | 2021-06-22 | Obi Pharma, Inc. | Antibodies, pharmaceutical compositions and methods |
US10980894B2 (en) | 2016-03-29 | 2021-04-20 | Obi Pharma, Inc. | Antibodies, pharmaceutical compositions and methods |
US11833223B2 (en) | 2016-03-29 | 2023-12-05 | Obi Pharma, Inc. | Antibodies, pharmaceutical compositions and methods |
WO2017172771A2 (en) | 2016-03-29 | 2017-10-05 | Janssen Biotech, Inc. | Method of treating psoriasis with increased interval dosing of anti-il12/23 antibody |
WO2017173302A2 (en) | 2016-04-01 | 2017-10-05 | The Regents Of The University Of California | Inhibitors of integrin alpha 5 beta 1 and methods of use |
WO2017175058A1 (en) | 2016-04-07 | 2017-10-12 | Janssen Pharmaceutica Nv | Anti-vista antibodies and fragments, uses thereof, and methods of identifying same |
EP3865511A1 (en) | 2016-04-14 | 2021-08-18 | F. Hoffmann-La Roche AG | Anti-rspo3 antibodies and methods of use |
WO2017180864A1 (en) | 2016-04-14 | 2017-10-19 | Genentech, Inc. | Anti-rspo3 antibodies and methods of use |
US11603402B2 (en) | 2016-04-15 | 2023-03-14 | Immunext, Inc. | Anti-human vista antibodies and use thereof |
US11649283B2 (en) | 2016-04-15 | 2023-05-16 | Immunext, Inc. | Anti-human vista antibodies and use thereof |
US11897959B2 (en) | 2016-04-15 | 2024-02-13 | Bioatla, Inc. | Anti-AXL antibodies, antibody fragments and their immunoconjugates and uses thereof |
US11603403B2 (en) | 2016-04-15 | 2023-03-14 | Immunext, Inc. | Anti-human vista antibodies and use thereof |
WO2017181079A2 (en) | 2016-04-15 | 2017-10-19 | Genentech, Inc. | Methods for monitoring and treating cancer |
US11149088B2 (en) | 2016-04-15 | 2021-10-19 | Bioatla, Inc. | Anti-Axl antibodies, antibody fragments and their immunoconjugates and uses thereof |
WO2017181111A2 (en) | 2016-04-15 | 2017-10-19 | Genentech, Inc. | Methods for monitoring and treating cancer |
US11525000B2 (en) | 2016-04-15 | 2022-12-13 | Immunext, Inc. | Anti-human VISTA antibodies and use thereof |
US11583577B2 (en) | 2016-04-22 | 2023-02-21 | Obi Pharma, Inc. | Cancer immunotherapy by immune activation or immune modulation via Globo series antigens |
EP3889175A1 (en) | 2016-05-02 | 2021-10-06 | F. Hoffmann-La Roche AG | The contorsbody - a single chain target binder |
WO2017191101A1 (en) | 2016-05-02 | 2017-11-09 | F. Hoffmann-La Roche Ag | The contorsbody - a single chain target binder |
WO2017194441A1 (en) | 2016-05-11 | 2017-11-16 | F. Hoffmann-La Roche Ag | Modified anti-tenascin antibodies and methods of use |
US10918627B2 (en) | 2016-05-11 | 2021-02-16 | Massachusetts Institute Of Technology | Convergent and enantioselective total synthesis of Communesin analogs |
US11254742B2 (en) | 2016-05-13 | 2022-02-22 | Bioatla, Inc. | Anti-Ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof |
EP4122958A1 (en) | 2016-05-13 | 2023-01-25 | BioAtla, Inc. | Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof |
WO2017197234A1 (en) | 2016-05-13 | 2017-11-16 | Bioatla, Llc | Anti-ror2 antibodies, antibody fragments, their immunoconjugates and uses thereof |
US11879011B2 (en) | 2016-05-13 | 2024-01-23 | Bioatla, Inc. | Anti-ROR2 antibodies, antibody fragments, their immunoconjucates and uses thereof |
WO2017201036A1 (en) | 2016-05-17 | 2017-11-23 | Genentech, Inc. | Stromal gene signatures for diagnosis and use in immunotherapy |
WO2017201449A1 (en) | 2016-05-20 | 2017-11-23 | Genentech, Inc. | Protac antibody conjugates and methods of use |
WO2017205741A1 (en) | 2016-05-27 | 2017-11-30 | Genentech, Inc. | Bioanalytical method for the characterization of site-specific antibody-drug conjugates |
EP3252078A1 (en) | 2016-06-02 | 2017-12-06 | F. Hoffmann-La Roche AG | Type ii anti-cd20 antibody and anti-cd20/cd3 bispecific antibody for treatment of cancer |
WO2017214024A1 (en) | 2016-06-06 | 2017-12-14 | Genentech, Inc. | Silvestrol antibody-drug conjugates and methods of use |
WO2017218977A2 (en) | 2016-06-17 | 2017-12-21 | Genentech, Inc. | Purification of multispecific antibodies |
WO2017223405A1 (en) | 2016-06-24 | 2017-12-28 | Genentech, Inc. | Anti-polyubiquitin multispecific antibodies |
WO2018011691A1 (en) | 2016-07-12 | 2018-01-18 | Nestec S.A. | Competitive immunoassay methods |
EP3928784A1 (en) | 2016-07-15 | 2021-12-29 | Acceleron Pharma Inc. | Compositions comprising actriia polypeptides for use in treating pulmonary hypertension |
WO2018013936A1 (en) | 2016-07-15 | 2018-01-18 | Acceleron Pharma Inc. | Compositions and methods for treating pulmonary hypertension |
US11447573B2 (en) | 2016-07-20 | 2022-09-20 | Nanjing Legend Biotech Co., Ltd. | Multispecific antigen binding proteins and methods of use thereof |
US11642400B2 (en) | 2016-07-27 | 2023-05-09 | Obi Pharma, Inc. | Immunogenic/therapeutic glycan compositions and uses thereof |
WO2018022762A1 (en) | 2016-07-27 | 2018-02-01 | Acceleron Pharma Inc. | Methods and compositions for treating myelofibrosis |
US11643456B2 (en) | 2016-07-29 | 2023-05-09 | Obi Pharma, Inc. | Human antibodies, pharmaceutical compositions and methods |
WO2018021450A1 (en) | 2016-07-29 | 2018-02-01 | 中外製薬株式会社 | Bispecific antibody exhibiting increased alternative fviii-cofactor-function activity |
US11046776B2 (en) | 2016-08-05 | 2021-06-29 | Genentech, Inc. | Multivalent and multiepitopic antibodies having agonistic activity and methods of use |
US11053308B2 (en) | 2016-08-05 | 2021-07-06 | Chugai Seiyaku Kabushiki Kaisha | Method for treating IL-8-related diseases |
US11780912B2 (en) | 2016-08-05 | 2023-10-10 | Chugai Seiyaku Kabushiki Kaisha | Composition for prophylaxis or treatment of IL-8 related diseases |
WO2018027204A1 (en) | 2016-08-05 | 2018-02-08 | Genentech, Inc. | Multivalent and multiepitopic anitibodies having agonistic activity and methods of use |
WO2018029124A1 (en) | 2016-08-08 | 2018-02-15 | F. Hoffmann-La Roche Ag | Therapeutic and diagnostic methods for cancer |
WO2018031662A1 (en) | 2016-08-11 | 2018-02-15 | Genentech, Inc. | Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof |
US11333644B2 (en) | 2016-08-15 | 2022-05-17 | Genentech, Inc. | Chromatography method for quantifying a nonionic surfactant in a composition comprising the non-ionic surfactant and a polypeptide |
US11680931B2 (en) | 2016-08-15 | 2023-06-20 | Genentech, Inc. | Chromatography method for quantifying a non-ionic surfactant in a composition comprising the non-ionic surfactant and a polypeptide |
WO2018035025A1 (en) | 2016-08-15 | 2018-02-22 | Genentech, Inc. | Chromatography method for quantifying a non-ionic surfactant in a composition comprising the non-ionic surfactant and a polypeptide |
US10538592B2 (en) | 2016-08-22 | 2020-01-21 | Cho Pharma, Inc. | Antibodies, binding fragments, and methods of use |
WO2018038046A1 (en) | 2016-08-22 | 2018-03-01 | 中外製薬株式会社 | Gene-modified non-human animal expressing human gpc3 polypeptide |
US10870694B2 (en) | 2016-09-02 | 2020-12-22 | Dana Farber Cancer Institute, Inc. | Composition and methods of treating B cell disorders |
WO2018045379A1 (en) | 2016-09-02 | 2018-03-08 | Dana-Farber Cancer Institute, Inc. | Composition and methods of treating b cell disorders |
WO2018049261A1 (en) | 2016-09-09 | 2018-03-15 | Icellhealth Consulting Llc | Oncolytic virus expressing immune checkpoint modulators |
WO2018049248A1 (en) | 2016-09-09 | 2018-03-15 | Icellhealth Consulting Llc | Oncolytic virus equipped with bispecific engager molecules |
US10844113B2 (en) | 2016-09-16 | 2020-11-24 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use |
US11780908B2 (en) | 2016-09-16 | 2023-10-10 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant FC regions, and methods of use |
US10604561B2 (en) | 2016-09-16 | 2020-03-31 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies, polypeptides containing variant Fc regions, and methods of use |
EP4339615A2 (en) | 2016-09-16 | 2024-03-20 | Shanghai Henlius Biotech, Inc. | Anti-pd-1 antibodies |
US11440942B2 (en) | 2016-09-19 | 2022-09-13 | Hoffmann-La Roche Inc. | Complement factor based affinity chromatography |
WO2018050878A1 (en) | 2016-09-19 | 2018-03-22 | F. Hoffmann-La Roche Ag | Complement factor based affinity chromatography |
EP4268845A2 (en) | 2016-09-23 | 2023-11-01 | F. Hoffmann-La Roche AG | Uses of il-13 antagonists for treating atopic dermatitis |
WO2018057849A1 (en) | 2016-09-23 | 2018-03-29 | Genentech, Inc. | Uses of il-13 antagonists for treating atopic dermatitis |
WO2018064478A1 (en) | 2016-09-29 | 2018-04-05 | The Regents Of The University Of California | NEUTRALIZING ANTIBODIES TO THE αVβ8 INTEGRIN COMPLEX FOR IMMUNOTHERAPY |
WO2018060462A1 (en) | 2016-09-29 | 2018-04-05 | Nascient Ltd | Tenascin epitope and antibodies thereto |
WO2018064436A1 (en) | 2016-09-30 | 2018-04-05 | Janssen Biotech, Inc. | Safe and effective method of treating psoriasis with anti-il23 specific antibody |
WO2018060035A1 (en) | 2016-09-30 | 2018-04-05 | F. Hoffmann-La Roche Ag | Spr-based dual-binding assay for the functional analysis of multispecific molecules |
WO2018065501A1 (en) | 2016-10-05 | 2018-04-12 | F. Hoffmann-La Roche Ag | Methods for preparing antibody drug conjugates |
EP4026556A1 (en) | 2016-10-05 | 2022-07-13 | Acceleron Pharma Inc. | Compositions and method for treating kidney disease |
WO2018068028A1 (en) | 2016-10-06 | 2018-04-12 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
US11472881B2 (en) | 2016-10-11 | 2022-10-18 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against CTLA-4 |
US11078298B2 (en) | 2016-10-28 | 2021-08-03 | Banyan Biomarkers, Inc. | Antibodies to ubiquitin C-terminal hydrolase L1 (UCH-L1) and glial fibrillary acidic protein (GFAP) and related methods |
WO2018081649A1 (en) | 2016-10-28 | 2018-05-03 | Banyan Biomarkers, Inc. | Antibodies to ubiquitin c-terminal hydrolase l1 (uch-l1) and glial fibrillary acidic protein (gfap) and related methods |
WO2018081648A2 (en) | 2016-10-29 | 2018-05-03 | Genentech, Inc. | Anti-mic antibidies and methods of use |
WO2018083535A1 (en) | 2016-11-04 | 2018-05-11 | Novimmune Sa | Anti-cd19 antibodies and methods of use thereof |
WO2018089967A1 (en) | 2016-11-14 | 2018-05-17 | Virginia Commonwealth University | Inhibitors of cancer invasion, attachment, and/or metastasis |
WO2018093821A1 (en) | 2016-11-15 | 2018-05-24 | Genentech, Inc. | Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies |
US11208474B2 (en) | 2016-11-16 | 2021-12-28 | Janssen Biotech, Inc. | Method of treating psoriasis with anti-IL23 specific antibody |
WO2018093841A1 (en) | 2016-11-16 | 2018-05-24 | Janssen Biotech, Inc. | Method of treating psoriasis with anti-il-23 specific antibody |
EP4335874A2 (en) | 2016-11-18 | 2024-03-13 | F. Hoffmann-La Roche AG | Anti-hla-g antibodies and use thereof |
WO2018091580A1 (en) | 2016-11-18 | 2018-05-24 | F. Hoffmann-La Roche Ag | Anti-hla-g antibodies and use thereof |
US11279694B2 (en) | 2016-11-18 | 2022-03-22 | Sumitomo Dainippon Pharma Oncology, Inc. | Alvocidib prodrugs and their use as protein kinase inhibitors |
WO2018094300A1 (en) | 2016-11-19 | 2018-05-24 | Potenza Therapeutics, Inc. | Anti-gitr antigen-binding proteins and methods of use thereof |
US11000601B2 (en) | 2016-11-21 | 2021-05-11 | Obi Pharma, Inc. | Conjugated biological molecules, pharmaceutical compositions and methods |
WO2018098363A2 (en) | 2016-11-23 | 2018-05-31 | Bioverativ Therapeutics Inc. | Bispecific antibodies binding to coagulation factor ix and coagulation factor x |
WO2018106776A2 (en) | 2016-12-07 | 2018-06-14 | Genentech, Inc. | Anti-tau antibodies and methods of use |
WO2018106781A1 (en) | 2016-12-07 | 2018-06-14 | Genentech, Inc | Anti-tau antibodies and methods of use |
WO2018108759A1 (en) | 2016-12-13 | 2018-06-21 | F. Hoffmann-La Roche Ag | Method to determine the presence of a target antigen in a tumor sample |
WO2018114754A1 (en) | 2016-12-19 | 2018-06-28 | F. Hoffmann-La Roche Ag | Combination therapy with targeted 4-1bb (cd137) agonists |
US10267787B2 (en) | 2016-12-19 | 2019-04-23 | Tolero Pharmaceuticals, Inc. | Profiling peptides and methods for sensitivity profiling |
US10422788B2 (en) | 2016-12-19 | 2019-09-24 | Tolero Pharmaceuticals, Inc. | Profiling peptides and methods for sensitivity profiling |
US10132797B2 (en) | 2016-12-19 | 2018-11-20 | Tolero Pharmaceuticals, Inc. | Profiling peptides and methods for sensitivity profiling |
WO2018114748A1 (en) | 2016-12-20 | 2018-06-28 | F. Hoffmann-La Roche Ag | Combination therapy of anti-cd20/anti-cd3 bispecific antibodies and 4-1bb (cd137) agonists |
US11821897B2 (en) | 2016-12-21 | 2023-11-21 | Hoffmann-La Roche Inc. | Assay for determining antibody or ligand binding and function |
WO2018114878A1 (en) | 2016-12-21 | 2018-06-28 | F. Hoffmann-La Roche Ag | Re-use of enzymes in in vitro glycoengineering of antibodies |
US11767342B2 (en) | 2016-12-21 | 2023-09-26 | Hoffmann-La Roche Inc. | Method for in vitro glycoengineering of antibodies |
WO2018114879A1 (en) | 2016-12-21 | 2018-06-28 | F. Hoffmann-La Roche Ag | Method for in vitro glycoengineering of antibodies |
WO2018114877A1 (en) | 2016-12-21 | 2018-06-28 | F. Hoffmann-La Roche Ag | In vitro glycoengineering of antibodies |
WO2018114772A1 (en) | 2016-12-21 | 2018-06-28 | F. Hoffmann-La Roche Ag | Assay for determining antibody or ligand binding and function |
US10858438B2 (en) | 2016-12-22 | 2020-12-08 | Boehringer Ingelheim International Gmbh | TRAILR2 CDH17 binding molecules for the treatment of cancer |
US11851495B2 (en) | 2016-12-22 | 2023-12-26 | Boehringer Ingelheim International Gmbh | TRAILR2 CDH17 binding molecules for the treatment of cancer |
WO2018115231A2 (en) | 2016-12-22 | 2018-06-28 | Boehringer Ingelheim International Gmbh | Binding molecules for the treatment of cancer |
WO2018129029A1 (en) | 2017-01-04 | 2018-07-12 | Immunogen, Inc. | Met antibodies and immunoconjugates and uses thereof |
US11390685B2 (en) | 2017-01-06 | 2022-07-19 | Biosion, Inc. | ErbB2 antibodies and uses therefore |
US11274157B2 (en) | 2017-01-12 | 2022-03-15 | Eureka Therapeutics, Inc. | Constructs targeting histone H3 peptide/MHC complexes and uses thereof |
US11041020B2 (en) | 2017-01-30 | 2021-06-22 | Janssen Biotech, Inc. | Methods for the treatment of active Psoriatic Arthritis |
US11014982B2 (en) | 2017-02-07 | 2021-05-25 | Janssen Biotech, Inc. | Anti-TNF antibodies, compositions, and methods for the treatment of active ankylosing spondylitis |
WO2018148585A1 (en) | 2017-02-10 | 2018-08-16 | Genentech, Inc. | Anti-tryptase antibodies, compositions thereof, and uses thereof |
EP3360898A1 (en) | 2017-02-14 | 2018-08-15 | Boehringer Ingelheim International GmbH | Bispecific anti-tnf-related apoptosis-inducing ligand receptor 2 and anti-cadherin 17 binding molecules for the treatment of cancer |
WO2018152496A1 (en) | 2017-02-17 | 2018-08-23 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Compositions and methods for the diagnosis and treatment of zika virus infection |
WO2018160841A1 (en) | 2017-03-01 | 2018-09-07 | Genentech, Inc. | Diagnostic and therapeutic methods for cancer |
WO2018175788A1 (en) | 2017-03-22 | 2018-09-27 | Genentech, Inc. | Hydrogel cross-linked hyaluronic acid prodrug compositions and methods |
US11642415B2 (en) | 2017-03-22 | 2023-05-09 | Ascendis Pharma A/S | Hydrogel cross-linked hyaluronic acid prodrug compositions and methods |
WO2018175752A1 (en) | 2017-03-22 | 2018-09-27 | Genentech, Inc. | Optimized antibody compositions for treatment of ocular disorders |
US11730822B2 (en) | 2017-03-24 | 2023-08-22 | Seagen Inc. | Process for the preparation of glucuronide drug-linkers and intermediates thereof |
WO2018183175A1 (en) | 2017-03-28 | 2018-10-04 | Genentech, Inc. | Methods of treating neurodegenerative diseases |
US11236167B2 (en) | 2017-04-17 | 2022-02-01 | Joint Stock Company “Biocad” | Monoclonal antibody to PD-L1 |
WO2018194496A2 (en) | 2017-04-17 | 2018-10-25 | Закрытое Акционерное Общество "Биокад" | Monoclonal antibody to pd-l1 |
WO2018195472A1 (en) | 2017-04-21 | 2018-10-25 | Genentech, Inc. | Use of klk5 antagonists for treatment of a disease |
WO2018200742A1 (en) | 2017-04-25 | 2018-11-01 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Antibodies and methods for the diagnosis and treatment of epstein barr virus infection |
EP4230649A2 (en) | 2017-04-25 | 2023-08-23 | The U.S.A. As Represented By The Secretary, Department Of Health And Human Services | Antibodies and methods for the diagnosis and treatment of epstein barr virus infection |
US11447564B2 (en) | 2017-04-26 | 2022-09-20 | Eureka Therapeutics, Inc. | Constructs specifically recognizing glypican 3 and uses thereof |
US11597774B2 (en) | 2017-05-04 | 2023-03-07 | City Of Hope | Antibody variable domains and antibody constructs |
US11203638B2 (en) | 2017-05-05 | 2021-12-21 | Allakos Inc. | Methods and compositions for treating perennial allergic conjunctivitis and keratoconjunctivitis |
US11965023B2 (en) | 2017-05-16 | 2024-04-23 | Alector Llc | Anti-Siglec-5 antibodies and methods of use thereof |
US11359014B2 (en) | 2017-05-16 | 2022-06-14 | Alector Llc | Anti-siglec-5 antibodies and methods of use thereof |
WO2018213316A1 (en) | 2017-05-16 | 2018-11-22 | Alector Llc | Anti-siglec-5 antibodies and methods of use thereof |
WO2018215535A1 (en) | 2017-05-23 | 2018-11-29 | Helmholtz Zentrum München - Deutsches Forschungszentrum für Gesundheit und Umwelt (GmbH) | Novel cd73 antibody, preparation and uses thereof |
WO2018215835A1 (en) | 2017-05-26 | 2018-11-29 | Novimmune Sa | Anti-cd47 x anti-mesothelin antibodies and methods of use thereof |
US11260117B2 (en) | 2017-05-26 | 2022-03-01 | Novimmune Sa | Anti-CD47 x anti-mesothelin antibodies and methods of use thereof |
WO2018220099A1 (en) | 2017-06-02 | 2018-12-06 | F. Hoffmann-La Roche Ag | Type ii anti-cd20 antibody and anti-cd20/cd3 bispecific antibody for treatment of cancer |
WO2019018629A1 (en) | 2017-07-19 | 2019-01-24 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Antibodies and methods for the diagnosis and treatment of hepatitis b virus infection |
WO2019018757A1 (en) | 2017-07-21 | 2019-01-24 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2019023347A1 (en) | 2017-07-26 | 2019-01-31 | Forty Seven, Inc. | Anti-sirp-alpha antibodies and related methods |
WO2019028292A1 (en) | 2017-08-03 | 2019-02-07 | Alector Llc | Anti-trem2 antibodies and methods of use thereof |
US10711062B2 (en) | 2017-08-03 | 2020-07-14 | Alector Llc | Anti-CD33 antibodies and methods of use thereof |
US11634489B2 (en) | 2017-08-03 | 2023-04-25 | Alector Llc | Anti-TREM2 antibodies and methods of use thereof |
EP4248996A2 (en) | 2017-08-03 | 2023-09-27 | Alector LLC | Anti-trem2 antibodies and methods of use thereof |
US10676525B2 (en) | 2017-08-03 | 2020-06-09 | Alector Llc | Anti-TREM2 antibodies and methods of use thereof |
WO2019028283A1 (en) | 2017-08-03 | 2019-02-07 | Alector Llc | Anti-cd33 antibodies and methods of use thereof |
US11254743B2 (en) | 2017-08-03 | 2022-02-22 | Alector Llc | Anti-CD33 antibodies and methods of use thereof |
US11585014B2 (en) | 2017-08-21 | 2023-02-21 | Adagene Inc. | Dynamic human antibody light chain libraries |
US11578426B2 (en) | 2017-08-21 | 2023-02-14 | Adagene Inc. | Dynamic human heavy chain antibody libraries |
US11497756B2 (en) | 2017-09-12 | 2022-11-15 | Sumitomo Pharma Oncology, Inc. | Treatment regimen for cancers that are insensitive to BCL-2 inhibitors using the MCL-1 inhibitor alvocidib |
WO2019065795A1 (en) | 2017-09-29 | 2019-04-04 | 中外製薬株式会社 | Multispecific antigen-binding molecule having blood coagulation factor viii (fviii) cofactor function-substituting activity, and pharmaceutical formulation containing said molecule as active ingredient |
WO2019067015A1 (en) | 2017-09-29 | 2019-04-04 | City Of Hope | Chimeric antigen receptors and bispecific antibodies for treatment of mantle cell lymphoma |
US11840567B2 (en) | 2017-10-03 | 2023-12-12 | Joint Stock Company “Biocad” | Bispecific antibodies with specific binding to CD47 and PD-L1 |
WO2019070164A1 (en) | 2017-10-03 | 2019-04-11 | Закрытое Акционерное Общество "Биокад" | MONOCLONAL ANTIBODY TO IL-5Rα |
US11912754B2 (en) | 2017-10-12 | 2024-02-27 | Immunowake Inc. | VEGFR-antibody light chain fusion protein |
US10640508B2 (en) | 2017-10-13 | 2020-05-05 | Massachusetts Institute Of Technology | Diazene directed modular synthesis of compounds with quaternary carbon centers |
WO2019086395A1 (en) | 2017-11-01 | 2019-05-09 | F. Hoffmann-La Roche Ag | Trifab-contorsbody |
WO2019086497A2 (en) | 2017-11-01 | 2019-05-09 | F. Hoffmann-La Roche Ag | Combination therapy with targeted ox40 agonists |
WO2019086331A2 (en) | 2017-11-02 | 2019-05-09 | Bayer Aktiengesellschaft | Bispecific antibodies binding alk-1 and bmpr-2 |
US11292846B2 (en) | 2017-11-02 | 2022-04-05 | Bayer Aktiengesellschaft | Bispecific antibodies binding ALK-1 and BMPR-2 |
WO2019090263A1 (en) | 2017-11-06 | 2019-05-09 | Genentech, Inc. | Diagnostic and therapeutic methods for cancer |
WO2019125846A1 (en) | 2017-12-19 | 2019-06-27 | The Rockefeller University | HUMAN IgG Fc DOMAIN VARIANTS WITH IMPROVED EFFECTOR FUNCTION |
WO2019122054A1 (en) | 2017-12-22 | 2019-06-27 | F. Hoffmann-La Roche Ag | Depletion of light chain mispaired antibody variants by hydrophobic interaction chromatography |
WO2019126472A1 (en) | 2017-12-22 | 2019-06-27 | Genentech, Inc. | Use of pilra binding agents for treatment of a disease |
US11905327B2 (en) | 2017-12-28 | 2024-02-20 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against TIGIT |
WO2019129211A1 (en) | 2017-12-28 | 2019-07-04 | Nanjing Legend Biotech Co., Ltd. | Antibodies and variants thereof against pd-l1 |
WO2019133512A1 (en) | 2017-12-29 | 2019-07-04 | Alector Llc | Anti-tmem106b antibodies and methods of use thereof |
US11713353B2 (en) | 2018-01-15 | 2023-08-01 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies and variants thereof against PD-1 |
WO2019143636A1 (en) | 2018-01-16 | 2019-07-25 | Lakepharma, Inc. | Bispecific antibody that binds cd3 and another target |
WO2019145475A2 (en) | 2018-01-25 | 2019-08-01 | Acm Biolabs Pte Ltd | Polymersomes comprising a soluble encapsulated antigen as well as methods of making and uses thereof |
WO2019152715A1 (en) | 2018-01-31 | 2019-08-08 | Alector Llc | Anti-ms4a4a antibodies and methods of use thereof |
WO2019157358A1 (en) | 2018-02-09 | 2019-08-15 | Genentech, Inc. | Therapeutic and diagnostic methods for mast cell-mediated inflammatory diseases |
WO2019171252A1 (en) | 2018-03-05 | 2019-09-12 | Janssen Biotech, Inc. | Methods of treating crohn's disease with anti-il23 specific antibody |
US11597727B2 (en) | 2018-03-13 | 2023-03-07 | The Regents Of The University Of California | Inhibitors of integrin alpha 2 beta 1 and methods of use |
WO2019175071A1 (en) | 2018-03-13 | 2019-09-19 | F. Hoffmann-La Roche Ag | Therapeutic combination of 4-1 bb agonists with anti-cd20 antibodies |
WO2019175125A1 (en) | 2018-03-13 | 2019-09-19 | F. Hoffmann-La Roche Ag | Combination therapy with targeted 4-1bb (cd137) agonists |
WO2019178316A1 (en) | 2018-03-14 | 2019-09-19 | Genentech, Inc. | Anti-klk5 antibodies and methods of use |
US11203646B2 (en) | 2018-03-14 | 2021-12-21 | Novimmune Sa | Anti-CD3 epsilon antibodies and methods of use thereof |
WO2019175658A1 (en) | 2018-03-14 | 2019-09-19 | Novimmune Sa | Anti-cd3 epsilon antibodies and methods of use thereof |
US11891432B2 (en) | 2018-03-15 | 2024-02-06 | Chugai Seiyaku Kabushiki Kaisha | Anti-dengue virus antibodies having cross-reactivity to Zika virus and methods of use |
US11958903B2 (en) | 2018-03-30 | 2024-04-16 | Nanjing Legend Biotech Co., Ltd. | Single-domain antibodies against LAG-3 and uses thereof |
WO2019192432A1 (en) | 2018-04-02 | 2019-10-10 | 上海博威生物医药有限公司 | Lymphocyte activation gene-3 (lag-3) binding antibody and use thereof |
WO2019195514A1 (en) | 2018-04-04 | 2019-10-10 | Genentech, Inc. | Methods for detecting and quantifying fgf21 |
WO2019202040A1 (en) | 2018-04-18 | 2019-10-24 | F. Hoffmann-La Roche Ag | Anti-hla-g antibodies and use thereof |
WO2019213416A1 (en) | 2018-05-02 | 2019-11-07 | The Usa, As Represented By The Secretary, Dept. Of Health And Human Services | Antibodies and methods for the diagnosis, prevention, and treatment of epstein barr virus infection |
WO2019215701A1 (en) | 2018-05-11 | 2019-11-14 | Janssen Biotech, Inc. | Methods of treating depression using il-23 antibodies |
US11453710B2 (en) | 2018-05-14 | 2022-09-27 | Werewolf Therapeutics, Inc. | Activatable interleukin 12 polypeptides and methods of use thereof |
US11352403B2 (en) | 2018-05-14 | 2022-06-07 | Werewolf Therapeutics, Inc. | Activatable interleukin-2 polypeptides and methods of use thereof |
US11535658B2 (en) | 2018-05-14 | 2022-12-27 | Werewolf Therapeutics, Inc. | Activatable interleukin-2 polypeptides and methods of use thereof |
WO2019224385A2 (en) | 2018-05-24 | 2019-11-28 | Glenmark Pharmaceuticals S.A. | Combined bispecific antibody and immuno-oncology therapies |
WO2019226973A1 (en) | 2018-05-25 | 2019-11-28 | Alector Llc | Anti-sirpa antibodies and methods of use thereof |
WO2019236965A1 (en) | 2018-06-08 | 2019-12-12 | Alector Llc | Anti-siglec-7 antibodies and methods of use thereof |
US11332541B2 (en) | 2018-06-09 | 2022-05-17 | Boehringer Ingelheim International Gmbh | Multi-specific binding proteins for cancer treatment |
WO2019234220A1 (en) | 2018-06-09 | 2019-12-12 | Boehringer Ingelheim International Gmbh | Dll3-cd3 bispecific antibodies |
US11241417B2 (en) | 2018-06-21 | 2022-02-08 | Yumanity Therapeutics, Inc. | Compositions and methods for the treatment and prevention of neurological disorders |
WO2019246557A1 (en) | 2018-06-23 | 2019-12-26 | Genentech, Inc. | Methods of treating lung cancer with a pd-1 axis binding antagonist, a platinum agent, and a topoisomerase ii inhibitor |
US11203645B2 (en) | 2018-06-27 | 2021-12-21 | Obi Pharma, Inc. | Glycosynthase variants for glycoprotein engineering and methods of use |
WO2020006568A1 (en) | 2018-06-29 | 2020-01-02 | City Of Hope | Cd6 targeted chimeric antigen receptors for treatent of certain autoimmune disorders |
WO2020006374A2 (en) | 2018-06-29 | 2020-01-02 | Alector Llc | Anti-sirp-beta1 antibodies and methods of use thereof |
WO2020014306A1 (en) | 2018-07-10 | 2020-01-16 | Immunogen, Inc. | Met antibodies and immunoconjugates and uses thereof |
US11396546B2 (en) | 2018-07-13 | 2022-07-26 | Alector Llc | Anti-Sortilin antibodies and methods of use thereof |
WO2020014617A1 (en) | 2018-07-13 | 2020-01-16 | Alector Llc | Anti-sortilin antibodies and methods of use thereof |
EP4212210A1 (en) | 2018-07-13 | 2023-07-19 | Alector LLC | Anti-sortilin antibodies and methods of use thereof |
WO2020016838A2 (en) | 2018-07-18 | 2020-01-23 | Janssen Biotech, Inc. | Sustained response predictors after treatment with anti-il23 specific antibody |
WO2020018789A1 (en) | 2018-07-18 | 2020-01-23 | Genentech, Inc. | Methods of treating lung cancer with a pd-1 axis binding antagonist, an antimetabolite, and a platinum agent |
US11214619B2 (en) | 2018-07-20 | 2022-01-04 | Surface Oncology, Inc. | Anti-CD112R compositions and methods |
US11279758B2 (en) | 2018-07-20 | 2022-03-22 | Surface Oncology, Inc. | Anti-CD112R compositions and methods |
WO2020023920A1 (en) | 2018-07-27 | 2020-01-30 | Alector Llc | Anti-siglec-5 antibodies and methods of use thereof |
WO2020027330A1 (en) | 2018-08-03 | 2020-02-06 | 中外製薬株式会社 | Antigen-binding molecule containing two antigen-binding domains that are linked to each other |
WO2020033485A1 (en) | 2018-08-08 | 2020-02-13 | Genentech, Inc. | Use of tryptophan derivatives and l-methionine for protein formulation |
EP3608674A1 (en) | 2018-08-09 | 2020-02-12 | Regeneron Pharmaceuticals, Inc. | Methods for assessing binding affinity of an antibody variant to the neonatal fc receptor |
WO2020032230A1 (en) | 2018-08-10 | 2020-02-13 | 中外製薬株式会社 | Anti-cd137 antigen-binding molecule and utilization thereof |
WO2020035577A1 (en) | 2018-08-16 | 2020-02-20 | Cantargia Ab | Anti-il1rap antibody compositions |
WO2020037154A1 (en) | 2018-08-17 | 2020-02-20 | 23Andme, Inc. | Anti-il1rap antibodies and methods of use thereof |
WO2020041541A2 (en) | 2018-08-23 | 2020-02-27 | Seattle Genetics, Inc. | Anti-tigit antibodies |
WO2020041758A1 (en) | 2018-08-24 | 2020-02-27 | City Of Hope | Masked cytokine conjugates |
WO2020047374A1 (en) | 2018-08-31 | 2020-03-05 | Alector Llc | Anti-cd33 antibodies and methods of use thereof |
WO2020049286A1 (en) | 2018-09-03 | 2020-03-12 | Femtogenix Limited | Polycyclic amides as cytotoxic agents |
EP4268831A2 (en) | 2018-09-12 | 2023-11-01 | Fred Hutchinson Cancer Center | Reducing cd33 expression to selectively protect therapeutic cells |
WO2020053325A1 (en) | 2018-09-12 | 2020-03-19 | Acm Biolabs Pte Ltd | Polymersomes comprising a covalently bound antigen as well as methods of making and uses thereof |
WO2020061060A1 (en) | 2018-09-19 | 2020-03-26 | Genentech, Inc. | Therapeutic and diagnostic methods for bladder cancer |
WO2020061381A1 (en) | 2018-09-19 | 2020-03-26 | La Jolla Institute For Immunology | Ptprs and proteoglycans in rheumatoid arthritis |
EP4249917A2 (en) | 2018-09-21 | 2023-09-27 | F. Hoffmann-La Roche AG | Diagnostic methods for triple-negative breast cancer |
WO2020061349A1 (en) | 2018-09-21 | 2020-03-26 | Genentech, Inc. | Diagnostic methods for triple-negative breast cancer |
US11866476B2 (en) | 2018-09-27 | 2024-01-09 | Xilio Development, Inc. | Masked IL-2-Fc fusion polypeptides |
US11718655B2 (en) | 2018-09-27 | 2023-08-08 | Xilio Development, Inc. | Masked interleukin-12 polypeptides |
US11827685B2 (en) | 2018-09-27 | 2023-11-28 | Xilio Development, Inc. | Masked cytokine polypeptides |
US11827686B2 (en) | 2018-09-27 | 2023-11-28 | Xilio Development, Inc. | Masked cytokine polypeptides |
US11053294B2 (en) | 2018-09-27 | 2021-07-06 | Xilio Development, Inc. | Masked cytokine polypeptides |
EP4321530A2 (en) | 2018-09-27 | 2024-02-14 | Xilio Development, Inc. | Masked cytokine polypeptides |
WO2020081767A1 (en) | 2018-10-18 | 2020-04-23 | Genentech, Inc. | Diagnostic and therapeutic methods for sarcomatoid kidney cancer |
WO2020086858A1 (en) | 2018-10-24 | 2020-04-30 | Genentech, Inc. | Conjugated chemical inducers of degradation and methods of use |
WO2020092455A2 (en) | 2018-10-29 | 2020-05-07 | The Broad Institute, Inc. | Car t cell transcriptional atlas |
WO2020096959A1 (en) | 2018-11-05 | 2020-05-14 | Genentech, Inc. | Methods of producing two chain proteins in prokaryotic host cells |
US11548941B2 (en) | 2018-11-20 | 2023-01-10 | Janssen Biotech, Inc. | Safe and effective method of treating psoriasis with anti-IL-23 specific antibody |
WO2020104943A2 (en) | 2018-11-20 | 2020-05-28 | Janssen Biotech, Inc. | Safe and effective method of treating psoriasis with anti-il-23 specific antibody |
WO2020104496A1 (en) | 2018-11-20 | 2020-05-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Bispecific antibody targeting transferrin receptor 1 and soluble antigen |
US11034710B2 (en) | 2018-12-04 | 2021-06-15 | Sumitomo Dainippon Pharma Oncology, Inc. | CDK9 inhibitors and polymorphs thereof for use as agents for treatment of cancer |
US11530231B2 (en) | 2018-12-04 | 2022-12-20 | Sumitomo Pharma Oncology, Inc. | CDK9 inhibitors and polymorphs thereof for use as agents for treatment of cancer |
WO2020117257A1 (en) | 2018-12-06 | 2020-06-11 | Genentech, Inc. | Combination therapy of diffuse large b-cell lymphoma comprising an anti-cd79b immunoconjugates, an alkylating agent and an anti-cd20 antibody |
WO2020123275A1 (en) | 2018-12-10 | 2020-06-18 | Genentech, Inc. | Photocrosslinking peptides for site specific conjugation to fc-containing proteins |
WO2020132034A1 (en) | 2018-12-20 | 2020-06-25 | 23Andme, Inc. | Anti-cd96 antibodies and methods of use thereof |
WO2020132230A2 (en) | 2018-12-20 | 2020-06-25 | Genentech, Inc. | Modified antibody fcs and methods of use |
WO2020132220A1 (en) | 2018-12-21 | 2020-06-25 | 23Andme, Inc. | Anti-il-36 antibodies and methods of use thereof |
WO2020132231A1 (en) | 2018-12-21 | 2020-06-25 | Genentech, Inc. | Methods of producing polypeptides using a cell line resistant to apoptosis |
WO2020139920A2 (en) | 2018-12-26 | 2020-07-02 | City Of Hope | Activatable masked anti-ctla4 binding proteins |
WO2020139926A2 (en) | 2018-12-26 | 2020-07-02 | Akrevia Therapeutics Inc. | Anti-ctla4 antibodies and methods of use thereof |
WO2020141117A1 (en) | 2018-12-30 | 2020-07-09 | F. Hoffmann-La Roche Ag | Ph-gradient spr-based binding assay |
WO2020154410A1 (en) | 2019-01-23 | 2020-07-30 | Genentech, Inc. | Methods of producing multimeric proteins in eukaryotic host cells |
WO2020153467A1 (en) | 2019-01-24 | 2020-07-30 | 中外製薬株式会社 | Novel cancer antigens and antibodies of said antigens |
WO2020157491A1 (en) | 2019-01-29 | 2020-08-06 | Femtogenix Limited | G-a crosslinking cytotoxic agents |
WO2020185535A1 (en) | 2019-03-08 | 2020-09-17 | Genentech, Inc. | Methods for detecting and quantifying membrane-associated proteins on extracellular vesicles |
WO2020186176A1 (en) | 2019-03-14 | 2020-09-17 | Genentech, Inc. | Treatment of cancer with her2xcd3 bispecific antibodies in combination with anti-her2 mab |
US11793802B2 (en) | 2019-03-20 | 2023-10-24 | Sumitomo Pharma Oncology, Inc. | Treatment of acute myeloid leukemia (AML) with venetoclax failure |
WO2020200941A1 (en) | 2019-03-29 | 2020-10-08 | F. Hoffmann-La Roche Ag | Spr-based binding assay for the functional analysis of multivalent molecules |
WO2020200944A1 (en) | 2019-03-29 | 2020-10-08 | F. Hoffmann-La Roche Ag | Method for generating avid-binding multispecific antibodies |
WO2020214963A1 (en) | 2019-04-18 | 2020-10-22 | Genentech, Inc. | Antibody potency assay |
WO2020214995A1 (en) | 2019-04-19 | 2020-10-22 | Genentech, Inc. | Anti-mertk antibodies and their methods of use |
WO2020213724A1 (en) | 2019-04-19 | 2020-10-22 | 中外製薬株式会社 | Chimeric receptor recognizing modification site of antibody |
WO2020229982A1 (en) | 2019-05-10 | 2020-11-19 | Takeda Pharmaceutical Company Limited | Antibody drug conjugates |
WO2020229378A1 (en) | 2019-05-13 | 2020-11-19 | F. Hoffmann-La Roche Ag | Interference-suppressed pharmacokinetic immunoassay |
US11739132B2 (en) | 2019-05-14 | 2023-08-29 | Werewolf Therapeutics, Inc. | Separation moieties and methods of use thereof |
WO2020232169A1 (en) | 2019-05-14 | 2020-11-19 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat follicular lymphoma |
WO2020230142A1 (en) | 2019-05-15 | 2020-11-19 | Neotx Therapeutics Ltd. | Cancer treatment |
WO2020232262A1 (en) | 2019-05-16 | 2020-11-19 | Procisedx Inc. | Assay detection methods for vcam-1 and calprotectin |
WO2020232295A1 (en) | 2019-05-16 | 2020-11-19 | Procisedx Inc. | An assay method for the detection of vcam-1 and alpha-2-macroglobulin in blood |
WO2020236528A1 (en) | 2019-05-23 | 2020-11-26 | Procisedx Inc. | Assay methods for the detection of human serum albumin, vitamin d, c-reactive protein, and anti-transglutaminase autoantibody |
US11780911B2 (en) | 2019-05-23 | 2023-10-10 | Janssen Biotech, Inc. | Method of treating inflammatory bowel disease with a combination therapy of antibodies to IL-23 and TNF alpha |
WO2020245677A1 (en) | 2019-06-03 | 2020-12-10 | Janssen Biotech, Inc. | Anti-tnf antibodies, compositions, and methods for the treatment of active ankylosing spondylitis |
WO2020247634A1 (en) | 2019-06-05 | 2020-12-10 | Genentech, Inc. | A method for regeneration of an overload chromatography column |
WO2020247159A1 (en) | 2019-06-06 | 2020-12-10 | Procisedx Inc. | DETECTION OF HEMOGLOBIN A1C (HbA1c) IN BLOOD |
WO2020250915A1 (en) | 2019-06-10 | 2020-12-17 | 中外製薬株式会社 | Anti-t cell antigen-binding molecule to be used in combination with cytokine inhibitor |
WO2020252066A1 (en) | 2019-06-11 | 2020-12-17 | Alector Llc | Anti-sortilin antibodies for use in therapy |
WO2020254355A1 (en) | 2019-06-19 | 2020-12-24 | F. Hoffmann-La Roche Ag | Method for the generation of a bivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization |
WO2020254352A1 (en) | 2019-06-19 | 2020-12-24 | F. Hoffmann-La Roche Ag | Method for the generation of a trivalent antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization |
WO2020254351A1 (en) | 2019-06-19 | 2020-12-24 | F. Hoffmann-La Roche Ag | Method for the generation of a multivalent, multispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization |
WO2020254357A1 (en) | 2019-06-19 | 2020-12-24 | F. Hoffmann-La Roche Ag | Method for the generation of a protein expressing cell by targeted integration using cre mrna |
WO2020254356A1 (en) | 2019-06-19 | 2020-12-24 | F. Hoffmann-La Roche Ag | Method for the generation of a multivalent, bispecific antibody expressing cell by targeted integration of multiple expression cassettes in a defined organization |
WO2020263450A1 (en) | 2019-06-25 | 2020-12-30 | Procisedx Inc. | Detection of anti-tnf alpha drug biologics and anti-drug antibodies |
WO2020260327A1 (en) | 2019-06-26 | 2020-12-30 | F. Hoffmann-La Roche Ag | Mammalian cell lines with sirt-1 gene knockout |
US11865177B2 (en) | 2019-06-28 | 2024-01-09 | Genentech, Inc. | Composition and methods for stabilizing liquid protein formulations |
WO2020264300A1 (en) | 2019-06-28 | 2020-12-30 | Genentech, Inc. | Composition and methods for stabilizing liquid protein formulations |
WO2021010326A1 (en) | 2019-07-12 | 2021-01-21 | 中外製薬株式会社 | Anti-mutation type fgfr3 antibody and use therefor |
WO2021011673A2 (en) | 2019-07-16 | 2021-01-21 | Ming Jin | Neutralizing anti-amyloid beta antibodies for the treatment of alzheimer's disease |
US11827715B2 (en) | 2019-07-19 | 2023-11-28 | Oncoresponse, Inc. | Human CD163 antibodies and uses thereof |
US11034770B2 (en) | 2019-07-19 | 2021-06-15 | Oncoresponse, Inc. | Immunomodulatory antibodies and methods of use thereof |
US11634501B2 (en) | 2019-07-19 | 2023-04-25 | Oncoresponse, Inc. | Immunomodulatory antibodies and methods of use thereof |
WO2021017892A1 (en) | 2019-07-26 | 2021-02-04 | 上海复宏汉霖生物技术股份有限公司 | Method and composition for anti-cd73 antibodies and variants |
WO2021021605A1 (en) | 2019-07-26 | 2021-02-04 | Vanderbilt University | Human monoclonal antibodies to enterovirus d68 |
WO2021022083A2 (en) | 2019-07-31 | 2021-02-04 | Alector Llc | Anti-ms4a4a antibodies and methods of use thereof |
WO2021024209A1 (en) | 2019-08-06 | 2021-02-11 | Aprinoia Therapeutics Inc. | Antibodies that bind to pathological tau species and uses thereof |
WO2021030251A1 (en) | 2019-08-12 | 2021-02-18 | Purinomia Biotech, Inc. | Methods and compositions for promoting and potentiating t-cell mediated immune responses through adcc targeting of cd39 expressing cells |
WO2021028752A1 (en) | 2019-08-15 | 2021-02-18 | Janssen Biotech, Inc. | Anti-tfn antibodies for treating type i diabetes |
WO2021050645A1 (en) | 2019-09-12 | 2021-03-18 | Genentech, Inc. | Compositions and methods of treating lupus nephritis |
WO2021055694A1 (en) | 2019-09-20 | 2021-03-25 | Genentech, Inc. | Dosing for anti-tryptase antibodies |
WO2021057978A1 (en) | 2019-09-27 | 2021-04-01 | 南京金斯瑞生物科技有限公司 | Anti-vhh domain antibodies and use thereof |
US11732045B2 (en) | 2019-10-02 | 2023-08-22 | Boehringer Ingelheim International Gmbh | Multi-specific binding proteins for cancer treatment |
WO2021064137A2 (en) | 2019-10-02 | 2021-04-08 | Boehringer Ingelheim International Gmbh | Multi-specific binding proteins for cancer treatment |
WO2021076196A1 (en) | 2019-10-18 | 2021-04-22 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma |
WO2021119400A1 (en) | 2019-12-12 | 2021-06-17 | Alector Llc | Methods of use of anti-cd33 antibodies |
WO2021119505A1 (en) | 2019-12-13 | 2021-06-17 | Genentech, Inc. | Anti-ly6g6d antibodies and methods of use |
WO2021131021A1 (en) | 2019-12-27 | 2021-07-01 | 中外製薬株式会社 | Anti-ctla-4 antibody and use thereof |
WO2021138454A1 (en) | 2019-12-30 | 2021-07-08 | City Of Hope | Methods of making and using regulatory t cells and effector t cells having chimeric antigen receptors targeted to cd6, cd19, and/or an il-13r for treatment of autoimmune disorders and cancers |
US11820827B2 (en) | 2019-12-30 | 2023-11-21 | Seagen Inc. | Methods of treating myelodysplastic syndrome and acute myeloid leukemia with nonfucosylated anti-CD70 antibodies |
WO2021138264A1 (en) | 2019-12-30 | 2021-07-08 | Seagen Inc. | Methods of treating cancer with nonfucosylated anti-cd70 antibodies |
WO2021136772A1 (en) | 2020-01-02 | 2021-07-08 | F. Hoffmann-La Roche Ag | Method for determining the amount of a therapeutic antibody in the brain |
WO2021139777A1 (en) | 2020-01-10 | 2021-07-15 | 上海复宏汉霖生物技术股份有限公司 | Anti-tigit antibodies and usage method |
WO2021160155A1 (en) | 2020-02-10 | 2021-08-19 | 上海诗健生物科技有限公司 | Claudin 18.2 antibody and use thereof |
WO2021160154A1 (en) | 2020-02-10 | 2021-08-19 | 上海诗健生物科技有限公司 | Cldn18.2 antibody and use thereof |
WO2021163265A1 (en) | 2020-02-11 | 2021-08-19 | Vanderbilt University | Human monoclonal antibodies to severe acute respiratory syndrome coronavirus 2 (sars-cov- 2) |
WO2021162020A1 (en) | 2020-02-12 | 2021-08-19 | 中外製薬株式会社 | Anti-cd137 antigen-binding molecule for use in cancer treatment |
WO2021170082A1 (en) | 2020-02-28 | 2021-09-02 | 南京圣和药业股份有限公司 | Anti-cd47/anti-pd-l1 antibody and applications thereof |
WO2021183849A1 (en) | 2020-03-13 | 2021-09-16 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
WO2021188749A1 (en) | 2020-03-19 | 2021-09-23 | Genentech, Inc. | Isoform-selective anti-tgf-beta antibodies and methods of use |
WO2021194913A1 (en) | 2020-03-24 | 2021-09-30 | Genentech, Inc. | Tie2-binding agents and methods of use |
EP4356924A2 (en) | 2020-03-26 | 2024-04-24 | Vanderbilt University | Human monoclonal antibodies to severe acute respiratory syndrome coronavirus 2 (sars-cov-2) |
WO2021195385A1 (en) | 2020-03-26 | 2021-09-30 | Vanderbilt University | HUMAN MONOCLONAL ANTIBODIES TO SEVERE ACUTE RESPIRATORY SYNDROME CORONAVIRUS 2 (SARS-GoV-2) |
WO2021195418A1 (en) | 2020-03-26 | 2021-09-30 | Vanderbilt University | Human monoclonal antibodies to severe acute respiratory syndrome coronavirus 2 (sars-cov-2) |
WO2021201202A1 (en) | 2020-04-02 | 2021-10-07 | 中外製薬株式会社 | Analysis method for impurity molecules in composition containing multi-specific antigen-binding molecules |
WO2021202959A1 (en) | 2020-04-03 | 2021-10-07 | Genentech, Inc. | Therapeutic and diagnostic methods for cancer |
WO2021217051A1 (en) | 2020-04-24 | 2021-10-28 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates |
WO2021222167A1 (en) | 2020-04-28 | 2021-11-04 | Genentech, Inc. | Methods and compositions for non-small cell lung cancer immunotherapy |
WO2021222533A1 (en) | 2020-04-30 | 2021-11-04 | Procisedx Inc. | Methods of detecting antibodies to sars-cov-2 |
US11643388B2 (en) | 2020-05-01 | 2023-05-09 | The Regents Of The University Of California | Inhibitors of alpha 2 beta 1 integrin and methods of use thereof |
WO2021225892A1 (en) | 2020-05-03 | 2021-11-11 | Levena (Suzhou) Biopharma Co., Ltd. | Antibody-drug conjugates (adcs) comprising an anti-trop-2 antibody, compositions comprising such adcs, as well as methods of making and using the same |
WO2021236658A1 (en) | 2020-05-19 | 2021-11-25 | Boehringer Ingelheim International Gmbh | Binding molecules for the treatment of cancer |
WO2021243204A1 (en) | 2020-05-29 | 2021-12-02 | 23Andme, Inc. | Anti-cd200r1 antibodies and methods of use thereof |
WO2021252977A1 (en) | 2020-06-12 | 2021-12-16 | Genentech, Inc. | Methods and compositions for cancer immunotherapy |
WO2021257503A1 (en) | 2020-06-16 | 2021-12-23 | Genentech, Inc. | Methods and compositions for treating triple-negative breast cancer |
WO2021256555A1 (en) | 2020-06-19 | 2021-12-23 | 中外製薬株式会社 | Anti-t cell antigen-binding molecule for use in combination with angiogenesis inhibitor |
WO2021259880A1 (en) | 2020-06-22 | 2021-12-30 | Almirall, S.A. | Anti-il-36 antibodies and methods of use thereof |
WO2021260210A2 (en) | 2020-06-26 | 2021-12-30 | Bayer Aktiengesellschaft | Anti ccr8 antibody therapy: biomarkers & combination therapies |
WO2021152186A2 (en) | 2020-06-26 | 2021-08-05 | Bayer Aktiengesellschaft | Ccr8 antibodies for therapeutic applications |
WO2021260208A2 (en) | 2020-06-26 | 2021-12-30 | Bayer Aktiengesellschaft | Sulfated peptides for chemokine receptor antibody generation |
WO2021260206A2 (en) | 2020-06-26 | 2021-12-30 | Bayer Aktiengesellschaft | Chemokine receptor antibodies binding sulfated trd motifs |
US11427640B1 (en) | 2020-06-26 | 2022-08-30 | Bayer Aktiengesellschaft | CCR8 antibodies for therapeutic applications |
WO2021260209A2 (en) | 2020-06-26 | 2021-12-30 | Bayer Aktiengesellschaft | Ccr8 antibodies and uses thereof |
WO2022016119A1 (en) | 2020-07-17 | 2022-01-20 | Simurx, Inc. | Chimeric myd88 receptors for redirecting immunosuppressive signaling and related compositions and methods |
WO2022020288A1 (en) | 2020-07-21 | 2022-01-27 | Genentech, Inc. | Antibody-conjugated chemical inducers of degradation of brm and methods thereof |
WO2022023735A1 (en) | 2020-07-28 | 2022-02-03 | Femtogenix Limited | Cytotoxic agents |
WO2022025220A1 (en) | 2020-07-31 | 2022-02-03 | 中外製薬株式会社 | Pharmaceutical composition including cell expressing chimeric receptor |
WO2022057651A1 (en) | 2020-09-16 | 2022-03-24 | 四川科伦博泰生物医药股份有限公司 | Anti-nectin-4 antibody, conjugate including same, and application thereof |
WO2022061214A1 (en) | 2020-09-21 | 2022-03-24 | Genentech, Inc. | Purification of multispecific antibodies |
WO2022063100A1 (en) | 2020-09-22 | 2022-03-31 | 南京圣和药业股份有限公司 | Anti-tigit antibody and double antibody and their application |
WO2022063877A1 (en) | 2020-09-24 | 2022-03-31 | F. Hoffmann-La Roche Ag | Mammalian cell lines with gene knockout |
WO2022069557A2 (en) | 2020-09-29 | 2022-04-07 | Immatics Biotechnologies Gmbh | Amidated peptides and their deamidated counterparts displayed by hla-a*02 for use in immunotherapy against different types of cancers |
DE102020125457A1 (en) | 2020-09-29 | 2022-03-31 | Immatics Biotechnologies Gmbh | Amidated peptides and their deamidated counterparts presented by HLA-A*02 molecules for use in immunotherapy against various types of cancer |
DE102020125465A1 (en) | 2020-09-29 | 2022-03-31 | Immatics Biotechnologies Gmbh | Amidated peptides and their deamidated counterparts presented by non-HLA-A*02 molecules for use in immunotherapy against various types of cancer |
WO2022069579A2 (en) | 2020-09-29 | 2022-04-07 | Immatics Biotechnologies Gmbh | Amidated peptides and their deamidated counterparts displayed by non-hla-a*02 for use in immunotherapy against different types of cancers |
WO2022076462A1 (en) | 2020-10-05 | 2022-04-14 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2022084210A1 (en) | 2020-10-20 | 2022-04-28 | F. Hoffmann-La Roche Ag | Combination therapy of pd-1 axis binding antagonists and lrrk2 inhitibors |
WO2022084354A1 (en) | 2020-10-21 | 2022-04-28 | Boehringer Ingelheim International Gmbh | Bispecific anti-vegf and anti-trkb binding molecules for the treatment of eye diseases |
WO2022084355A2 (en) | 2020-10-21 | 2022-04-28 | Boehringer Ingelheim International Gmbh | Agonistic trkb binding molecules for the treatment of eye diseases |
WO2022098972A1 (en) | 2020-11-08 | 2022-05-12 | Seagen Inc. | Combination-therapy antibody drug conjugate with immune cell inhibitor |
WO2022097117A1 (en) | 2020-11-09 | 2022-05-12 | Takeda Pharmaceutical Company Ltd. | Antibody drug conjugates |
WO2022100613A1 (en) | 2020-11-10 | 2022-05-19 | 上海齐鲁制药研究中心有限公司 | Bispecific antibody for claudin 18a2 and cd3 and application of bispecific antibody |
WO2022101458A1 (en) | 2020-11-16 | 2022-05-19 | F. Hoffmann-La Roche Ag | Combination therapy with fap-targeted cd40 agonists |
WO2022120352A1 (en) | 2020-12-02 | 2022-06-09 | Alector Llc | Methods of use of anti-sortilin antibodies |
WO2022136140A1 (en) | 2020-12-22 | 2022-06-30 | F. Hoffmann-La Roche Ag | Oligonucleotides targeting xbp1 |
WO2022152880A1 (en) | 2021-01-15 | 2022-07-21 | Immatics Biotechnologies Gmbh | Peptides displayed by hla for use in immunotherapy against different types of cancers |
WO2022159349A1 (en) | 2021-01-20 | 2022-07-28 | Oncoresponse, Inc. | Immunomodulatory antibodies and uses thereof |
WO2022157094A2 (en) | 2021-01-22 | 2022-07-28 | Bayer Aktiengesellschaft | Lrrc15 antibodies and conjugates thereof |
WO2022169825A1 (en) | 2021-02-03 | 2022-08-11 | Mozart Therapeutics, Inc. | Binding agents and methods of using the same |
WO2022175217A1 (en) | 2021-02-18 | 2022-08-25 | F. Hoffmann-La Roche Ag | Method for resolving complex, multistep antibody interactions |
WO2022177392A1 (en) | 2021-02-19 | 2022-08-25 | (주)샤페론 | Single domain antibody against cd47 and use thereof |
WO2022177393A1 (en) | 2021-02-19 | 2022-08-25 | (주)샤페론 | Single domain antibody against pd-l1 and use thereof |
WO2022187272A1 (en) | 2021-03-01 | 2022-09-09 | Xilio Development, Inc. | Combination of masked ctla4 and pd1/pdl1 antibodies for treating cancer |
WO2022187270A1 (en) | 2021-03-01 | 2022-09-09 | Xilio Development, Inc. | Combination of ctla4 and pd1/pdl1 antibodies for treating cancer |
WO2022184082A1 (en) | 2021-03-03 | 2022-09-09 | Sorrento Therapeutics, Inc. | Antibody-drug conjugates comprising an anti-bcma antibody |
WO2022190034A1 (en) | 2021-03-12 | 2022-09-15 | Janssen Biotech, Inc. | Method of treating psoriatic arthritis patients with inadequate response to tnf therapy with anti-il23 specific antibody |
WO2022190033A1 (en) | 2021-03-12 | 2022-09-15 | Janssen Biotech, Inc. | Safe and effective method of treating psoriatic arthritis with anti-il23 specific antibody |
WO2022198192A1 (en) | 2021-03-15 | 2022-09-22 | Genentech, Inc. | Compositions and methods of treating lupus nephritis |
WO2022197947A1 (en) | 2021-03-18 | 2022-09-22 | Alector Llc | Anti-tmem106b antibodies and methods of use thereof |
WO2022197877A1 (en) | 2021-03-19 | 2022-09-22 | Genentech, Inc. | Methods and compositions for time delayed bio-orthogonal release of cytotoxic agents |
WO2022200387A1 (en) | 2021-03-22 | 2022-09-29 | Novimmune S.A. | Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof |
WO2022200389A1 (en) | 2021-03-22 | 2022-09-29 | Novimmune S.A. | Bispecific antibodies targeting cd47 and pd-l1 and methods of use thereof |
WO2022204274A1 (en) | 2021-03-23 | 2022-09-29 | Alector Llc | Anti-tmem106b antibodies for treating and preventing coronavirus infections |
WO2022201122A1 (en) | 2021-03-26 | 2022-09-29 | Janssen Biotech, Inc. | Humanized antibodies against paired helical filament tau and uses thereof |
WO2022217026A1 (en) | 2021-04-09 | 2022-10-13 | Seagen Inc. | Methods of treating cancer with anti-tigit antibodies |
WO2022214565A1 (en) | 2021-04-09 | 2022-10-13 | F. Hoffmann-La Roche Ag | Process for selecting cell clones expressing a heterologous polypeptide |
WO2022217022A1 (en) | 2021-04-10 | 2022-10-13 | Profoundbio Us Co. | Folr1 binding agents, conjugates thereof and methods of using the same |
WO2022218957A1 (en) | 2021-04-12 | 2022-10-20 | Acm Biolabs Pte Ltd | Polymersomes comprising a soluble encapsulated polynucleotide and an ionizable lipid as well as methods of making and uses thereof |
WO2022220275A1 (en) | 2021-04-15 | 2022-10-20 | 中外製薬株式会社 | ANTI-C1s ANTIBODY |
WO2022226317A1 (en) | 2021-04-23 | 2022-10-27 | Profoundbio Us Co. | Anti-cd70 antibodies, conjugates thereof and methods of using the same |
WO2022228705A1 (en) | 2021-04-30 | 2022-11-03 | F. Hoffmann-La Roche Ag | Dosing for combination treatment with anti-cd20/anti-cd3 bispecific antibody and anti-cd79b antibody drug conjugate |
WO2022228706A1 (en) | 2021-04-30 | 2022-11-03 | F. Hoffmann-La Roche Ag | Dosing for treatment with anti-cd20/anti-cd3 bispecific antibody |
WO2022238481A1 (en) | 2021-05-11 | 2022-11-17 | Modiquest B.V. | Antibodies |
WO2022241446A1 (en) | 2021-05-12 | 2022-11-17 | Genentech, Inc. | Methods of using anti-cd79b immunoconjugates to treat diffuse large b-cell lymphoma |
WO2022241082A1 (en) | 2021-05-14 | 2022-11-17 | Genentech, Inc. | Agonists of trem2 |
WO2022247030A1 (en) | 2021-05-27 | 2022-12-01 | 江苏荃信生物医药股份有限公司 | ANTI-HUMAN INTERFERON α RECEPTOR 1 MONOCLONAL ANTIBODY AND APPLICATION THEREOF |
EP4155321A1 (en) | 2021-06-04 | 2023-03-29 | Chugai Seiyaku Kabushiki Kaisha | Anti-ddr2 antibodies and uses thereof |
WO2022258600A1 (en) | 2021-06-09 | 2022-12-15 | F. Hoffmann-La Roche Ag | Combination of a particular braf inhibitor (paradox breaker) and a pd-1 axis binding antagonist for use in the treatment of cancer |
WO2022263507A1 (en) | 2021-06-17 | 2022-12-22 | Boehringer Ingelheim International Gmbh | Novel tri-specific binding molecules |
WO2022270612A1 (en) | 2021-06-25 | 2022-12-29 | 中外製薬株式会社 | Use of anti-ctla-4 antibody |
WO2022270611A1 (en) | 2021-06-25 | 2022-12-29 | 中外製薬株式会社 | Anti–ctla-4 antibody |
WO2023278377A1 (en) | 2021-06-29 | 2023-01-05 | Seagen Inc. | Methods of treating cancer with a combination of a nonfucosylated anti-cd70 antibody and a cd47 antagonist |
WO2023280227A2 (en) | 2021-07-06 | 2023-01-12 | Profoundbio Us Co. | Linkers, drug linkers and conjugates thereof and methods of using the same |
WO2023004386A1 (en) | 2021-07-22 | 2023-01-26 | Genentech, Inc. | Brain targeting compositions and methods of use thereof |
WO2023019239A1 (en) | 2021-08-13 | 2023-02-16 | Genentech, Inc. | Dosing for anti-tryptase antibodies |
WO2023028591A1 (en) | 2021-08-27 | 2023-03-02 | Genentech, Inc. | Methods of treating tau pathologies |
WO2023034750A1 (en) | 2021-08-30 | 2023-03-09 | Genentech, Inc. | Anti-polyubiquitin multispecific antibodies |
WO2023029281A1 (en) | 2021-09-03 | 2023-03-09 | 江苏荃信生物医药股份有限公司 | Anti-human tslp monoclonal antibody and use thereof |
WO2023029280A1 (en) | 2021-09-03 | 2023-03-09 | 江苏荃信生物医药股份有限公司 | Anti-human interleukin-33 monoclonal antibody and use thereof |
WO2023058723A1 (en) | 2021-10-08 | 2023-04-13 | 中外製薬株式会社 | Method for preparing prefilled syringe formulation |
WO2023064947A1 (en) | 2021-10-15 | 2023-04-20 | Regenxbio Inc. | Antibodies and methods of using thereof |
WO2023076876A1 (en) | 2021-10-26 | 2023-05-04 | Mozart Therapeutics, Inc. | Modulation of immune responses to viral vectors |
WO2023073615A1 (en) | 2021-10-29 | 2023-05-04 | Janssen Biotech, Inc. | Methods of treating crohn's disease with anti-il23 specific antibody |
WO2023081898A1 (en) | 2021-11-08 | 2023-05-11 | Alector Llc | Soluble cd33 as a biomarker for anti-cd33 efficacy |
WO2023086807A1 (en) | 2021-11-10 | 2023-05-19 | Genentech, Inc. | Anti-interleukin-33 antibodies and uses thereof |
WO2023084488A1 (en) | 2021-11-15 | 2023-05-19 | Janssen Biotech, Inc. | Methods of treating crohn's disease with anti-il23 specific antibody |
WO2023095000A1 (en) | 2021-11-23 | 2023-06-01 | Janssen Biotech, Inc. | Method of treating ulcerative colitis with anti-il23 specific antibody |
WO2023094282A1 (en) | 2021-11-25 | 2023-06-01 | F. Hoffmann-La Roche Ag | Quantification of low amounts of antibody sideproducts |
WO2023117325A1 (en) | 2021-12-21 | 2023-06-29 | F. Hoffmann-La Roche Ag | Method for the determination of hydrolytic activity |
WO2023147328A1 (en) | 2022-01-26 | 2023-08-03 | Genentech, Inc. | Antibody-conjugated chemical inducers of degradation with hydolysable maleimide linkers and methods thereof |
WO2023147329A1 (en) | 2022-01-26 | 2023-08-03 | Genentech, Inc. | Antibody-conjugated chemical inducers of degradation and methods thereof |
WO2023173026A1 (en) | 2022-03-10 | 2023-09-14 | Sorrento Therapeutics, Inc. | Antibody-drug conjugates and uses thereof |
WO2023170295A1 (en) | 2022-03-11 | 2023-09-14 | Janssen Pharmaceutica Nv | Multispecific antibodies and uses thereof |
WO2023170291A1 (en) | 2022-03-11 | 2023-09-14 | Janssen Pharmaceutica Nv | Multispecific antibodies and uses thereof |
WO2023170290A1 (en) | 2022-03-11 | 2023-09-14 | Janssen Pharmaceutica Nv | Multispecific antibodies and uses thereof |
WO2023178357A1 (en) | 2022-03-18 | 2023-09-21 | Evolveimmune Therapeutics, Inc. | Bispecific antibody fusion molecules and methods of use thereof |
WO2023180353A1 (en) | 2022-03-23 | 2023-09-28 | F. Hoffmann-La Roche Ag | Combination treatment of an anti-cd20/anti-cd3 bispecific antibody and chemotherapy |
WO2023187707A1 (en) | 2022-03-30 | 2023-10-05 | Janssen Biotech, Inc. | Method of treating mild to moderate psoriasis with il-23 specific antibody |
WO2023187407A1 (en) | 2022-04-01 | 2023-10-05 | Bradcode Limited | Human monoclonal antibodies binding to sars-cov-2 and methods of use thereof |
WO2023191816A1 (en) | 2022-04-01 | 2023-10-05 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2023192622A1 (en) | 2022-04-01 | 2023-10-05 | Genentech, Inc. | Hydroxypropyl methyl cellulose derivatives to stabilize polypeptides |
WO2023198727A1 (en) | 2022-04-13 | 2023-10-19 | F. Hoffmann-La Roche Ag | Pharmaceutical compositions of anti-cd20/anti-cd3 bispecific antibodies and methods of use |
WO2023201299A1 (en) | 2022-04-13 | 2023-10-19 | Genentech, Inc. | Pharmaceutical compositions of therapeutic proteins and methods of use |
WO2023202967A1 (en) | 2022-04-19 | 2023-10-26 | F. Hoffmann-La Roche Ag | Improved production cells |
WO2023215737A1 (en) | 2022-05-03 | 2023-11-09 | Genentech, Inc. | Anti-ly6e antibodies, immunoconjugates, and uses thereof |
WO2023215498A2 (en) | 2022-05-05 | 2023-11-09 | Modernatx, Inc. | Compositions and methods for cd28 antagonism |
WO2023219613A1 (en) | 2022-05-11 | 2023-11-16 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2023223265A1 (en) | 2022-05-18 | 2023-11-23 | Janssen Biotech, Inc. | Method for evaluating and treating psoriatic arthritis with il23 antibody |
WO2023232961A1 (en) | 2022-06-03 | 2023-12-07 | F. Hoffmann-La Roche Ag | Improved production cells |
WO2023245105A1 (en) | 2022-06-17 | 2023-12-21 | Genentech, Inc. | Use of kosmotropes to enhance yield of an affinity chromatography purification step |
WO2024015897A1 (en) | 2022-07-13 | 2024-01-18 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2024013315A1 (en) | 2022-07-15 | 2024-01-18 | Boehringer Ingelheim International Gmbh | Binding molecules for the treatment of cancer |
WO2024020432A1 (en) | 2022-07-19 | 2024-01-25 | Genentech, Inc. | Dosing for treatment with anti-fcrh5/anti-cd3 bispecific antibodies |
WO2024020579A1 (en) | 2022-07-22 | 2024-01-25 | Bristol-Myers Squibb Company | Antibodies binding to human pad4 and uses thereof |
WO2024030956A2 (en) | 2022-08-03 | 2024-02-08 | Mozart Therapeutics, Inc. | Cd39-specific binding agents and methods of using the same |
WO2024049949A1 (en) | 2022-09-01 | 2024-03-07 | Genentech, Inc. | Therapeutic and diagnostic methods for bladder cancer |
WO2024079069A1 (en) | 2022-10-12 | 2024-04-18 | F. Hoffmann-La Roche Ag | Method for classifying cells |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO1993008829A1 (en) | Compositions that mediate killing of hiv-infected cells | |
EP0383799B2 (en) | Adheson variants | |
US5565335A (en) | Adhesion variants | |
Zettlmeissl et al. | Expression and characterization of human CD4: immunoglobulin fusion proteins | |
AU668423B2 (en) | Bispecific immunoadhesins | |
JP3808553B2 (en) | CTLA4 mutant molecules and uses thereof | |
CN105017429B (en) | Multimeric IL-15 soluble fusion molecules and methods of making and using the same | |
US5817767A (en) | Synergistic composition of CD4-based protein and anti-HIV-1 antibody, and methods of using same | |
US5605689A (en) | Treatment of HIV-associated immune thrombocytopenic purpura | |
CA2080226C (en) | Cd4-gamma2 and cd4-igg2 chimeras | |
US20030104535A1 (en) | Adheson variants | |
AU765218B2 (en) | A novel chimeric protein for prevention and treatment of HIV infection | |
EP0832971B1 (en) | Adheson variants | |
IL91070A (en) | Cytotoxic agent against specific virus infection | |
AU618969B2 (en) | Adheson variants | |
CHAMOW et al. | A humanized, bispecific immunoadhesin-antibody that retargets CD3+ effectors to kill HIV-1-infected cells | |
AU623924B2 (en) | Cytotoxic agent against specific virus infection |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): JP US |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL SE |
|
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
ENP | Entry into the national phase |
Ref country code: US Ref document number: 1994 240676 Date of ref document: 19940504 Kind code of ref document: A Format of ref document f/p: F |
|
122 | Ep: pct application non-entry in european phase |