IL91070A - Cytotoxic agent against specific virus infection - Google Patents

Cytotoxic agent against specific virus infection

Info

Publication number
IL91070A
IL91070A IL9107089A IL9107089A IL91070A IL 91070 A IL91070 A IL 91070A IL 9107089 A IL9107089 A IL 9107089A IL 9107089 A IL9107089 A IL 9107089A IL 91070 A IL91070 A IL 91070A
Authority
IL
Israel
Prior art keywords
protein
cells
hybrid protein
hiv
human
Prior art date
Application number
IL9107089A
Other languages
Hebrew (he)
Other versions
IL91070A0 (en
Original Assignee
Us Commerce
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27397211&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=IL91070(A) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority claimed from US07/223,270 external-priority patent/US5206353A/en
Application filed by Us Commerce filed Critical Us Commerce
Publication of IL91070A0 publication Critical patent/IL91070A0/en
Publication of IL91070A publication Critical patent/IL91070A/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70514CD4
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/21Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Pseudomonadaceae (F)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/32Fusion polypeptide fusions with soluble part of a cell surface receptor, "decoy receptors"
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/55Fusion polypeptide containing a fusion with a toxin, e.g. diphteria toxin

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Description

Cytotoxic agent against specific virus infection THE UNITED STATES OF AMERICA, represented by the Secretary, United States Department of Commerce C: 78118 CYTOTOXIC AGENT AGAINST SPECIFIC VIRUS INFECTION Technical Field The present invention is related generally to the control of viral infection. More particularly, the present invention is related to the construction of a chimeric gene expressing a recombinant fusion protein which selectively kills specific virus-infected cells; to a recombinant soluble truncated form of CD4 containing the active binding site for human immunodeficiency virus; and to a multivalent product having substantially long half-life, bonding avidity and the capacity to direct components of the native immune system to kill HIV infected cells or HIV virions _in_ vivo relative to mono-meric forms. A hybrid fusion protein having selective cytotoxicity against HIV infected cells has been made. Background of Invention It is estimated that in the absence of effective therapy, most, if not all, individuals infected with human immunodeficiency virus (HIV) will develop acquired immune deficiency syndrome (AIDS) and ultimately succumb to a combination of opportunistic microbial infections and malignancies. It is further estimated that without an effective vaccine, the number of infected individuals is likely to increase substantially.
Anti-viral agents, immunomodulators and inhibitors of specific HIV functions are being tested as potential treatments to alleviate the high morbidity and mortality related to AIDS. However, a potent cytotoxic agent targeted to selectively kill HIV-infected cells has not heretofore been developed.
CD4 derivatives are uniquely suitable for AIDS treatment, since divergent strains of HIV-1 and HIV-2 all infect human T lymphocytes by binding to surface CD4. A recent report describes recombinant proteins containing soluble CD4 linked to human immunoglobulin heavy constant region sequences (Capon et al. 1989. Nature (London) 337, 525-531). However, the molecules did not bind complement component Cg , and no activity against HIV- infected cells or virions was presented. The hybrid proteins of the present invention have distinctive properties not heretofore known or described.
CD4 is an integral membrane glycoprotein of human helper T lymphocytes that serves as an essential component of the receptor for the human immunodeficiency virus (HIV) (Popovic et al . 1984. Clin. Res. 33, 560A abstr.; and Maddon et al . 1986. Cell 47 , 333-348 ), the causative agent of acquired immunodeficiency syndrome. HIV binding and fusion with the cell are mediated by specific interaction between the external subunit of the viral envelope glycoprotein (gpl20) and CD4 on the target cell surface [McDougal et al. 1986, Science 231, 382-385; Sodroski et al. 1986. Nature (London) 322,470-474; and Lundin et al. 1987. J. Immunol. Methods 97, 93-100].
Recent studies have yielded considerable insight into the structure of the CD4 molecule and its counterpart from other species . The primary sequence deduced from the human cDNA (Maddon et al. 1985. Cell 42, 93-104) and from N-terminal protein sequence analysis (Fisher et al, 1988, Nature, 331: 76-78) indicates that the processed molecule is 433 amino acid residues in length, with a long N-terminal extracellular region followed by a transmembrane segment and a C-terminal cytoplasmic tail. The external region contains an N-terminal domain of 100 amino acid residues that shares striking sequence homology and secondary structural features with the immunoglobulin light chain variable domain .
The remainder of the external region ( 270 residues) appears to be composed of three additional domains that also display structural relationships to the immunoglobulin family (Clark et al. 1987. Proc . Natl . Acad. Sci. USA 84, 1649-1653). The finding of introns separating the coding sequences for these regions in the CD4 gene (Littman, D.R. 1987. Annu. Rev. Immunol. 5, 561-584) supports this notion of structural and possibly - 3 - 91070/2 f nctional domains . Of particular interest is the existence of conserved pairs of cysteine residues that probably form intradomain disulfide bonds within the first, second, and fourth external domains (Classon et al. 1986. Proc. Natl. Acad. Sci. USA 83, 4499-4503). These structural features deduced from cDNA sequencing have been complemented by epitope analyses using panels of anti-CD4 monoclonal antibodies (mAbs) . Such studies have shed light on the topographic relationships of the various epitopes to one another, to . the HIV-binding site, and to the cell membrane (Lundin et al, suora ; Rao et al. 1983. Cell . Immunol . 80, 310-319; and Sattentau et al. 1985. Science 234, 1120-1123). However, the region(s) of the CD4 molecule involved in binding to the HIV envelope glycoprotein heretofore have not been identified.
SUMMARY OF THE INVENTION It is, therefore, an object of the present invention to provide a chimeric gene which directs the synthesis, in a suitable expression vector, of a hybrid protein comprising' a virus binding region from a cellular receptor sequence linked to a protein sequence containing a region having an effect leading to cell toxicity.
It is a further object of the present invention to provide a hybrid protein comprising a virus binding region from a cellular receptor sequence linked to a protein sequence containing a region having an effect leading to cell cytotoxicity. In particular, there is provided an isolated substantially pure fusion protein comprising the HIV binding portion of the human CD4 molecule, and active regions of Pseudomonas exotoxin A. - 3a - 91070/1 It is another abject of the present invention to provide an anti-HIV composition comprising a polypeo-tide molecule made of about 180 amino acid residues representing the first two immunoglobulin-like domain of CD4 and having immunological and functional properties of an active H V-binding site.
It is also an objec of the present invention to provide multimeric human CD4—immunoglobulin recombinant proteins which selectively bind to gpl20 on the surface of HIV-infected cells with higher affinity tha monomeric soluble CD4 and which can direct components of 91070/2 - 4 - the immune system (complement and ADCC) to fight HIV infection.
It is yet another object of the present invention to provide an-anti-HIV reagent containing only human sequences so that heat immune responses , which usually occur with foreign proteins, are minimized when the reagent of the present invention is administered to humans .
It is a further object of the present invention to provide a method of killing HIV infected cells or neutralizing HIV activity through the hybrid proteins of the present invention.
It is another object of the present invention to provide a method of controlling AIDS virus infection, comprising contacting HIV-infected cells with effective amounts of the fusion protein of the present invention to selectively kill the HIV-infected cells .
Other objects and advantages of the present invention will become evident from the following detailed description of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS These and other objects, features and many of the attendant advantages of the invention will be better understood upon a reading of the following detailed description when considered in connection with the accompanying drawings wherein : Figure 1 s a schematic representation of the plasmid used for expressing CD ( 178 ) -PE40.
Figure 2 shows the results of column chromatography ( 2A) and gel electrophoresis (2B) of the CD4(178)-PE40; - 5 - Figure 3 demonstrates the binding of CD4(178)-PE40 to HIV envelope protein gpl20 by (3A) coprecipita-tion technique and (3B, 3C, 3D and 3E) by immunofluorescence microscopy; and Figure 4 shows the selective cytotoxic effect of CD4 ( 178 ) -PE40 on cells expressing HIV-1 envelope glycoprotein: 4A. Cells expressing the HIV-1 envelope glycoprotein encoded by a recombinant vaccinia virus . Closed symbols represent cells infected with vPE-16, a vaccinia recombinant containing the HIV-1 gpl60 gene linked to the vaccinia 7.5 K promoter, inserted within the thymidine kinase locus . Open symbols represent cells infected with a control vaccinia recombinant, vTF7-3, which contains the bacteriophage T7 RNA polymerase gene also linked to the vaccinia 7.5 K promoter and inserted within the thymidine kinase locus . The toxin preparations used were: Δ , A PE, 0, · PE40, Q , ■ CD4(178)-PE40. 4B. Cells chronically infected with HIV-1. Closed symbols represent the 8E5 human T-cell line which con-tains a single integrated copy of the HIV-1 (LAV) genome'. The virions produced are non-infectious due to a premature chain termination mutation in the reverse transcriptase gene. Open symbols represent the parental non-infected A3.01 cell line. The toxin preparation used were: Δ , A PE, 0, · PE40, □ , g CD4 ( 178-PE40) .
Figure 5 shows schematic construction of plasmid pCD4f. Plasmid pT 7-5 contains the bacteriophage T7 gene 10 promoter (PT7) and the T7 terminator (TT7) separated by a unique BamHI site. This region is flanked by vaccinia virus thymidine kinase left (TKL) and right (T R) sequences. An adapter made by using two partially complementary synthetic oligonucleotides (GATCGAATTCAGGC-CTAATTAATTAAGTCGAC and GATCGTCGACTTAATTAATTAGGCCTGAATTC ) was ligated into the BamHI site of pTF7-5 by using the BamHI 5' overhangs of the adapter. The BamHI site is destroyed in the desired recombinants. Hence the reaction mixture was digested with BamHI to linearize recir- cularized plasmids lacking the insert, and ampicillin- resistant transformants were screened by restriction mapping to identify those containing the insert in the desired orientation. Plasmid pEB-2 contains unique sites for EcoRI and Stu I , followed by a universal termination sequence (UTS) providing termination codons in all three reading frames, followed by a unique Sal I site. The desired CD4 DNA fragment was obtained by digesting pCD4-GEM4 with Nhe I (which cleaves the plasmid at a unique site at nucleotide 678 of the CD4 cDNA sequence), filling in the staggered end with the Klenow fragment of DNA polymerase I and dNTPs, and then digesting with EcoRI . The resulting 0.68-kilobase EcoRI-Nhe I fragment, which contains the ATG initiation codon of CD4 , was force-cloned into pEB-2, which had been digested with EcoRI and Stu I . The Stu I site in the vector is destroyed in the recombinant. Hence the reaction mixture was digested with Stu I, and pCD4, was identified by restriction mapping of the ampicillin-resistant transformants . DNA sequence analysis of pCD4 indicated that the last amino acid of the CD4 sequence is the leucine at position 177 of the processed translation product, and that two additional C-terminal residues, proline and asparagine, are derived from translation of a portion of the UTS sequence in the vector.
Figure 6 shows the results of analysis of the metabolically labeled transient expression products . Transient metabolic labeling reactions were performed in cells infected with vTF7-3 and transfected with either plasmid pEB-2 or pCD4f, and the media were collected. For immunoprecipitation, reaction mixes were prepared containing 1.1 ml of transfection medium, 0.99 ml of protease inhibitor buffer, and 0.11 ml of 20% (vol/vol) Nonidet P-40. The samples were cleared by incubation with 0.13 ml of a 20% (vol/vol) suspension of protein A-agarose for 1 hr at 4°C; this was followed by centrifuga-tion. To the supernatants were added 2 ug of each of the - 7 - following murine mAbs : MT151, 0KT4 , and 0KT4A (all are IgG2 ) . After overnight incubation, 0.05 ml of 20% suspension of protein A-agarose was added, and the incubations were continued for 3 hr at 4°C on a rotator. The samples were centrifuged and pellet and supernatant fractions were saved. The pellets were washed and treated with 0.1 ml of sample buffer containing 8 M urea, and 0.09-ml aliquots were analyzed by gel electrophoresis. (6A) Analysis on 12% gels of the total medium fractions (0.05 ml) and the corresponding supernatant fractions remaining after radioimmunoprecipitation . Lanes 1 and 2, total medium of cells transfected with pCD4f (lane 1) and the corresponding immunoprecipitation supernatant ( lane 2); lanes 3 and 4, total medium of cells transfected with pEB-2 (lane 3) and the corresponding immunoprecipitation supernatant (lane 4). (6B) Analysis on 15% gels of immunoprecipitates from medium of cells transfected with pCD4f (lane 5) and cells transfected wiht pEB-2 (lane 6 ) . The arrow on the left indicates the position of the CD4 fragment band, and the numbers in the center repre-sent molecular weight markers (expressed as Mf x 10 ).
Figure 7 shows the results of epitope analysis of the CD4 fragment. Cells were metabolically labeled with 35S-cysteine after infection with vTF7-3 and trans-fection with pCD4f . The medium was collected. A mixture was prepared containing 0.55 ml of this transfection medium, 0.55 ml of protease inhibitor buffer, 0.07 ml of 20% (vol/vol) Nonidet P-40, and 1.58 ml of phosphate-buffered saline containing 0.02% (wt/vol) sodium azide. The mixture was cleared with 0.28 ml of a 20% suspension of protein A-agarose as described for Fig. 2, and 0.27 ml aliquots (representing 0.05 ml of initial transfection medium) were treated with 1 ug of the indicated mAbs. After overnight incubation at 4°C, each sample received 0.05 ml of a 20% (vol/vol) suspension of protein A-agarose that had been previously coated with saturating amounts of rabbit antiserum to mouse IgG, thereby circum- venting potential problems associated with antibodies of different subclasses. Samples were incubated on a rotator for 4 hr at 4°C, and the pellets were collected and washed. They were dissolved in 0.09 ml of sample buffer containing 8 M urea and applied to 12% polyacryl-amide gels. Lane 1, total transfection medium (0.05 ml); lane 2 , immunoprecipitate obtained with a control mAb (2E12.1). Immunoprecipitates were obtained with a battery of anti-CD4 mAbs: lane 3, MT151; lane 4, Leu3A; lane 5, 0KT4; lane 6, 0KT4A; lane 7, 0KT4B; lane 8, 0KT4C; lane 9, 0KT4D; lane 10, 0KT4E; lane 11, 0KT4F. Molecular weight markers are shown on the left (expressed as Mf x 10~3) .
Figure 8 demonstrates the interaction of the CD4 fragment with gpl20. Medium from cells metabolically labeled after infection with vTF7-3 and transfection with pCD4 was used as the source of the CD4 fragment. Media from unlabeled or metabolically labeled cells doubly infected with vTF7-3 plus vPE-6 served as the source of the gpl20. Molecular weight markers are shown on the left (expressed as Mj x 10~3). (8A) Coprecipitation of the CD4 fragment and gpl20 by using an anti-gpl20 mAb. Initial reaction mixtures contained 0.075 ml of each of the indicated media, 0.05 ml of protease inhibitor buffer, and 0.01 ml of 20% (vol/vol) Nonidet P-40. In the case of the double and single virus infection media, mixtures containing 1 part labeled and 19 parts corresponding unlabeled media were used. After preincubation for 4 hr at room temperature (about 22°-25°C), 0.14-ml aliquots were removed and the indicated MAbs were added (anti-gpl20, 0.1 ml of hybridoma 902 supernatant; anti-CD4, 1 ug of 0KT4A) . The immune complexes were collected with protein A-agarose that had been precoated with rabbit antiserum to mouse IgG and processed for electrophoresis on 12% gels as described in the legend to Fig. 7.
Lane 1 , total reaction mixture from the incuba- tion containing the transfection medium and the vTF7-3 plus vPE-6 double infection medium. The immune precipitates were obtained from reactions containing the following additions: lane 2, transfection medium, vTF7-3 plus vPE-G double infection medium, no antibody; lane 3, normal medium containing 2.5% fetal bovine serum, vTF7-3 plus vPE-6 double infection medium, anti-gpl20; lane 4, transfection medium, normal medium containing 2.5% fetal bovine serum, anti-gpl20; lane 5, transfection medium, VTP7-3 single infection medium, anti-gpl20; lane 6, transfection medium, vTF7-3 plus vPE-6 double infection medium, anti-gpl20; lane 7, transfection medium, normal medium containing 2.5% fetal bovine serum, anti-CD4. (8B) gpl20 inhibition of immunoprecipitation of the CD4 fragment by an anti-CD4 mAb. Initial reaction mixtures contained 0.05 ml of metabolically labeled transfection medium, 0.05 ml of protease inhibitor buffer, 0.01 ml of 20% Nonidet P-40, and 0.04 ml of phosphate-buffered saline containing 0.02% (wt/vol) sodium azide. The mixtures were supplemented with the unlabeled media indicated below and allowed to incubate at room temperature for 5 hr. Ten nanograms of anti-CD4 mAb 0KT4A was added, and the incubations were continued overnight at 4°C. Immune complexes were collected and processed as described in the legend to Fig. 6 and elec-trophoresed on 12% gels. The supplementary media added during the initial incubation were as follows: lane 8, normal medium containing 2.5% fetal bovine serum; lane 9, vTF7-3 single infection medium; lane 10, vTF7-3 plus vPE-6 double infection medium.
Figure 9 is a schematic representation of CD4-immunoglobulin hybrid proteins which were made in this invention .
Figure 10 shows the construction scheme of the intermediate plasmid, pCD4CHl which was used for the construction of the following plasmids for the expression of the hybrid proteins .
Figure 11 shows the construction scheme of PCD4ITM10 and pCD4lTM10G which express CD4(109)CH.
Figure 12 shows the construction scheme of pCD4ITM20 and pCD4ITM20G which express CD4(178)CH.
Figure 13 shows the construction scheme of PCD4ITM30 and pCD4lTM30G which express CD4(372)CH.
Figure 14 shows the construction scheme of pCD4ITM40G which expresses CD4(181)CL.
Figure 15 shows the expression of CD4(109)CH, CD4(178)CH, and CD4(372)CH in CV-1 cells. The immunocom-plexes were analyzed by SDS-polyacrylamide gel (10%) electrophoresis in a reducing condition in the presence of 5% beta-mercaptoethanol . Lanes 1, 3, 5, 7 and 9 represent the analysis of the culture media obtained by transfection of CV-1 cells by pEB2 (Berger et al . 1988. Proc. Natl. Acad. Sci. USA 85, 2357-2361), pCD4LTMl . (Mizukami et al. 1988, Proc. Natl. Acad. Sci. USA 85, 9273-9277), pCD4ITM10, pCD4ITM20, and pCD4ITM30, respectively. Lanes 2, 4, 6, 8 and 10 represent the analysis of the extracts of cells obtained by transfection of CV-1 cells by pEB2, pCD4LTMl, pCD4lT 10, pCD4lTM20, and PCD4ITM30, respectively. Molecular weight markers are shown on the right (expressed as kilodalton) .
Figure 16 shows the pattern of CD4(109)CH, CD4(178)CH, and CD4(372)CH expressed in CV-1 cells analyzed by SDS-polyacrylamide gels (7.5%) in a non-reducing condition. Lanes 1, 2, 3, 4 and 5 represent the analysis of the extracts of cells obtained by transfection of CV-1 cells by pEB2, pCD4LTMl , pCD4ITM10, pCD4ITM20, and pCD4ITM30, respectively. Lanes 6, 7, 8, 9 and 10 represent the analysis of the culture media obtained by transfection of CV-1 cells by pEB2, pCD4LTMl, pCD4ITM10, pCD4lTM20, and pCD4ITM30, respectively.
Figure 17 shows the coexpression of CD4(178)CH with CD4(181)CL in CV-1 cells. The immunocomplexes were analyzed by SDS-polyacrylamide gel (7.5%) electrophoresis in a reducing condition (lanes 1-4) or a non-reducing condition (lanes 5-8). Lanes 1 and 5 represent the analysis of the culture media of pTM3-transfected cells, lanes 2 and 6 for the culture media of pCD4ITM20G-transfected cells, lanes 3 and 7 for the culture media of pCD4lTM40G-transfected cells, and lanes 4 and 8 for the culture media of pCD4lTM20G and pCD48lT 40G doubly-transfected cells.
Figure 18 shows the schematic model structure of CD4(176)CH and CD4(181)CL tetrameric complex.
Figure 19 shows the expression of CD4(109)CH, CD4(178)CH, and CD4(372)CH in RPMI8226 cells. The immunocomplexes were analzyed by SDS-polyacrylamide gel (7.5%) electrophoresis in reducing conditions (lanes 1-8) or non-reducing conditions (lanes 9-16). Lanes 1, 9 and 2, 10 represent the analysis of the culture media and the extracts, respectively, of non-transfected cells, lanes 3, 11 and 4, 12 for the culture media and the extracts, respectively, of pCD4ITM10-transfected cells, lanes 5, 13 and 6, 14 for the culture media and the extracts, respectively, of pCD4ITM20 transfected cells, and lanes 7, 15 and 8, 16 for the culture media and the extracts of pCD4ITM30-transfected cells.
Figure 20 shows the analysis of the binding properties of CD4(178)CH and soluble CD4(372) which were secreted from the CV-l-transfected cells. Lanes 1-6 represent the analysis of soluble CD4> and lanes 7-12 represent the analysis of CD4(178)CH. The culture media were incubated with the following antibodies and ligands , and analyzed on each lane. Lanes 1 and 7 (no addition), 2 and 8 (OKT4), 3 and 9 (OKT4A), 4 and 10 (gpl20), 5 and 11 [anti-human IgG ( Fc ) ] , 6 and 12 (protein A-agarose). solCD4 and 178H denote soluble CD4(372) and CD4(178)CH, respectively .
Figure 21 shows the analysis of the binding property of CD4(178)CH which was secreted from the RPMl8226-transfected cells. The culture media were incubated with the following antibodies and ligands, and analyzed on each lane. Lane 1 (0 T4), 2 (0KT4A), 3 (gpl20), 4 [anti-human IgG (Fc)], 5 (protein A-agarose), 6 (anti-human lambda chain). 178H and IgL denote CD4(178)H and Ig light chain (lambda type), respectively.
Figure 22 shows the analysis of the binding properties of CD4(178)CH and CD4(181)CL coexpressed in CV-1 cells. The culture media of pCD4ITM20G and pCD4ITM40G doubly-transfected cells were incubated with the following antibodies and ligands , and analyzed on each lane. Lane 1 (no addition), 2 (0KT4), 3 (0KT4A) , 4 (gpl20), 5 [anti-human IgG (Fc)], 6 (protein A-agarose), 7 (anti-human kappa chain). 178H and 161L denote CD4(178)Ch and CD4(181)CL, respectively.
DETAILED DESCRIPTION OF THE INVENTION The above and various other objects and advantages of the present invention are achieved by a chimeric gene which encodes a recombinant fusion protein having selective toxicity against specific virus-infected cells . The principal aspect of the present invention is that a toxin, or a cytotoxic part thereof, could be genetically attached to a receptor protein (or a fragment thereof) so that the fusion - product binds to cells infected with a virus, since all viruses depend on a cellular receptor for entry. CD4 is one such receptor required by HIVs of different types. According to the present invention, such a chimeric gene encodes recombinant hybrid proteins comprising the HIV-gpl20 binding regions of the human CD4 molecule and constant regions of the human immunoglobulin heavy and/or light chain molecules. Hence, this invention is demonstrated by a partial but essential CD4 linked fusion cytotoxic product. The same principle can be applied for other viruses .
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly undersstood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described - 13 - herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned hereunder are incorporated herein by reference. Unless mentioned otherwise, the techniques employed herein are standard methodologies well known to one of ordinary skill in the art.
The term "substantially pure" as used herein means a product which is at least 80% pure monomeric hybrid protein. the term "selective" as used herein means that the fusion protein of the present inveniton preferentially attacks cells such as HIV-infected cells without significantly affecting the activity of other cells.
Part I of the detailed description of the invention below relates to the construction of a chimeric gene expressing a recombinant fusion protein which selectively kills specific virus-infected cells.
Part II of the detailed description of the invention below relates to a recombinant soluble truncated form of CD4 containing the active binding site for human immunodeficiency virus .
Part III of the detailed description of the invention below relates to a multivalent product housing substantially long half-life, bonding avidity and the capacity to direct components of the native immune system to kill HIV infected cells or HIV virions in vivo rela- tive to monomeric forms .
PART I MATERIALS AND M!ETHODS Construction of Expression Vector for CD ( 178 ) -PE40 : The plasmid pVC403 was constructed as described below. pVC403 carries a fusion gene encoding the first 178 amino acids of mature CD4 [referred to as CD4(178)] based on amino acid sequence data and amino acids 1-3 and 253-613 of Pseudomonas exotoxin A (PE) (referred to as PE40) . The fusion gene is under control of a T7 late promotor. E. coli strain BL21 - 14 - (^DE3) carrying pVC403 was used to express the fusion protein upon IPTG induction. The direction of transcription from the T7 promoter and for the B-lactamase gene is shown by solid arrows in Figure 1. The circled numbers are the amino acids of CD4 and the boxed numbers are the amino acids of PE. The boundaries of the CD4(178) sequence and the start of PE40 sequence are shown at the top .
Construction of pVC403; Plasmid pVC4 which carries a full length PE gene attached to a T7 promoter was cut with Ndel and Asp718 and ligated to a 52 bp linker containing codons for the first 16 amino acids of mature CD4 and Ndel and Asp718 cohesive ends. This intermediate plamid (pVC401) has 3 Rsal sites, one between the first 16 codons of mature CD4 and the remainder of PE gene. pVC401 was partially cut with Rsal, then with Xhol, and a 2.8 Kb fragment was isolated. Plasmic pCD4SPE40TMl which carries a fusion gene between the first 178 amino acids of CD4 [CD4(178)] and PE40 under a T7 promoter was restricted with Rsal and Xhol, and a 1.3 Kb fragment was isolated. Construction of pCD4SPE40TMl is described below. The 1.3 Kb fragment from pCD4SPE40TMl was ligated to a 2.8 Kb fragment from pVC401 to produce plasmid pVC403. This plasmid has a Nde I site at the junction of the CD4(178) and PE40 genes that can be used to introduce various other PE genes .
Construction of pCD4SPE40TMl ; A 0.70-kb EcoRI-Sall fragment containing the amino-terminal two immunoglobulin-like domains of CD4 was excised from pCD4f and cloned into M13mpl8. The resulting recombinant phage, mpl8CD4TMl was propagated in a dut~ ung" strain and the single-stranded template DNA was annealed with a 33 mer oligonucleotide, TM21 containing an Ndel site (CATATG) encoding histidine and methionine residues just after a codon encoding an alanine residue, the 178th amino . acid of CD4. After second strand syn- thesis, the double-stranded DNA was transformed into a wild type strain, and a mutant clone mpl8CD4TM21 was selected by Ndel digestion.
To obtain a final expression plasmid for a fusion protein more easily, an intermediate plasmid, pCD4PE40TMl was constructed as follows. A 1.23-kb fragment containing PE40 was excised from pVC8 by digesting it with EcoRI, filling in the cohesive end with DNA polymerase I Klenow fragment, and digesting it with Xbal. The fragment was ligated with a 5.21-kb fragment of pCD4LTMl (an expression plasmid for 372 amino-acid CD4 ) ; the fragment was obtained by digesting the plasmid with Sail, filling in the cohesive end with DNA polymerase I Klenow fragment, and digesting with Nhel, yielding pCD4PE40TMl. From this plasmid, a 5.72-kb Ndel (partial )-EcoRi fragment was excised and ligated with a 0.69-kb Ndel-EcoRI fragment of mpl8CD4TM21, yielding-pCD4SPE40TMl . This plasmid is capable of expressing a 546 amino-acid fusion proteing consisting of the first 178 amino acids of DC4 at the amino terminus, followed by histidine and methionine residues derived from the Ndel site used for joining the two molecules, followed by the carboxy terminal PE40 sequence.
A deposit of the plasmid pVC 403 has been made at the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland, 20852, U.S.A., on June 29, 1988 under the accession number 67739. The deposit shall be viably maintained, replacing if it becomes non-viable, for a period of 30 years from the date of the deposit, or for 5 years from the last date of request for a sample of the deposit, whichever is longer, and made available to the public without restriction in accordance with the provisions of the law. The Commissioner of Patents and Trademarks, upon request, shall have access to the deposit.
Purification and Characterization of CD4 ( 178 ) -PE40 ; BL21 (ADE3) carrying plasmid pVC403 was grown in LB medium at 37°C with ampicillin (100 ug/ml ) , induced at ODs50nm^*^ with InM isopropyl D-thiogalactoside (IPTG) and the incubation continued for 90 minutes at 37°C. The cells were fractionated into periplasm and spheroplasts . The spheroplasts were suspended in TE (50 mM Tris pH 8.0, lmM EDTA) , sonicated three times at 100 watts for 30 seconds each and spun at 100,000 x g for 60 minutes to isolate the supernatant (cytoplasm) and pellet (containing inclusion bodies). For localization experiments, the pellet was suspended in TE and the various fractions were analyzed by ADP-ribosylation assays and by SDS-PAGE, using Coomassie Blue staining and immunoblot-ting with rabbit antibodies to PE.
For partial purificaton of CD4 ( 178 ) -PE40 , a denaturation/renaturation procedure was employed. A 500 ml culture of BL21 (7\DE3) containing pVC403 was induced and the inclusion body pellet fraction prepared as described above. The pellet was suspended in 6.5 ml extraction buffer (guanidine HC1 7M, Tris HCl 0.1M pH 8.0, EDTA lmM and DTT lmM) and sonicated for 20 seconds three times . The suspension was stirred for 1 hour in the cold and centrifuged at 100,000 x g for 15 minutes, and the supernatant saved. The supernatant (6.5 ml) was added dropwise to 500 ml cold phosphate buffered saline with rapid stirring. After 48 hours, a portion was purified as follows: 110 ml was dialyzed against Buffer A (Tris HCl 20 mM pH 7.7) for 8 hours with two one liter changes, filtered through a 0.45 m filter and applied on a Mono Q column (HR 5/5) at a flow rate of 1 m./min. The column was washed with 5 ml buffer A and then developed with a 25 ml linear gradient (0-0.5 M NaCl) and finally with 5 ml 1 M NaCl in Buffer A. 1 ml fractions were collected and analyzed for total protein, ADP-ribosylation activity and reactivity by ELISA using immobilized anti-PE antibodies and anti-CD4 monoclonal antibodies OKT4A (Ortho) and BL41 (Pel-freeze). Protein concentration was determined using Bradford reagent with bovine serum albumin as a standard. ADP-ribosylation activity is expressed as units/ml; 1 unit is equal to the activity of 1 Demonstration of Binding of CD4 ( 178 ) -PE40 to HIV Envelope Protein gpl20: Two methods were employed to demonstrate this specific binding interaction. The first invovled copre-cipitation of radiolabeled gpl20 along with CD4 ( 178 ) -PE40 plus antibodies to PE. Media containing [ S]-methionine-labeled gpl20 was obtained as previously described using a vaccinia/bacteriophage T7 hybrid expression system. CV-1 cells were co-infected with two vaccinia virus recombinants: vPE6, encoding a secreted form of pgl20 (HIV-1, IIIB isolate) under control of the bacteriophage T7 promoter, and vTF7-3, encoding the T7 RNA polymerase driven by the vaccinia virus 7.5 K promoter. Five 1 of media containing ^5S-labeled gpl20 was preincubated with 90 1 of crude renatured CD4 ( 178 ) -PE40 for 4 hr at 4°C. Anti-PE antiserum (2 M.1) was added, and after overnight incubation at 4°C the immune complexes - 18 - were precipitated with 10 1 Protein A-agarose (Calbio-chem). The washed immunoprecipitates were analyzed by SDS-PAGE on 10% gels and the protein bands visualized by fluorography. The analysis is shown in Fig. 3A. The immune complex precipitated from a mixture of media con^-taining [35S] -labeled gpl20 is shown in lane 3. For controls, either the anti-PE (lane 1) or the CD4(178)-PE40 (lane 2) were omitted.
The second method involved immunofluro-escence. Confluent monolayers of CV-1 cells in 35 mm wells of 6-2311 plates (Costar) were infected with a recombinant vaccinia virus encoding gpl60 (HIV-1, 11IB isolate) under control of the vaccinia 7.5 promoter. The multiplicity of infection was 1.5. As a control, cells were infected with vTF7-3 (see above). Ten hours post-infection, CD4 ( 178 ) -PE40 (fraction 19 of the mono Q column, see Fig. 2) was added to a final toxin concentration of 50 g/ml in PBS plus 0.2%- (w/v) bovine serum albumin. After 1 hr at 4°C, the dishes were rinsed and incubated with a polyclonal anti-PE antiserum [1:500 in PBS plus 0.2% (w/v) bovine serum albumin] for an additional hour at 4°C. The cells were then incubated with affinity purified goat anti-rabbit IgG conjugated to rhodamine. Cells were fixed in formaldehyde, mounted and photgraphed. In the analysis shown in Figures 3B, 3C, 3D and 3E cells were infected with either the recombinant vaccinia virus containing the HIV-1 gpl60 gene (3B and 3C) or with the control vaccinia recombinant (3D and 3E) . 3B and 3D are fluorescence micrographs and 3C and 3E are the corresponding phase contrast micrographs. Bar indicates 20 im at 350x.
Demonstration of Selective Cytotoxicity for Cells Expressing the HIV Envelope Glycoprotein; Two test systems were employed. The first involved cells expressing the HIV envelope glycoprotein encoded by a recombinant vaccinia virus . Duplicate essays were performed in 16 mm wells of 24-well plates (Costar) . CV-1 cells were grown to 90% confluence (2 x 10^ cells per well). The indicated recombinant vaccinia viruses were added to the wells at a multiplicity of infection of 20 in 0.25 ml of Dulbecco ' s MEM supplemented with 2.5% fetal bovine serum. After 90 min with occasional rocking, the medium was removed and replaced with 1 ml of the same medium containing 10% of the normal methionine concentration. 7.5 hr later, 0.05 ml of the indicated toxin preparations in Dulbecco ' s phosphate buffered saline were added to give the final concentrations shown. The incubations were continued for 4 hr, at which time 20 pi Ci of -^S-methionine was added to each well in 0.05 ml of methionine-free medium. After one hr the labeling medium was removed and the wells were rinsed twice with 1 ml of Dulbecco 's phosphate buffered saline. Cells were harvested in 0.5 ml of 0.1 N NaOH containing 0.1% (w/v) bovine serum albumin and the protein was precipitated with trichloroacetic acid and radioactivity determined by scintillation counting.
Results are expressed as % control incorporation (no toxin added). In the analysis shown in Fig. 4a, closed symbols represent cells infected with a vaccinia recombinant encoding gpl60, whereas open symbols represent dels infected with a control vaccinia recombinant, vTF7-3, encoding the bacteriophage T7 RNA polymerase (see description of Fig. 3). The toxin preparations used were (ΔΆ) PE' (Ο/·) PE40, (□,0) CD4(178)-PE40.
The second test system employed cells chronically infected with HIV. 8E5 is a human T-cell line which contains a single integrated copy of the HIV-1 (LAV) genome. The virions produced are non-infectious due to a premature chain termination mutation in the reverse transcriptase gene. As a control, the parental non-infected A3.01 cell line was used. Assays were performed in duplicate in 24-well plates. Individual wells were seeded with 7 x 10^ cells of the indicated cell line in 0.9 ml of medium containing 1 part RPMI supplemented - 20 - with 10% fetal bovine serum plus 8 parts of the same medium lacking methionine. The designated toxin preparations were added in 0.02 ml Dulbecco ' s PBS to give 111% of the final concentration shown. After 17.5 hr, lO^Ci of J -S-methionine in 0.1 ml of complete medium was added to each well, and the incubations continued for 1 hr.
Contents of the wells were then quantitatively transferred to centrifuge tubes and spun for 10 min at 2800 RPM in a Beckman centrifuge. The supernatants were removed and the pellets suspended in 0.1% (w/v) SDS. Fifty 1 aliquots were analyzed by trichloroacetic acid precipitation using Whatman GF/C filters . Results are expressed as % control incorporation (no toxin added). A background value was obtained by treating cells with 5 g PE for 18.5 hr, then incubating with -^S-methionine for only 1 min. This value, which represented only 3% of the control incorporation, was subtracted in the calculations to yield the data shown in Fig. 4b. Closed symbols represent the 8E5 cells, whereas open symbols represent the A3.01 cells. The toxin preparations used were: (Δ, ) PE, (0,#) PE40, (□,■) CD4(178)-PE40.
RESULTS As shown in Figure 1 , a chimeric gene encoding the first 178 amino acids of CD4 and amino acids 1 to 3 and 253 to 613 of PE was constructed (Figure 1). This segment of PE (designated PE40) lacks domain I but retains domains II and III which are responsible for translocation and ADP-ribosylation, respectively. The plasmid, pVC403, also contained a bacteriophage T7 late promoter and the Shine-Delgarno ribosome binding sequence for high expression in Escherichia coli BL21 (ΛϋΕ3). The chimeric protein, designated CD4 ( 178 ) -PE40 , was synthesized in large amounts, remained intracellular and appeared to be primarily associated with inclusion bodies in the 100,000xg pellet of sonicated spheroplasts . The denatured protein had the expected Mr of approximately 60,000 and reacted with polyclonal antibodies to PE by inununoblot analysis (see below).
A purification scheme involving denaturation of the insoluble protein with guanidine followed by rapid dilution was used. An ELISA demonstrated that the renatured form of CD4 ( 178 ) -PE40 reacted with polyclonal antibody to native PE and monoclonal antibodies 0KT4A and BL4 directed to CD4. Enzymatic activity of the hybrid protein was shown by an affinity capture procedure; up to 30% of the ADP-ribosylation activity could be selectively immunoprecipitated by 0KT4A monoclonal antibody.
A highly purified monomeric form of CD4(178)-PE40 was obtained by chromatography of the renatured protein on a mono Q column (Figure 2A) . Analysis of each fraction by polyacrylamide gel electrophoresis in · the presence of sodium dodecyl sulfate (SDS) indicated that fraction 19 contained at least 80% pure monomeric fusion protein that reacted with a rabbit polyclonal antibody to PE (Figure 2). Further purification of fraction 19 on TSK-250 gel filtration column showed that the fusion protein eluted as a symmetrical peak at the elution volume expected for a 60,000 Mr protein. SDS polyacrylamide gel electrophoresis revealed the presence of a single band corresponding to a protein of about 60,000 Daltons.
To determine the ability of CD4 ( 178 ) -PE40 to bind gpl20, two types of assays were performed (Figure 3). First, CD4 ( 178 ) -PE40 was mixed with soluble [ JJS]methionine-labeled gpl20, and the immune complexes obtained with anti-PE serum were bound to protein A agarose and resolved by SDS polyacrylamide gel electrophoresis. As shown in Figure 3A, labeled gpl20 was specifically coprecipitated along with CD4 ( 178 ) -PE40. Second, the binding of CD4 ( 178 ) -PE40 to cell-associated gpl20 was established by immunofluorescence microscopy. The HIV envelope glycoprotein was produced in CV-1 cells using a vaccinia based expression system. Both the external gpl20 and transmembrane gp41 subunits are present on the surface of cells infected with a recombinant vaccinia virus encoding gp 160; furthermore, such cells form extensive syncytia when mixed with CD4-bearing human cells. Figure 3B shows that CD4 ( 178 ) -PE40 bound to CV-1 cells that had been infected with a recombinant vaccinia virus encoding gpl60 but not to cells infected with a control recombinant vaccinia virus . Additional specificity controls indicated that the fluorescence was not observed if either the CD4 ( 178 ) -PE40 or the anti-PE antibodies were omitted. Taken together, these results demonstrate that CD4 ( 178 ) -PE40 binds to gpl20 in solution or on the cell surface.
Binding of authentic PE to cells followed by internalization and translocation to the cytoplasm results in ADP-ribosylation of elongation factor 2 and the consequent inhibition of protein synthesis and cell death. Two assay systems were employed to determine whether CD4 ( 178 ) -PE40 is selectively internalized and translocated by cells expressing the HIV envelope glycoprotein, leading to inhibition of protein synthesis. First, the effects on cells infected with recombinant vaccinia viruses were examined.
Figure 4A shows that protein synthesis in CV-1 cells infected with a recombinant vaccinia virus encoding gpl60 was severely inhibited after only 4 hours of exposure to CD4 ( 178 ) -PE40 (ID50 of 27 ng/ml). By contrast, cells infected with a control recombinant vaccinia virus were much less sensitive to the hybrid toxin (ID50 > 1,000 ng/ml). When authentic PE was employed, cells infected with the gpl60-expressing and the control recombinant vaccinia viruses were equally sensitive (ID50 = 100 ng/ml); they were also equally insensitive to PE40, which lacks a cell binding domain (ID5Q > 1,000 ng/ml). We conclude that expression of the HIV envelope protein rendered cells very sensitive to the hybrid toxin and that the specificity was conferred by the CD4 moiety.
As a second system to evaluate the selectivity - 23 - and effectiveness of CD4 ( 178 ) -PE40 , an uninfected human lymphocyte cell line (A3.01) and a daughter cell line (8E5) that is chronically infected with HIV were tested as targets. . The 8E5 cells are especially suitable for experimental studies since they contain a single integrated viral genome, constitutively synthesize HIV proteins including gpl20, form syncytia when mixed with CD4-bearing cells, and produce budding particles. Addition of CD4 ( 178 ) -PE40 to 8E5 cells led to inhibition of protein synthesis: the ID5Q of 100 ng/ml (determined at 17.5 hours after addition of toxin) indicated that the HIV-infected cells were highly sensitive to the hybrid toxin (Figure 4B) . By contrast, protein synthesis in the parental A3.01 cells was resistant to CD4 ( 178 ) -PE40 under these conditions . Both cell lines were moderately sensitive to authentic PE (ID^Q = 500 ng/ml) and unaffected by PE40.
In evaluating the therapeutic potential of a hybrid toxin, effects on cells other than the desired targets must be considered. Since the natural receptor for CD4 is believed to be the class II major histocompatibility (MHC) molecules on the surface of antigen-presenting cells, B-lymphocytes and macrophages might be affected by the chimeric toxin. Tests indicated, however, that CD4 ( 178 ) -PE40 did not inhibit protein synthesis in Raji cells, a B-cell line which expresses large amounts of MHC class II molecules. This result is consistent with a published report that soluble CD4 has no inhibitory effect on CD4/MHC class II interactions in vitro, and suggests that monomeric forms of CD4 may have relative weak affinity for class II antigens.
These results demonstrate that HIV-infected lymphocytes were selectively killed by a hybrid toxin made in _E. coli containing a 178 amino acid segment of human CD4 linked to the second and third domains of the potent Pseudomonas exotoxin A. Additional experiments with recombinant vaccinia virus expression vectors indi- - 24 - cated that the sensitivity to the chimeric toxin resulted from expression of the HIV envelope protein. For both the HIV-infected and the recombinant vaccinia virus-infected cell systems, selectivity was mediated by the CD4 moeity of the chimeric protein. The concentrations of purified renatured CD4 ( 178 ) -PE40 required for 50% inhibition of protein synthesis in three experiments ranged from 27 to 100 ng per ml. Based on data with other PE fusion proteins, it is not difficult to attain such levels in animals without significant non-specific toxicity. Furthermore, CD4 ( 178 ) -PE40 could be useful against cells infected with diverse strains of HIV-1 as well as HIV-2, since the envelope proteins of all these viruses retain binding specificity for CD4 despite extensive antigenic variation.
In summary, the data presented herein clearly establish that a fusion protein CD4 ( 178 ) -PE40 specifically and efficiently kills HIV-infected cells. This allows the use of this recombinant toxin as a therapeutic agent for the control and treatment of AIDS. A therapeutic composition in accordance with the present invention comprises an effective amount of the recombinant toxin to kill HIV-infected cells in a pharmaceutically acceptable vehicle, if necessary, such as physiological saline, buffered solutions and the like. The toxin may be administered by any suitable route, systemically or locally as deemed more effective. The method of controlling or treating AIDS comprises contacting HIV-infected cells with the effective amount of the recombinant toxin [CD4( 178)-PE40 fusion protein] to kill HIV-infected cells or inhibit fusion and syncytia formation resulting subsequent to HIV-infection.
It is important to note here that the present invention differs significantly from and has advantages over other treatment modalities of AIDS at least in the following respects .
I . It has been reported that soluble deriva- - 25 - tives of CD4 block HIV infectivity of cells in culture, presumably by competing for the ability of the virus to bind to cell-associated CD4. Without being bound to any specific theory, it is postulated that the invention described herein acts by a different mechanism, namely by killing cells which have already been infected with HIV. In this regard, it has been reported that soluble CD4 is much less effective when added after the virus has been allowed to infect the cell, unlike the CD4-toxin which kills cells after infection has occurred. It should be noted that the hybrid toxin may also produce competitive inhibition of infectivity seen with soluble CD4 in addition to its targeted killing of HIV-infected cells .
II. Selective killing of HIV-infected cells using an immunotoxin composed of an anti-gpl20 mouse monoclonal antibody chemically conjugated to protein toxin (ricin) has also been reported. However, the CD4 ( 178 ) -PE40 fusion protein of the present invention possesses numerous advantages over this immunotoxin: (a) In the case of the immunotoxin the antibody used is type specific, and does not bind to gpl20 from diverse isolates of HIV-1. In contrast, CD4 ( 178 ) -PE40 may be used against divergent strains of HIV-1 as well as against HIV-2, since all these viruses use CD4 as the receptor. Because of this requirement for CD4 receptor specificity, it is extremely unlikely that variants of HIV, resistant to CD4-toxin hybrid proteins, will arise, whereas variants which no longer bind type-specific monoclonal antibodies often arise. (b) The immunotoxin is produced by chemical coupling procedures which are difficult to control, thereby compromising the uniformity of the conjugate and also result in low yield. In contrast, the recombinant CD4 ( 178 ) -PE40 fusion protein can be produced in large quantities in a bacterial expression system using standard procedures. (c) The mouse immunoglobulin component of the immunotoxin is likely to be immunogenic in human subjects, thereby compromising its effectiveness. In contrast, with CD4-toxin fusion proteins, the targeting of gpl20-expressing cells is achieved by a fragment of human CD4 , which is likely to be less immunogenic in humans.
III. Selective killing of HIV-infected cells in vitro by liposomes containing diphtheria toxin fragment A has also been reported. Clearly, this is quite distinct from the fusion-protein methodology of the present invention.
Having described certain aspects of the present invention, various modifications thereof which can be achieved by one of ordinary skill in the art, are now listed .
A. Variations in the CD4 portion. This can be achieved, for example, by differences in length of the CD4 sequencer. Shorter or longer versions of the CD4 sequence can be found which can also be attached to toxins to achieve selective killing of HIV-infected cells . The length of the CD4 sequence can have important consequences for the affinity for gpl20, for the relative affinities for gpl20 vs. class II antigens, for the physical accessibility to different regions within the body, and for the immunogenicity. In addition, site-specific mutagenesis can be used to decrease the affinity of CD4 for normal cellular antigens, and/or increase the affinity for gpl20. Such mutations would widen the window between effective therapeutic dosages and unwanted toxic side effects.
B. Variation in the toxin portion. Modifications of PE can be made. By selective mutagenesis or deletion, the immunogenicity of the PE sequence can be reduced and the potency of the hybrid toxin increased (e.g., by enhancing translocation such as ricin and diptheria toxin fragment A could be similarly employed in context of fusion technique described herein. - 27 - Bacterial . By employing, for example, certain _E. coli expression system, secreted forms of the hybrid toxin can be made obviating the need for denaturation/re-naturation .
Eukaryotic . Mammalian, vaccinia virus, baculo-virus, and yeast expression systems can also be used as advantageous expression systems as is well known to one of ordinary skill in the art.
PART II MATERIALS AND METHODS Enzymes . Restriction endonucleases were obtained from New England Biolabs or Bethesda Research Laboratories . The Klenow fragment of DNA polymerase I and T4 DNA ligase were from New England Biolabs .
Antibodies . Murine anti-CD4 mAbs were obtained from the following sources: MT151, Boehringer Mannheim; Leu3A, Becton Dickinson; 0KT4 , 0KT4A, 0KT4B, 0KT4C, 0KT4D, 0KT4E, and OKT4F, M. Telle, Ortho Diagnostics. Two murine anti-gpl20 mAbs were employed: 2E12.1 (Epitope, Beaverton, OR) and a tissue culture supernatant from hybridoma 902 (B. Chesebro, National Institute of Allergy and Infectious Diseases, Hamilton, MT) . Rabbit antiserum to mouse IgG (heavy plus light chains) was purchased from ICN.
Plasmids . The CD4 cDNA was donated by D.
Littman (University of California, San Francisco). Plasmid pCD4-GEM4 (obtained from A. Rabson, National Institute of Allergy and Infectious Diseases, Bethesda, MD) contains a full-length copy of the CD4 cDNA with 5 ' EcoRI and 3' BamHi linkers (Maddon et al, supra ) cloned into the EcoRi-BamHI site of pGEM4 (Promega Biotec, Madison, I). pTF7-5 contains a bacteriophage T7 promoter and terminator separated by a unique BamHI site and flanked by the left and right vaccinia thymidine kinase gene sequences (see Fig. 1).
Construction and preparation of recombinant plasmids were performed according to the methods outlined - 28 - by Maniatis et al. 1982. Molecular Cloning; A Laboratory Manual (Cold Spring Harbor Lab., Cold Spring Harbor, NY) . DNA fragments were purified from low-melting-point agarose gels by using the Elutip-d proce-dure (Schleicher & Schuell). Plasmids were isolated by the alkaline NaDodSo^ lysis method (Birnboim et al. 1979. Nucleic Acids Res. 7, 1513-1523) and purified by CsCl/ethidium bromide equilibrium density gradient cen-trifugation .
Virus and Cells. Vaccinia virus recombinant vTF7-3 contains the bacteriophage T7 gene 1 (encoding the T7 RNA polymerase) under control of the vaccinia P7.5 promoter (Fuerst et al. 1986. Proc. Natl. Acad. Sci. USA 83, 8122-8126). vPE6 is a vaccinia recombinant derived from pTF7-5 containing a bacteriophage T7 promoter linked to the HIV-1 envelope gene (IIIB isolate, clone BH8 ) with a termination codon inserted by _in_ vitro mutagenesis immediately preceding the sequence encoding the consensus retroviral envelope cleavage site Arg-Glu-Lys-Arg . This virus directs high-level expression of a secreted form of gpl20 in cells doubly infected with vTF7-3.
CV-1 monkey kidney cells were grown in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum.
Expression Conditions. Transfection experiments for transient expression were performed by using conditions similar to those described in Fuerst et al, supra . CV-1 cells were grown to 90-95% confluence in 25-cm2 flasks ( 2.5 x 106 cells) and infected with vTF7-3 at a multiplicity of 30 plaque-forming units (pfu) per cell in medium with 2.5% fetal bovine serum. The virus was allowed to adsorb for 30 min at 37 °C with occasional rocking of the flask, whereupon the inoculum was removed and replaced with 1 ml of transfection buffer containing 5 Ug of calcium phosphate-precipitated plasmid DNA. After incubation for 30 min at 37°C with occasional rocking, 5 ml of medium containing 2.5% fetal bovine serum - 29 - was added. The medium was removed after 4 hr at 37 °C, and the cells were incubated with 2-4 ml of cysteine-free medium containing 2.5% dialyzed fetal bovine serum for 15-60 min. This medium was then replaced with 2.25 ml of the same medium supplemented with 0.1-0.3 mCi of L-[ ] cysteine per ml (Amersham, 1.3 Ci/mmol; 1 Ci = 37 GBq) . Labeling was allowed to proceed at 37°C for 4-5 hr, after which 0.25 ml of complete medium containing 2.5% fetal bovine serum was added. Thirty-six hours later the medium was collected and centrifuged in a Savant high-speed microcentrifuge, first at 2000 rpm for 5 min and then at 10,000 rpm for 30 min. The resulting supernatant was used for subsequent analyses .
For expression of secreted gpl20, double virus infections were performed by using protocols similar to those reported (Fuerst et al . (1987. Mol . Cell. Biol. 7, 2538-2544). CV-1 cells grown in flasks as described above were infected with vTF7-3 and vPE6 (15 pfu each per cell) in 1 ml of medium containing 2.5% fetal bovine serum. After 90 min at 37°C, the virus inoculum was removed and replaced with fresh medium containing 2.5% fetal bovine serum. In the case of unlabeled infection, the incubation was continued at 37 °C for 23 hr, after which the medium was collected. For metabolic labeling, the incubation was continued for 10.5 hr, at which time the medium was removed and the cells were incubated for 15 min at room temperature in cysteine-free medium with 2.5% dialyzed fetal bovine serum. This medium was then replaced with 2.25 ml of the same medium supplemented with 0.1 mCi of [ ^5S ] cysteine per ml. After 5 hr of labeling at 37 C°, 0.25 ml of complete medium containing 2.5% fetal bovine serum was added. The incubation was continued for an additional 7 hr and the medium was then collected. Media from these infections were centrifuged as described above for the transfection experiments.
Control infections were performed identically, except that the virus inoculum contained vTF7-3 only (30 - 30 - pfu per cell ) .
Radioimmunoprecipitation . The specific reaction conditions are similar to those noted in the description of the figures supra . Protease inhibitor buffer contained 0.1 mM «^-- (p-tosyl ) -lysine chloromethyl ketone, 0.1 mM L-l-tosylamido-2-phenylethyl chloromethyl ketone, 50 mM iodoacetimide, 0.01 mM leupeptin, and 70 Kallikrein units of aprotinin per ml in phosphate-buffered saline with 0.02% (wt/vol) sodium azide. Immune complexes collected with protein A-agarose (Calbiochem) were precipitated and washed three times by centrifuga-tion in a Savant high-speed microcentrifuge at 3000 rpm for 5 min. NaDodSO/Polyacrylamide Gel Electrophoresis. The procedure of Laemmli, 1970, Nature (London) 227, 680-685, was employed, with the acrylamide concentrations specified in the figure legends. Gels were analyzed by fluorography using EN^HANCE (New England Nuclear) . 14C-Methylated protein molecular weight markers (Amersham) were lysozyme (Mr 14,000), carbonic anhydrase (M 30,000), ovalbumin (Mr 46,000), bovine serum albumin (Mr 69,000), phosphorylase b (Mr 93,000), and myosin (Mr 200,000) .
RESULTS Expression of the Soluble CD4 Fragment. The expression system employed in the present study is based on that of Fuerst et al, supra . Mammalian cells are infected with a recombinant vaccinia virus (vTF7-3) containing the bacteriophage T7 RNA polymerase gene linked to a vaccinia promoter and then transfected with a plasmid vector containing the target gene of interest flanked by bacteriophage T7 promoter and transcriptional terminator regions . The T7 RNA polymerase mediates high-level transcription of the target gene in the cytoplasm of the transfected cells. In accordance with the present invention, a plasmid vector (pEB-2) was designed that contains, between the T7 promoter and transcriptional terminator, two new unique restriction sites ( EcoRI and - 31 - Stu I) directly followed by a universal translational termination sequence. After cleaving this vector with EcoRI and Stul, any DNA fragment containing an EcoRI site and a 3 ' blunt end can be force-cloned in the proper orientation. If the DNA insert contains the translation initiation codon but only a portion of the adjacent coding region for a particular gene, a truncated polypeptide is expressed. Depending on which synthetic termination codon is in frame, the shortened polypeptide may also contain up to three additional C-terminal amino acids encoded by the vector.
For the present studies, the EcoRI-Nhe I DNA fragment of the CD4 cDNA was inserted into pEB-2 to obtain another plasmid, designated pCD4 (Fig. 5). Based on the reported cDNA sequence (Maddon et al , supra ) , pCD4 would be expected to encode a truncated variant of CD4 with a normal N terminus; cleavage of the signal sequence would result in a polypeptide containing the first 177 amino acid residues of mature CD4 (the first two immunoglobulin-like domains) and containing no consensus N-linked glycosylation sites . This fragment might therefore be expected to be secreted into the medium. DNA sequence analysis of pCD4f indicated that the fragment also contains C-terminal proline and arginine resi-dues derived from the UTS sequence of the vector.
Figures 6A and 6B show the results of a transient metabolic labeling experiment with cells infected with vTF7-3 and transfected wiht different plasmids . NaDodSO^/polyacrylamide gel electrophoretic analysis revealed that the medium of cells transfected with control plasmid pEB-2 contained a complex pattern of polypeptide bands (lane 3); medium from cells transfected with pCD4f contained the same complex pattern of polypeptides as well as an additional faint band at the posi-tion expected for the truncated CD4 polypeptide encoded by this plasmid (lane 1). Immunoprecipitation analysis with a mixture of several murine anti-CD4 mAbs confirmed - 32 - that this band indeed represented a fragment of the CD4 molecule. It was selectively removed from the medium after immunoprecipitation (lane 2) and was specifically precipitated from the medium of cells transfected with pCD4f (lane 5) but not pEB-2 (lane 6). The amounts of this labeled polypeptide that could be immunoprecipitated from the medium fraction far exceeded the amounts precipitable from the detergent-solubilized cell pellet fraction (data not shown). It was, therefore, concluded that pCD4f encodes the expected fragment representing the N-terminal 177 amino acid residues of the extracellular region of the CD4 molecule (plus two residues from the vector), that this fragment is secreted in soluble form into the medium, and that it displays reactivity with anti-CD4 iriAbs .
Epitope Analysis . By using a variety of assays, several laboratories have demonstrated that specific anti-CD4 mAbs differ widely in their ability to block the interaction between CD4 and the HIV envelope glycoprotein (McDougal et al, supra ; Sodroski et al, supra ; Lasky et al . 1987. Cell 50, 975-985; Ludin et al, supra; McDougal et al . 1986. J. Immunol . 137, 2937-2944; Sattenatu et al , supra ) . It was therefore of interest to test which epitopes are expressed on the soluble CD4 fragment encoded by pCD4f. Fig. 7 shows the results obtained by radioimmunoprecipitation analysis from the medium of cells metabolically labeled after transfection with pCD4f. Importantly, a close correlation was found between the reactivity of a particular mAb with the frag-ment and the ability of the mAb to block the CD4-envelope glycoprotein interaction. Thus, strong immunoprecipitation was obtained with mAbs MT151, Leu3A, 0KT4A, OKT4B, 0KT4D, 0KT4E, and OKT4F, all of which have been shown to inhibit the interaction of membrane-associated or soluble gpl20 with CD4. By contrast, mAb OKT4 failed to immuno-precipitate the fragment, consistent with its reported inability to block CD4 interaction with membrane- associated or soluble gpl20. mAb 0KT4C displayed barely-detectable reactivity with the fragment in keeping with its reported failure to block interaction of intact HIV with CD4 (McDougal et al , supra ; Sattenatu et al, supra ) and its relatively weak capacity to inhibit binding of soluble gpl20 to CD4 (Lundin et al, supra ) .
Several of the anti-CD4 mAbs were also tested in an alternative assay that measures the ability of unlabeled medium from transfected cells to block the binding of a particular antibody to CD4 on the surface of a lymphocyte cell line. The results supported the immunoprecipitation analysis: medium from cells transfected with pCD4f blocked the binding of mAbs MT151, Leu3A, and 0KT4A but had no effect on the binding of mAB 0KT4 (data not shown) . It was therefore, concluded that the epitopes detected by the HIV-blocking anti-CD4 mAbs are contained within the N-terminal 177 amino acid residues of the extracellular region of CD4 and that functional epitopes for these mAbs can be produced when less than half of the full-length CD4 molecule is synthesized .
Interaction of the CD4 Fragment with Soluble gpl20. It was next determined whether the CD4 fragment is capable of specific interaction with gpl20. To test for the formation of a complex between these molecules , medium from metabolically labeled cells expressing soluble gpl20 was mixed with medium from metabolically labeled cells expressing the CD4 fragment. It was then assessed whether a murine anti-gpl20 mAb could specifically coprecipitate the CD4 fragment along with the gpl20. The results of such a coprecipitation experiment are shown in Fig. 8A. Of the many labeled bands observed in the initial mixture of media containing gpl20 and the CD4 fragment (lane 1), the anti-gpl20 mAb specifically precipitated two proteins: gpl20 and the CD4 fragment ( lane 6 ) . The identity of the CD4 fragment band was confirmed by its absence when the fragment-containing - 34 - medium was omitted from the reaction (only the gpl20 band was observed) (lane 3) and by its comigration with the single band observed when the fragment-containing medium was immunoprecipitated with an anti-CD4 mAB (lane 7).
The presence of the CD4 fragment in the anti-gpl20 immunoprecipitate resulted from a true complex with gpl20, as judged by the absence of the fragment band when either normal medium (lane 4) or medium from metabol-ically labeled cells infected only with the vaccinia virus expressing T7 RNA polymerase (lane 5) was used in place of the gpl20-containing medium. Analysis of the supernatants remaining after immunoprecipitation indicated that under the conditions of this experiment, nearly all of the CD4 fragment was complexed to gpl20, and immunoprecipitation of the complex by the anti-gpl20 itiAb was virtually complete (data not shown) . This indicated a high affinity for the binding reaction.
To further analyze the specificity of this interaction, it was further determined whether soluble unlabeled gpl20 could compete for the immunoprecipitation of the CD4 fragment by an anti-CD4 mAb. As shown in Fig. 8B, unlabeled medium containing gpl20 strongly inhibited the immunoprecipitation of the CD4 fragment by the 0KT4A mAb (compare lanes 1 and 3). By contrast, medium lacking gpl20 (from cells infected only with the vaccinia expressing T7 RNA polymerase) had no effect (lane 2). It was, therefore, concluded that the interaction of the CD4 fragment with gpl20 is quite specific.
In summary, the results presented here provide direct evidence for localization of the HIV-binding site within the N-terminal 177 amino acid residues of CD4, which contain the first two immunoglobulin-like domains .
The present invention now makes it possible to prepare a composition for the prevention of HIV infec-tion. Such a composition comprises an effective amount of the recombinant, soluble, truncated form of the CD4 containing the first two immunoglobulin-type domains - 35 - within the first 177 amino acid residues from the N-terminal half of the CD4 molecule, to inhibit binding of the HIV to the host cells . A method for inhibiting HIV infection of the host cells comprises providing an effec-tive amount of the recombinant, soluble truncated form of CD4 molecule of the present invention, to bind HIV.
PART III Without being bound to any specific theory or postulate, the following unique aspects of the third part of the present invention relating to CD4-immunoglobulin hybrid proteins are set forth. (a) The invention relies on basic host immunological defense mechanisms which normally involve humoral antibody. By substituting the gpl20 binding region of CD4 for the variable regions of immunoglobulins, the resultant molecules acquire high affinity for all HIV envelope variants , plus selected effector function provided by the particular heavy chain constant regions employed. This overcomes the problems associated with the failure of HIV-infected individuals to raise high affinity antibodies against conserved determinants of the HIV envelope glycoprotein. (b) The hybrid molecules of the present invention contain only human sequences, thereby minimizing problems arising from host immune responses to foreign proteins . (c) The present invention does not involve the use of molecules which are inherently cytotoxic. Thus, problems related to non-specific toxicity are greatly reduced compared to therapies involving CD4-toxins and immunotoxins . (d) The CD4-immunoglobulin hybrid proteins of the present invention are disulfide-bonded multimers (dimers or tetramers, depending on the particular con-structs). Multivalency greatly enhances the avidity of CD4 for gpl20 on both the cell surface and the virion, compared to the monomeric CD4 derivatives . This also - 36 - enhances direct neutralization of viral infectivity or inhibition of viral spread by cell-to-cell fusion. (e) The immunoglobulin region also prolongs the survival of the CD4 derivatives in the circulation, thereby enhancing beneficial effects mediated by both direct neutralization and effector-mediated mechanisms. (f) CD4-immunoglobulin hybrid proteins may lyse intact virions as well as HIV-infected cells, in contrast to CD4 toxins which act only against cells . Indeed, there is support for complement-mediated lysis of certain retroviruses in_ vitro (Cooper et al, 1979. Springer Semin. Immunopathol , 2, 285-320).
In order to produce the CD4-immunoglobulin hybrid proteins of the present invention (shown schemati-cally in Fig. 9), a number of factors must be considered. The first involves the region of CD4 to be employed. Most critically, it must contain the high affinity binding site for gpl20. Experiments with truncated soluble derivatives of CD4 (Traunecker et al . 1988, Nature (London) 331, 84-86; Berger et al, supra ) indicate that the amino terminal half of the extracellular region (approximately 180 amino acid residues, representing the first two immunoglobulin-like domains) contains the gpl20 binding site. Site directed mutagenesis studies [Clayton et al. 1988, Nature (London) 335, 363-366; Landau et al. 1988, Nature (London) 334, 159-162; Peterson et al. 1988, Cell 54, 65-72; Mizukami et al , supra ] suggest that the amino-terminal immunoglobulin-like domain (approximately the first 100 amino acids) is of particular importance and may be sufficient for gpl20 binding.
Other factors to consider in choosing the CD4 sequence include the ease of expression of the corresponding immunoglobulin hybrid proteins in secreted form, their stability in the circulation, their accessibility to different sites in the body, and the possibility that they may also contain the determinants for binding MHC Class II antigens (the surface molecules on antigen- - 37 - presenting cells with which cellular CD4 is believed to interact). Such binding could potentially impair the activity of CD4- cells in normal function, though experiments with soluble CD [Hussey et al. 1988, Nature (London) 331, 78-81] and with CD4-Pseudomonas exotoxin hybrid protein (Berger et al, submitted) suggest that these effects will be negligible due to the weak binding affinity between soluble CD4 and MHC Class II molecules.
A second consideration is the choice of human immunoglobulin sequences. An effective approach is to link active regions of CD4 to the constant regions of immunoglobulin heavy chain. The resultant molecules contain the regions involved in binding to complement as well as to Fc receptors on the surface of cells partic-ipating in antibody-dependent cell mediated cytotoxicity (ADCC). As to immunoglobulins, preferred is human IgGl, since this immunoglobulin subclass has been shown to be the most efficient at mediating cell killing by both complement and ADCC (Bruggemann et al 1987, J . Exp . Med . 166, 1351-1361). This IgG segment contains the CHI, hinge, CH2 and CH3 regions. The resultant hybrid proteins are then secreted as disulfide-bonded homodimers which specifically bind gpl20, antibodies to CD4 and to human IgG, Protein A, complement (specifically Cg), and Fc receptors on appropriate cells of the immune system (e.g., macrophages ) .
A third factor to consider is co-expression of the CD4-IgG heavy chain proteins along with human light chains. Under these conditions, disulfide-bonded hetero-tetramers analogous to normal human IgG are produced thereby enhancing expression and secretion of the CD4-heavy chain hybrid molecules . Furthermore, the binding of complement seems dependent on factors other than simply the presence of relevant sequences on the heavy chain constant region, since different subclasses of human IgG which contain the known complement binding sequence differ widely in their complement binding - 38 - capacity. Thus, higher order structural features appear to be important, and it is likely that these are dependent on the heterotetrameric structure with the light chains .
A particular embodiment of this approach involves co-expression of the CD4-heavy chain molecules, not with normal human light chains but instead with recombinant proteins containing CD4 sequences linked to the constant regions of human light chains. The result-ing heterotetramers each contain four copies of the CD4 sequence, and this multivalency leads to extremely high avidity for gpl20 on the surface of infected cells and HIV virions . The construction of the chimeric genes and the expression of the hybrid proteins are now exempli-fied.
MATERIALS AND METHODS Materials Restriction enzymes were purchased from New England BioLabs or Bethesda Research Laboratories . T4 DNA ligase was from New England BioLabs.
The following antibodies were obtained from the indicated sources: OKT4 and 0KT4A (Ortho Pharmaceuticals); anti-Leu-3A (Becton Dickinson); a murine anti-human kappa light chain mAb (Boehringer Mannheim); a murine anti-gpl20 monoclonal antibody (mAb) from hybridoma 902 (National Institute of Allergy and Infectious Diseases, Hamilton, MT); biotinylated goat anti-mouse IgG and biotinylated goat anti-human IgG (Fc) antibodies (Bethesda Research Laboratories); biotinylated goat anti-human lambda light chain antibody (Amersham) .
Protein A-agarose and streptavidin agarose were purchased from Bethesda Research Laboratories .
Construction of the Intermediate Plasmid, PCD4CH1 For easy construction of plasmids for expres-sion of the hybrid proteins, the intermediate plasmid, pCD4CHl was constructed as follows (Figure 10). A 1.7-kilobase (kb) EcoRl-BamHl fragment containing a whole - 39 - human CD4 cDNA was isolated from pDE4GEM4 (obtained from National Institute of Allergy and Infectious Diseases, Bethesda, MD) . A 1.2-kb BamHl-Smal (partial ) fragment containing a partial human immunoglobulin Gl ( IgGl ) heavy chain cDNA including sequences coding for a joining (J) region and three constant domains (CHI, CH2, and CH3 ) was isolated from pGMH6 (Liu et al . 1987. Gene 54, 33-40). These two fragments were cloned into the Stul and EcoRl sites of pEB2, yielding pCD4CHl .
Construction of pCD4lTM10 and pCD4IT 10G To express the hybrid protein, CD4(109)CH (Figure 9) which comprises the first immunoglobulin (Ig)-like domain (1-109) of CD4 and three C domains of the human IgGl heavy chain molecule, pCD4ITM10 and pCD4lTM10G were constructed as follows (Figure 11). A 0.46-kb EcoRl-NruI fragment encoding the amino-terminal 104 amino acids of CD4 was isolated from pCM34 in which an Nrul site (TCGCGA) was inserted between the 103th and 104th codons of the CD4 cDNA (Mizukami et al, supra ) . The fragment, together with an adapter consisting of two synthetic oligonucleotides .
TM 44 ( GACACCCACCTGCTTGCCTCCACCAAGGGCC ) and TM 45 ( CTTGGTGGAGGCAAGCAGGTGGGTGTC ) . was ligated into the Apal and EcoRI sites of pCD4CHl in which the Apal site exists in the amino-terminal region of the CHI domain. The resulting plasmid, pCD4ITM10 is capable of expressing CD4(109)CH under control of the bacteriophage T7 promoter. pCD4lTM10G was constructed by ligating a 2.2-kb Xbal-Sall fragment containing the coding sequences for CD4(109)CH from pCD4ITM10 with a 6.1-kb Xbal-Sall fragment from pTM3 which contains an Eco-gpt transcription unit as a selective marker.
Construction of pCD4lTM20 and pCD4ITM20G To express the hybrid protein, CD4(178)CH (Figure 9) which comprises the amino-terminal two Ig-like domains (1-178) of CD4 and three constant domains of the human IgGl heavy chain molecule, pCD4ITM20 and pCD4lTM20G were constructed - 40 - as follows (Figure 12). An adapter consisting of two synthetic oligonucleotides, TM46 ( CTAGCCGCCTCCACCAAGGGCC ) and TM47 ( CTTGGTGGAGGCGG) , was ligated into the Apal and Nhel sites of pCD4CHl in which the Nhel site exists in the carboxyl-terminal region of the second domain of CD4. The resulting plasmid, pCD4lTM20 is capable of expressing CD4(178)CH under control of the bacteriophage T7 promoter, pCD4ITM20G was constructed by ligating a 2.4-kb Xbal-Sall fragment containing the coding sequences for CD4(178)CH from pCD4lTM20 with a 6.1-kb Xbal-Sall fragment from pTM3 which contains an Eco-gpt transcription unit as a selective marker.
Construction of pCD4lTM30 and pCD4lTM30G To express the hybrid protein, CD4(372)CH (Figure 9) which consists of the amino-terminal four domains (1-372) of CD4 and three constant domains of the human IgGl heavy chain molecule, pCD4lTM30 and pCD4lTM30G were constructed as follows (Figure 13). A 0.65-kb Sacl-Hpall fragment corresponding to nucleotides 598-1252 of the cDNA sequence reported by Maddon et al (1985, Cell 42, 93-104) was isolated from pCD4GEM4. The fragment, together with an adapter consisting of TM48 ( CGGTGCAGCCAATGGCCTCCACCAA-GGGCC) and TM49 ( CTTGGTGGAGGCCATTGGCTGCAC ) , was ligated into the Apal and Sacl sites of PCD4CH1 in which the Sacl site exists in the carboxyl-terminal region of the second domain of CD4. The resulting plasmid, pCD4lTM30 is capable of expressing CD4(372)CH under control of the bacteriophage T7 promoter. pCD4lTM30G was constructed by ligating a 3.0-kb Xbal-Sall fragment containing the cod-ing sequences for CD4(372)CH from pCD4lTM30 with a 6.1-kb Xbal-Sall fragment from pTM3 which contains an Eco-gpt transcription unit as a selective marker.
Construction of pCD4lTM40G To express the hybrid protein, CD4(181)CL (Figure 9) which comprises the amino-terminal 181 amino acids of CD4, one amino acid (Leu) artificially created by introduction of a Hindlll restriction site, three amino acids (Gln-Met-Lys ) of the - 41 - joining region of the human Ig kappa light chain, and the whole constant region of the human Ig kappa light chain, pCD4ITM40G was constructed as follows (Figure 14). A 0.35-kb Hindlll-Xhol fragment encoding a part of the joining region and the whole constant region of the human Ig kappa light chain was isolated from pING1480 in which the HindiII site was introduced into the joining region and the Xhol site was introduced into the 3 noncoding region of the human Ig kappa light chain cDNA. The fragment, together with an adapter comprising two synthetic oligonucleotides, TM62 (CTAGCTTTCCAGA) and TM63 (AGCTTCT-GGAAAG), was ligated into the Nhel and Sail sites of PCD4LTM1G, a derivative of pCD4LTMl (Mizukami et al, supra ) , which contains an Eco-gpt transcription unit as a selective marker.
Expression of the hybrid proteins in CV-1 and RPMI8226 cells. Transient expression and metabolic labeling of the hybrid proteins with [35S] cysteine (Amersham) were performed according to the protocol of Fuerst et al (1986. Proc . Natl. Acad. Sci. USA 83, 8122-8126) by transfecting the expression plasmids for the hybrid proteins into the cells that were previously infected with vTF7-3 which expresses the bacteriophage T7 RNA polymerase gene under control of the vaccinia P7.5 promoter (Fuerst et al, supra ) . For subsequent analysis, 2.5 ml of culture medium was supplemented with 0.2 ml of 10-fold concentrated protease inhibitor buffer (Berger et al, supra ) and 0.142 ml of 20% (vol/vol) Nonidet P-40. The cells were suspended with 1.25 ml of phosphate-buffered saline with 0.1 ml of 10-fold concentrated protease inhibitor buffer, and lysed by the addition of 0.071 ml of 20% (vol/vol) Nonidet P-40. 0.23 ml of the processed culture media or 0.115 ml of the cell extracts were added with 0.5 to 1.0 microgram of OKT4A and anti-Leu-3A, respectively, and incubated for 8 hr at 4°C. The immune complexes were collected by adding 0.1 ml of 20% (vol/vol) suspension of - 42 - protein A-agarose and washed as described by Berger et al ( supra ) . The complexes bound to protein A-agarose were solubilized by boiling in Laemmll sample buffer containing 8 M urea and were resolved in SDS-polyacrylamide gels (Berger et al. supra) . The gels were treated with En Hance (New England Nuclear) and labeled proteins were visualized by fluorography.
Conditions for binding of various antibodies and ligands to the hybrid proteins . 0.115 ml of the processed culture media were used for the binding experiments . For the binding to mAbs OKT4 , 0KT4A and mouse anti-human Ig kappa chain, the media were added with 0.5 microgram of the mAbs, incubated for 8 hr at 4°C, then added with 10 microgram of biotinylated goat anti-moust igG, and incubated for 8 hr at 4°C. 0.1 ml of 20% (vol/vol) suspension of streptavidin agarose was added, and the incubations were continued for 1 hr at 4°C on a rotator. The samples were processed and analyzed by SDS-polyacrylamide gel (7.5%) electrophoresis in a reducing condition as described by Berger et al ( supra ) . For the binding to goat anti-human IgG (Fc) antibody and to goat anti-human Ig lambda light chain antibody, the media were mixed with 10 microgram of these biotinylated goat antibodies, and incubated for 8 hr at 4°C. 0.1 ml of 20% suspension of streptoavidin agarose was added, and the samples were processed as above. For the binding to the HIV-1 gpl20, the media were mixed with 0.1 ml of the culture media in which the gpl20 had been expressed by a vaccinia virus-based double infection system (Fuerst et al, 1987, Mol . Cell. Biol. 7, 2538-2544), and incubated for 2 hr at 4°C. The complex was added with 0.1 ml of hybridoma 902 supernatant, incubated for 8 hr at 4°C, then added with 10 microgram of biotinylated goat anti-mouse IgG, and incubated for 8 hr at 4°C. 0.1 ml of 20% suspension of streptavidin agarose was added, and the samples were processed as above. For the binding to protein A-agarose, the media were directly added to 20% (vol/vol) suspension of protein A-agarose, and the incubations were continued for 1 hr at 4°C on a rotator. The samples were then washed and processed as described above .
RESULTS Three types of hybrid proteins [CD4(109)CH, CD4(178)CH and CD4(372)CH] with different lengths (1-109, 1-178, and 1-372 of the human CD4 extracellular region linked to human IgGl heavy chain constant region, and one hybrid protein [CD4(181)CL] comprising the amino-terminal 181 amino acid residues of CD4 and the human Ig light chain constant region were designed (Figure 9). To express these hybrid proteins, a vaccinia virus-based expression system was used, and the plasmids for the expression of these hybrid proteins were constructed (Figures 10-14). In those plasmids the coding sequences for the hybrid proteins are placed under the T7 promoter and can be expressed upon coexpression of T7 RNA polymerase .
First, the expression of CD4(109)CH, CD4(178)CH, and CD4(372)CH in CV-1 cells was investigated (Figure 15). In both culture media and cell fractions, 38-kilodalton (kd), 65-kd, and 88-kd proteins were detected by transfection of pCD4ITM10, pCD4ITM20, and pCD4ITM30, respectively, after immunoprecipitation with anti-CD4 mAbs followed by trapping with protein A-agarose. The calculated total amino acid residue numbers of CD4(109)CH, CD4(178)CH, and CD4(372)CH are 439, 508, and 702, respectively. The observed molecular weights of the expressed proteins are slightly heavier than those estimated by the residue numbers. The differences presumably come from glycosylation of the proteins; the CH2 domain of the Ig heavy chain and the third and fourth Ig-like domains of CD4 each have one asparagine-linked glycosylation site. A considerable portion of the synthesized proteins were secreted into the culture media even in the absence of Ig light chain expression; this - 44 - was unexpected, since it has been shown that Ig heavy chain secretion is poor in the absence of light chain expression (Pepe et al, 1986, J. Immunol. 137:2367-2372).
The subunit structure of the hybrid proteins which were expressed in CV-1 cells was then analyzed by SDS-polyacrylamide-gel electrophoresis in non-reducing conditions (Figure 16). In the absence of reducing agent, CD4(109)CH, CD4(178)CH, and CD4(372)CH moved to the high molecular weight positions, presumably in dimer positions; by contrast a soluble form of CD4 consisting of 1-372 amino acid residues of CD4 migrated at the expected monomer position. The result indicates that CD4(109)CH, CD4(178)CH, and CD4(372)CH exist as disulphide-linked dimers both in the culture media and inside of the cells.
Next, the expression of the other hybrid protein, CD4(181)CL, was examined by transfection of CV-1 cells with pCD4ITM40G (Figure 17). By transfection with only pCD4lTM40G, CV-1 cells expressed a 34-38 kd protein which is most likely CD4(181)CL. The major, portion of this protein migrated in the monomer position also in the absence of reducing agent, indicating that CD4(181)CL exists as monomers. In contrast, CD4(178)CH migrated in the dimer position in a non-reducing condition, indicat-ing that CD4(178)CL exists as disulphide-linked dimers. When both proteins were coexpressed by cotransfection with pCD4lTM20G and pCD4ITM40G, a new protein band with a high molecular weight (>200 kd) appeared in a non-reducing condition. This band is most likely due to a hetero-tetrameric structure made of two subunits of CD4(178)CH and two subunits of CD4(181)CL, analogous to natural Ig molecules, and thus containing four HIV-gpl20 binding sites (Figure 18).
Then, the coexpression of CD4(109)CH, CD4(178)CH, and CD4(372)CH with the normal human Ig lambda light chain was examined, by transfecting pCD4ITM10, pCD4ITM20, and pCD4lTM30 into RPMI 8226, a - 45 - human myeloma cell line (ATCC CCL 155) which secretes human Ig lambda light chains (Figure 19). All of those three hybrid proteins were synthesized and secreted efficiently into the culture media, although much of the expressed proteins accumulated in the inside of the cells . Co-immunoprecipitation of the human Ig lambda chain with CD4(109)CH, CD4(178)CH, and CD4(372)CH was observed, indicating that those hybrid proteins formed complexes with the human Ig lambda light chain which was synthesized by the host cell line. When the protein complexes were analyzed by SDS-polyacrylamide gels in a non-reducing condition, new protein bands with high molecular weights appeared for each complex. The estimated molecular weights of major complexes in the culture media of the cells transfected with pCD4lTM10, pCD4lTM20, and pCD4lTM30 are 180 kd, 210 kd, and >220 kd, respectively. This result indicates that these complexes represent tetrameric structures composed of two subunits of each hybrid protein and two subunits of the human Ig lambda light chain from the host cell. These molecules may, therefore, have structures analogous to natural Ig molecules.
The binding properties of CD4(178)CH to various ligands and antibodies was then investigated. CD4(178)CH which was expressed and secreted from the CV-1-transfected cells, was first analyzed (Figure 20). A soluble form of CD4 containing full extracellular four Ig-like domains was also expressed and analyzed as a control. CD4(178)CH bound to the HIV gpl20, 0KT4A, anti-human IgG (Fc) antibody, and protein A-agarose, but did not bind to 0KT4. The soluble CD4 bound to the HIV gpl20, 0KT4, and 0KT4A. However, it did not bind to anti-human IgG (Fc) antibody and protein A-agarose. The binding regions for gpl20 and 0KT4A have been identified in the first domain of CD4 (Clayton et al, supra ; Landau et al, supra ; Peterson et al, supra; Mizukami et al, supra ) , whereas the binding region for 0KT4 is believed to exist in the third or fourth domains of CD4. These results are consistent with the binding properties of CD4(178)CH and the soluble CD4 to the ligands and antibodies examined.
CD4(178)CH which was coexpressed with the host-derived human Ig lambda chain by the transfected-RPMl8226 cells was then examined for the binding property to various ligands and antibodies (Figure 21). The hybrid protein bound to the gpl20, 0KT4A, anti-human IgG (Fc) antibody, and protein A-agarose, but did not bind to 0KT4. When the Ig lambda chain was immunoprecipitated with anti-human Ig lambda chain antibody, CD4(178)CH was also coimmunoprecipitated with it, demonstrating that CD4(178)CH makes a complex w-yT\ / the host-derived lambda chain .
CD4(178)CH and CD4(181)CL which were coexpressed in CV-1 cells were also analyzed for the binding properties to various ligands and antibodies (Figure 22). Although 0KT4 did not immunoprecipitate CD4(178)CH or CD4(181)CL, 0KT4A could immunoprecipitate both these hybrid proteins. The gpl20 could also bind to both proteins as well. Anti-human IgG (Fc) antibody and protein A-agarose could immunoprecipitate CD4(178)CH, and also coprecipitate CD4(181)CL with it. Anti-human Ig kappa mAb could immunoprecipitate CD4(181)CL, and also coprecipitate CD4(178)CH with it. These results, together with the results shown in Figure 17, demonstrate that CD4(178)CH and CD4(181)CL coexpressed in CV-1 cells form the protein complex with a hetero-tetrameric structure in which each subunit maintains its intrinsic binding property to various ligands and antibodies .
In summary, this part of the present invention teaches the construction of multimeric recombinant proteins comprising the gpl20 binding region of human CD4 linked to constant regions of heavy and light chain components of human IgG, the resulting recombinant proteins at least possessing the property of inhibiting HIV - 47 - proliferation by either neutralizing HIV activity, by killing HIV-infected cells, or by lysing HIV virions.
The availability of the unique recombinant proteins of the present invention now allows the prepara-tion of a therapeutic or prophylactic composition comprising effective amount of the recombinant hybrid protein of the present invention to kill HIV or inhibit HIV infection, and pharmaceutically acceptable carrier. A method of treating or inhibiting HIV infection comprises administering an effective amount of the above mentioned composition to a host in need of protection or treatment against HIV to kill or inhibit HIV infection.
A deposit of plasmids pCD4ITM10G, pCD4ITM20G, PCD4ITM30G and pCD4lTM40G for the production of recombi-nant hybrid proteins in accordance with the present invention have been made at the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland, 20852, U.S.A., on April 27, 1989 under accession numbers 67940, 67941, 67942 and 67943, respectively. The deposit shall be viably maintained, replacing if it becomes non-viable during the life of the patent, for a period of 30 years from the date of the deposit, or for 5 years from the last date of request for a sample of the deposit, whichever is longer, and made available to the public without restriction in accordance with the provisions of the law. The Commissioner of Patents and Trademarks, upon request shall have access to the deposit.
It is understood that the examples and embod-iments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims . - 48 - 91070/3

Claims (35)

1. A chimeric gene which directs the synthesis, in a suitable expression vector, of a hybrid protein comprising a virus binding region from cellular receptor having a sequence linked to a protein sequence containing a region having an effect leading to cell cytotoxicity.
2. The gene of claim 1, wherein the cellular receptor sequence is from CD4 and the protein sequence is from Pseudomonas exotoxin A.
3. The gene of claim 2 directing the synthesis of CD4(178) — PE40 fusion protein.
4. The gene of claim 3 inserted in a cloning vector.
5. The gene of claim 4 wherein said cloning vector has the functional characteristics of ATCC deposit No. 67739
6. The chimeric gene of claim 1, wherein said cellular receptor sequence includes the N-terminal 177 amino acid residues of the mature human CD4, comprising the first two immunoglobulin type domains, which binds to gpl20, the external subunit of human immunodeficiency virus envelope glycoprotein.
7. A hybrid protein comprising a virus binding region from a cellular receptor sequence linked to a protein sequence containing a region having an effect leading to cell cytotoxicity.
8. The hybrid protein of claim 7, wherein the cellular receptor sequence is from CD4 and protein sequence is from Pseudomonas exotoxin A.
9. The hybrid protein of claim 8 being CD(178)-PE40 recombinant fusion protein.
10. The hybrid protein of claim 7, being a recombinant protein comprising the N-terminal 177 amino acid residues of the mature human CD4, including the first two immunoglobulin-like domains, which binds to gpl20, the external subunit of human immunodeficiency virus envelope - 49 - 91070/3 glycoprotein, linked to a protein sequence containing a region having an effect leading to cell cytotoxicity.
11. A hybrid protein, comprising a gpl20 binding region of human CD4 recombinantly linked to a constant region of human immunoglobulin
12. The hybrid protein of claim 11, wherein the immunoglobulin is IgG.
13. The hybrid protein of claims 11 or 12 being multimeric.
14. The hybrid protein of claim 13 being dimeric.
15. The hybrid protein of claims 13 or 14 being a heterotetramer composed of coexpressed CD4-human heavy chain constant region constructs coexpressed with normal human immunoglobulin light chains.
16. The hybrid protein of claim 15, containing two normal human immunoglobulin light chains.
17. The hybrid protein of claims 12 or 13 being a heterotetramer composed of coexpressed CD4-human heavy chain constant region constructs coexpressed with CD4-human immunoglobulin light chain constant region constructs.
18. The hybrid protein of claim 17, containing two CD4-human light chain constant region constructs.
19. The hybrid protein of claims 13 or 14 being a multimer composed of coexpressed CD4-human heavy chain constant region constructs coexpressed with normal human immunoglobulin light chains.
20. The hybrid protein of claims 13 or 14 being a multimer composed or coexpressed CD4-human heavy chain constant region constructs coexpressed with CD4-human light chain constant region constructs.
21. The hybrid protein of any of claims 12-20 having binding affinity for complement component Clq. - 50 - 91070/3
22. The hybrid protein of any of claims 12-20 mediating complement dependent lysis of HIV infected cells expressing the HIV envelope glycoprotein.
23. The hybrid protein of any of claims 12-20 mediating complement depending lysis of free HIV virions.
24. The hybrid protein of any of claims 12-20 mediating antibody-dependent cellular cytotoxicity.
25. The hybrid protein of any of claims 12-20 having binding affinity for Fc receptors on cells mediating antibody dependent cellular cytotoxicity.
26. A hybrid protein according to claims 1 or 7, wherein the protein sequence's effect is directly cytotoxic.
27. A hybrid protein according to claims 1 or 7, wherein the protein sequence's effect is indirectly cytotoxic.
28. A composition comprising an effective amount of the hybrid protein of claim 7 to prevent proliferation of virus infection or kill HIV infected cells, and pharmaceutically acceptable, sterile, non-toxic carrier, if necessary.
29. The composition of claim 28 for preventing proliferation of HIV infection.
30. A composition comprising an effective amount of the polypeptide of claim 10 to inhibit binding of HIV to host cells.
31. A composition comprising an effective amount of hybrid protein of any of claims 11-25 to inhibit HIV infection or kill HIV infected cells and virions and pharmaceutically acceptable carrier.
32. Use of the agent according to claim 7 for the preparation of a medicament for controlling viral infection substantially as described in the specification. - 51 - 91070/1
33. Use of the agent according to claim 7 for the preparation of a medicament for controlling HIV infection substantially as described in the specification.
34. Use of the protein according to claim 10 for the preparation of a medicament for preventing HIV infection of host cells substantially as described in the specification.
35. Use of the composition of claim 31 for the preparation of a medicament for controlling HIV infection substantially as described in the specification. For the Applicants, DR. REINHOLD COHN AND PARTNERS
IL9107089A 1988-07-23 1989-07-21 Cytotoxic agent against specific virus infection IL91070A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US07/223,270 US5206353A (en) 1988-07-23 1988-07-23 CD-4/cytotoxic gene fusions
US28373988A 1988-12-13 1988-12-13
US34430489A 1989-04-27 1989-04-27

Publications (2)

Publication Number Publication Date
IL91070A0 IL91070A0 (en) 1990-02-09
IL91070A true IL91070A (en) 1995-03-30

Family

ID=27397211

Family Applications (1)

Application Number Title Priority Date Filing Date
IL9107089A IL91070A (en) 1988-07-23 1989-07-21 Cytotoxic agent against specific virus infection

Country Status (3)

Country Link
EP (1) EP0428603A4 (en)
IL (1) IL91070A (en)
WO (1) WO1990001035A1 (en)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5498538A (en) * 1990-02-15 1996-03-12 The University Of North Carolina At Chapel Hill Totally synthetic affinity reagents
DE69104048T2 (en) * 1990-08-06 1995-02-09 Upjohn Co REMOVAL OF INTERNAL INITIATION OF THE SOLUBLE CD4 GENE.
US6099842A (en) * 1990-12-03 2000-08-08 The United States Of America As Represented By The Department Of Health And Human Services Recombinant immunotoxin composed of a single chain antibody reacting with the human transferrin receptor and diptheria toxin
US7070991B2 (en) 1991-02-08 2006-07-04 Progenics Pharmaceuticals, Inc. Cells expressing a CD4-IgG2 chimeric heterotetramer
JP3670276B2 (en) 1991-02-08 2005-07-13 プロゲニクス・ファーマスーティカルズ、インコーポレイテッド CD4-Gamma-2 chimera and CD4-IgG2 chimera
US5234905A (en) * 1991-02-22 1993-08-10 University Of Colorado Foundation, Inc. Soluble CD4 molecules modified to prolong circulating half-life
GB9217124D0 (en) * 1992-08-13 1992-09-23 Antisoma Ltd Medical treatment
AU5098393A (en) * 1992-08-14 1994-03-15 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Recombinant toxin with increased half-life

Also Published As

Publication number Publication date
EP0428603A1 (en) 1991-05-29
IL91070A0 (en) 1990-02-09
WO1990001035A1 (en) 1990-02-08
EP0428603A4 (en) 1991-11-13

Similar Documents

Publication Publication Date Title
Zettlmeissl et al. Expression and characterization of human CD4: immunoglobulin fusion proteins
US5428143A (en) Cytotoxic agent against specific virus infection
Chaudhary et al. Selective killing of HIV-infected cells by recombinant human CD4-Pseudomonas exotoxin hybrid protein
RU2167676C2 (en) Redirection of cellular immunity by chimeric receptors
RU2161044C2 (en) Method of direction of immune response induction, dna, vector, method of treatment
CA1341427C (en) Variants of immunoglobulin gene superfamily member
US5565335A (en) Adhesion variants
KR100667121B1 (en) Compositions and Methods for the Treatment of Viral Infectious Diseases
CA2182890C (en) Targeted cytolysis of hiv-infected cells by chimeric cd4 receptor-bearing cells
JPH08500017A (en) Bispecific immune adhesin
ES2237727T3 (en) CHAMPIONS OF GAMMA2-CD4 AND IGG2-CD4.
WO1993008829A1 (en) Compositions that mediate killing of hiv-infected cells
CA2049964A1 (en) C4 binding protein fusion proteins
JPH03504234A (en) Soluble human CD4 fragment and its use
IL91070A (en) Cytotoxic agent against specific virus infection
WO1992013559A1 (en) CD4-GAMMA1 AND CD4-IgG1 CHIMERAS
AU623924B2 (en) Cytotoxic agent against specific virus infection
US7070991B2 (en) Cells expressing a CD4-IgG2 chimeric heterotetramer
Chamow et al. A humanized, bispecific immunoadhesin-antibody that retargets CD3+ effectors to kill HIV-1-infected cells
WO1990000566A1 (en) Inhibition of hiv-1 infection with soluble cd4
US20030211470A1 (en) CD4-IgG2-based salvage therapy of HIV-1 infection
Winkler et al. CD4-Pseudomonas exotoxin hybrid proteins: modulation of potency and therapeutic window through structural design and characterization of cell internalization
JPH03504802A (en) Cytotoxic agents against certain viral infections
THOMAS et al. Dissecting the Basis for Its Inhibitory Effect on HIV-Induced Cell Fusion
HK1059789B (en) Cd4-gamma2 and cd4-lgg2 chimeras

Legal Events

Date Code Title Description
RH Patent void