WO2007147265A1 - Polynucleotides and polypeptide sequences involved in cancer - Google Patents

Polynucleotides and polypeptide sequences involved in cancer Download PDF

Info

Publication number
WO2007147265A1
WO2007147265A1 PCT/CA2007/001134 CA2007001134W WO2007147265A1 WO 2007147265 A1 WO2007147265 A1 WO 2007147265A1 CA 2007001134 W CA2007001134 W CA 2007001134W WO 2007147265 A1 WO2007147265 A1 WO 2007147265A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
cell
polypeptide
ovarian cancer
cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2007/001134
Other languages
English (en)
French (fr)
Inventor
Roy Rabindranauth Sooknanan
Gilles Bernard Tremblay
Mario Filion
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Alethia Biotherapeutics ULC
Original Assignee
Alethia Biotherapeutics ULC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP07720048.3A priority Critical patent/EP2032701B1/en
Priority to AU2007262635A priority patent/AU2007262635B2/en
Priority to CA2655933A priority patent/CA2655933C/en
Priority to ES07720048.3T priority patent/ES2444695T3/es
Priority to US12/305,648 priority patent/US8216582B2/en
Priority to JP2009515683A priority patent/JP5564249B2/ja
Priority to EP16203468.0A priority patent/EP3231442B1/en
Application filed by Alethia Biotherapeutics ULC filed Critical Alethia Biotherapeutics ULC
Priority to DK07720048.3T priority patent/DK2032701T3/da
Publication of WO2007147265A1 publication Critical patent/WO2007147265A1/en
Anticipated expiration legal-status Critical
Priority to US13/152,209 priority patent/US20120128661A1/en
Priority to US13/490,857 priority patent/US20120288498A1/en
Priority to US14/690,562 priority patent/US20160039930A1/en
Priority to US15/863,594 priority patent/US20180346563A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6801Drug-antibody or immunoglobulin conjugates defined by the pharmacologically or therapeutically active agent
    • A61K47/6803Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates
    • A61K47/6811Drugs conjugated to an antibody or immunoglobulin, e.g. cisplatin-antibody conjugates the drug being a protein or peptide, e.g. transferrin or bleomycin
    • A61K47/6817Toxins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A61K47/6869Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell the tumour determinant being from a cell of the reproductive system: ovaria, uterus, testes, prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3069Reproductive system, e.g. ovaria, uterus, testes, prostate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57545Immunoassay; Biospecific binding assay; Materials therefor for cancer of the ovaries
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to polynucleotide and polypeptide sequences which are differentially expressed in cancer compared to normal cells
  • the present invention more particularly relates to the use of these sequences in the diagnosis, prognosis or treatment of cancer and in the detection of cancer cells
  • ovarian cancer accounts for the highest tumor-related mortality in women in the United States (Jemal et al., 2005). It is the fourth leading cause of cancer-related death in women in the U. S (Menon et al., 2005).
  • the American Cancer Society estimated a total of 22,220 new cases in 2005 and attributed 16,210 deaths to the disease (Bonome et al., 2005).
  • the statistics have remained largely the same - the majority of women who develop ovarian cancer will die of this disease (Chambers and Vanderhyden, 2006).
  • the disease carries a 1 :70 lifetime risk and a mortality rate of >60% (Chambers and Vanderhyden, 2006).
  • the high mortality rate is due to the difficulties with the early detection of ovarian cancer when the malignancy has already spread beyond the ovary. Indeed, >80% of patients are diagnosed with advanced staged disease (stage III or IV) (Bonome et al , 2005) These patients have a poor prognosis that is reflected in ⁇ 45% 5-year survival rate, although 80% to 90% will initially respond to chemotherapy (Berek et al., 2000). This increased success compared to 20% 5-year survival rate years earlier is, at least in part, due to the ability to optimally debulk tumor tissue when it is confined to the ovaries, which is a significant prognostic factor for ovarian cancer (Bristow R. E., 2000 and Brown et al., 2004). In patients who are diagnosed with early disease (stage I), the 5-yr survival ranges from >90 (Chambers and Vanderhyden, 2006).
  • Ovarian cancer comprises a heterogeneous group of tumors that are derived from the surface epithelium of the ovary or from surface inclusions. They are classified into serous, mucinous, endometrioid, clear cell, and Brenner (transitional) types corresponding to the different types of epithelia in the organs of the female reproductive tract (Shih and Kurman, 2005) Of these, serous tumors account for ⁇ 60% of the ovarian cancer cases diagnosed Each histologic subcategory is further divided into three groups benign, intermediate (borderline tumor or low malignancy potential (LMP)), and malignant, reflecting their clinical behavior (Seidman et al , 2002) LMP represents 10% to 15% of tumors diagnosed as serous and is a conundrum as they display atypical nuclear structure and metastatic behavior, yet they are considerably less aggressive than high-grade serous tumors The 5-year survival for patients with LMP tumors is 95% in contrast to a ⁇ 45% survival for advanced high- grade disease over the same period (Be
  • the initial chemotherapy regimen for ovarian cancer includes the combination of carboplatin (Paraplatin) and paclitaxel (taxol) Years of clinical trials have proved this combination to be most effective after effective surgery - reduces tumor volume in about 80% of the women with newly diagnosed ovarian cancer and 40% to 50% will have complete regression - but studies continue to look for ways to improve it
  • Recent abdominal infusion of chemotherapeutics to target hard-to-reach cells in combination with intravenous delivery has increased the effectiveness
  • severe side effects often lead to an incomplete course of treatment
  • This present invention tries to address these needs and other needs
  • new polynucleotide sequences and new polypeptide sequences as well as compositions, antibodies specific for these sequences, vectors and cells comprising a recombinant form of these new sequences
  • the present invention also provides methods of detecting cancer cells using single or multiple polynucleotides and/or polypeptide sequences which are specific to these tumor cells.
  • Some of the polynucleotides and/or polypeptides sequences provided herein are differentially expressed in ovarian cancer compared to normal cells and may also be used to distinguish between malignant ovarian cancer and an ovarian cancer of a low malignancy potential and/or a normal state (individual free of ovarian cancer)
  • diagnostic methods prognostic methods, methods of detection, kits, arrays, librairies and assays which comprises one or more polypeptide and/or polynucleotide sequences or antibodies described herein as well as new therapeutic avenues for cancer treatment
  • the Applicant has come to the surprising discovery that polynucleotide and/or polypeptide sequences described herein are preferentially upregulated in malignant ovarian cancer compared to low malignancy potential ovarian cancer and/or compared to normal cells More interestingly some of these sequences appear to be overexpressed in late stage ovarian cancer
  • the Applicant has also come to the surprising discovery that some of the sequences described herein are not only expressed in ovarian cancer cells but in other cancer cells such as cells from breast cancer, prostate cancer, renal cancer, colon cancer, lung cancer, melanoma, leukemia and from cancer of the central nervous system
  • several of these sequences, either alone or in combination may represent universal tumor markers Therefore, some NSEQs and PSEQs described herein not only find utility in the field of ovarian cancer detection and treatment but also in the detection and treatment of other types of tumors
  • NSEQs or PSEQs of the present invention may readily identify a cell as being cancerous
  • NSEQs or PSEQs may be used to identify a cell as being a ovarian cancer cell, a prostate cancer cell, a breast cancer cell, a lung cancer cell, a colon cancer cell, a renal cancer cell, a cell from a melanoma, a leukemia cell or a cell from a cancer of the central nervous system
  • NSEQs or PSEQs described herein may be used to identify a cell as being a malignant ovarian cancer or a low malignant potential ovarian cancer
  • NSEQs or PSEQs in ovarian cancer cell may preferentially be indicative that the ovarian cancer is of the malignant type
  • Some NSEQs or PSEQs of the present invention may also more particularly indicate that the cancer is a late-stage malignant ovarian cancer
  • the NSEQs or PSEQs may further be used to treat cancer or to identify compounds useful in the treatment of cancer including, ovarian cancer ( ⁇ e, LMP and/or malignant ovarian cancer), prostate cancer, breast cancer lung cancer colon cancer, renal cancer, melanoma leukemia or cancer of the central nervous system
  • ovarian cancer ⁇ e, LMP and/or malignant ovarian cancer
  • prostate cancer breast cancer lung cancer colon cancer
  • renal cancer melanoma leukemia or cancer of the central nervous system
  • NSEQ refers generally to polynucleotides sequences comprising or consisting of any one of SEQ ID NOs 1 to 49, and 169 (e g , an isolated form) or comprising or consisting of a fragment of any one of SEQ ID NOs 1 to 49 and 169
  • NSEQ more particularly refers to a polynucleotide sequence comprising or consisting of a transcribed portion of any one of SEQ ID NOs 1 to 49 and 169, which may be, for
  • NSEQ also refers to a polynucleotide sequence able to encode any one of the polypeptides described herein or a polypeptide fragment of any one of the above.
  • NSEQ refers to a sequence substantially complementary to any one of the above.
  • NSEQ may also relates to SEQ ID NO :50 including any polynucleotide comprising or consisting of SEQ ID NO'50 (e.g., an isolated form) or comprising or consisting of a fragment of any one of SEQ ID.
  • NSEQ such as a polynucleotide sequence comprising or consisting of a transcribed portion of any one of SEQ ID NO 50, which may be, for example, free of untranslated or untranslatable portion(s) ( ⁇ e., a coding portion of SEQ ID NO'50)
  • NSEQ additionally refers to a sequence substantially identical to any one of the above and more particularly substantially identical to polynucleotide sequence comprising or consisting of a transcribed portion of SEQ. ID. NO:50, which may be, for example, free of untranslated or untranslatable portion(s).
  • NSEQ additionally refers to a nucleic acid sequence region of SEQ. ID. NO:50 which encodes or is able to encode a polypeptide.
  • NSEQ refers to a sequence substantially complementary to any one of the above. As such, in embodiments of the invention NSEQ encompasses, for example,
  • SEQ. ID NOs: 1 to 49, 50 and 169 and also encompasses polynucleotide sequences which comprises, are designed or derived from SEQ ID. NOs: 1 to 49, 50 or 169.
  • Non- limiting examples of such sequences includes, for example, SEQ ID NOs 103-150 or 151-152.
  • the term "inhibitory NSEQ” generally refers to a sequence substantially complementary to any one of SEQ ID NOs- 1 to 49, 50 or 169, substantially complementary to a fragment of any one of SEQ. ID. Nos: 1 to 49, 50 or 169, substantially complementary to a sequence substantially identical to SEQ. ID.
  • Suitable "inhibitory NSEQ” may have for example and without limitation from about 10 to about 30 nucleotides, from about 10 to about 25 nucleotides or from about 15 to about 20 nucleotides.
  • PSEQ refers generally to each and every polypeptide sequences mentioned herein such as, for example, any polypeptide sequences encoded (putatively encoded) by any one of NSEQ described herein (e g , any one of SEQ ID NOs 1 to 49 or 169) including their isolated or substantially purified form Therefore, in embodiments of the invention, a polypeptide comprising or consisting of any one of SEQ ID NOs"51 to 88 or 170 including variants (e g , an isolated natural protein variant), analogs, derivatives and fragments thereof are collectively referred to herein as "PSEQ" In other embodiments of the invention, such as those related to detection and/or treatment of cancers other than ovarian cancer, PSEQ also refers to polypeptide comprising or consisting of SEQ ID NO 89 including variants (e g , an isolated natural protein variant) analogs, derivatives and fragments
  • NSEQs or PSEQs described herein have been previously characterized for purposes other than those described herein
  • dignostics and therapeutics which are known to target those NSEQs or PSEQs (e g , antibodies and/or inhibitors) may thus now be applied for inhibition of these NSEQ or PSEQ in the context of treatment of ovarian cancer, prostate cancer, renal cancer, colon cancer, lung cancer, melanoma, leukemia or cancer of the central nervous system
  • antibodies capable of binding to folate receptor-1 may thus be used for specific binding of tumor cells other than ovarian cancer cells, such as breast cancer, prostate cancer, renal cancer, colon cancer, lung cancer, melanoma, leukemia and from cancer of the central nervous system
  • antibodies and/or inhibitors of folate receptor-1 e g , CB300638, CB300945 which are Cyclopenta[g]qu ⁇
  • NSEQ described herein may be used either directly or in the development of tools for the detection and isolation of expression products (mRNA, mRNA precursor, hnRNA, etc ), of genomic DNA or of synthetic products (cDNA, PCR fragments, vectors comprising NSEQ etc )
  • NSEQs may also be used to prepare suitable tools for detecting an encoded polypeptide or protein NSEQ may thus be used to provide an encoded polypeptide and to generate an antibody specific for the polypeptide
  • oligonucleotides sequences may be prepared based on the polynucleotide sequences described herein
  • oligonucleotides having 10 to 20 nucleotides or more may be prepared for specifically hybridizing to a NSEQ having a substantially complementary sequence and to allow detection, identification and isolation of nucleic sequences by hybridization
  • Probe sequences of for example, at least 10-20 nucleotides may be prepared based on a sequence found in any one of SEQ ID NO 1 to 49, 50 or 169 and more particularly selected from regions that lack homology to undesirable sequences
  • Probe sequences of 20 or more nucleotides that lack such homology may show an increased specificity toward the target sequence
  • Useful hybridization conditions for probes and primers are readily determinable by those of skill in the art
  • Stringent hybridization conditions encompassed herewith are those that may allow hybridization of nucleic acids that are greater than 90% homologous but which may prevent hybridization of nucleic acids that are less than 70% homologous The specific
  • a probe may be labelled by any procedure known in the art, for example by incorporation of nucleotides linked to a "reporter molecule"
  • a "reporter molecule”, as used herein, may be a molecule that provides an analytically identifiable signal allowing detection of a hybridized probe Detection may be either qualitative or quantitative
  • Commonly used reporter molecules include fluorophores, enzymes, biotin, chemiluminescent molecules, bioluminescent molecules digoxigenin avidin streptavidin or radioisotopes
  • Commonly used enzymes include horseradish peroxidase, alkaline phosphatase, glucose oxidase and ⁇ -galactosidase, among others
  • mRNAs identical or substantially identical to the NSEQs of the present invention may thus be detected and/or isolated using methods which are known in the art Exemplary embodiment of such methods includes, for example and without limitation, hybridization analysis using oligonucleotide probes, reverse transcription and in vitro nucleic acid amplification methods
  • Such procedures may therefore permit detection of mRNAs in ovarian cells (e g ovarian cancer cells) or in any other cells expressing such mRNAs
  • ovarian cells e g ovarian cancer cells
  • expression of mRNA in a tissue-specific or a disease-specific manner may be useful for defining the tissues and/or particular disease state
  • One of skill in the art may readily adapt the NSEQs for these purposes
  • NSEQs may hybridize to a substantially complementary sequence found in a test sample (e g , cell, tissue, etc ) Additionally, a sequence substantially complementary to NSEQ (including fragments) may bind a NSEQ and substantially identical sequences found in a test sample (e g , cell, tissue, etc )
  • Polypeptide encoded by an isolated NSEQ polypeptide variants, polypeptide analogs or polypeptide fragments thereof are also encompassed herewith
  • the polypeptides whether in a premature, mature or fused form, may be isolated from lysed cells, or from the culture medium, and purified to the extent needed for the intended use
  • purification may be accomplished by salt fractionation, size exclusion chromatography ion exchange chromatography reverse phase chromatography, affinity chromatography and the like
  • PSEQ may be made by chemical synthesis
  • Natural variants may be identified through hybridization screening of a nucleic acid library or polypeptide library from different tissue, cell type, population, species etc using the NSEQ and derived tools
  • a NSEQ able to encode any one of a PSEQ described herein may be inserted into an expression vector, i e , a vector that contains the elements for transcriptional and translational control of the inserted coding sequence in a particular host These elements may include regulatory sequences, such as enhancers, constitutive and inducible promoters, and 5' and 3' un-translated regions
  • a vector that contains the elements for transcriptional and translational control of the inserted coding sequence in a particular host may include regulatory sequences, such as enhancers, constitutive and inducible promoters, and 5' and 3' un-translated regions
  • RNA and/or polypeptide may be expressed from a vector comprising NSEQ using an in vitro transcription system or a coupled in vitro transcription/translation system respectively
  • host cells that contain NSEQ and/or that express a polypeptide encoded by the NSEQ, or a portion thereof may be identified by a variety of procedures known to those of skill in the art These procedures include, but are not limited to, DNA/DNA or DNA/RNA hybridizations, PCR amplification, and protein bioassay or immunoassay techniques that include membrane, solution or chip based technologies for the detection and/or quantification of nucleic acid or amino acid sequences Immunological methods for detecting and measuring the expression of polypeptides using either specific polyclonal or monoclonal antibodies are known in the art Examples of such techniques include enzyme-linked immunosorbent assays (ELiSAs), radioimmunoassays (RIAs), and fluorescence activated cell sorting (FACS) Those of skill in the art may readily adapt these methodologies to the present invention
  • ELiSAs enzyme-linked immunosorbent assays
  • RIAs radioimmunoassays
  • FACS fluorescence activated cell sorting
  • Host cells comprising NSEQ may thus be cultured under conditions for the transcription of the corresponding RNA (mRNA, siRNA, shRNA etc ) and/or the expression of the polypeptide from cell culture
  • the polypeptide produced by a cell may be secreted or may be retained intracellular ⁇ depending on the sequence and/or the vector used
  • expression vectors containing NSEQ may be designed to contain signal sequences that direct secretion of the polypeptide through a prokaryotic or eukaryotic cell membrane Due to the inherent degeneracy of the genetic code, other DNA sequences that encode the same substantially the same or a functionally equivalent amino acid sequence may be produced and used, for example, to express a polypeptide encoded by NSEQ
  • the nucleotide sequences of the present invention may be engineered using methods generally known in the art in order to alter the nucleotide sequences for a variety of purposes including, but not limited to, modification of the cloning, processing, and/or expression of the gene product DNA
  • nucleic acid sequences may be ligated to a heterologous sequence resulting in translation of a fusion polypeptide containing heterologous polypeptide moieties in any of the aforementioned host systems
  • heterologous polypeptide moieties may facilitate purification of fusion polypeptides using commercially available affinity matrices
  • moieties include, but are not limited to, glutathione S- transferase (GST), maltose binding protein, thioredoxin, calmodulin binding peptide, 6- His (His), FLAG, c-myc, hemaglutinin (HA), and antibody epitopes such as monoclonal antibody epitopes
  • the present invention relates to a polynucleotide which may comprise a nucleotide sequence encoding a fusion protein, the fusion protein may comprise a fusion partner fused to a peptide fragment of
  • the present invention additionally relates to a bioassay for evaluating compounds as potential antagonists of the polypeptide described herein
  • the bioassay may comprise a) culturing test cells in culture medium containing increasing concentrations of at least one compound whose ability to inhibit the action of a polypeptide described herein is sought to be determined, wherein the test cells may contain a polynucleotide sequence described herein (for example in a form having improved trans-activation transcription activity, relative to wild-type polynucleotide, and comprising a response element operatively linked to a reporter gene), and thereafter b) monitoring in the cells the level of expression of the product of the reporter gene (encoding a reporter molecule) as a function of the concentration of the potential antagonist compound in the culture medium, thereby indicating the ability of the potential antagonist compound to inhibit activation of the polypeptide encoded by, the polynucleotide sequence described herein
  • the present invention further relates to a bioassay for evaluating compounds as potential agonists for a polypeptide encoded by the polynucleotide sequence described herein
  • the bioassay may comprise a) culturing test cells in culture medium containing increasing concentrations of at least one compound whose ability to promote the action of the polypeptide encoded by the polynucleotide sequence described herein is sought to be determined, wherein the test cells may contain a polynucleotide sequence described herein (for example, in a form having improved trans- activation transcription activity, relative to wild-type polynucleotide, and comprising a response element operatively linked to a reporter gene), and thereafter b) monitoring in the cells the level of expression of the product of the reporter gene as a function of the concentration of the potential agonist compound in the culture medium, thereby indicating the ability of the potential agonist compound to promote activation of a polypeptide encoded by the polynucleotide sequence described herein
  • NSEQ may be used to identify a particular cell, cell type, tissue, disease and thus may be used for diagnostic purposes to determine the absence, presence, or altered expression ( ⁇ e increased or decreased compared to normal) of the expression product of a gene
  • Suitable NSEQ may be for example, between 10 and 20 or longer, i e , at least 10 nucleotides long or at least 12 nucleotides long, or at least 15 nucleotides long up to any desired length and may comprise, for example, RNA, DNA, branched nucleic acids, and/or peptide nucleic acids (PNAs)
  • the polynucleotides may be used to detect and quantify gene expression in samples in which expression of NSEQ is correlated with disease
  • NSEQ may be used to detect genetic polymorphisms associated with a disease These polymorphisms may be detected for example in the transcript, cDNA or genomic DNA
  • the invention provides for the use of at least one of the NSEQ described herein on an array and for the use of that array in a method of detection of a particular cell, cell type, tissue, disease for the prognosis or diagnosis of cancer
  • the method may comprise hybridizing the array with a patient sample (putatively comprising or comprising a target polynucleotide sequence substantially complementary to a NSEQ) under conditions to allow complex formation (between NSEQ and target polynucleotide), detecting complex formation, wherein the complex formation is indicative of the presence of the polynucleotide and wherein the absence of complex formation is indicative of the absence of the polynucleotide in the patient sample
  • the presence or absence of the polynucleotide may be indicative of cancer such as, for example ovarian cancer or other cancer as indicated herein
  • the method may also comprise the step of quantitatively or qualitatively comparing (e g , with a computer system, apparatus) the level of complex formation in the patient sample to that of standards for normal cells or individual or other type, origin or grade of cancer
  • the present invention provides one or more compartmentalized kits for detection of a polynucleotide and/or polypeptide for the diagnosis or prognosis of ovarian cancer
  • a first kit may have a receptacle containing at least one isolated NSEQ or probe comprising NSEQ
  • a probe may bind to a nucleic acid fragment which is present/absent in normal cells but which is absent/present in affected or diseased cells
  • Such a probe may be specific for a nucleic acid site that is normally active/inactive but which may be inactive/active in certain cell types
  • such a probe may be specific for a nucleic acid site that may be abnormally expressed in certain cell types
  • Such a probe may identify a specific mutation
  • the probe may be capable of hybridizing to the nucleic acid sequence which is mutated (not identical to the normal nucleic acid sequence) or may be capable of hybridizing to nucleic acid sequences adjacent to the mutated nucleic acid sequences
  • the probes provided in the present kits
  • Antibodies e g , isolated antibody that may specifically bind to a protein or polypeptide described herein (a PSEQ) as well as nucleic acids encoding such antibodies are also encompassed by the present invention
  • antibody means a monoclonal antibody, a polyclonal antibody, a single chain antibody, a chimeric antibody, a humanized antibody, a deimmumzed antibody, an antigen-binding fragment, an Fab fragment, an F(ab') 2 fragment, and Fv fragment CDRs or a single-chain antibody comprising an antigen-binding fragment (e g , a single chain Fv)
  • the antibody may originate for example from a mouse rat or any other mammal or from other sources such as through recombinant DNA technologies
  • the antibody may also be a human antibody which may be obtained for example, from a transgenic non-human mammal capable of expressing human Ig genes
  • the antibody may also be a humanised antibody which may comprise, for example, one or more complementarity determining regions of non-human origin It may also comprise a surface residue of a human antibody and/or framework regions of a human antibody
  • the antibody may also be a chimeric antibody which may comprise, for example, variable domains of a non-human antibody and constant domains of a human antibody
  • the antibody of the present invention may be mutated and selected based on an increased affinity, solubility, stability specificity and/or for one of a polypeptide described herein and/or based on a reduced immunogenicity in a desired host or for other desirable characteristics
  • Suitable antibodies may bind to unique antigenic regions or epitopes in the polypeptides, or a portion thereof Epitopes and antigenic regions useful for generating antibodies may be found within the proteins, polypeptides or peptides by procedures available to one of skill in the art For example, short, unique peptide sequences may be identified in the proteins and polypeptides that have little or no homology to known ammo acid sequences Preferably the region of a protein selected to act as a peptide epitope or antigen is not entirely hydrophobic, hydrophilic regions are preferred because those regions likely constitute surface epitopes rather than internal regions of the proteins and polypeptides These surface epitopes are more readily detected in samples tested for the presence of the proteins and polypeptides Such antibodies may include, but are not limited to polyclonal monoclonal chimeric and single chain antibodies, Fab fragments, and fragments produced by a Fab expression library The production of antibodies is well known to one of skill in the art and is not intended to be limited herein
  • Peptides may be made by any procedure known to one of skill in the art, for example, by using in vitro translation or chemical synthesis procedures or by introducing a suitable expression vector into cells
  • Short peptides which provide an antigenic epitope but which by themselves are too small to induce an immune response may be conjugated to a suitable carrier
  • Suitable carriers and methods of linkage are well known in the art
  • Suitable carriers are typically large macromolecules such as proteins, polysaccharides and polymeric amino acids Examples include serum albumins, keyhole limpet hemocyanin, ovalbumin, polylysi ⁇ e and the like
  • One of skill in the art may use available procedures and coupling reagents to link the desired peptide epitope to such a carrier
  • coupling reagents may be used to form disulfide linkages or thioether linkages from the carrier to the peptide of interest If the peptide lacks a disulfide group, one may be provided by the addition of a cysteine residue Alternatively, coupling may
  • antigenic peptides selected from the present proteins and polypeptides will range without limitation, from 5 to about 100 amino acids in length. More typically, however, such an antigenic peptide will be a maximum of about 50 amino acids in length, and preferably a maximum of about 30 amino acids. It is usually desirable to select a sequence of about 6, 8, 10, 12 or 15 amino acids, up to about 20 or 25 amino acids (and any number therebetween). Amino acid sequences comprising useful epitopes may be identified in a number of ways.
  • preparing a series of short peptides that taken together span the entire protein sequence may be used to screen the entire protein sequence.
  • One of skill in the art may routinely test a few large polypeptides for the presence of an epitope showing a desired reactivity and also test progressively smaller and overlapping fragments to identify a preferred epitope with the desired specificity and reactivity.
  • antigenic polypeptides and peptides are useful for the production of monoclonal and polyclonal antibodies.
  • Antibodies to a polypeptide encoded by the polynucleotides of NSEQ, polypeptide analogs or portions thereof may be generated using methods that are well known in the art
  • monoclonal antibodies may be prepared using any technique that provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma, the human B-cell hybridoma, and the EBV- hybridoma techniques.
  • techniques developed for the production of chimeric antibodies may be used.
  • techniques described for the production of single chain antibodies may be employed.
  • Fabs that may contain specific binding sites for a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof, may also be generated.
  • Various immunoassays may be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art.
  • polyclonal antibodies a selected animal may be immunized with a protein or polypeptide Serum from the animal may be collected and treated according to known procedures Polyclonal antibodies to the protein or polypeptide of interest may then be purified by affinity chromatography Techniques for producing polyclonal antisera are well known in the art.
  • Monoclonal antibodies may be made by one of several procedures available to one of skill in the art, for example, by fusing antibody producing cells with immortalized cells and thereby making a hybridoma
  • the general methodology for fusion of antibody producing B cells to an immortal cell line is well within the province of one skilled in the art
  • Another example is the generation of MAbs from mRNA extracted from bone marrow and spleen cells of immunized animals using combinatorial antibody library technology
  • MAbs derived from animals or from derived cell lines are that although they may be administered to a patient for diagnostic or therapeutic purposes they are often recognized as foreign antigens by the immune system and are unsuitable for continued use Antibodies that are not recognized as foreign antigens by the human immune system have greater potential for both diagnosis and treatment Methods for generating human and humanized antibodies are now well known in the art Chimeric antibodies may be constructed in which regions of a non-human
  • a preferred chimeric antibody is one that has amino acid sequences that comprise one or more complementarity determining regions (CDRs) of a non-human Mab that binds to a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof grafted to human framework (FW) regions
  • CDRs complementarity determining regions
  • FW human framework
  • grafting of one or more non-human CDRs onto a human antibody may also involve the substitution of amino acid residues which are adjacent to a particular CDR sequence or which are not contiguous with the CDR sequence but which are packed against the CDR in the overall antibody variable domain structure and which affect the conformation of the CDR
  • Humanized antibodies of the invention therefore include human antibodies which comprise one or more non-human CDRs as well as such antibodies in which additional substitutions or replacements have been made to preserve or enhance binding characteristics
  • Chimeric antibodies of the invention also include antibodies that have been humanized by replacing surface-exposed residues to make the MAb appear human Because the internal packing of amino acid residues in the vicinity of the antigen- binding site remains unchanged, affinity is preserved Substitution of surface-exposed residues of a polypeptide encoded by the polynucleotides of NSEQ (or a portion thereof)-ant ⁇ body according to the invention for the purpose of humanization does not mean substitution of CDR residues or adjacent residues that influence affinity for a polypeptide encoded by the polynucleotides of NSEQ or a portion thereof
  • Chimeric antibodies may also include antibodies where some or all non-human constant domains have been replaced with human counterparts This approach has the advantage that the antigen-binding site remains unaffected However, significant amounts of non-human sequences may be present where variable domains are derived entirely from non-human antibodies
  • Antibodies of the invention include human antibodies that are antibodies consisting essentially of human sequences
  • Human antibodies may be obtained from phage display libraries wherein combinations of human heavy and light chain variable domains are displayed on the surface of filamentous phage Combinations of variable domains are typically displayed on filamentous phage in the form of Fab's or scFvs
  • the library may be screened for phage bearing combinations of variable domains having desired antigen-binding characteristics
  • Preferred variable domain combinations are characterized by high affinity for a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof
  • Preferred variable domain combinations may also be characterized by high specificity for a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof and little cross-reactivity to other related antigens
  • human antibodies may be obtained from transgenic animals into which un-rearranged human Ig gene segments have been introduced and in which the endogenous mouse Ig genes have been inactivated
  • Preferred transgenic animals contain very large contiguous Ig gene fragments that are over 1 Mb in size but human polypeptide-specific Mabs of moderate affinity may be raised from transgenic animals containing smaller gene loci
  • Transgenic animals capable of expressing only human Ig genes may also be used to raise polyclonal antiserum comprising antibodies solely of human origin
  • Antibodies of the invention may include those for which binding characteristics have been improved by direct mutation or by methods of affinity maturation Affinity and specificity may be modified or improved by mutating CDRs and screening for antigen binding sites having the desired characteristics
  • CDRs may be mutated in a variety of ways One way is to randomize individual residues or combinations of residues so that in a population of otherwise identical antigen binding sites, all twenty amino acids may be found at particular positions Alternatively, mutations may be induced over a range of CDR residues by error prone PCR methods Phage display vectors containing heavy and light chain variable region gene may be propagated in mutator strains of E coli These methods of mutagenesis are illustrative of the many methods known to one of skill in the art
  • the antibody may further comprise a detectable label (reporter molecule) attached thereto
  • the method may comprise a) immunizing a mammal (e g , mouse, a transgenic mammal capable of producing human Ig, etc ) with a suitable amount of a PSEQ described herein including, for example, a polypeptide fragment comprising at least 6 (e g , 8, 10, 12 etc ) consecutive amino acids of a PSEQ, b) collecting the serum from the mammal, and c) isolating the polypeptide-specific antibodies from the serum of the mammal
  • the method may further comprise the step of administering a second dose to the mammal (e g animal)
  • the method may comprise a) immunizing a mammal (e g , mouse, a transgenic mammal capable of producing human Ig, etc ) with a suitable amount of a PSEQ thereof, b) obtaining lymphoid cells from the immunized animal obtained from (a), c) fusing the lymphoid cells with an immortalizing cell to produce hybrid cells, and d) selecting hybrid cells which produce antibody that specifically binds to a PSEQ thereof
  • Also encompassed by the present invention is a method of producing an antibody that specifically binds to one of the polypeptide described herein, the method may comprise a) synthesizing a library of antibodies (e g , antigen binding fragment) on phage or ⁇ bosomes, b) panning the library against a sample by bringing the phage or ribosomes into contact with a composition comprising a polypeptide or polypeptide fragment described herein, c) isolating phage which binds to the polypeptide or polypeptide fragment, and, d) obtaining an antibody from the phage or ribosomes
  • a library of antibodies e g , antigen binding fragment
  • the antibody of the present invention may thus be obtained for example from a library (e g , bacteriophage library) which may be prepared for example, by a) extracting cells which are responsible for production of antibodies from a host mammal, b) isolating RNA from the cells of (a), c) reverse transcribing mRNA to produce cDNA, d) amplifying the cDNA using a (antibody-specific) primer, and e) inserting the cDNA of (d) into a phage display vector or ribosome display cassette such that antibodies are expressed on the phage or ribosomes
  • a library e g , bacteriophage library
  • the host animal may be immunized with polypeptide and/or a polypeptide fragment and/or analog described herein to induce an immune response prior to extracting the cells which are responsible for production of antibodies
  • the antibodies obtained by the means described herein may be useful for detecting proteins, variant and derivative polypeptides in specific tissues or in body fluids Moreover, detection of aberrantly expressed proteins or protein fragments is probative of a disease state
  • expression of the present polypeptides encoded by the polynucleotides of NSEQ, or a portion thereof may indicate that the protein is being expressed at an inappropriate rate or at an inappropriate developmental stage
  • the present antibodies may be useful for detecting diseases associated with protein expression from NSEQs disclosed herein
  • antibodies may be those which preferably recognize an epitope present at the surface of a tumor cell
  • Standard values for polypeptide expression are established by combining samples taken from healthy subjects, preferably human, with antibody to the polypeptide under conditions for complex formation The amount of complex formation may be quantified by various methods, such as photometric means Quantities of polypeptide expressed in disease samples may be compared with standard values Deviation between standard and subject values may establish the parameters for diagnosing or monitoring disease
  • Immunoassays may use a monoclonal or polyclonal antibody reagent that is directed against one epitope of the antigen being assayed Alternatively, a combination of monoclonal or polyclonal antibodies may be used which are directed against more than one epitope Protocols may be based, for example, upon competition where one may use competitive drug screening assays in which neutralizing antibodies capable of binding a polypeptide encoded by the polynucleotides of NSEQ, or a portion thereof, specifically compete with a test compound for binding the polypeptide Alternatively one may use, direct antigen- antibody reactions or sandwich type assays and protocols may, for example, make use of solid supports or immunoprecipitation Furthermore, antibodies may be labelled with a reporter molecule for easy detection Assays that amplify the signal from a bound reagent are also known Examples include immunoassays that utilize avidin and biotin,
  • Kits suitable for immunodiagnosis and containing the appropriate labelled reagents include antibodies directed against the polypeptide protein epitopes or antigenic regions, packaged appropriately with the remaining reagents and materials required for the conduct of the assay as well as a suitable set of assay instructions
  • the present invention therefore provides a kit for specifically detecting a polypeptide described herein, the kit may comprise for example an antibody or antibody fragment capable of binding specifically to the polypeptide described herein
  • the kit may be a diagnostic kit, which may comprise a) one or more antibodies described herein, and b) a detection reagent which may comprise a reporter group
  • the antibodies may be immobilized on a solid support
  • the detection reagent may comprise, for example, an antiimmunoglobulin, protein G, protein A or lectin etc
  • the reporter group may be selected, without limitation, from the group consisting of radioisotopes fluorescent groups, luminescent groups, enzymes biotin and dye particles
  • NSEQ NSEQ
  • PSEQ a Therapeutic or Therapeutic targets
  • NSEQ, PSEQ, expression systems, assays, kits and array discussed above may also be used to evaluate the efficacy of a particular therapeutic treatment regimen, in animal studies, in clinical trials, or to monitor the treatment of an individual subject
  • hybridization or amplification assays may be repeated on a regular basis to determine if the level of mRNA or protein in the patient (patient's blood tissue, cell etc ) begins to approximate the level observed in a healthy subject
  • results obtained from successive assays may be used to show the efficacy of treatment over a period ranging from several days to many years
  • NSEQ may be used therapeutically for the purpose of expressing mRNA and polypeptide or conversely to block transcription and/or translation of the mRNA
  • Expression vectors may be constructed using elements from retroviruses, adenoviruses, herpes or vaccinia viruses, or bacterial plasmids, and the like These vectors may be used for delivery of nucleotide sequences to a particular target organ, tissue, or cell population Methods well known to those skilled in the art may be used to construct vectors to express nucleic acid sequences or their complements
  • NSEQ may be used for somatic cell or stem cell gene therapy
  • Vectors may be introduced in vivo, in vitro, and ex vivo
  • vectors are introduced into stem cells taken from the subject, and the resulting transgenic cells are clonally propagated for autologous transplant back into that same subject
  • Delivery of NSEQ by transfection, liposome injections, or polycationic ammo polymers may be achieved using methods that are well known in the art
  • endogenous NSEQ expression may be inactivated using homologous recombination methods that insert an inactive gene sequence into the coding region or other targeted region of NSEQ
  • vectors containing NSEQ may be introduced into a cell or tissue to express a missing polypeptide or to replace a non- functional polypeptide
  • a NSEQ able to encode such PSEQ for that purpose or may directly administer PSEQ to that cell or tissue
  • NSEQ e g , an inhibitory NSEQ
  • NSEQ an inhibitory NSEQ
  • inhibitory NSEQ may be done by cloning the inhibitory NSEQ into a vector and introducing the vector into a cell to down-regulate the expression of a polypeptide encoded by the target NSEQ
  • Complementary or anti- sense sequences may also comprise an oligonucleotide derived from the transcription initiation site, nucleotides between about positions -10 and +10 from the ATG may be used Therefore, inhibitory NSEQ may encompass a portion which is substantially complementary to a desired nucleic acid molecule to be inhibited and a portion (sequence) which binds to an untranslated portion of the nucleic acid Similarly, inhibition may be achieved using triple helix base-pairing methodology Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules Recent therapeutic advances using triplex DNA have been described in the literature (See, e g , Gee et al 1994) Ribozymes
  • RNA molecules may be modified to increase intracellular stability and half-life Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2' O-methyl rather than phosphodiester linkages within the backbone of the molecule Alternatively, nontraditional bases such as inosine, queosme, and wybutosme, as well as acetyl-, methyl-, thio-, and similarly modified forms of adenine, cytidine, guanine, thymine, and uridine which are not as easily recognized by endogenous endonucleases, may be included
  • compositions are also encompassed by the present invention
  • the pharmaceutical composition may comprise at least one NSEQ or PSEQ and a pharmaceutically acceptable carrier
  • NSEQ and/or PSEQ in tumor cells may advantageously be used for inducing an immune response (through their administration) in an individual having, or suspected of having a tumor expressing such sequence
  • Administration of NSEQ and/or PSEQ in individuals at risk of developping a tumor expressing such sequence is also encompassed herewith
  • a pharmaceutical composition may contain pharmaceutically acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations that may be used pharmaceutically
  • the therapeutically effective dose may be estimated initially either in cell culture assays or in animal models such as mice, rats, rabbits, dogs, or pigs An animal model may also be used to determine the concentration range and route of administration Such information may then be used to determine useful doses and routes for administration in humans
  • a therapeutically effective dose refers to that amount of active ingredient that ameliorates the symptoms or condition
  • Therapeutic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or with experimental animals, such as by calculating and contrasting the ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population) statistics
  • Any of the therapeutic compositions described above may be applied to any subject in need of such therapy, including, but not limited to, mammals such as dogs, cats cows, horses, rabbits monkeys and most preferably, humans
  • the pharmaceutical compositions utilized in this invention may be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intra
  • treatment refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the targeted pathologic condition or disorder
  • Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented
  • the invention also provides products, compositions processes and methods that utilize a NSEQ described herein, a polypeptide encoded by a NSEQ described herein, a PSEQ described herein for research, biological, clinical and therapeutic purposes
  • NSEQ may be extended utilizing a partial nucleotide sequence and employing various PCR-based methods known in the art to detect upstream sequences such as promoters and other regulatory elements
  • an XL-PCR kit PE Biosystems, Foster City Calif
  • nested primers and commercially available cDNA libraries (Life Technologies, Rockville Md ) or genomic libraries (Clontech, Palo Alto Calif ) to extend the sequence
  • the polynucleotides may also be used as targets in a microarray
  • the microarray may be used to monitor the expression patterns of large numbers of genes simultaneously and to identify splice variants, mutations and polymorphisms Information derived from analyses of the expression patterns may be used to determine gene function, to identify a particular cell, cell type or tissue, to understand the genetic basis of a disease, to diagnose a disease, and to develop and monitor the activities of therapeutic agents used to treat a disease
  • Microarrays may also be used to detect genetic diversity, single nucleotide polymorphisms which may characterize a particular population, at the genomic level
  • the polynucleotides (NSEQ) may also be used to generate hybridization probes useful in mapping the naturally occurring genomic sequence Fluorescent in situ hybridization (FISH) may be correlated with other physical chromosome mapping techniques and genetic map data
  • a sequence which is upregulated in an ovarian cancer cell may represent a sequence which is involved in or responsible for the growth, development, maligancy and so on of the cancer cell (referred herein as a positive regulator of ovarian cancer)
  • a sequence which is downregulated (unexpressed or expressed at low levels) in a malignant ovarian cancer cell may represent a sequence which is responsible for the maintenance of the normal status (untransformed) of an ovarian cell (referred herein as a negative regulator of ovarian cancer) Therefore, both the presence or absence of some sequences may be indicative of the disease or may be indicative of the disease, probability of having a disease, degree of severity of the disease (staging) Therefore, the present invention relates in an aspect thereof to an isolated polynucleotide (e g , exogenous form of) which may comprise a member selected from the group consisting of, a) a polynucleotide which may
  • the present invention relates to expressed polynucleotides which are selected from the group consisting of, a) a polynucleotide which may comprise or consist of any one of SEQ ID NO: 1
  • SEQ ID NO 1 SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 19, SEQ ID NO 20 SEQ ID NO 22, SEQ ID NO 28 SEQ ID NO 37 SEQ ID NO 41 , SEQ ID NO 45 SEQ ID NO 46 SEQ ID NO 47 and SEQ ID NO 49 and even more specifically those which are selected from the group consisting of SEQ ID NO 14, SEQ ID NO 19, SEQ ID NO 22,
  • SEQ ID NO 37 SEQ ID NO 41 , SEQ ID NO 45, SEQ ID NO 46 and SEQ ID NO 49, b) a polynucleotide which may comprise the open reading frame of any one of SEQ ID NO 1 , SEQ ID NO 14, SEQ ID NO 16, SEQ ID NO 19, SEQ ID NO 20, SEQ ID NO 22, SEQ ID NO 28, SEQ ID NO
  • SEQ ID NO 22 SEQ ID NO 37, SEQ ID NO 41 , SEQ ID NO 45, SEQ ID NO 46 and SEQ ID NO 49, which may be, for example, free of untranslated or untranslatable port ⁇ on(s), d) a polynucleotide which may comprise a translated or translatable portion of any one of SEQ ID NO 1 SEQ ID NO 14 SEQ ID NO 16
  • SEQ ID NO 19 SEQ ID NO 20, SEQ ID NO 22 SEQ ID NO 28 SEQ ID NO 37, SEQ ID NO 41 SEQ ID NO 45, SEQ ID NO 46 SEQ ID NO 47 and SEQ ID NO 49 and even more specifically those which are selected from the group consisting of SEQ ID NO 14, SEQ ID NO 19, SEQ ID NO 22, SEQ ID NO 37, SEQ ID NO 41 , SEQ ID NO 45,
  • SEQ ID NO 46 and SEQ ID NO 49 (e g , coding portion), e) a polynucleotide which may comprise a sequence substantially identical (e g , from about 50 to 100%, or about 60 to 100% or about 70 to 100% or about 80 to 100% or about 85, 90, 95 to 100% identical over the entire sequence or portion of sequences) to a), b), c), or d), f) a polynucleotide which may comprise a sequence substantially complementary (e g , from about 50 to 100%, or about 60 to 100% or about 70 to 100% or about 80 to 100% or about 85, 90, 95 to 100% complementarity over the entire sequence or portion of sequences) to a), b), c), or d) and, g) a fragment of any one of a) to f) including polynucleotides which consist in the above
  • Vectors (e g , a viral vector, a mammalian vector, a plasmid, a cosmid, etc ) which may comprise the polynucleotides described herein are also encompassed by the present invention
  • the vector may be, for example, an expression vector
  • the present invention also provides a library of polynucleotide comprising at least one polynucleotide (e.g., at least two, etc.) described herein (may include SEQ ID NO.:50)
  • the library may be, for example, an expression library Some or all of the polynucleotides described herein may be contained within an expression vector
  • the present invention also relates to a polypeptide library which may comprise at least one (e.g., at least two, etc.) polypeptide as described herein.
  • the present invention provides arrays which may comprise at least one polynucleotide (e.g., at least two, etc.) described herein.
  • the present invention also provides an isolated cell (e.g., an isolated live cell such as an isolated mammalian cell, a bacterial cell, a yeast cell, an insect cell, etc.) which may comprise the polynucleotide, the vector or the polypeptide described herein.
  • an isolated cell e.g., an isolated live cell such as an isolated mammalian cell, a bacterial cell, a yeast cell, an insect cell, etc.
  • the present invention relates to a composition comprising the polynucleotide and/or polypeptide described herein.
  • the composition may be, for example, a pharmaceutical composition which may comprise a polynucleotide and/or a polypeptide described herein and a pharmaceutically acceptable carrier. More specifically, the pharmaceutical composition may be used for the treatment of ovarian cancer and/or for inhibiting the growth of an ovarian cancer cell
  • Polynucleotides fragments of those listed above includes polynucleotides comprising at least 10 nucleic acids which may be identical to a corresponding portion of any one of a) to e) and more particularly a coding portion of any one of SEQ ID NO..1 to 49, 50 or 169.
  • polynucleotide fragments encompassed by the present invention includes polynucleotides comprising at least 10 nucleic acids which may be substantially complementary to a corresponding portion of a coding portion of any one of SEQ ID NO.:1 to 49, 50 or 169 and encompasses, for example, fragments selected from the group consisting of any one of SEQ ID NO.: 103 to 150.
  • sequences may represent powerful markers of cancer and more particularly of, ovarian cancer, breast cancer, prostate cancer, leukemia, melanoma, renal cancer, colon cancer, lung cancer, cancer of the central nervous system and any combination thereof.
  • sequences which are specifically expressed in a certain types of cancer cell may be used for developing tools for the detection of this specific type of cancer cell and may also be used as targets in the development of anticancer drugs
  • a positive signal may be in the form of a band in a gel following electrophoresis, Northern blot or Western blot a PCR fragment detected by emission of fluorescence, etc
  • sequences which are particularly useful for the development of tools for the detection of cancer cell may preferably be expressed at lower levels in at least some normal cells (non-cancerous cells)
  • normal cells non-cancerous cells
  • the appearance of a band upon RT-PCR amplification of mRNAs obtained from ovarian cancer cells, renal cancer cells, lung cancer cells, breast cancer cells and melanoma cells indicates that SEQ ID NO 1 is expressed in such cancer cells and that SEQ ID NO 1 may therefore represent a valid marker and target for these types of cancer cells
  • NSEQs chosen among those which are substantially complementary to those listed in Table 2, or to fragments of those of Table 2, may be used for the treatment of cancer
  • the present invention therefore relates to a method for identifying a cancer cell
  • the method may comprise contacting a cell, a cell sample (cell lysate), a body fluid (blood, urine, plasma, saliva etc ) or a tissue with a reagent which may be, for example, capable of specifically binding at least one NSEQ or PSEQ described herein
  • the method may more particularly comprise contacting a sequence isolated or derived such cell, sample, fluid or tissue
  • the complex formed may be detected using methods known in the art.
  • the presence of the above mentioned complex may be indicative (a positive indication of the presence) of the presence of a cancer cell
  • the present invention also relates in an additional aspect thereof to a method for the diagnosis or prognosis of cancer
  • the method may comprise, for example, detecting, in a cell, tissue, sample, body fluid, etc , at least one NSEQ or PSEQ described herein
  • the cell, cell sample, body fluid or tissue may originate, for example from an individual which has or is suspected of having a cancer and more particularly ovarian cancer, breast cancer, prostate cancer, leukemia, melanoma, renal cancer, colon cancer, lung cancer and/or cancer of the central nervous system Any of the above mentioned methods may further comprise comparing the level obtained with at least one reference level or value Detection of NSEQ may require an amplification (e g , PCR) step in order to have sufficient material for detection purposes
  • the polynucleotide described herein may comprise, for example, a RNA molecule a DNA molecule, including those which are partial or complete, single-stranded or double-stranded, hybrids modified by a group etc
  • NSEQ or PSEQ described herein comprises the use of at least one NSEQ or PSEQ described herein and derived antibodies in the manufacture of a composition for identification or detection of a cancer cell (e g , a tumor cell) or for inhibiting or lowering the growth of cancer cell (e g , for treatment of ovarian cancer or other cancer)
  • NSEQ and PSEQ are expressed at higher levels in malignant ovarian cancer than in LMP detection of such NSEQ or PSEQ in a sample from an individual (or in vivo) one may rule-out a low malignant potential ovarian cancer and may therefore conclude in a diagnostic of a malignant ovarian cancer
  • detection of the NSEQ or PSEQ in a cell, tissue, sample or body fluid from an individual may also be indicative of a late-stage malignant ovarian cancer
  • therapies adapted for the treatment of a malignant ovarian cancer or a late-stage malignant ovarian cancer may be commenced
  • the method may also comprise a step of qualitatively or quantitatively comparing the level (amount, presence) of at least one complex present in the test cell, test sample, test fluid or test tissue with the level of complex in a normal cell, a normal cell sample, a normal body fluid, a normal tissue or a reference value (e g , for a non-cancerous condition)
  • the normal cell may be any cell which does not substantially express the desired sequence to be detected Examples of such normal cells are included for example, in the description of the drawings section
  • a normal cell sample or tissue thus include, for example, a normal (non-cancerous) ovarian cell, a normal breast cell, a normal prostate cell, a normal lymphocyte, a normal skin cell, a normal renal cell, a normal colon cell, a normal lung cell and/or a normal cell of the central nervous system
  • a normal cell may be chosen from those of identical or similar cell type
  • the presence of more than one complex may be performed in order to increase the precision of the diagnostic method
  • at least two complexes e g , formed by a first reagent and a first polynucleotide and a second reagent or a second polynucleotide
  • NSEQ described herein is a polynucleotide which may comprise a sequence substantially complementary to the NSEQ
  • a suitable reference level or value may be, for example, derived from the level of expression of a specified sequence in a low malignant potential ovarian cancer and/or from a normal cell
  • the higher level measured in an ovarian cell, ovarian tissue or a sample of ovarian origin compared to a reference level or value for a normal cell may be indicative of an ovarian cancer
  • the presence or level of expression of a desired NSEQ or PSEQ to be detected or identified may be compared with the presence, level of expression, found in a normal cell which has been shown herein not to express the desired sequence
  • the invention therefore provides polynucleotides which may be able to lower or inhibit the growth of an ovarian cancer cell (e g , in a mammal or mammalian cell thereof)
  • the present invention therefore relates in a further aspect to the use of a polynucleotide sequence which may be selected from the group consisting of a) a polynucleotide which may comprise a sequence substantially complementary to any of SEQ ID NO 1 to SEQ ID NO 49, 50 or 169 b) a polynucleotide which may comprise a sequence substantially complementary to a transcribed or transcribable portion of any one of SEQ
  • polynucleotide which may comprise a sequence substantially complementary to a translated or translatable portion of any one of SEQ ID NOs 1 to 49, 50 or 169, and, d) a fragment of any one of a) to c) for reducing, lowering or inhibiting the growth of a cancer cell
  • the polynucleotide may be selected, for example from the group consisting of polynucleotides which may comprise a sequence of at least 10 nucleotides which is complementary to the nucleic acid sequence of any one of SEQ ID NO 1 to 49, 50 and 169 (to a translated portion which may be free, for example, of untranslated portions)
  • the present invention encompasses immunizing an individual by administering a NSEQ (e g , in an expression vector) or a PSEQ
  • the present invention also relates to a method of reducing or slowing the growth of an ovarian cancer cell in an individual in need thereof
  • the method may comprise administering to the individual a polynucleotide sequence which may be selected from the group consisting of a) a polynucleotide which may comprise a sequence substantially complementary (also including 100% complementary over a portion e g a perfect match) to any of SEQ ID NO 1 to SEQ ID NO 49 and 169 or 50 b) a polynucleotide which may comprise a sequence substantially complementary (also including 100% complementary over a portion, e g a perfect match) to a transcribed or transcribable portion of any one of SEQ ID NOs 1 to 49 and 169 or 50, c) a polynucleotide which may comprise a sequence substantially complementary (also including 100% complementary over a portion, e g , a perfect match) to a translated or translatable portion of any one of SEQ ID NOs 1 to 49 and 169 or
  • the present invention therefore provides in yet another aspect thereof, a siRNA or shRNA molecule that is able to lower the expression of a nucleic acid selected from the group consisting of a) a polynucleotide which may comprise any one of SEQ ID NO 1 to SEQ ID NO 49 and SEQ ID NO 169 or SEQ ID NO 50, b) a polynucleotide which may comprise a transcribed or transcribable portion of any one of SEQ ID NOs 1 to 49 and 169, or SEQ ID NO 50, c) a polynucleotide which may comprise a translated or translatable portion of any one of SEQ ID NOs 1 to 49 and 169 or SEQ ID NO 50, and, d) a polynucleotide which may comprise a sequence substantially identical to a), b), or c) Exemplary embodiment of polynucleotides are those which, for example, may be able to inhibit the growth of an ovarian cancer cell, such as, for example, a
  • the present invention also provides a kit for the diagnosis of cancer
  • the kit may comprise at least one polynucleotide as described herein and/or a reagent capable of specifically binding at least one polynucleotide described herein
  • the present invention relates to an isolated polypeptide encoded by the polynucleotide described herein
  • the present invention more particularly provides an isolated polypeptide which may be selected from the group consisting of a) a polypeptide which may comprise any one of SEQ ID NO 51 to 88 and 170 b) a polypeptide which may be encoded by any one of the polynucleotide described herein, c) a fragment of any one of a) or b) d) a derivative of any one of a) or b) and, e) an analog of any one of a) or b)
  • the analog may comprise, for example, at least one amino acid substitution, deletion or insertion in its amino acid sequence
  • the substitution may be conservative or non-conservative
  • the polypeptide analog may be a biologically active analog or an immunogenic analog which may comprise, for example, at least one amino acid substitution (conservative or non conservative), for example, 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 50 etc (including any number there between) compared to the original sequence
  • An immunogenic analog may comprise, for example, at least one amino acid substitution compared to the original sequence and may still be bound by an antibody specific for the original sequence
  • a polypeptide fragment may comprise, for example, at least 6 consecutive amino acids, at least 8 consecutive amino acids or more of an ammo acid sequence selected from the group consisting of polypeptides encoded by a polynucleotide selected from the group consisting of SEQ
  • the fragment may be immunogenic and may be used for the purpose, for example, of generating antibodies
  • Exemplary embodiments of polypeptide encompassed by the present invention are those which may be encoded by any one of SEQ ID NO 1-49 and 169, more particularly those encoded by any one of SEQ ID NO 1 , 14, 16, 19, 20, 22, 28 37, 41 , 45, 46, 47 or 49 and even more particularly those encoded by any one of SEQ ID NO 14, 19, 22, 37, 41 , 45, 46 or 49
  • the present invention relates to a polypeptide which may be encoded by the isolated differentially expressed sequence of the present invention
  • the present invention as well relates to the polypeptide encoded by the non-human ortholog polynucleotide, analogs, derivatives and fragments thereof
  • the first possible open-reading frame may start at the first nucleotide (5'-3') of the sequence, therefore using in a 5' to 3' direction nucleotides No 1 to 3 as the first codon, using nucleotides 4 to 6 as the second codon, etc
  • the second possible open-reading frame may start at the second nucleotide (5'-3') of the sequence, therefore using in a 5' to 3' direction nucleotides No 2 to 4 as the first codon using nucleotides 5 to 7 as the second codon, etc
  • the third possible open-reading frame may start at the third nucleotide (5'-3') of the sequence, therefore using in a 5' to 3' direction nucleotides No 3 to 5 as the first codon, using nucleotides 6 to 8 as the second codon etc
  • the fourth possible open-reading frame may start at the third nucleotide (5'-3') of the sequence, therefore using in a 5' to 3' direction nucleotides No 3 to 5
  • the present invention relates to the use of at least one polypeptide in the manufacture of a composition for the identification or detection of a cancer cell (tumor cell)
  • the polypeptide may be used, for example as a standard in an assay and/or for detecting antibodies specific for the particular polypeptide, etc
  • the present invention relates to the use of at least one polypeptide described herein in the identification or detection of a cancer cell, such as for example, an ovarian cancer cell or any other cancer cell as described herein
  • the present invention therefore relates in a further aspect, to the use of at least one polypeptide described herein in the prognosis or diagnosis of cancer, such as, for example, a malignant ovarian cancer or a low malignant potential ovarian cancer
  • detection of the polypeptide in a cell (e g ovarian cell) tissue (e g ovarian tissue) sample or body fluid from an individual may preferentially be indicative of a malignant ovarian cancer diagnosis
  • the presence of the polypeptide in a cell, tissue, sample or body fluid from an individual may preferentially be indicative of a late-stage malignant ovarian cancer
  • methods for identifying a cancer cell which may comprise, for example, contacting a test cell, a test cell sample (cell lysate), a test body fluid (blood, urine, plasma, saliva etc ) or a test tissue with a reagent which may be capable of specifically binding the polypeptide described herein, and detecting the complex formed by the polypeptide and reagent
  • a cancer cell such as for example, an ovarian cancer cell a breast cancer cell a prostate cancer cell leukemia melanoma a renal cancer cell a colon cancer cell a lung cancer cell a cancer cell of the central nervous system and any combination thereof
  • the presence of a complex formed by the polypeptide and the specific reagent may be indicative, for example, of ovarian cancer including, for example, a low malignant potential ovarian cancer or a malignant ovarian cancer
  • the method is more particularly powerful for the detection of ovarian cancer of the malignant type Therefore, the presence of a complex may preferentially be indicative of a malignant ovarian cancer relative (rather than) to a low malignant potential ovarian cancer Detection of the complex may also be indicative of a late stage malignant ovarian cancer
  • the method may also comprise a step of qualitatively or quantitatively comparing the level (amount presence) of at least one complex present in a test cell a test sample a test fluid or a test tissue with the level of complex in a normal cell a normal cell sample a normal body fluid a normal tissue or a reference value (e g , for a non-cancerous condition)
  • a reference value e g , for a non-cancerous condition
  • the presence of more than one polypeptide or complex may be determined, e g , one formed by a first specific reagent and a first polypeptide and another formed by a second specific reagent and a second polypeptide may be detected Detection of more than one polypeptide or complex may help in the determination of the tumorigenicity of the cell
  • An exemplary embodiment of a reagent which may be used for the detection of the polypeptide described herein, is an antibody and antibody fragment thereof
  • the present invention also relates to a kit which may comprise at least one of the polypeptide described herein and/or a reagent capable of specifically binding to at least one of the polypeptide described herein
  • compositions which comprises a polypeptide may be used, for example, for generating antibodies against the particular polypeptide, may be used as a reference for assays and kits, etc
  • Additional aspects of the invention relates to isolated or purified antibodies (including an antigen-binding fragment thereof) which may be capable of specifically binding to a polypeptide selected from the group consisting of, a) a polypeptide comprising or consisting of any one of SEQ ID NO 51 to 89 or 170, and, b) a polypeptide comprising a polypeptide sequence encoded by any one of the polynucleotide sequence described herein (e g , a fragment of at least 6 amino acids of the polypeptide)
  • exemplary embodiments of the present invention relates to antibodies which may be capable of specifically binding a polypeptide comprising a polypeptide sequence encoded by any one of SEQ ID NO 1 , 14, 16, 19, 20, 22, 28, 37, 41 , 45, 46, 47 or 49, or a fragment of at least 6 ammo acids of the polypeptide
  • the present invention relates to antibodies which may be capable of specifically binding a polypeptide comprising a polypeptide sequence encoded by any one of SEQ ID NO 14, 19, 22, 37, 41 , 45, 46 or 49, or a fragment of at least 6 amino acids of the polypeptide
  • the present invention relates to a hybridoma cell which is capable of producing an antibody which may specifically bind to a polypeptide selected from the group consisting of , a) a polypeptide which may comprise any one of SEQ ID NO 51 to 88, 89 and 170, and, b) a polypeptide which may comprise a polypeptide sequence encoded by any one of the polynucleotide sequence described herein or a fragment of at least 6 amino acids of the polypeptide
  • Exemplary hyb ⁇ doma which are more particularly encompassed by the present invention are those which may produce an antibody which may be capable of specifically binding a polypeptide comprising a polypeptide sequence encoded by any one of SEQ ID NO 1 , 14, 16, 19, 20, 22, 28, 37, 41 , 45, 46, 47 or 49 or a fragment of at least 6 amino acids of the polypeptide
  • Exemplary embodiments of hybridoma which are even more particularly encompassed by the present invention are those which may produce an antibody which is capable of specifically binding a polypeptide comprising a polypeptide sequence encoded by any one of SEQ ID NO 14, 19, 22, 37, 41 , 45, 46 or 49 or a fragment of at least 6 amino acids of the polypeptide
  • the present invention also relates to a composition which may comprise an antibody described herein
  • the present invention provides a method of making an antibody which may comprise immunizing a non-human animal with an immunogenic fragment (at least 6 amino acids, at least 8 amino acids, etc ) of a polypeptide which may be selected, for example, from the group consisting of , a) a polypeptide which may comprise or consist in any one of SEQ ID NO:
  • polypeptide which may comprise a polypeptide sequence encoded by any one of the polynucleotide sequence described herein or a portion thereof
  • Exemplary polypeptides which may more particularly be used for generating antibodies are those which are encoded by any one of SEQ ID NO 1 , 14, 16, 19, 20, 22, 28, 37, 41 , 45, 46, 47 or 49 (and polypeptide comprising a polypeptide fragment of these particular PSEQ)
  • Even more particular polypeptides encompassed by the present invention are those which are encoded by any one of SEQ ID NO 14, 19, 22, 37, 41 , 45, 46 or 49
  • the present invention relates to a method of identifying a compound which is capable of inhibiting the activity or function of a polypeptide which may be selected, for example from the group consisting of any one of SEQ ID NO 51 to 88 and 170 or a polypeptide comprising a polypeptide sequence encoded by any one of SEQ ID NO 1 to 49 and 169 (e g , a transcribed portion, a translated portion, a fragment, substantially identical and even substantially complementary sequences)
  • the method may comprise contacting the polypeptide with a putative compound an isolating or identifying a compound which is capable of specifically binding any one of the above mentioned polypeptide
  • the compound may originate from a combinatorial library
  • the method may also further comprise determining whether the activity or function of the polypeptide (e g , such as a function indicated at Table 2) is affected by the binding of the compound Those compounds which capable of binding to the polypeptide and which and/or which are capable of altering the function or activity of the polypeptide represents a
  • the present invention also relates to an assay and method for identifying a nucleic acid sequence and/or protein involved in the growth or development of ovarian cancer
  • the assay and method may comprise silencing an endogenous gene of a cancer cell such as an ovarian cancer cell and providing the cell with a candidate nucleic acid (or protein)
  • a candidate gene (or protein) positively involved in inducing cancer cell death (e g , apoptosis) (e g , ovarian cancer cell ) may be identified by its ability to complement the silenced endogenous gene
  • a candidate nucleic acid involved in ovarian cancer provided to a cell for which an endogenous gene has been silenced, may enable the cell to undergo apoptosis more so in the presence of an inducer of apoptosis
  • an assay or method may comprise silencing an endogenous gene (gene expression) corresponding to the candidate nucleic acid or protein sequence to be evaluated and determining the effect of the candidate nucleic acid or protein on cancer growth (e g , ovarian cancer cell growth)
  • cancer growth e g , ovarian cancer cell growth
  • a sequence involved in the promotion or inhibition of cancer growth, development or malignancy may change the viability of the cell, may change the ability of the cell to grow or to form colonies etc
  • the activity of a polypeptide may be impaired by targeting such polypeptide with an antibody molecule or any other type of compound Again, such compound may be identified by screening combinatorial libraries, phage libraries, etc
  • the present invention also provides a method for identifying an inhibitory compound (inhibitor, antagonist) able to impair the function (activity) or expression of a polypeptide described herein
  • the method may comprise, for example, contacting the (substantially purified or isolated) polypeptide or a cell expressing the polypeptide with a candidate compound and measuring the function (activity) or expression of the polypeptide A reduction in the function or activity of the polypeptide (compared to the absence of the candidate compound) may thus positively identify a suitable inhibitory compound
  • the impaired function or activity may be associated, for example, with a reduced ability of the polypeptide to reduce growth of an ovarian cancer cell or a reduced enzymatic activity or function identified for example in Table 2
  • sequence identity relates to (consecutive) nucleotides of a nucleotide sequence with reference to an original nucleotide sequence which when compared are the same or have a specified percentage of nucleotides which are the same
  • the identity may be compared over a region or over the total sequence of a nucleic acid sequence
  • ' identity may be compared, for example over a region of 10, 19, 20 nucleotides or more (and any number therebetween) and more preferably over a longer region or over the entire region of a polynucleotide sequence described at Table 4 (e g , any one of SEQ ID NO 1 to 49 and 169)
  • gaps of non-identical nucleotides may be found between identical nucleic acids regions (identical nucleotides)
  • a polynucleotide may have 100% identity with another polynucleotide over a portion thereof
  • the two polynucleotides may have 50% of their overall (total) sequence identity to one another
  • Percent identity may be determined, for example, with n algorithm GAP, BESTFIT, or FASTA in the Wisconsin Genetics Software Package Release 7 0, using default gap weights
  • Polynucleotides of the present invention or portion thereof having from about 50 to about 100% and any range therebetween, or about 60 to about 100% or about 70 to about 100% or about 80 to about 100% or about 85% to about 100% about 90% to about 100%, about 95% to about 100% sequence identity with an original polynucleotide are encompassed herewith It is known by those of skill in the art, that a polynucleotide having from about 50% to 100% identity may function (e g , anneal to a substantially complementary sequence) in a manner similar to an original polynucleotide and therefore may be used in replacement of an original polynucleotide
  • a polynucleotide (a nucleic acid sequence) may comprise or have from about 50% to about 100% identity with an original polynucleotide over a defined region and may still work as efficiently or sufficiently to achieve the present invention
  • substantially identical used to define the polynucleotides of the present invention refers to polynucleotides which have for example
  • Substantially identical polynucleotide sequences may be identified by providing a probe of about 10 to about 25, or more or about 10 to about 20 nucleotides long (or longer) based on the sequence of any one of SEQ ID NOs 1 to 49 and 169 (more particularly, a transcribed and/or translated portion of any one of SEQ ID NOs 1 to 49 and 169) and complementary sequence thereof and hybridizing a library of polynucleotide (e g , cDNA or else) originating from another species, tissue, cell, individual etc
  • a polynucleotide which hybridizes under highly stringent conditions (e g , 6XSCC, 65 0 C) to the probe may be isolated and identified using methods known in the art
  • a sequence "substantially identical” includes for example an isolated allelic variant an isolated splice variant, an isolated non-human ortholog a modified NSEQ etc
  • sequence complementarity refers to (consecutive) nucleotides of a nucleotide sequence which are complementary to a reference (original) nucleotide sequence The complementarity may be compared over a region or over the total sequence of a nucleic acid sequence
  • Polynucleotides of the present invention or portion thereof having from about 50 to about 100%, or about 60 to about 100% or about 70 to about 100% or about 80 to about 100% or about 85%, about 90%, about 95% to about 100% sequence complementarity with an original polynucleotide are thus encompassed herewith It is known by those of skill in the art, that a polynucleotide having from about 50% to 100% complementarity with an original sequence may anneal to that sequence in a manner sufficient to carry out the present invention (e g , inhibit expression of the original polynucleotide)
  • polynucleotide generally refers to any polyribonucleotide or polydeoxyribo-nucleotide, which may be unmodified RNA or DNA, or modified RNA or DNA
  • Polynucleotides include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single
  • polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • polynucleotide embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found or not in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells.
  • Polynucleotide includes but is not limited to linear and end-closed molecules.
  • Polynucleotide also embraces relatively short polynucleotides, often referred to as oligonucleotides
  • Polypeptides refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds ( ⁇ e , peptide isosteres). "Polypeptide” refers to both short chains, commonly referred as peptides, oligopeptides or oligomers, and to longer chains generally referred to as proteins. As described above, polypeptides may contain amino acids other than the 20 gene- encoded amino acids.
  • polypeptide analog or “analog” relates to mutants, chimeras, fusions, a polypeptide comprising at least one amino acid deletion, a polypeptide comprising at least one amino acid insertion or addition, a polypeptide comprising at least one amino acid substitutions, and any other type of modifications made relative to a given polypeptide.
  • an “analog” is thus to be understood herein as a molecule having a biological activity and/or chemical structure similar to that of a polypeptide described herein
  • An “analog” may have sequence similarity with that of an original sequence or a portion of an original sequence and may also have a modification of its structure as discussed herein
  • an “analog” may have at least 80% or 85% or 90 % sequence similarity with an original sequence or a portion of an original sequence.
  • An “analog” may also have, for example, at least 70 % or even 50 % sequence similarity with an original sequence or a portion of an original sequence and may function in a suitable manner
  • a “derivative” is to be understood herein as a polypeptide originating from an original sequence or from a portion of an original sequence and which may comprise one or more modification, for example, one or more modification in the ammo acid sequence (e g , an amino acid addition deletion insertion substitution etc ), one or more modification in the backbone or side-chain of one or more amino acid, or an addition of a group or another molecule to one or more amino acids (side-chains or backbone)
  • Biologically active derivatives of the carrier described herein are encompassed by the present invention
  • an “derivative” may have, for example, at least 50 %, 70%, 80%, 90% sequence similarity to an original sequence with a combination of one or more modification in a backbone or side-chain of an amino acid, or an addition of a group or another molecule, etc
  • biologically active refers to an analog which retains some or all of the biological activity of the original polypeptide, i e , to have some of the activity or function associated with the polypeptide described at Table 2, or to be able to promote or inhibit the growth ovarian cancer
  • any polypeptide having a modification compared to an original polypeptide which does not destroy significantly a desired activity, function or immunogenicity is encompassed herein
  • modifications may, on the other hand, keep or increase the biological activity of the original polypeptide or may optimize one or more of the particularity (e g stability, bioavailability, etc ) of the polypeptides of the present invention which, in some instance might be desirable
  • Polypeptides of the present invention may comprise for example, those containing amino acid sequences modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are known in the art Modifications may occur anywhere in a polypeptide including the polypeptide backbone, the amino acid side-chains and the amino- or carboxy-terminus It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide Also, a given
  • Example of substitutions may be those, which are conservative ( ⁇ e , wherein a residue is replaced by another of the same general type or group) or when wanted non-conservative ( ⁇ e , wherein a residue is replaced by an amino acid of another type)
  • a non-naturally occurring amino acid may substitute for a naturally occurring amino acid ( ⁇ e , non-naturally occurring conservative amino acid substitution or a non-naturally occurring non-conservative amino acid substitution)
  • amino acids may be sub-classified as acidic, basic, neutral and polar, or neutral and non-polar
  • three of the encoded amino acids are aromatic
  • encoded polypeptides differing from the determined polypeptide of the present invention contain substituted codons for ammo acids, which are from the same type or group as that of the amino acid to be replaced
  • the basic amino acids Lys, Arg and His may be interchangeable
  • the acidic amino acids Asp and GIu may be interchangeable
  • the neutral polar amino acids Ser, Thr, Cys, GIn, and Asn may be interchangeable
  • the non-polar aliphatic amino acids GIy, Ala, VaI, lie, and Leu are interchangeable but because of size GIy and Ala are more closely related and VaI, lie and Leu are more closely related to each other
  • the aromatic amino acids Phe, Trp and Tyr may be interchangeable
  • polypeptides are made synthetically substitutions by amino acids, which are not naturally encoded by DNA (non-naturally occurring or unnatural amino acid) may also be made
  • a non-naturally occurring amino acid is to be understood herein as an amino acid which is not naturally produced or found in a mammal
  • a non-naturally occurring amino acid comprises a D-amino acid, an amino acid having an acetylaminomethyl group attached to a sulfur atom of a cysteine, a pegylated amino acid, etc
  • the inclusion of a non-naturally occurring amino acid in a defined polypeptide sequence will therefore generate a derivative of the original polypeptide
  • Non-naturally occurring amino acids include also the omega amino acids of the formula NH 2 (CH 2 )nCOOH wherein n is 2-6, neutral nonpolar amino acids, such as sarcosine, t- butyl alanine, t-butyl glycine, N-methyl isoleucine, norleucine, etc Phenylglycine may substitute for Trp, Tyr or Phe, citrulline and methionine sulfoxide are neutral nonpolar, cysteic acid
  • one site of interest for substitutional mutagenesis may include but are not restricted to sites identified as the active s ⁇ te(s), or immunological s ⁇ te(s)
  • Other sites of interest may be those, for example, in which particular residues obtained from various species are identical These positions may be important for biological activity Examples of substitutions identified as "conservative substitutions" are shown in Table A If such substitutions result in a change not desired then other type of substitutions denominated "exemplary substitutions" in Table A or as further described herein in reference to ammo acid classes, are introduced and the products screened In some cases it may be of interest to modify the biological activity of a polypeptide by amino acid substitution, insertion, or deletion For example, modification of a polypeptide may result in an increase in the polypeptide's
  • Non-conservative substitutions will entail exchanging a member of one of these classes for another
  • any specified range or group is to be understood as a shorthand way of referring to each and every member of a range or group individually as well as each and every possible sub-ranges or sub-groups encompassed therein; and similarly with respect to any sub-ranges or sub-groups therein.
  • Fig 1 to Fig 31 , Fig 33, Fig 34 Fig 36 Fig 37 Fig 39 Fig 40 Fig 42 Fig 43, Fig 46, Fig 47, Fig 49, Fig 50 and Fig 56 are pictures of macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human sequences Macroarrays were prepared using RAMP amplified RNA from six human LMP samples (A-F 1) and twenty malignant ovarian tumor samples (Table B) (A-F 2 and A-G 3-4), and 30 different normal human tissues (adrenal (A7), breast (B7), jejunum (C7), trachea (D7), liver (E7), placenta (F7), aorta (G7), brain (H7), lung (A8), adrenal cortex (B8), esophagus (C8), colon (D8), ovary (E8), kidney (F8), prostate (G8), thymus (H8), skeletal muscle (A9), vena
  • Fig 57 to Fig 105 are pictures of RT-PCR results showing the differential expression data for STAR selected cancer-related human sequences in RNA samples derived from the NCI-60 panel of cancer cell lines These 59 cell lines are derived from tumors that encompass 9 human cancer types that include leukemia, the central nervous system, breast, colon, lung, melanoma, ovarian, prostate, and renal Complimentary DNAs were prepared using random hexamers from RAMP amplified RNA from 59 human cancer cell lines (Table C) The cDNAs were quantified and used as templates for PCR with gene-specific primers using standard methods known to those skilled in the art For each PCR result depicted in Fig 57 to Fig 105, equal amounts of template cDNA used in each PCR reaction was confirmed by reamplifying GAPDH with a specific primer pair OGS 315
  • Fig 1 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 1
  • the STAR dsDNA clone representing SEQ ID NO 1 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Expression of this sequence was only observed in one (placenta (F7)) of the 30 normal tissues and the breast cancer cell line, MCF7 (B- C 5),
  • Fig 2 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 2
  • the STAR dsDNA clone representing SEQ ID NO 2 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Expression of this sequence was also evident in six (breast (B7), placenta (F7), aorta (G7), colon (D8), ovary (E8) and thymus (H8)) of the 30 normal tissues,
  • Fig 3 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 3
  • the STAR dsDNA clone representing SEQ ID NO 3 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) but overall only low levels of expression No significant expression was seen in any of the normal tissues
  • Fig 4 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 4
  • the STAR dsDNA clone representing SEQ ID NO 4 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Expression of this sequence
  • Fig 5 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 5
  • the STAR dsDNA clone representing SEQ ID NO 5 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1 )
  • Weak expression of this sequence similar to that of LMPs was also observed in many of the normal tissues,
  • Fig 6 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 6
  • the STAR dsDNA clone representing SEQ ID NO 6 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Expression of this sequence was also evident in three (liver (E7), placenta (F7) and kidney (F8)) of the 30 normal tissues,
  • FIg 7 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 7
  • the STAR dsDNA clone representing SEQ ID NO 7 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in several malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Expression of this sequence was only evident in one (testicle (F10)) of the 30 normal tissues,
  • Fig 8 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 8
  • the STAR dsDNA clone representing SEQ ID NO 8 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Expression of this sequence was only evident in two (esophagus (C8) and stomach (C9)) of the 30 normal tissues and the breast and prostate cancer cell lines, MDA (A5) and LNCap (G6 and H6) respectively,
  • Fig 9 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 9
  • the STAR dsDNA clone representing SEQ ID NO 9 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Expression of this sequence was only evident in one (placenta (F7)) of the 30 normal tissues, the breast cancer cell line, MCF7 (B-C 5) and LCM microdissected prostate cancer samples (D6 and F6),
  • Fig 10 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 10
  • the STAR dsDNA clone representing SEQ ID NO 10 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Expression of this sequence was only evident in one (testicle (F10)) of the 30 normal tissues, the breast cancer cell lines, MDA (A5) and MCF7 (B-C 5) and prostate cancer cell line, LNCap (G-H 6),
  • Fig 11 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 11
  • the STAR dsDNA clone representing SEQ ID NO 11 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Significant expression of this sequence was only evident in the breast cancer cell lines, MDA (A5) and MCF7 (B-C 5),
  • Fig 12 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 12
  • the STAR dsDNA clone representing SEQ ID NO 12 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in the majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Significant expression of this sequence was only evident in one (testicle (F10)) of the 30 normal tissues and the prostate cancer cell line, LNCap (G-H 6) Weaker expression was also observed in normal ovary (E8),
  • Fig 13 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 13
  • the STAR dsDNA clone representing SEQ ID NO 13 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Significant expression of this sequence was only evident in the breast cancer cell lines MDA (A5) and MCF7 (B-C 5) Weaker expression was also observed in some normal tissues and the prostate cancer cell line, LNCap (G-H 6),
  • Fig 14 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 14
  • the STAR dsDNA clone representing SEQ ID NO 14 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation
  • Fig 15 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 15
  • the STAR dsDNA clone representing SEQ ID NO 15 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in the majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1 )
  • Weaker expression of this sequence similar to that of the LMPs was noted in many of the normal tissues as well,
  • Fig 16 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 16
  • the STAR dsDNA clone representing SEQ ID NO 16 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in the majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1)
  • Significant expression of this sequence was also evident in the breast cancer cell lines, MDA (A5) and MCF7 (B-C 5) Weaker expression similar to that of the LMPs was seen in prostate and some normal tissue samples,
  • Fig 17 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 17
  • the STAR dsDNA clone representing SEQ ID NO 17 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in the majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Significant expression of this sequence was only evident in two (breast (B7) and bladder (H9)) of the 30 normal tissues
  • Fig 18 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 18
  • the STAR dsDNA clone representing SEQ ID NO 18 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP
  • Fig 19B (panels A and B) is a picture of RT-PCR data showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 19 and KCNMB2 gene belonging to Unigene cluster, Hs 478368 Primer pairs specific to either the STAR clone sequence for SEQ ID NO 19 or the KCNMB2 gene were used to perform RT-PCR on normal ovarian tissue, and benign and different stages/grades of ovarian cancer As indicated by the expected PCR amplicon product (Fig 19B, panel A), compared to normal (Lane 1), benign (Lanes 2-3) and LMPs (Lanes 4-7) samples, increased expression of SEQ ID NO 19 mRNA was evident in clear cell carcinoma (Lanes 8-9), late stage endometrioid (Lane 12) and malignant serous (Lanes 15-17) These results confirm the upregulation of the gene expression for SEQ ID NO 19 in malignant ovarian cancer However, the expression of KCNMB2 was markedly different from that of SEQ ID NO 19 showing
  • Fig 20 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 20
  • the STAR dsDNA clone representing SEQ ID NO 20 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in several malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Significant expression of this sequence was also evident in the four (jejunum (C7), trachea (D7), colon (D8) and thymus (H8)) of the 30 normal tissues,
  • Fig 21 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 21
  • the STAR dsDNA clone representing SEQ ID NO 21 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1 )
  • Significant expression of this sequence was also evident in the three (adrenal (A7), breast (B7) and aorta (G7)) of the 30 normal tissues,
  • Fig 22 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 22
  • the STAR dsDNA clone representing SEQ ID NO 22 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1)
  • Significant expression of this sequence was also evident in the breast cancer cell line, MCF7 (B-C 5)
  • Weaker expression similar to that of the LMPs was seen in a majority of the normal tissues,
  • Fig 23 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 23
  • the STAR dsDNA clone representing SEQ ID NO 23 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in several malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1 )
  • Significant expression of this sequence was also evident in the breast cancer cell lines, MDA (A5) and MCF7 (B-C 5) and prostate cancer cell line, LNCap (G-H 6)
  • Fig 24 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 24
  • the STAR dsDNA clone representing SEQ ID NO 24 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in several of the malignant ovarian cancer
  • Fig 25 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 25
  • the STAR dsDNA clone representing SEQ ID NO 25 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Significant expression of this sequence was also evident in the prostate cancer cell line, LNCap (G-H 6),
  • Fig 26 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 26
  • the STAR dsDNA clone representing SEQ ID NO 26 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1)
  • Significant expression of this sequence was also evident in the breast cancer cell lines MDA (A5) and MCF7 (B-C 5), prostate cancer cell line, LNCap (G-H 6) and one normal tissue, testicle (F 10) Weaker expression similar to that of the LMPs was seen in some normal tissues as well,
  • Fig 27 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 27
  • the STAR dsDNA clone representing SEQ ID NO 27 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1)
  • Significant expression of this sequence was also evident in the breast cancer cell lines, MDA (A5) and MCF7 (B-C 5), prostate cancer cell line, LNCap (G-H 6)
  • Weaker expression similar to that of the LMPs was seen in seven (adrenal (A7), placenta (F7), lung (A8), esophagus (C8), colon (D8), ovary (E8) and testicle (F10)) of the 30 normal tissues as well,
  • Fig 28 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 28
  • the STAR dsDNA clone representing SEQ ID NO 28 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1)
  • Significant expression of this sequence was also evident in the breast cancer cell lines, MDA (A5) and MCF7 (B-C 5) Weaker expression similar to that of LMPs was seen for all other tissues,
  • Fig 29 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 29
  • the STAR dsDNA clone representing SEQ ID NO 29 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1 )
  • Significant expression of this sequence was also evident in the breast cancer cell line, MCF7 (B-C 5) and three (breast (B7), esophagus (C8) and fallopian tube (F9)) of the 30 normal tissues,
  • Fig 30 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 30
  • the STAR dsDNA clone representing SEQ ID NO 30 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Significant expression of this sequence was also evident in the breast cancer cell line, MCF7 (B-C 5), prostate cancer samples (D-H 6) Weaker expression similar to that of LMPs was seen in only very few normal tissues
  • Fig 31 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 31
  • the STAR dsDNA clone representing SEQ ID NO 31 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority
  • Fig 32 is a picture of RT-PCR data showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 32
  • the macroarray data was not available
  • a primer pair, OGS 1077 (GCGTCCGGGCCTGTCTTCAACCT, SEQ ID NO 153) and OGS 1078 (GCCCCACCCTCTACCCCACCACTA, SEQ ID NO 154) for SEQ ID NO 32 was used to perform RT-PCR on normal ovarian tissue, and benign and different stages/grades of ovarian cancer
  • the expected PCR amplicon product compared to normal (Lane 1 ) and benign (Lanes 2-3) increased expression of SEQ ID NO 32 mRNA was evident in LMPs (Lanes 4-7) clear cell carcinoma (Lanes 8-9) late stage endometrioid (Lane 12) and malignant serous (Lanes 15-17)
  • Fig 33 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 33
  • the STAR dsDNA clone representing SEQ ID NO 33 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1 )
  • Significant expression of this sequence was also evident in the prostate cancer samples (B-F 6)
  • Weaker expression was seen in many normal tissues and strong expression was seen trachea (D7), colon (D8), small intestine (D9), thymus (H8) and spleen (G9)
  • Fig 34 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 34
  • the STAR dsDNA clone representing SEQ ID NO 34 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1 )
  • Significant expression of this sequence was also evident in the prostate cancer samples (B-F 6)
  • Weaker expression was seen in many normal tissues and strong expression was seen trachea (D7), colon (D8), small intestine (D9) thymus (H8) and spleen (G9)
  • Fig 35 is a picture of RT-PCR data showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 35 For this gene the macroarray data was not available A primer pair, OGS 1141 (GAGATCCTGATCAAGGTGCAGG, SEQ ID NO 155) and OGS 1142 (TGCACGCTCACAGCAGTCAGG.
  • SEQ ID NO 156) for SEQ ID NO 35 was used to perform RT-PCR on LMP samples, different stages/grades of ovarian cancer and normal human tissue samples As indicated by the expected PCR amplicon product (indicated as AB-0201), increased expression of SEQ ID NO 35 mRNA was evident in some ovarian cancer lanes (lanes 10, 11 , 14, 18, 28 and 29) and the mRNA was not expressed in LMP samples Expression was observed in only one normal tissue sample, ileum (lane 27) Equal amounts of template cDNA used in each PCR reaction was confirmed by reamplifying GAPDH with a specific primer pair, OGS 315 (TGAAGGTCGGAGTCAACGGATTTGGT SEQ ID NO 167) and OGS 316 (CATGTGGGCCATGAGGTCCACCAC, SEQ ID NO 168) for this housekeeping gene These results confirm the upregulation of the gene expression for SEQ ID NO 35 in malignant ovarian cancer,
  • Fig 36 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 36
  • the STAR dsDNA clone representing SEQ ID NO 36 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a few of the malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) No expression was seen in other cancer types nor in normal human tissues
  • Fig 37 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 37
  • the STAR dsDNA clone representing SEQ ID NO 37 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Weak expression of this sequence was also evident in the prostate cancer samples (B-F 6) Weaker expression was seen in some normal tissues
  • Fig 38 is a picture of RT-PCR data showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 38 For this gene, the macroarray data was not available A primer pair, OGS 1202 (AACATGACTAAGATGCCCAACC, SEQ ID NO 157) and OGS 1203 (AATCTCCTTCACCTCCACTACTG.
  • SEQ ID NO 158) for SEQ ID NO 38 was used to perform RT-PCR on LMP samples, different stages/grades of ovarian cancer and normal human tissue samples As indicated by the expected PCR amplicon product (indicated as AB-0332), increased expression of SEQ ID NO 38 mRNA was evident in approximately half of the ovarian cancer lanes and weaker expression was seen in LMP samples Expression was observed in many normal tissue samples Equal amounts of template cDNA used in each PCR reaction was confirmed by reamplifying GAPDH with a specific primer pair, OGS 315
  • Fig 39 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 39
  • the STAR dsDNA clone representing SEQ ID NO 39 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Strong expression was also observed in breast cancer samples (A-C 5) and weak expression in prostate cancer samples (A-H 6) Weaker expression was seen in a few normal tissues with strong expression in testes (F 10)
  • Fig 40 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 40
  • the STAR dsDNA clone representing SEQ ID NO 40 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Weak expression was seen in a few normal tissues with strong expression in kidney (F 8)
  • These results confirm the upregulation of the gene expression for SEQ ID NO 40 in malignant ovarian cancer,
  • Fig 41 is a picture of RT-PCR data showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 41
  • the macroarray data was not available
  • a primer pair, OGS 1212 (AAGCATAGCCATAGGTGATTGG, SEQ ID NO 159) and OGS 1213 (ACAGGTATCAGACAAGGGAGCAG, SEQ ID NO 160) for SEQ ID NO 41 was used to perform RT-PCR on LMP samples, different stages/grades of ovarian cancer and normal human tissue samples
  • the expected PCR amplicon product indicated as AB-0532
  • increased expression of SEQ ID NO 41 mRNA was evident in a large majority of the ovarian cancer lanes and weaker expression was seen in LMP samples
  • Expression was observed in a few normal tissue samples such as kidney, thymus and spleen (lanes 14, 16 and 23, respectively)
  • Equal amounts of template cDNA used in each PCR reaction was confirmed by reamplifying GAPDH with a specific primer pair, OGS
  • Fig 43 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 43
  • the STAR dsDNA clone representing SEQ ID NO 43 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1 ) Strong expression was also observed in breast cancer samples (A-C 5) and weak expression in prostate cancer samples (A-H 6) Weaker expression was seen in normal tissues with strong expression in testes (F 10)
  • These results confirm the upregulation of the gene expression for SEQ ID NO 43 in malignant ovarian cancer,
  • Fig 44 is a picture of RT-PCR data showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 44
  • the macroarray data was not available
  • a primer pair, OGS 1171 (TTACGACCTATTTCTCCGTGG, SEQ ID NO 161) and OGS 1172 (AATGCAATAATTGGCCACTGC, SEQ ID NO 162) for SEQ ID NO 44 was used to perform RT-PCR on LMP samples, different stages/grades of ovarian cancer and normal human tissue samples
  • the expected PCR amplicon product indicated as AB-0795
  • increased expression of SEQ ID NO 44 mRNA was evident in a large majority of the ovarian cancer lanes and weaker expression was seen in LMP samples
  • Expression was observed in several normal tissue samples such as aorta, skeletal muscle, small intestine and spleen (lanes 7, 17, 20 and 23, respectively)
  • Equal amounts of template cDNA used in each PCR reaction was confirmed by reamplifying GAPDH with a
  • Fig 47 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 47
  • the STAR dsDNA clone representing SEQ ID NO 47 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Significant expression of this sequence was also evident in the prostate cancer samples (B-F 6)
  • Weaker expression was seen in many normal tissues and strong expression was seen trachea (D7), colon (D8) small intestine (D9), thymus (H8) and spleen (G9)
  • Fig 48 is a picture of RT-PCR data showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 48 For this gene, the macroarray data was not available A primer pair, OGS 1282 (ATGGCTCATACAGCACTCAGG, SEQ ID NO 165) and OGS 1283 (GAACTGTCACTCCGGAAAGCCT.
  • SEQ ID NO 166) for SEQ ID NO 48 was used to perform RT-PCR on LMP samples, different stages/grades of ovarian cancer and normal human tissue samples As indicated by the expected PCR amplicon product (indicated as AB-1120), increased expression of SEQ ID NO 48 mRNA was evident in a majority of the ovarian cancer lanes and weaker expression was seen in LMP samples Expression was eveident in virtually all normal tissues Equal amounts of template cDNA used in each PCR reaction was confirmed by reamplifying GAPDH with a specific primer pair, OGS 315 (TGAAGGTCGGAGTCAACGGATTTGGT, SEQ ID NO 167) and OGS 316 (CATGTGGGCCATGAGGTCCACCAC, SEQ ID NO 168) for this housekeeping gene These results confirm the upregulation of the gene expression for SEQ ID NO 48 in malignant ovarian cancer,
  • Fig 49 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 49
  • the STAR dsDNA clone representing SEQ ID NO 49 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1 ) Strong expression was also observed in breast cancer samples (A-C 5) and weak expression in prostate cancer samples (A-H 6) Weaker expression was seen in normal tissues
  • Fig 50 is a picture of the macroarray hybridization results showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 50
  • the STAR dsDNA clone representing SEQ ID NO 50 was labeled with 32 P and hybridized to the macroarray
  • the hybridization results obtained confirm its upregulation in a majority of malignant ovarian cancer samples (A-F 2 and A-G 3-4) compared to LMP samples (A-F 1) Significant expression of this sequence was also evident in the seven (adrenal (A7), breast (B7), trachea (D7), placenta (F7), lung (A8), kidney (F8) and fallopian tube (F9)) of the 30 normal tissues
  • Fig 51 is a picture showing an example of STAR subtraction for the ovarian cancer samples
  • the housekeeping genes, GAPDH (Panel A) and ⁇ -actin (Panel B) were nicely subtracted for both LMP minus Malignant (SL133 to SL137) and
  • Fig 53 is a picture showing the effect of SEQ ID -specific shRNAs on the proliferation of TOV-21 G cells Decreased proliferation is indicative of a gene that when attenuated is required for normal growth of the cancer cells
  • the cells were stably transfected with two separate shRNA expression vectors and the proliferation of the cells was measured in an MTT assay
  • the positive control plasmid expresses a shRNA that has homology to no known gene in humans
  • Fig 54 is a picture showing SEQ ID -specific shRNAs on the survival of TOV- 21 G cells Less staining is indicative of a gene that, when attenuated, is required for survival of the cancer cells in this assay
  • the cells were transiently transfected with two separate shRNA expression vectors and the remaining colonies were stained with crystal violet and photographed
  • the positive control plasmid expresses a shRNA that has homology to no known gene in humans,
  • Fig 55A and 55B are pictures of RT-PCR data showing the differential expression data for STAR selected ovarian cancer-related human SEQ ID NO 01 , 09, 12, 15, 17, 19, 20 and 24
  • STAR SEQ ID NOs selected after macroarray analysis were upregulated in malignant ovarian cancer samples compared to LMPs and normal ovarian samples
  • semi-quantitative RT-PCR was performed for 25 cycles using HotStarTaq polymerase according to the supplier instructions (Qtagen)
  • Qtagen HotStarTaq polymerase
  • SEQ ID NOs 01 , 09, 12, 15, 17, 19, 20 and 24 a specific primer pair for each was used
  • the differential expression results obtained for each SEQ ID NO tested are shown in Figure 55A and 55B
  • the expected PCR amplicon product for each SEQ ID NO there is a clear tendency towards increased expression of the mRNAs corresponding to SEQ ID NOs 01 , 09, 12, 15, 17, 19, 20 and 24 in
  • Fig 57 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 1 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair OGS 1136 (GCTTAAAAGAGTCCTCCTGTGGC, SEQ ID NO 171) and OGS 1044 (TGGACATTGTTCTTAAAGTGTGG, SEQ ID NO 172) for SEQ ID NO 1 was used to perform RT-PCR
  • OGS 1136 GCTTAAAAGAGTCCTCCTGTGGC, SEQ ID NO 171
  • OGS 1044 TGGACATTGTTCTTAAAGTGTGG, SEQ ID NO 172
  • Fig 58 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 2 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1250 (AGGTTTTATGGCCACCGTCAG, SEQ ID NO 173) and OGS 1251 (ATCCTATACCGCTCGGTTATGC, SEQ ID NO 174) for SEQ ID NO 2 was used to perform RT-PCR
  • OGS 1250 AGGTTTTATGGCCACCGTCAG, SEQ ID NO 173
  • OGS 1251 ATCCTATACCGCTCGGTTATGC, SEQ ID NO 174
  • Fig 59 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 3 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • Fig 60 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 4 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1051 (ACACTGGATGCCCTGAATGACACA, SEQ ID NO 177) and OGS 1052 (GCTTTGGCCCTTTTTGCTAA, SEQ ID NO 178) for SEQ ID NO 4 was used to perform RT-PCR As indicated by the expected PCR amplicon, increased expression of SEQ ID NO 4 mRNA was evident in melanoma, ovarian, CNS, and lung cancers and weakly expressd in the leukemia samples, Fig 61 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 5 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1252 (CCCACTTCTGTCTTACTGCATC, SEQ ID NO 179) and OGS 1253 (
  • Fig 62 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 6 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1083 (AACGATTGCCCGGATTGATGACA, SEQ ID NO 181) and OGS 1084 (TACTTGAGGCTGGGGTGGGAGATG. SEQ ID NO 182) for SEQ ID NO 6 was used to perform RT-PCR As indicated by the expected PCR amplicon, increased expression of SEQ ID NO 6 mRNA was evident all cancer types,
  • Fig 63 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 7 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1053 (CACTACGCCAGGCACCCCCAAAAC, SEQ ID NO 183) and OGS 1054 (CGAGGCGCACGGCAGTCT, SEQ ID NO 184) for SEQ ID NO 7 was used to perform RT-PCR As indicated by the expected PCR amplicon, increased expression of SEQ ID NO 7 mRNA was evident only in ovarian cancer samples,
  • Fig 64 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 8 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1037 (ATCCGTTGCTGCAGCTCGTTCCTC, SEQ ID NO 185) and OGS 1038 (ACCCTGCTGACCTTCTTCCATTCC, SEQ ID NO 186) for SEQ ID NO 8 was used to perform RT-PCR As indicated by the expected PCR amplicon, increased expression of SEQ ID NO 8 mRNA was evident in all cancer types,
  • Fig 65 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 9 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1045 (TCGGAGGAGGGCTGGCTGGTGTTT, SEQ ID NO 187) and OGS 1046 (CTTGGGCGTCTTGGAGCGGTTCTG SEQ ID NO 188) for SEQ ID NO 9 was used to perform RT-PCR
  • OGS 1045 TCGGAGGAGGGCTGGCTGGTGTTT, SEQ ID NO 187)
  • OGS 1046 CTTGGGCGTCTTGGAGCGGTTCTG SEQ ID NO 188) for SEQ ID NO 9 was used to perform RT-PCR
  • the expected PCR amphcon (lower band on the gel, the top band is an artifact of the PCR reaction) increased expression of SEQ ID NO 9 mRNA was evident in ovarian, lung, colon, breast cancer, and melanoma and weakly expressed in leukemia
  • Fig 66 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 10 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1240 (AGAGCCTATTGAAGATGAACAG, SEQ ID NO 189) and OGS 1241 (TGATTGCCCCGGATCCTCTTAGG, SEQ ID NO 190) for SEQ ID NO 10 was used to perform RT-PCR As indicated by the expected PCR amplicon, increased expression of SEQ ID NO 10 mRNA was evident in all cancer types,
  • Fig 67 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 11 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair OGS 1304 (GGACAAATACGACGACGAGG, SEQ ID NO 191 ) and OGS 1305 (GGTTTCTTGGGTAGTGGGC SEQ ID NO 192) for SEQ ID NO 1 1 was used to perform RT-PCR
  • Fig 68 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 12 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1039 (CCCCGGAGAAGGAAGAGCAGTA, SEQ ID NO 193) and OGS 1040 (CGAAAGCCGGCAGTTAGTTATTGA, SEQ ID NO 194) for SEQ ID NO
  • Fig 69 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 13 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair OGS 1095 (GGCGGGCAACGAATTCCAGGTGTC SEQ ID NO 195) and OGS 1096 (TCAGAGGTTCGTCGCATTTGTCCA, SEQ ID NO 196) for SEQ ID NO 13 was used to perform RT-PCR
  • Fig 70 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 15 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1284 (CAACAGTCATGATGTGTGGATG, SEQ ID NO 197) and OGS 1285 (ACTGCACCTTGTCCGTGTTGAC SEQ ID NO 198) for SEQ ID NO 15 was used
  • Fig 71 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 16 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1063 (CCGGCTGGCTGCTTTGTTTA, SEQ ID NO 199) and OGS 1064 (ATGATCAGCAGGTTCGTTGGTAGG, SEQ ID NO 200) for SEQ ID NO 16 was used to perform RT-PCR
  • OGS 1031 ATGCCGGAAGTGAATGTGG, SEQ ID NO 201
  • OGS 1032 GGTGACTCCGCCTTTTGAT, SEQ ID NO 202
  • Fig 73 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 18 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1308 (ACATTCGCTTCTCCATCTGG, SEQ ID NO 203) and OGS 1309 (TGTCACGGAAGGGAACCAGG.
  • Fig 74 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 19 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair OGS 1069 ACGCTGCCTCTGGGTCACTT SEQ ID NO 205
  • OGS 1070 TTGGCAAATCAATGGCTTGTAAT 1 SEQ ID NO 206
  • Fig 75 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 20 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair OGS 1061 A primer pair OGS 1061 (ATGGC
  • Fig 76 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 21 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1097 (CACCAAATCAGCTGCTACTACTCC, SEQ ID NO 209) and OGS 1098 (GATAAACCCCAAAGCAGAAAGATT, SEQ ID NO 210) for SEQ ID NO 21 was used to perform RT-PCR As indicated by the expected PCR amplicon, increased expression of SEQ ID NO 21 mRNA was evident in all cancer types but weakly in leukemia,
  • Fig 77 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 22 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1075 (CGAGATTCCGTGGGCGTAGG, SEQ ID NO 211 ) and OGS 1076 (TGAGTGGGAGCTTCGTAGG, SEQ ID NO 212) for SEQ ID NO 22 was used to perform RT-PCR
  • OGS 1075 CGAGATTCCGTGGGCGTAGG, SEQ ID NO 211
  • OGS 1076 TGAGTGGGAGCTTCGTAGG, SEQ ID NO 212
  • Fig 78 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 23 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1232 (TCAGAGTGGACGTTGGATTAC, SEQ ID NO 213) and OGS 1233 (TGCTTGAAATGTAGGAGAACA. SEQ ID NO 214) for SEQ ID NO 23 was used to perform RT-PCR As indicated by the expected PCR amplicon, increased expression of SEQ ID NO 23 mRNA was evident in all cancer types
  • Fig 79 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 24 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1067 (GAGGGGCATCAATCACACCGAGAA, SEQ ID NO 215) and OGS 1068 (CCCCACCGCCCACCCATTTAGG.
  • Fig 80 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 25 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1099 (GGGGGCACCAGAGGCAGTAA, SEQ ID NO 217) and OGS 1 100 (GGTTGTGGCGGGGGCAGTTGTG, SEQ ID NO 218) for SEQ ID NO 25 was used to perform RT-PCR As indicated by the expected PCR amplicon, increased expression of SEQ ID NO 25 mRNA was evident in all cancer types but weakly in leukemia,
  • Fig 81 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 26 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1246 (ACAGACTCCTGTACTGCAAACC, SEQ ID NO 219) and OGS 1247 (TACCGGTTCGTCCTCTTCCTC SEQ ID NO 220) for SEQ ID NO 26 was used to perform RT-PCR
  • Fig 82 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 27 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • Fig 83 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 28 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1332 (TAGGCGCGCCTGACATACAGCAATGCCAGTT, SEQ ID NO 223) and OGS 1333 (TAAGAATGCGGCCGCGCCACATCTTGAACACTTTGC , SEQ ID NO 224) for SEQ ID NO 28 was used to perform RT-PCR As indicated by the expected PCR amplicon, increased expression of SEQ ID NO 28 mRNA was evident in ovarian prostate, and renal cancer but weakly in all other types, Fig 84 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 29 in RNA samples derived from the NCI-60 panel of cancer cell lines.
  • a primer pair, OGS 1101 (TGGGGAGGAGTTTGAGGAGCAGAC; SEQ. ID. NO. 225) and OGS 1102 (GTGGGACGGAGGGGGCAGTGAAG; SEQ. ID. NO. 226) for SEQ. ID. NO. 29 was used to perform RT-PCR. As indicated by the expected PCR amplicon, increased expression of SEQ. ID. NO. 29 mRNA was evident in ovarian, renal, lung, colon, and breast cancer but weakly in CNS cancer and melanoma;
  • Fig. 85 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ. ID. NO. 30 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1300 (GCAACTATTCGGAGCGCGTG; SEQ ID. NO 227) and OGS 1301 (CCAGCAGCTTGTTGAGCTCC; SEQ ID NO 228) for SEQ. ID NO 30 was used to perform RT-PCR. As indicated by the expected PCR amplicon, increased expression of SEQ. ID. NO. 30 mRNA was evident in all cancer types;
  • Fig. 86 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ. ID. NO. 31 in RNA samples derived from the NCI-60 panel of cancer cell lines.
  • a primer pair, OGS 1302 (GGAGGAGCTAAGCGTCATCGC; SEQ. ID. NO. 229) and OGS 1303 (TCGCTTCAGCGCGTAGACC; SEQ. ID. NO. 230) for SEQ. ID. NO. 31 was used to perform RT-PCR.
  • OGS 1302 GGAGGAGCTAAGCGTCATCGC; SEQ. ID. NO. 229)
  • OGS 1303 TCGCTTCAGCGCGTAGACC; SEQ. ID. NO. 230
  • Fig. 87 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ. ID. NO. 32 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1077 (GCGTCCGGGCCTGTCTTCAACCT, SEQ ID NO. 153) and OGS 1078 (GCCCCACCCTCTACCCCACCACTA; SEQ ID NO. 154) for SEQ ID. NO. 32 was used to perform RT-PCR. As indicated by the expected PCR amplicon, increased expression of SEQ. ID. NO. 32 mRNA was evident in ovarian cancer and melanoma but weaker expression was detectable in CNS, breast, colon, lung, and renal cancer;
  • Fig. 88 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ. ID. NO. 33 in RNA samples derived from the NCI-60 panel of cancer cell lines.
  • OGS 1292 TATTAGTTGGGATGGTGGTAGCAC; SEQ. ID. NO. 231
  • OGS 1294 GAGAATTCGAGTCGACGATGAC; SEQ. ID. NO. 232
  • Fig 89 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 34 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair OGS 1242 (GAAATTGTGTTGACGCAGTCTCC, SEQ ID NO 233) and OGS 1243 (AGGCACACAACAGAGGCAGTTC, SEQ ID NO 234) for SEQ ID NO 34 was used to perform RT-PCR
  • OGS 1242 GAAATTGTGTTGACGCAGTCTCC, SEQ ID NO 233
  • OGS 1243 AGGCACACAACAGAGGCAGTTC, SEQ ID NO 234
  • Fig 90 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 35 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1 141 (GAGATCCTGATCAAGGTGCAGG, SEQ ID NO 155) and OGS 1 142 (TGCACGCTCACAGCAGTCAGG SEQ ID NO 156) for SEQ ID NO 35 was used to perform RT-PCR As indicated by the expected PCR amplicon increased expression of SEQ ID NO 35 mRNA was evident in ovarian lung and breast cancer but weakly in colon and CNS cancer,
  • Fig 91 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 36 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1280 (GTACATCAACCTCCTGCTGTCC, SEQ ID NO 235) and OGS 1281 (GACATCTCCAAGTCCCAGCATG, SEQ ID NO 236) for SEQ ID NO 36 was used to perform RT-PCR As indicated by the expected PCR amplicon, increased expression of SEQ ID NO 36 mRNA was evident in all cancer types,
  • Fig 92 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 37 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair OGS 1159 (AGTCTCTCACTGTGCCTTATGCC SEQ ID NO 237) and OGS 1160 (AGTCCTAAGAACTGTAAACG SEQ ID NO 238) for SEQ ID NO 37 was used to perform RT-PCR As indicated by the expected PCR amplicon increased expression of SEQ ID NO 37 mRNA was evident only in ovarian and renal cancer
  • Fig 93 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 38 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1202 (AACATGACTAAGATGCCCAACC, SEQ ID NO 157) and OGS 1203 (AATCTCCTTCACCTCCACTACTG.
  • Fig 94 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 39 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1310 (CATCTATACGTGGATTGAGGA, SEQ ID NO 239) and OGS 131 1 (ATAGGTACCAGGTATGAGCTG, SEQ ID NO 240) for SEQ ID NO 39 was used to perform RT-PCR
  • OGS 1310 CATCTATACGTGGATTGAGGA, SEQ ID NO 239)
  • OGS 131 1 ATAGGTACCAGGTATGAGCTG, SEQ ID NO 240
  • Fig 95 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 40 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1 155 (TGTCCACATCATCATCGTCATCC, SEQ ID NO 241 ) and OGS 1 156 (TGTCACTGGTCGGTCGCTGAGG, SEQ ID NO 242) for SEQ ID NO 39 was used to perform RT-PCR
  • OGS 1 155 TGTCCACATCATCATCATCGTCATCC, SEQ ID NO 241
  • OGS 1 156 TGTCACTGGTCGGTCGCTGAGG, SEQ ID NO 242
  • Fig 96 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 41 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • Fig 97 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 42 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1316 (CATGGGGCTTAAGATGTC, SEQ ID NO 243) and OGS 1317 (GTCGATTTCTCCATCATCTG, SEQ ID NO 244) for SEQ ID NO 42 was used to perform RT-PCR As indicated by the expected PCR amplicon increased expression of SEQ ID NO 42 mRNA was evident in all cancer types, Fig 98 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 43 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1306 (AAGAGGCGCTCTACTAGCCG, SEQ ID NO 245) and OGS 1307 (CTTTCCACATGGAACACAGG, SEQ ID NO 246) for SEQ ID NO 43 was used to perform RT-
  • Fig 100 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 45 in RNA samples derived from the NCI-60 panel of cancer cell lines A primer pair, OGS 1175 (ACACATCAAACTGCTTATCCAGG, SEQ ID NO 163) and OGS 1176 (ACTGATGTGAAAATGCACATCC.
  • FIG 101 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 46 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair OGS 1286 CATTTTCCTGGAATTTGATACAG, SEQ ID NO 247) and OGS 1287 (GTAGAGAGTTTATTTGGGCCAAG, SEQ ID NO 248) for SEQ ID NO 46 was used to perform RT-PCR
  • OGS 1286 CATTTTCCTGGAATTTGATACAG, SEQ ID NO 247
  • OGS 1287 GTAGAGAGTTTATTTGGGCCAAG
  • Fig 102 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 47 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1244 (CATCTATGGTAACTACAATCG, SEQ ID NO 249) and OGS 1245 (GTAGAAGTCACTGATCAGACAC, SEQ ID NO 250) for SEQ ID NO 47 was used to perform RT-PCR
  • OGS 1244 CATCTATGGTAACTACAATCG, SEQ ID NO 249
  • OGS 1245 GTAGAAGTCACTGATCAGACAC, SEQ ID NO 250
  • Fig 103 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 48 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair OGS 1282 (ATGGCTCATACAGCACTCAGG, SEQ ID NO 165) and OGS 1283 (GAACTGTCACTCCGGAAAGCCT, SEQ ID NO 166) for SEQ ID NO 48 was used to perform RT-PCR
  • Fig 104 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 50 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1035 (CTGCCTGCCAACCTTTCCATTTCT SEQ ID NO 251 ) and OGS 1036 (TGAGCAGCCACAGCAGCATTAGG, SEQ ID NO 252) for SEQ ID NO 50 was used
  • Fig 105 is a picture of RT-PCR data showing the differential expression data for the STAR selected ovarian cancer-related human SEQ ID NO 169 in RNA samples derived from the NCI-60 panel of cancer cell lines
  • a primer pair, OGS 1248 (CACCTGATCAGGTGGATAAGG, SEQ ID NO 253) and OGS 1249 (TCCCAGGTAGAAGGTGGAATCC, SEQ ID NO 254) for SEQ ID NO 169 was used to perform RT-PCR
  • OGS 1248 CACCTGATCAGGTGGATAAGG, SEQ ID NO 253
  • OGS 1249 TCCCAGGTAGAAGGTGGAATCC, SEQ ID NO 254
  • increased expression of SEQ ID NO 169 mRNA was evident in ovarian, renal, and lung cancer but weak in CNS cancer
  • the applicant employed a carefully planned strategy to identify and isolate genetic sequences involved in ovarian cancer
  • the process involved the following steps 1) preparation of highly representative cDNA libraries using mRNA isolated from LMPs and malignant ovarian cancer samples of human origin, 2) isolation of sequences upregulated in the malignant ovarian cancer samples, 3) identification and characterization of upregulated sequences, 4) selection of upregulated sequences for tissue specificity, 5) determination of knock-down effects on ovarian cancer cell line proliferation and migration, and 6) determination of the expression pattern of each upregulated sequence in samples derived from nine different cancer types
  • the results discussed in this disclosure demonstrate the advantage of targeting ovarian cancer- related genes that are highly specific to this differentiated cell type compared to normal tissues and provide a more efficient screening method when studying the genetic basis of diseases and disorders Polynucleotide and/or polypeptide sequences that are known but have not had a role assigned to them until the present disclosure have also been isolated and shown to have a critical role in ovarian cancer cell line proliferation and migration Finally, novel polynu
  • LMP and malignant ovarian tumor samples were selected based on histopathology to identify the respective stage and grade (Table B) .
  • LMP was choosen instead of normal ovarian tissue to avoid genes that associated with proliferation due to ovulation. Also very few cells would have been recovered and stromal cells would have been a major contaminant. LMP and serous (most common) ovarian tumors represent the extremes of tumorigenicity, differentiation and invasion.
  • TrizolTM InVitrogen, Grand Island, NY
  • Table B shows the pathologies including grade and stage of the different ovarian cancer samples used on the macroarrays.
  • the non-redundant clones are then used to prepare DNA micro-arrays, which are used to quantify their relative differential expression patterns by hybridization to fluorescent cDNA probes
  • Two classes of cDNA probes may be used, those which are generated from either RNA transcripts prepared from the same subtracted libraries (subtracted probes) or from mRNA isolated from different ovarian LMP and malignant samples (standard probes)
  • subtracted probes provides increased sensitivity for detecting the low abundance mRNA sequences that are preserved and enriched by STAR
  • the specificity of the differentially expressed sequences to malignant ovarian cancer is measured by hybridizing radio-labeled probes prepared from each selected sequence to macroarrays containing RNA from different LMP and malignant ovarian cancer samples and different normal human tissues
  • RNA Amplification Procedure U S Patent Application No 11/000,958 published under No US 2005/0153333A1 on July 14, 2005 and entitled "Selective Terminal Tagging of Nucleic Acids"
  • RNA from five human ovarian LMP samples (MF-15, -16, -18, -19 and - 20) (Table B) and five malignant ovarian cancer samples (MF-22, -25, -27, -28 and - 30) (Table B) (CHUM, Montreal, QC) were prepared as described above Following a slight modification of the teachings of Malek et al , 1998 (U S Patent No 5,712,127) i e , preparation of the cDNA libraries on the paramagnetic beads as described below), 1 ⁇ g of total RNA from each sample were used to prepare highly representative cDNA libraries on streptavidin-coated paramagnetic beads (InVitrogen, Grand Island, NY) for preparing tester and driver materials In each case, first-strand cDNA was synthesized using an oligo dT ⁇ primer with 3' locking nucleotides (e g , A G or C), a 5'-b ⁇ ot ⁇ n moiety and containing a Not I recognition site (OGS 3
  • RNA was converted to double-stranded cDNA by performing first-strand cDNA synthesis as described above followed by primer-directed (primer OGS 494 (SEQ ID NO 95) for TAG1 and primer OGS 302 (SEQ ID NO 96) for TAG2) second-strand DNA synthesis using Advantage-2 Taq polymerase (BD Biosciences Clontech, Mississauga, ON)
  • primer-directed primer OGS 494 (SEQ ID NO 95) for TAG1
  • primer OGS 302 SEQ ID NO 96
  • Advantage-2 Taq polymerase BD Biosciences Clontech, Mississauga, ON
  • the double-stranded cDNA was purified using Qiaquick columns and quantified at A 26 o ⁇ m Thereafter, 6x 1- ⁇ g aliquots of each double-stranded cDNA was digested individually with one of the following 4-base recognition restriction enzymes Rsa I 1 Sau3A1 , Mse I, Msp I, HmPI I and Bs
  • Tester 1 (MF-22) - human malignant ovarian cancer donor 1
  • Tester 2 (MF-25) - human malignant ovarian cancer donor 2
  • Tester 3 (MF-27) - human malignant ovarian cancer donor 3
  • Tester 4 (MF-28) - human malignant ovarian cancer donor 4
  • Tester 5 (MF-30) - human malignant ovarian cancer donor 5
  • Driver 1 (MF-15) - human ovarian LMP donor 1
  • Driver 2 (MF-16) - human ovarian LMP donor 2
  • Driver 3 (MF-18) - human ovarian LMP donor 3
  • Driver 4 (MF-19) - human ovarian LMP donor 4
  • Driver 5 (MF-20) - human ovarian LMP donor 5
  • each tester RNA sample was subtracted following the teachings of U S patent No 5,712,127 with the pooled driver DNA (MF-15, -16, -18, -19 and -20) in a ratio of 1 100 for 2-rounds following the teachings of Malek et al , 1998 (U S Patent No 5,712,127) Additionally, control reactions containing tester RNA and no driver DNA, and tester RNA plus driver DNA but no RNase H were prepared The tester RNA remaining in each reaction after subtraction was converted to double-stranded DNA, and a volume of 5% removed and amplified in a standard PCR reaction for 30-cycles for analytical purposes The remaining 95% of only the tester-driver plus RNase H subtracted samples after 2-rounds were amplified for 4-cycles in PCR, digested with Asc I and Not I restriction enzymes, and one half ligated into the pCATRMAN (SEQ ID NO 99) plasmid vector and the other half, into the p20 (SEQ ID NO 100) plasmid vector The ligated materials
  • CCNE1 a probe specific for CCNE1 (Accession # NMJD01238, a gene known to be upregulated in malignant ovarian cancer, indicated that it was not subtracted (Fig. 51 , Panel C). Based on these results, it was anticipated that the subtracted libraries would be enriched for differentially expressed upregulated sequences.
  • PCR reactions were desalted using the 96-well filter plates (Coming) and the amplicons recovered in 100 ⁇ L 1OmM Tris (pH 8.0). A 5- ⁇ L aliquot of each PCR reaction was visualized on a 1.5% agarose gel containing ethidium bromide and only those reactions containing a single amplified product were selected for DNA sequence analysis using standard DNA sequencing performed on an ABI 3100 instrument (Applied Biosystems, Foster City, CA). Each DNA sequence obtained was given a Sequence Identification Number and entered into a database for subsequent tracking and annotation.
  • PCR amplicons representing the annotated sequences from the pCATRMAN libraries described above were used to prepare DNA microarrays
  • the purified PCR amplicons contained in 70 ⁇ l_ of the PCR reactions prepared in the previous section was lyophihzed and each reconstituted in 20 ⁇ L of spotting solution comprising 3xSSC and 0 1% sarkosyl DNA micro-arrays of each amplicon in triplicate were then prepared using CMT-GAP2 slides (Corning, Corning, NY) and the GMS 417 spotter (Affymet ⁇ x, Santa Clara, CA)
  • the DNA micro-arrays were then hybridized with either standard or subtracted cy3 and cy5 labelled cDNA probes as recommended by the supplier (Amersham Biosciences, Piscataway, NJ)
  • the standard cDNA probes were synthesized using RAMP amplified RNA prepared from the different human ovarian LMP and malignant samples It is well known to the skilled artisan that standard cDNA probes only provide limited sensitivity of detection and consequently, low abundance sequences contained in the cDNA probes are usually missed Thus, the hybridization analysis was also performed using cy3 and cy5 labelled subtracted cDNA probes prepared from in vitro transcribed RNA generated from subtracted libraries (SLP123 to SLP127 and SLP133 to SLP137) cloned into the p20 plasmid vector and represent the different tester and driver materials
  • These subtracted libraries may be enriched for low abundance sequences as a result of following the teachings of Malek et al , 1998 (U S Patent No 5,71
  • the differentially expressed sequences identified in Section F for the different human malignant ovarian cancer subtracted libraries were tested for specificity by hybridization to nylon membrane-based macroarrays
  • the macroarrays were prepared using RAMP amplified RNA from 6 LMP and 20 malignant human ovarian samples, and 30 normal human tissues (adrenal, liver, lung, ovary, skeletal muscle, heart, cervix, thyroid, breast, placenta, adrenal cortex, kidney, vena cava, fallopian tube, pancreas, testicle, jejunum, aorta, esophagus, prostate, stomach, spleen, ileum, trachea, brain, colon, thymus, small intestine, bladder and duodenum) purchased commercially (Ambion, Austin, TX)
  • RAMP RNA prepared from breast cancer cell lines, MDA and MCF7, prostate cancer cell line, LNCap, and a normal and prostate cancer LCM microdissected sample
  • RT-PCR was used to determine the specificity of expression Using the same RAMP RNA samples that were spotted on the macroarrays, 500 ⁇ g of RNA was converted to single-stranded cDNA with Thermoscript RT (Invitrogen, Burlington, ON) as described by the manufacturer The cDNA reaction was diluted so that 1/200 of the reaction was used for each PCR experiment After trial PCR reactions with gene-specific primers designed against each SEQ ID NOs to be tested, the linear range of the reaction was determined and applied to all samples, PCR was conducted in 96-well plates using Hot-Start Taq Polymerase from Qiagen (Mississauga,
  • Fig 1-49 and 51 show the macroarray hybridization signal patterns and RT- PCR amplification data for the malignant ovarian cancer and normal human tissues relative to LMPs for the 50 sequences isolated and selected for biological validation Amongst the 50 selected sequences, 27 were associated with genes having functional annotation 15 were associated with genes with no functional annotation and 8 were novel sequences (genomic hits) The identification of gene products involved in regulating the development of ovarian cancer has thus led to the discovery of highly specific, including novel targets, for the development of new therapeutic strategies for ovarian cancer management Representative sequences summarized in Table 2 are presented below and corresponding sequences are illustrated in Table 4
  • the present invention thus relates in one aspect thereof to a method of representatively identifying a differentially expressed sequence involved in ovarian cancer
  • the sequence may be, for example, differentially expressed in a malignant ovarian cancer cell compared to a LMP ovarian cancer cell or normal ovarian cells
  • the sequence may be, for example differentially expressed in a malignant ovarian cancer cell and a LMP ovarian cancer cell compared to a normal ovarian cell
  • the method of the present invention may comprise the following steps or some of the following steps, a) separately providing total messenger RNA from malignant and LMP ovarian cancer cells, and normal ovarian cells, the total messenger RNA may comprise, for example, at least one endogeneously differentially expressed sequence, b) generating (e g , single copy) of a) single-stranded cDNA from each messenger RNA of malignant ovarian cancer cell and (e g , randomly) tagging the 3'-end of the single-stranded cDNA with a RNA polymerase promoter sequence and a first sequence tag, c) generating (e g , single copy) of a) single-stranded cDNA from each messenger RNA of LMP ovarian cancer cells or normal ovarian cell and (e g , randomly) tagging the 3'-end of the single-stranded cDNA with a RNA polymerase promoter sequence and a second sequence tag, d) separately generating partially or completely double-
  • the method may further comprise the step of comparatively determining the presence of the identified differentially expressed sequence in a cancer cell relative to a normal cell (e g , a normal ovarian cell, a normal prostate cell, a normal breast cell etc ) or relative to a standard value
  • the method may be used to preferentially identify a sequence which is upregulated in malignant ovarian cancer cell compared to a cell from a low malignancy potential ovarian cancer and/or compared to a normal cell
  • a sequence may be further selected based on a reduced, lowered or substantially absent expression in a subset of other normal cell (e g , a normal ovarian cell) or tissue, therefore representing a candidate sequence specifically involved in ovarian cancer
  • the method may also further comprise a step of determining the complete sequence of the nucleotide sequence and may also comprise determining the coding sequence of the nucleotide sequence
  • a sequence may also be selected for its specificity to other types of tumor cells, thus identifying a sequence having a more generalized involvement in the development of cancer These types of sequence may therefore represent desirable candidates having a more universal utility in the treatment and/or detection of cancer
  • the present invention also relates in a further aspect, to the isolated differentially expressed sequence (polynucleotide and polypeptide) identified by the method of the present invention
  • the candidate STAR sequence for SEQ ID NO 1 maps to a genomic hit and est hits according to NCBI's nr and est databases (see Table 2) Although, the matching ests are clustered into a new Unigene identifier number, Hs 555871 , the STAR sequence does not map to any of the known mRNA sequences listed in this cluster, which codes for guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 (GNGT1)
  • G protein guanine nucleotide binding protein
  • GNGT1 gamma transducing activity polypeptide 1
  • the candidate protein encoded by the isolated SEQ ID NO 2 is associated with a previously identified gene that encodes a predicted polypeptide, interferon- induced protein 44-l ⁇ ke (IFI44L) with an unknown function (see Table 2)
  • IFI44L interferon- induced protein 44-l ⁇ ke
  • the candidate protein encoded by the isolated SEQ ID NO 3 is associated with a previously identified gene that encodes a known polypeptide, HOX D1 , which contains a homeobox DNA-binding domain
  • This gene is a member of the Antp homeobox family and is nuclear sequence-specific transcription factor that is previously known to be involved in differentiation and limb development (see Table 2)
  • Table 2 We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and the normal human tissues ( Figure 3), which have not been previously reported Thus, it is believed that the gene may be required for, or involved in ovarian cancer tumorigenesis as well
  • the candidate protein encoded by the isolated SEQ ID NO 4 is associated with a previously identified gene that encodes a hypothetical polypeptide, LOC92196, similar to death-associated protein with an unknown function (see Table 2)
  • LOC92196 a hypothetical polypeptide
  • Table 2 We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 4), which have not been previously reported Thus, it is believed that expression of this gene may be required for, or involved in ovarian cancer tumorigenesis
  • the candidate protein encoded by the isolated SEQ ID NO 5 is associated with a previously identified gene that encodes a predicted polypeptide, interferon- induced protein with tetratricopeptide repeats 1 (IFIT1) with unknown function (see Table 2)
  • IFIT1 interferon- induced protein with tetratricopeptide repeats 1
  • the candidate protein encoded by the isolated SEQ ID NO 6 is associated with a previously identified gene that encodes a known protein, glycine dehydrogenase (GLDC) (decarboxylating, glycine decarboxylase, glycine cleavage system protein P), which is a mitochondrial enzyme that catalyzes the degradation of glycine (see Table 2)
  • GLDC glycine dehydrogenase
  • the candidate protein encoded by the isolated SEQ. ID. N0:7 is associated with a previously identified gene that encodes a protein, dipeptidase 3 (DPEP3), which has membrane dipeptidase (proteolysis and peptidolysis) activity (see Table 2).
  • DPEP3 dipeptidase 3
  • Table 2 membrane dipeptidase (proteolysis and peptidolysis) activity
  • the candidate protein encoded by the isolated SEQ. ID. NO:8 is associated with a previously identified gene that encodes a protein, neuromedin U (NMU), which is a neuropeptide with potent activity on smooth muscle (see Table 2).
  • NMU neuromedin U
  • FIG. 8 The candidate protein encoded by the isolated SEQ. ID. NO:8 is associated with a previously identified gene that encodes a protein, neuromedin U (NMU), which is a neuropeptide with potent activity on smooth muscle.
  • the candidate protein encoded by the isolated SEQ. ID. NO 9 is associated with a previously identified gene that encodes a protein, bone morphogenetic protein 7 (BMP7), which plays a role in calcium regulation and bone homeostasis (see Table 2)
  • BMP7 bone morphogenetic protein 7
  • Table 2 We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 9), which have not been previously reported. Thus, it is believed that expression of the gene may be required for, or involved in ovarian cancer tumorigenesis.
  • the candidate protein encoded by the isolated SEQ. ID. NO: 10 is associated with a previously identified gene that encodes a protein, cyclin-dependent kinase inhibitor 3 (CDKN3) (CDK2-assoc ⁇ ated dual specificity phosphatase), which is expressed at the G1 to S transition of the cell cycle (see Table 2)
  • CDKN3 cyclin-dependent kinase inhibitor 3
  • Figure 10 a majority of normal human tissues
  • the candidate protein encoded by the isolated SEQ ID NO 11 is associated with a previously identified gene that encodes a protein CDC28 protein kinase regulatory subunit 1 B (CKS1B), which has cyclin-dependent protein kinase activity in cell cycle regulation (see Table 2)
  • CKS1B protein CDC28 protein kinase regulatory subunit 1 B
  • Table 2 cyclin-dependent protein kinase activity in cell cycle regulation
  • the candidate protein encoded by the isolated SEQ ID NO 12 is associated with a previously identified gene that encodes a protein, preferentially expressed antigen in melanoma (PRAME), which has no known function (see Table 2)
  • PRAME preferentially expressed antigen in melanoma
  • the candidate protein encoded by the isolated SEQ ID NO 13 is associated with a previously identified gene that encodes a protein, ISG15 ubiquitin-like modifier (ISG 15), which is associated with ubiquitin-dependent protein catabolism (see Table 2)
  • ISG 15 ISG15 ubiquitin-like modifier
  • Table 2 ISG 15 ubiquitin-dependent protein catabolism
  • SEQ. ID. NO:14 The candidate STAR sequence represented by the isolated SEQ ID NO 14 is associated with a previously identified partial gene sequence related to Accession # AI922121 1 (see Table 2), which codes for a yet unknown protein
  • this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 14), which have not been previously reported
  • expression of the gene corresponding to this STAR sequence may be required for, or involved in ovarian cancer tumo ⁇ genesis
  • the candidate protein encoded by the isolated SEQ ID NO 15 is associated with a previously identified gene that encodes a hypothetical protein, FLJ33790 which has no known function (see Table 2)
  • a hypothetical protein FLJ33790 which has no known function
  • the STAR sequence represented by the isolated SEQ ID NO 16 maps to a previously identified est, BG213598 that is from a transcribed genomic locus contained in the Unigene cluster, Hs 334302, which encodes a yet unknown protein (see Table 2)
  • Hs 334302 which encodes a yet unknown protein (see Table 2)
  • the candidate protein encoded by the isoalted SEQ ID NO 17 is associated with a previously identified gene that encodes a protein, V-set domain containing T cell activation inhibitor 1 (VTCN1), which has no known function (see Table 2)
  • VTCN1 T cell activation inhibitor 1
  • the candidate protein encoded by the isolated SEQ ID NO 18 is associated with a previously identified gene that encodes a protein, kinesin family member 2OA (KIF20A), which is involved in cell division in and membrane traffic within the Golgi apparatus (see Table 2)
  • KIF20A kinesin family member 2OA
  • Table 2 kinesin family member 2OA
  • the STAR sequence represented by the isolated SEQ ID NO 19 maps to a genomic hit, Accession #AY769439 and to a group of ests represented by Accession # AA744939
  • the ests are clustered into Unigene identifier, Hs 478368 representing the protein, potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2)
  • Hs 478368 representing the protein, potassium large conductance calcium-activated channel, subfamily M, beta member 2
  • KCNMB2 beta member 2
  • the STAR sequence represented by the isolated SEQ ID NO 20 maps to a previously identified est, BU595315 belonging to a group of ests that is from a transcribed genomic locus contained in the Unigene cluster, Hs 603908, which encodes a yet unknown protein (see Table 2)
  • Hs 603908 which encodes a yet unknown protein
  • Unigene cluster may be required for, or involved in ovarian cancer tumorigenesis
  • the candidate protein encoded by the isolated SEQ ID NO 21 is a previously identified gene that encodes a protein, chemokine (C-X-C motif) ligand 10 (CXCL10), which has chemokine activity (see Table 2)
  • CXCL10 chemokine (C-X-C motif) ligand 10
  • Table 2 chemokine activity
  • the STAR sequence represented by the isolated SEQ ID NO 22 maps to chromosome 14, and may represent a portion of an unknown gene sequence (see Table 2)
  • This STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 22), which have not been previously reported
  • expression of the gene corresponding to this STAR sequence may be required for or involved in ovarian cancer tumorigenesis
  • the candidate protein encoded by the isolated SEQ ID NO 23 is a previously identified gene that encodes a protein, asparagine-linked glycosylation 8 homolog (yeast, alpha-1 ,3-glucosyltransferase) (ALG8), which catalyzes the addition of the second glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation of proteins (see Table 2)
  • ALG8 asparagine-linked glycosylation 8 homolog
  • the candidate protein encoded by the isolated SEQ ID NO 24 is a previously identified gene that encodes a protein, kidney associated antigen 1 (KAAG1), which has no known function (see Table 2)
  • KAAG1 kidney associated antigen 1
  • the candidate protein encoded by the isolated SEQ ID NO 25 is a previously identified gene that encodes a protein, cychn-dependent kinase inhibitor 2A (CDKN2A), which is involved in cell cycle control, G1/S Checkpoint (see Table 2)
  • CDKN2A cychn-dependent kinase inhibitor 2A
  • G1/S Checkpoint see Table 2
  • the candidate protein encoded by the isolated SEQ ID NO 26 is a previously identified gene that encodes a protein, microtubule-associated protein homolog (Xenopus laevis) (TPX2), which is involved in cell proliferation from the transition G1/S until the end of cytokinesis (see Table 2)
  • TPX2 microtubule-associated protein homolog
  • Table 2 we have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 26), which have not been previously reported Thus, it is believed that expression of the gene may be required for, or involved in ovarian cancer tumorigenesis
  • SEQ. ID. NO:27 The candidate protein encoded by the isolated SEQ ID NO 27 is a previously identified gene that encodes a protein, ubiquitin-conjugating enzyme E2C (UBE2C), which is required for the destruction of mitotic cyclins and for cell cycle progression (see Table 2)
  • UBE2C ubiquitin-conjugating enzyme
  • the STAR sequence represented by the isolated SEQ ID NO 28 maps to cDNA FLJ35538 fis, clone SPLEN2002463 of Unigene cluster, Hs 590469 and may represent a portion of an unknown gene sequence (see Table 2)
  • This STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (Figure 28), which have not been previously reported
  • expression of the gene correspondong to this STAR sequence (and polynucleotides comprising this STAR sequence) or a related gene member as is outlined in the Unigene cluster may be required for or involved in ovarian cancer tumorigenesis
  • the candidate protein encoded by the isolated SEQ ID NO 29 is a previously identified gene that encodes a protein, cellular retinoic acid binding protein 2 (CRABP2), whose function has not been precisely determined but this isoform is important in retinoic acid-mediated regulation of human skin growth and differentiation (see Table 2)
  • CRABP2 cellular retinoic acid binding protein 2
  • the candidate protein encoded by the isolated SEQ ID NO 30 is a previously identified gene that encodes a protein, Histone 3 H2a (HIST3H2A) which is involved in nucleosome formation (see Table 2)
  • HIST3H2A Histone 3 H2a
  • Table 2 We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 30), which have not been previously reported.
  • expression of the gene may be required for, or involved in ovarian cancer tumorigenesis.
  • the candidate protein encoded by the isolated SEQ. ID. NO:31 is a previously identified gene that encodes a protein, Histone 1 , H4h (HIST1 H4H), which is involved in nucleosome formation (see Table 2).
  • Histone 1 , H4h HIST1 H4H
  • Table 30 we have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 30), which have not been previously reported.
  • expression of the gene may be required for, or involved in ovarian cancer tumorigenesis.
  • the candidate protein encoded by the isolated SEQ. ID. NO:32 is a previously identified gene that encodes a hypothetical protein, Homeo box D3 (HOXD3), which is a nuclear transcription factor involved in development and differentiation (see Table 2).
  • HXD3 Homeo box D3
  • the candidate protein encoded by the isolated SEQ. ID. NO:33 is a previously identified gene that encodes a member of the immunoglobulin gene family, immunoglobulin constant gamma 1 (IGHG1), which probably plays a role in immune response and antigen binding (see Table 2).
  • IGHG1 immunoglobulin constant gamma 1
  • the candidate protein encoded by the isolated SEQ ID NO 34 is a previously identified gene that encodes a member of the immunoglobulin gene family, immunoglobulin kappa constant (IGKC), which probably plays a role in immune response and antigen bunding (see Table 2)
  • IGKC immunoglobulin kappa constant
  • Table 2 we have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (Figure 34), which have not been previously reported
  • the expression pattern of this gene is similar to two other genes disclosed here, SEQ ID NO 33 and SEQ ID NO 47 which also encode immunoglobulins This type of clustered immunoglobulin expression in ovarian cancer has not been previously described Thus, it is believed that expression of the gene may be required for ovarian cancer tumorigenesis
  • the candidate protein encoded by the isolated SEQ ID NO 35 is a gene located on chromosome 10 that encodes an open reading frame of unknown function (see Table 2)
  • the gene may encode a protein termed astrop ⁇ ncin that was found to be expressed in a critical region in DiGeorge syndrome
  • expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (Figure 35), which have not been previously reported Thus, it is believed that expression of the gene may be required for, or involved in ovarian cancer tumorigenesis
  • the candidate protein encoded by the isolated SEQ ID NO 36 is a previously identified gene that encodes a protein, histocompatibility (minor) 13 (HM13), which has no known function (see Table 2)
  • HM13 histocompatibility 13
  • Table 2 we have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 36), which have not been previously reported Thus, it is believed that expression of the gene may be required for, or involved in ovarian cancer tumorigenesis
  • SEQ. ID. NO:37 The STAR sequence represented by the isolated SEQ ID NO 37 maps to chromosome 13, and may represent a portion of an unknown gene sequence (see Table 2) We have demonstrated that this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 37), which have not been previously reported Thus, it is believed that expression of the gene corresponding to this STAR sequence (and polynuclotides comprising this STAR sequence) may be required for, or involved in ovarian cancer tumorigenesis
  • the candidate protein encoded by the isolated SEQ ID NO 38 is a previously identified gene that encodes a protein, frizzled-related protein (FRZB), which is associated with symptomatic osteoarthritis and may play a role in skeletal morphogenesis (see Table 2)
  • FRZB frizzled-related protein
  • the candidate protein encoded by the isolated SEQ ID NO 39 is a previously identified gene that encodes a protein, forkhead box M1 (FOXM1), which is a transcription factor that regulates genes involved in cell proliferation (see Table 2)
  • FOXM1 forkhead box M1
  • Table 2 we have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 39), which have not been previously reported Thus, it is believed that expression of the gene may be required for, or involved in ovarian cancer tumorigenesis
  • the candidate protein encoded by the isolated SEQ ID NO 40 is a gene located on chromosome 20 that encodes an open reading frame of unknown function (see Table 2)
  • the gene is predicted to encode a membrane protein
  • the STAR sequence represented by the isolated SEQ ID NO 41 maps to chromosome 1 , and may represent a portion of an unknown gene sequence (see Table 2)
  • Weak homology has been found between SEQ ID NO 41 and the envelop proteins present at the surface of human endogenous retroviruses
  • this STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 41), which have not been previously reported
  • expression of the gene corresponding to this STAR sequence (and polynuclotides comprising this STAR sequence) may be required for, or involved in ovarian cancer tumorigenesis
  • SEQ. ID. NO:42 The candidate protein encoded by the isolated SEQ ID NO 42 is a gene located on chromosome 16 that encodes an open reading frame of unknown function (see Table 2) The gene is predicted to encode a membrane protein We have demonstrated that expression of this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LIvIP samples and a majority of normal human tissues ( Figure 42), which have not been previously reported Thus, it is believed that expression of the gene may be required for, or involved in ovarian cancer tumorigenesis
  • the candidate protein encoded by the isolated SEQ ID NO 43 is a previously identified gene that encodes a protein, Rac GTPase activating protein 1 (RACGAP1), which is a GTPase that interacts with Rho GTPases to control many cellular processes (see Table 2)
  • RCGAP1 Rac GTPase activating protein 1
  • the candidate protein encoded by the isolated SEQ. ID NO 44 is a gene that encodes transmembrane protein 19 (TMEM19) that has no known function (see Table 2)
  • TMEM19 transmembrane protein 19
  • Table 2 The gene is predicted to encode a membrane protein
  • the STAR sequence represented by the isolated SEQ ID NO 45 maps to chromosome 4, and may represent a portion of an unknown gene sequence (see
  • the STAR sequence represented by the isolated SEQ ID NO 46 maps to chromosome 1 , and may represent a portion of an unknown gene sequence (see
  • the candidate protein encoded by the isolated SEQ ID NO 47 is a previously identified gene with the Unigene cluster, Hs 449585 and may represent a portion immunoglobulin lambda locus (IGLV@) which probably plays a role in immune response and antigen bunding (see Table 2)
  • IGLV@ immunoglobulin lambda locus
  • the candidate protein encoded by the isolated SEQ. ID. NO:48 is a previously identified gene that encodes a protein, secretory carrier membrane protein 3 (SCAMP3), which functions as a cell surface carrier protein during vesicular transport (see Table 2).
  • SCAMP3 secretory carrier membrane protein 3
  • the STAR sequence represented by the isolated SEQ. ID. NO:49 maps to chromosome 2, and may represent a portion of an unknown gene sequence (see Table 2).
  • This STAR clone sequence is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues (Figure 49), which have not been previously reported.
  • expression of the gene corresponding to this STAR sequence (and polynuclotides comprising this STAR sequence) may be required for, or involved in ovarian cancer tumorigenesis.
  • the candidate protein encoded by the isolated SEQ. ID. NO:50 is a previously identified gene that encodes a protein, Folate receptor 1 (adult) (FOLR1), with members of this gene family having a high affinity for folic acid and for several reduced folic acid derivatives, and mediate delivery of 5-methyltetrahydrofolate to the interior of cells (see Table 2).
  • FOLR1 Folate receptor 1
  • the candidate protein encoded by the isolated SEQ ID NO 169 is a previously identified gene that encodes a protein, ceruloplasmin (CP), that binds most of the copper in plasma and is involved in the peroxidation of Fe(I I transferrin
  • CP ceruloplasmin
  • aceruloplasminemia leads to iron accumulation and tissue damage and is associated diabetes and neurologic diseases (see Table 2)
  • aceruloplasminemia leads to iron accumulation and tissue damage and is associated diabetes and neurologic diseases (see Table 2)
  • this gene is markedly upregulated in malignant ovarian cancer samples compared to ovarian LMP samples and a majority of normal human tissues ( Figure 56) which have not been previously reported
  • expression of the gene corresponding to this STAR sequence and polynuclotides comprising this STAR sequence
  • RNA interference is a recently discovered gene regulation mechanism that involves the sequence-specific decrease in a gene's expression by targeting the mRNA for degradation and although originally described in plants, it has been discovered across many animal kingdoms from protozoans and invertebrates to higher eukaryotes (reviewed in Agrawal et al 2003)
  • Dicer an RNAse Ill-like protein active in cells
  • the siRNA in a homology-d ⁇ ven manner, complexes into a RNA-protein amalgamation termed RISC (RNA-induced silencing complex) in the presence of mRNA to cause degradation resulting in attenuation of that mRNA's expression (Agrawal et al , 2003)
  • RNA interference is proving to be a method of choice for the analysis of a large number of genes in a quick and relatively inexpensive manner
  • transfection of synthetic siRNAs is an efficient method, the effects are often transient at best (Hannon G J , 2002) Delivery of plasmids expressing short hairpin RNAs by stable transfection has been successful in allowing for the analysis of RNA interference in longer-term studies (Brummelkamp et al , 2002 Elbashir et al , 2001 ) /- Determination of knockdown effects on the proliferation of ovarian cancer cell lines
  • shRNA sequences were chosen based on their upregulation in ovarian tumors and the selective nature of their expression in these tumors compared to other tissues as described above.
  • the design of shRNA sequences was performed using web-based software that is freely available to those skilled in the art (Qiagen for example) These chosen sequences, usually 19-mers, were included in two complementary oligonucleotides that form the template for the shRNAs, i e the 19-nt sense sequence, a 9-nt linker region (loop), the 19-nt antisense sequence followed by a 5-6 poly-T tract for termination of the RNA polymerase III Appropriate restriction sites were inserted at the ends of these oligonucleotides to facilitate proper positioning of the inserts so that the transcriptional start point is at a precise location downstream of the hU6 promoter
  • TOV-21G or TOV-112D cells were seeded in 6-well plates in OSE (Samouelian et al , 2004) containing 10% fetal bovine serum at a density of 600 000 cells/well, allowed to plate overnight and transfected with 1 ⁇ g of pSil-shRNA plasmid ( Figure 53, sh-1 and sh-2) using the Fugene 6 reagent (Roche, Laval, QC) After 16h of incubation, fresh medium was added containing 2 ⁇ g/ml puromycin (Sigma, St Louis, MO) to select for stable transfectants Control cells were transfected with a control pSil (sh-scr (SEQ ID NO 102) that contains a scrambled shRNA sequence that displays homology to no known human gene After approximately 4-5 days, pools and/or individual clones of cells were isolated and expanded for further analyses The effectiveness of attenuation was verified in all shRNA cells lines Total RNA was prepared by standard methods using TrizolTM reagent from cells
  • each shRNA-expressing cell line was determined and compared to cells expressing the scrambled shRNA (control) Cell number was determined spectrophotomet ⁇ cally by MTT assay at 570 nm (Mosmann, 1983) After selection of stably shRNA expressing pools and expansion of the lines, 5 000 cells/well of each cell lines was plated in 48-well plates in triplicate and incubated for 4 days under standard growth conditions Representative data from 2 experiments ⁇ SEM is displayed and experiments were typically repeated at least three times to confirm the results observed Figure 53 shows representative results that were obtained when the proliferation assay was applied to stable TOV-21 G cells lines The cell number after 4 days in the control cell line expressing the scrambled shRNA (Figure 53, sh scr) was arbitrarily set to 100% TOV-21G cell lines containing shRNA against SEQ ID NO 1 (sh-1 SEQ ID NO 103 and sh-2 SEQ ID NO 104), SEQ ID NO 3 (sh-1 SEQ ID NO 107 and sh-2 SEQ ID NO 108)
  • a colony survival assay was used to determine the requirement of the selected genes in the survival of the cancer cells.
  • the 'colony formation assay' or 'clonogenic assay' is a classical test to evaluate cell growth after treatment.
  • the assay is widespread in oncological research areas where it is used to test the proliferating power of cancer cell lines after radiation and/or treatment with anticancer agents. It was expected that the results obtained when analyzing the genes that were functionally important in ovarian cancer would correlate between the growth inhibition study and the colony survival assay.
  • TOV-21 G cells were seeded in 12-well plates at a density of 50 000 cells/well and transfected 24h later with 1 ⁇ g of pSil-shRNA vector, the same plasmids used in the previous assay. The next day, fresh medium was applied containing 2 ⁇ g/ml puromycin and the selection of the cells was carried out for 3 days. The cells were washed and fresh medium without puromycin was added and growth continued for another 5 days. To visualize the remaining colonies, the cells were washed in PBS and fixed and stained simultaneously in 1% crystal violet/10% ethanol in PBS for 15 minutes at room temperature. Following extensive washing in PBS, the dried plates were scanned for photographic analysis.
  • the amount of TOV-21G-derived colonies that survived correlated with the growth inhibition data.
  • the growth inhibition in the proliferation assay ( Figure 53) and cell death in the colony assay ( Figure 54) was greater in TOV-21G cells containing shRNA-2 compared to shRNA-1 for SEQ. ID. NO. 1 (0094) (0094-sh2 stronger than 0094-sh1) and SEQ. ID. NO. 3 (0671) (0671-sh2 stronger than 0671-sh1) whereas, for SEQ. ID. NO.
  • RNA samples were obtained from the Developmental Therapeutics Program at the NCI/NIH.
  • RNA samples that amplified from the total RNA samples obtained from the NCI 500 ⁇ g of RNA was converted to single-stranded cDNA with Thermoscript RT (Invitrogen, Burlington, ON) as described by the manufacturer
  • the cDNA reaction was diluted so that 1/200 of the reaction was used for each PCR experiment.
  • the linear range of the reaction was determined and applied to all samples, PCR was conducted in 96-well plates using Hot-Start Taq Polymerase from Qiagen (Mississauga, ON) in a DNA Engine Tetrad from MJ Research.
  • mammal(s) for purposes of this disclosure refers to any animal classified as a mammal, including humans, domestic and farm animals and zoo, sports or pet animals, such as dogs cats cattle horses, sheep pigs, goats rabbits etc
  • mammal is human

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Reproductive Health (AREA)
  • General Engineering & Computer Science (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pregnancy & Childbirth (AREA)
  • Gynecology & Obstetrics (AREA)
PCT/CA2007/001134 2006-06-23 2007-06-22 Polynucleotides and polypeptide sequences involved in cancer Ceased WO2007147265A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
JP2009515683A JP5564249B2 (ja) 2006-06-23 2007-06-22 癌に関与するポリヌクレオチド配列およびポリペプチド配列
AU2007262635A AU2007262635B2 (en) 2006-06-23 2007-06-22 Polynucleotides and polypeptide sequences involved in cancer
CA2655933A CA2655933C (en) 2006-06-23 2007-06-22 Polynucleotides and polypeptide sequences involved in cancer
ES07720048.3T ES2444695T3 (es) 2006-06-23 2007-06-22 Polinucleótidos y polipéptidos implicados en el cáncer
US12/305,648 US8216582B2 (en) 2006-06-23 2007-06-22 Polynucleotides and polypeptide sequences involved in cancer
EP16203468.0A EP3231442B1 (en) 2006-06-23 2007-06-22 Polynucleotides and polypeptide sequences involved in cancer
DK07720048.3T DK2032701T3 (da) 2006-06-23 2007-06-22 Polynukleotider og polypeptider, der er inddraget i cancer
EP07720048.3A EP2032701B1 (en) 2006-06-23 2007-06-22 Polynucleotides and polypeptides involved in cancer
US13/152,209 US20120128661A1 (en) 2006-06-23 2011-06-02 Polynucleotide and polypeptide sequences involved in cancer
US13/490,857 US20120288498A1 (en) 2006-06-23 2012-06-07 Polynucleotides and polypeptide sequences involved in cancer
US14/690,562 US20160039930A1 (en) 2006-06-23 2015-04-20 Polynucleotides and polypeptide sequences involved in cancer
US15/863,594 US20180346563A1 (en) 2006-06-23 2018-01-05 Polynucleotides and polypeptide sequences involved in cancer

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US81582906P 2006-06-23 2006-06-23
US60/815,829 2006-06-23
US87447106P 2006-12-13 2006-12-13
US60/874,471 2006-12-13

Related Child Applications (3)

Application Number Title Priority Date Filing Date
US12/305,648 A-371-Of-International US8216582B2 (en) 2006-06-23 2007-06-22 Polynucleotides and polypeptide sequences involved in cancer
US13/152,209 Continuation-In-Part US20120128661A1 (en) 2006-06-23 2011-06-02 Polynucleotide and polypeptide sequences involved in cancer
US13/490,857 Division US20120288498A1 (en) 2006-06-23 2012-06-07 Polynucleotides and polypeptide sequences involved in cancer

Publications (1)

Publication Number Publication Date
WO2007147265A1 true WO2007147265A1 (en) 2007-12-27

Family

ID=38833043

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2007/001134 Ceased WO2007147265A1 (en) 2006-06-23 2007-06-22 Polynucleotides and polypeptide sequences involved in cancer

Country Status (8)

Country Link
US (4) US8216582B2 (https=)
EP (3) EP2502628B1 (https=)
JP (2) JP5564249B2 (https=)
AU (1) AU2007262635B2 (https=)
CA (1) CA2655933C (https=)
DK (1) DK2032701T3 (https=)
ES (1) ES2444695T3 (https=)
WO (1) WO2007147265A1 (https=)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010060186A1 (en) * 2008-11-03 2010-06-03 Alethia Biotherapeutics Inc. Antibodies that specifically block the biological activity of a tumor antigen
WO2011024618A1 (ja) * 2009-08-24 2011-03-03 国立大学法人金沢大学 遺伝子発現プロファイルによる消化器癌、胃癌、大腸癌、膵臓癌及び胆道癌の検出
WO2011054112A1 (en) * 2009-11-03 2011-05-12 Alethia Biotherapeutics Inc. Antibodies that specifically block the biological activity of kidney associated antigen 1
US20120128661A1 (en) * 2006-06-23 2012-05-24 Alethia Biotherapeutics Inc. Polynucleotide and polypeptide sequences involved in cancer
WO2012129668A1 (en) 2011-03-31 2012-10-04 Alethia Biotherapeutics Inc. Antibodies against kidney associated antigen 1 and antigen binding fragments thereof
US20120288498A1 (en) * 2006-06-23 2012-11-15 Alethia Biotherapeutics Inc. Polynucleotides and polypeptide sequences involved in cancer
US8557966B2 (en) 2010-02-24 2013-10-15 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US8709432B2 (en) 2011-04-01 2014-04-29 Immunogen, Inc. Methods for increasing efficacy of FOLR1 cancer therapy
WO2013104050A3 (en) * 2012-01-09 2015-04-02 Alethia Biotherapeutics Inc. Methods of treating triple negative breast cancer and basal-like breast cancer using inhibitors against kidney associated 1 (kaag1) inhibitor
WO2013177060A3 (en) * 2012-05-20 2015-08-20 Trustees Of Boston University Methods and systems for monitoring, diagnosing, and treating chronic obstructive polmonary disease
US9200073B2 (en) 2012-08-31 2015-12-01 Immunogen, Inc. Diagnostic assays and kits for detection of folate receptor 1
US9296822B2 (en) 2005-12-08 2016-03-29 E.R. Squibb & Sons, L.L.C. Human monoclonal antibodies to O8E
EP3054299A3 (en) * 2010-08-13 2016-11-30 Arizona Board of Regents, a body corporate acting on behalf of Arizona State University Biomarkers for the early detection of breast cancer
US9637547B2 (en) 2013-08-30 2017-05-02 Immunogen, Inc. Monoclonal antibodies for detection of folate receptor 1
US10172875B2 (en) 2015-09-17 2019-01-08 Immunogen, Inc. Therapeutic combinations comprising anti-FOLR1 immunoconjugates
CN109575136A (zh) * 2013-12-12 2019-04-05 艾伯维施特姆森特克斯有限责任公司 新型抗dpep3抗体和使用方法

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0011903D0 (en) * 2000-05-18 2000-07-05 Astrazeneca Ab Combination chemotherapy
US20100260832A1 (en) * 2007-06-27 2010-10-14 Poniard Pharmaceuticals, Inc. Combination therapy for ovarian cancer
TW200916094A (en) * 2007-06-27 2009-04-16 Poniard Pharmaceuticals Inc Stabilized picoplatin dosage form
US20100310661A1 (en) * 2007-07-16 2010-12-09 Poniard Pharmaceuticals, Inc. Oral formulations for picoplatin
EP2619574B1 (en) * 2010-09-15 2020-10-28 Almac Diagnostic Services Limited Molecular test for predicting responsiveness to dna-damage therapeutic agents in individuals having cancer
WO2012064286A1 (en) * 2010-11-11 2012-05-18 Agency For Science, Technology And Research Targeting metabolic enzymes in human cancer
EP2751570A4 (en) * 2011-08-31 2015-08-12 Oncocyte Corp METHOD AND COMPOSITIONS FOR THE TREATMENT AND DIAGNOSIS OF CANCER
FR2984364A1 (fr) * 2011-12-20 2013-06-21 Biomerieux Sa Procede pour le diagnostic ou le pronostic in vitro du cancer de l'ovaire
GB201511546D0 (en) 2015-07-01 2015-08-12 Immatics Biotechnologies Gmbh Novel peptides and combination of peptides for use in immunotherapy against ovarian cancer and other cancers
MA54884A (fr) 2015-07-01 2022-01-12 Immatics Biotechnologies Gmbh Neuartige peptide und kombination aus peptiden zur verwendung in der immuntherapie gegen ovarialkarzinom und andere karzinome
GB201517538D0 (en) * 2015-10-05 2015-11-18 Immatics Biotechnologies Gmbh Novel peptides and combination of peptides for use in immunotherapy against small cell lung cancer and other cancers
US11860141B2 (en) 2017-08-14 2024-01-02 Quest Diagnostics Investments Llc Detection and quantitation of guanidinoacetate, creatine, and creatinine by mass spectrometry

Citations (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999058546A1 (en) * 1998-05-13 1999-11-18 Ludwig Institute For Cancer Research Tumor associated antigen encoded by the reverse strand of a new ubiquitously expressed gene
WO2001070979A2 (en) * 2000-03-21 2001-09-27 Millennium Pharmaceuticals, Inc. Genes, compositions, kits, and method for identification, assessment, prevention and therapy of ovarian cancer
WO2001098468A2 (en) * 2000-06-16 2001-12-27 Incyte Genomics, Inc. Proteases
US20020106678A1 (en) * 1998-06-30 2002-08-08 Robishaw Janet D. cDNA clones encoding human G protein gamma subunits
WO2002070539A2 (en) * 2001-03-05 2002-09-12 Hyseq, Inc. Novel nucleic acids and polypeptides
WO2002086443A2 (en) * 2001-04-18 2002-10-31 Protein Design Labs, Inc Methods of diagnosis of lung cancer, compositions and methods of screening for modulators of lung cancer
WO2002102235A2 (en) * 2001-06-18 2002-12-27 Eos Biotechnology Inc. Methods of diagnosis of ovarian cancer, compositions and methods of screening for modulators of ovarian cancer
US20030024579A1 (en) 1999-07-07 2003-02-06 Blackmore Donald Ian Diverter valve
US20030065157A1 (en) * 2001-04-04 2003-04-03 Lasek Amy W. Genes expressed in lung cancer
US20030087250A1 (en) 2001-03-14 2003-05-08 Millennium Pharmaceuticals, Inc. Nucleic acid molecules and proteins for the identification, assessment, prevention, and therapy of ovarian cancer
US20030099974A1 (en) * 2001-07-18 2003-05-29 Millennium Pharmaceuticals, Inc. Novel genes, compositions, kits and methods for identification, assessment, prevention, and therapy of breast cancer
WO2003068054A2 (en) * 2002-02-13 2003-08-21 The Government Of The United States Of America As Represented By The Secretary, Department Of Health Services Identification of ovarian cancer tumor markers and therapeutic targets
US20030219760A1 (en) 2001-09-05 2003-11-27 The Brigham And Women's Hospital, Inc. Diagnostic and prognostic tests
WO2004030615A2 (en) * 2002-10-02 2004-04-15 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
WO2004076622A2 (en) * 2003-02-10 2004-09-10 National Institute Of Advanced Industrial Science And Technology Regulation of gene expression by dna interference
US6812339B1 (en) * 2000-09-08 2004-11-02 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
US20040242606A1 (en) 2001-08-31 2004-12-02 Vasilios Bavetsias Anti-cancer cyclopenta (g)quinazoline compounds
US20050009851A1 (en) 2001-08-31 2005-01-13 Vasilios Bavetsias Use of cyclopeta[g]quinazoline derivatives for treating cancer
WO2005024055A1 (en) * 2003-09-05 2005-03-17 Garvan Institute Of Medical Research Methods of diagnosis and prognosis of ovarian cancer ii
US20050214826A1 (en) 2004-02-19 2005-09-29 Yale University Identification of cancer protein biomarkers using proteomic techniques
US20060014686A1 (en) 2004-02-06 2006-01-19 Wyeth Diagnoses and therapeutics for cancer
US20060078941A1 (en) 2003-06-09 2006-04-13 Santin Alessandro D Gene expression profiling in primary ovarian serous papillary tumors and normal ovarian epithelium

Family Cites Families (145)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK365785A (da) * 1984-09-17 1986-03-18 Hoffmann La Roche Metalcomplexer
US5075447A (en) * 1984-09-17 1991-12-24 Hoffmann-La Roche Inc. Ruthenium complexes useful as carriers for immunologically active materials
GB8601646D0 (en) 1986-01-23 1986-02-26 Davidson R S Binding assay & reagent
US5585279A (en) * 1986-01-23 1996-12-17 Davidson; Robert S. Time-resolved luminescence binding assays using a fluorescent transition metal label other than ruthenium
US6018030A (en) * 1986-11-04 2000-01-25 Protein Polymer Technologies, Inc. Peptides comprising repetitive units of amino acids and DNA sequences encoding the same
DE69028552T2 (de) 1989-12-28 1997-03-06 The Upjohn Co., Kalamazoo, Mich. Diaromatische substituierte verbindungen gegen den aids-virus
IL105325A (en) 1992-04-16 1996-11-14 Minnesota Mining & Mfg Immunogen/vaccine adjuvant composition
AU4017695A (en) 1994-10-28 1996-05-23 Procept, Inc. Ruthenium complexes and their use as immunosuppressive agents
US5708022A (en) * 1994-10-28 1998-01-13 Procept, Inc. Method for inhibiting immune response
US5712127A (en) 1996-04-29 1998-01-27 Genescape Inc. Subtractive amplification
US5831003A (en) 1996-06-28 1998-11-03 Bayer Corporation Peptides which bind to prothrombin and thrombin
NZ502303A (en) 1997-06-18 2002-02-01 Ulrich J Krull Nucleic acid biosensor system & diagnostic use
WO1999031513A1 (en) 1997-12-15 1999-06-24 Lakowicz Joseph R Method and composition for characterizing a sample containing a sample lipid and an assay kit
US6759243B2 (en) * 1998-01-20 2004-07-06 Board Of Trustees Of The University Of Illinois High affinity TCR proteins and methods
US6472367B1 (en) 1998-05-05 2002-10-29 Adherex Technologies, Inc. Compounds and methods for modulating OB-cadherin mediated cell adhesion
ES2299244T3 (es) * 1998-05-13 2008-05-16 Domantis Limited Sistema de exposicion de fagos para la seleccion de proteinas correctamente plegadas.
US7037667B1 (en) * 1998-06-01 2006-05-02 Agensys, Inc. Tumor antigen useful in diagnosis and therapy of prostate and colon cancer
US7521197B2 (en) * 1998-06-05 2009-04-21 Alexis Biotech Limited Method for producing cytotoxic T-cells
JP2002519428A (ja) 1998-07-02 2002-07-02 メルク エンド カムパニー インコーポレーテッド プレニル−タンパク質トランスフェラーゼの阻害剤
US6288221B1 (en) * 1998-08-20 2001-09-11 Duke University Methods of synthesis of halogen base-modified oligonucleotides and subsequent labeling with a metal-catalyzed reaction
US6806089B1 (en) * 1998-09-08 2004-10-19 University Of Maryland, Baltimore Low frequency modulation sensors using nanosecond fluorophores
AU6136599A (en) 1998-09-08 2000-03-27 University Of Maryland At Baltimore Low frequency modulation sensors using nanosecond fluorophores
AU1223400A (en) * 1998-10-22 2000-05-08 Phillip B. B. Moheno Novel pterin antineoplastic agents
AU3268500A (en) 1999-03-19 2000-10-09 Anormed Inc. Pharmaceutical compositions comprising metal complexes
US6872519B1 (en) * 1999-04-27 2005-03-29 Mirus Bio Corporation In vitro process for selecting phage resistant to blood inactivation
US20090087878A9 (en) * 1999-05-06 2009-04-02 La Rosa Thomas J Nucleic acid molecules associated with plants
GB9916529D0 (en) * 1999-07-14 1999-09-15 Chiron Spa Antigenic peptides
CZ2002959A3 (cs) 1999-09-17 2002-07-17 Millennium Pharmaceuticals, Inc. Inhibitory faktoru Xa
WO2001046209A1 (en) 1999-12-20 2001-06-28 Fluorrx, Inc. Fluorescent probes
US20030219806A1 (en) * 2000-02-22 2003-11-27 Millennium Pharmaceuticals, Inc. Novel 18607, 15603, 69318, 12303, 48000, 52920, 5433, 38554, 57301, 58324, 55063, 52991, 59914, 59921 and 33751 molecules and uses therefor
US7585839B2 (en) * 2000-02-23 2009-09-08 Zealand Pharma A/S Medical uses of intercellular communication facilitating compounds
US20030215860A1 (en) * 2000-02-29 2003-11-20 Millennium Pharmaceuticals, Inc. Novel 18636, 2466, 43238, 1983, 52881, 2398, 45449, 50289, 52872 and 26908 molecules and uses therefor
US6436703B1 (en) * 2000-03-31 2002-08-20 Hyseq, Inc. Nucleic acids and polypeptides
US7834146B2 (en) * 2000-05-08 2010-11-16 Monsanto Technology Llc Recombinant polypeptides associated with plants
WO2002006339A2 (en) * 2000-07-03 2002-01-24 Curagen Corporation Proteins and nucleic acids encoding same
US20050053930A1 (en) * 2000-07-18 2005-03-10 David Anderson Therapeutic polypeptides, nucleic acids encoding same, and methods of use
GB0023008D0 (en) 2000-09-20 2000-11-01 Glaxo Group Ltd Improvements in vaccination
US7264810B2 (en) * 2001-01-19 2007-09-04 Cytos Biotechnology Ag Molecular antigen array
TW200526779A (en) * 2001-02-08 2005-08-16 Wyeth Corp Modified and stabilized GDF propeptides and uses thereof
US7030236B2 (en) 2001-03-09 2006-04-18 Mona Savitri Jhaveri Antisense oligonucleotides tarageting folate receptor alpha, and the use thereof
WO2002083921A2 (en) * 2001-04-10 2002-10-24 Agensys, Inc. Nuleic acids and corresponding proteins useful in the detection and treatment of various cancers
US20040053824A1 (en) * 2001-06-29 2004-03-18 Tang Y Tom Extracellular matrix and cell adhesion molecules
US20030124579A1 (en) 2001-09-05 2003-07-03 Eos Biotechnology, Inc. Methods of diagnosis of ovarian cancer, compositions and methods of screening for modulators of ovarian cancer
AR045702A1 (es) * 2001-10-03 2005-11-09 Chiron Corp Composiciones de adyuvantes.
BR0214295A (pt) 2001-11-19 2004-11-09 Elan Pharm Inc Composto, método para tratar um paciente que tem ou prevenir um paciente de adquirir uma doença ou condição, e, método para produzir um composto
DE10162480A1 (de) 2001-12-19 2003-08-07 Ingmar Hoerr Die Applikation von mRNA für den Einsatz als Therapeutikum gegen Tumorerkrankungen
WO2003057725A2 (en) * 2002-01-09 2003-07-17 University Of Lausanne Cell-permeable peptide inhibitors of the jnk signal transduction pathway
WO2003062290A1 (en) 2002-01-16 2003-07-31 Biocompatibles Uk Limited Polymer conjugates
EP1478328B1 (en) * 2002-01-28 2013-06-05 Keraplast Technologies Ltd. Bioactive keratin peptides
US6962910B2 (en) * 2002-02-01 2005-11-08 Virginia Tech Intellectual Properties, Inc. Supramolecular complexes as photoactivated DNA cleavage agents
DE10206616A1 (de) * 2002-02-15 2003-09-04 Qiagen Gmbh Verfahren zur Reduktion der Background-Kontamination nach Markierungsreaktionen
AU2003228267A1 (en) 2002-03-05 2003-09-22 Board Of Regents, The University Of Texas System Methods of enhancing immune induction involving mda-7
US20040101874A1 (en) * 2002-04-12 2004-05-27 Mitokor Inc. Targets for therapeutic intervention identified in the mitochondrial proteome
PL375064A1 (en) * 2002-05-20 2005-11-14 Abgenix, Inc. Treatment of renal carcinoma using antibodies against the egfr
EP1422242A1 (en) 2002-11-22 2004-05-26 Emory University Plastic and elastic protein copolymers
WO2004087874A2 (en) 2003-03-28 2004-10-14 Nuvelo, Inc. Novel nucleic acids and polypeptides
AU2004240765B2 (en) * 2003-05-20 2009-03-19 Cellpep Sa Modified antiviral peptides with increased activity and cell membrane affinity
CA2526393A1 (en) * 2003-05-21 2004-12-02 Genesense Technologies Inc. Antisense oligonucleotides directed to ribonucleotide reductase r1 and uses thereof in the treatment of cancer
WO2006003352A1 (en) 2004-07-06 2006-01-12 Warwick Effect Polymers Limited Living radical polymerization initiator comprising a functional group capable of reacting with polyeptides or the like, comb polymer obtained therewith, polypeptide conjugates and drugs obtained therefrom
GB0314472D0 (en) * 2003-06-20 2003-07-23 Warwick Effect Polymers Ltd Polymer
GB0318096D0 (en) * 2003-08-01 2003-09-03 Queen Mary & Westfield College Vaccine
DE10335833A1 (de) * 2003-08-05 2005-03-03 Curevac Gmbh Transfektion von Blutzellen mit mRNA zur Immunstimulation und Gentherapie
US20050147621A1 (en) * 2003-10-10 2005-07-07 Higgins Darren E. Use of bacterial 5' untranslated regions for nucleic acid expression
DE10347710B4 (de) * 2003-10-14 2006-03-30 Johannes-Gutenberg-Universität Mainz Rekombinante Impfstoffe und deren Verwendung
US7202234B2 (en) * 2003-10-24 2007-04-10 Eisai Co., Ltd. Compounds and methods for treating Toll-like receptor 2-related diseases and conditions
US20050153333A1 (en) 2003-12-02 2005-07-14 Sooknanan Roy R. Selective terminal tagging of nucleic acids
EP1547581A1 (en) 2003-12-23 2005-06-29 Vectron Therapeutics AG Liposomal vaccine for the treatment of human hematological malignancies
EP1550458A1 (en) * 2003-12-23 2005-07-06 Vectron Therapeutics AG Synergistic liposomal adjuvants
WO2005066337A2 (en) * 2004-01-09 2005-07-21 Yissum Research Development Company Of The Hebrew University Of Jerusalem Compounds, pharmaceutical compositions and therapeutic methods of preventing and treating diseases and disorders associated with amyloid fibril formation
EA200601575A1 (ru) 2004-03-01 2007-06-29 Пептера Фармасьютикалс Лтд. Казеиновые пептиды и их терапевтическое применение
WO2007084413A2 (en) 2004-07-14 2007-07-26 Ptc Therapeutics, Inc. Methods for treating hepatitis c
US7772271B2 (en) * 2004-07-14 2010-08-10 Ptc Therapeutics, Inc. Methods for treating hepatitis C
US7553944B2 (en) * 2004-07-21 2009-06-30 The University Of Hong Kong Human virus causing respiratory tract infection and uses thereof
US20080280317A1 (en) * 2004-08-27 2008-11-13 Northeastern University Comprehensive Characterization Of Complex Proteins At Trace Levels
DE102004042546A1 (de) * 2004-09-02 2006-03-09 Curevac Gmbh Kombinationstherapie zur Immunstimulation
WO2006027202A1 (en) 2004-09-06 2006-03-16 Unite De Recherche En Biotherapie Et Oncologie (Rubio) Generation of multiparent cell hybrids
JP2008512490A (ja) 2004-09-08 2008-04-24 チェルシー・セラピューティクス,インコーポレイテッド 異常細胞増殖および炎症の障害を治療するための代謝的に不活性な葉酸拮抗剤
US8247371B2 (en) 2004-10-14 2012-08-21 Yale University Therapy with Clostridium perfringens enterotoxin to treat ovarian and uterine cancer
WO2006050247A2 (en) * 2004-10-29 2006-05-11 Neose Technologies, Inc. Remodeling and glycopegylation of fibroblast growth factor (fgf)
JP2008526749A (ja) * 2005-01-04 2008-07-24 ザ ブライハム アンド ウイメンズ ホスピタル, インコーポレイテッド 自己アセンブリするペプチドナノファイバーを用いたpdgfの徐放性の送達
US7531533B2 (en) * 2005-01-27 2009-05-12 Asahi Kasei Pharma Corporation 6-Membered heterocyclic compound and use thereof
EP1847533B1 (en) 2005-01-27 2013-08-14 Asahi Kasei Pharma Corporation Six-membered heterocyclic compound and the use thereof
US8007811B2 (en) * 2005-02-14 2011-08-30 Epitopix, Llc Polypeptides and immunizing compositions containing gram positive polypeptides and methods of use
CN101160524A (zh) * 2005-02-24 2008-04-09 西米尼斯公司 用于生物样品分类的组合物和方法
EP1863800A4 (en) 2005-03-17 2011-05-04 Harvard College SYNTHESIS OF AVRAINVILLAMID, STEPHACIDINE B AND ANALOGUE THEREOF
FR2885525B1 (fr) * 2005-05-13 2009-09-18 Urodelia Sa Medicament notamment anti-cancereux, destine a des traitements par immunotherapie, en particulier autologue
KR101604799B1 (ko) * 2005-06-13 2016-03-28 클리브랜드 바이오랩스, 아이엔씨. 리포펩티드를 사용하여 아폽토시스에 대항하는 보호방법
WO2006138380A2 (en) 2005-06-15 2006-12-28 Massachusetts Institute Of Technology Amine-containing lipids and uses thereof
BRPI0612287A8 (pt) 2005-06-27 2019-01-22 Exelixis Inc composição para uso farmacêutico no tratamento de doenças através da medicina nuclear e métodos de uso e para modulação de atividade de receptor nuclear
WO2007005249A2 (en) 2005-06-29 2007-01-11 Hyperbranch Medical Technology, Inc. Nanoparticles and dendritic-polymer-based hydrogels comprising them
US7494788B2 (en) * 2005-07-11 2009-02-24 Molecular Kinetics, Inc. Entropic bristle domain sequences and their use in recombinant protein production
US7820790B2 (en) * 2005-07-13 2010-10-26 Amgen Mountain View Inc. IL-6 binding proteins
GB0516058D0 (en) 2005-08-04 2005-09-14 Oxford Genome Sciences Uk Ltd New protein isoforms and uses thereof
GB0517293D0 (en) 2005-08-24 2005-10-05 Cancer Rec Tech Ltd Vectors and uses thereof
PL1931998T3 (pl) * 2005-09-15 2010-11-30 Alk Abello As Sposób ilościowego oznaczania alergenów
WO2007073432A2 (en) 2005-10-11 2007-06-28 Chemocentryx, Inc. Piperidine derivatives and methods of use
AU2006303037A1 (en) 2005-10-21 2007-04-26 Merz Pharma Gmbh & Co Kgaa Chromenones and their use as modulators of metabotropic glutamate receptors
UA96139C2 (uk) * 2005-11-08 2011-10-10 Дженентек, Інк. Антитіло до нейропіліну-1 (nrp1)
DK1954274T3 (da) * 2005-11-10 2011-01-31 Chemocentryx Inc Substituerede quinoloner og fremgangsmåder til anvendelse
EP1954134B1 (en) 2005-11-23 2011-09-14 Merck Sharp & Dohme Corp. Process for synthesizing a 2-phenyl-1h-phenantrho[9,10-d]imidazole derivative
KR101049859B1 (ko) 2007-11-28 2011-07-19 대한민국 N-말단 pI 값 조절에 의한 수용성 재조합 단백질 생산방법
WO2007101441A1 (en) * 2006-03-06 2007-09-13 Symphogen A/S Recombinant polyclonal antibody for treatment of respiratory syncytial virus infections
JP5167155B2 (ja) 2006-03-09 2013-03-21 ザ ボード オブ リージェンツ オブ ザ ユニバーシティー オブ テキサス システム ペプチド結合に基づく多数の細胞株のプロファイリングに関連した組成物および方法
CA2642819C (en) 2006-03-10 2015-06-09 Warwick Effect Polymers Ltd. Sugar polymers
WO2007110755A1 (en) 2006-03-27 2007-10-04 Medical Therapies Limited Prophylaxis or treatment of cardiovascular inflammation
JP5093783B2 (ja) * 2006-04-20 2012-12-12 クリングルファーマ株式会社 Hgf前駆体蛋白質改変体及びその活性型蛋白質
WO2007131191A2 (en) * 2006-05-05 2007-11-15 Perkinelmer Life And Analytical Sciences Mass spectrometry methods for multiplexed quantification of protein kinases and phosphatases
CA2652247C (en) 2006-05-08 2015-11-17 Adaerata, Limited Partnership Chimeric pcsk9 proteins, cells comprising same, and assays using same
ES2444695T3 (es) * 2006-06-23 2014-02-26 Alethia Biotherapeutics Inc. Polinucleótidos y polipéptidos implicados en el cáncer
NL1032064C2 (nl) * 2006-06-27 2008-01-02 Walraven Holding Bv J Van Pijpbeugel met trillingisolerende inlaag.
EP2041556A1 (en) 2006-06-28 2009-04-01 RGB Technologies AB A sensor kit and a system for detecting an analyte in a test environment
US8198046B2 (en) * 2006-07-11 2012-06-12 Danisco Us Inc. KEX2 cleavage regions of recombinant fusion proteins
EP2049144B8 (en) * 2006-07-21 2015-02-18 ratiopharm GmbH Glycosylation of peptides via o-linked glycosylation sequences
WO2008012362A2 (en) * 2006-07-27 2008-01-31 Oxford Genome Sciences (Uk) Ltd New protein isoforms and uses thereof
EP2052088A2 (en) * 2006-08-02 2009-04-29 Genizon Biosciences Genemap of the human genes associated with psoriasis
AU2007284651B2 (en) 2006-08-09 2014-03-20 Institute For Systems Biology Organ-specific proteins and methods of their use
WO2008029031A2 (fr) * 2006-09-07 2008-03-13 Laurence Faure Test pharmaco diagnostique ciblant l' oncologie
WO2008033932A2 (en) 2006-09-13 2008-03-20 The Institutes For Pharmaceutical Discovery, Llc Biarylthiazole carboxylic acid derivatives as protein tyrosine phosphatase-ib inhibitors
CN101663308A (zh) * 2006-10-30 2010-03-03 桑尔克斯药品公司 N-甲基色胺钙五水合物(dcp)和基于它的治疗方法
DE102006051516A1 (de) 2006-10-31 2008-05-08 Curevac Gmbh (Basen-)modifizierte RNA zur Expressionssteigerung eines Proteins
CA2672860C (en) 2006-12-28 2013-01-29 Abbott Laboratories Inhibitors of poly(adp-ribose)polymerase
WO2008086426A2 (en) * 2007-01-09 2008-07-17 Cleveland Biolabs, Inc. Methods for increasing and mobilizing hematopoietic stem cells
DE102007001370A1 (de) 2007-01-09 2008-07-10 Curevac Gmbh RNA-kodierte Antikörper
WO2008124483A1 (en) * 2007-04-04 2008-10-16 Specigen, Inc. Protein cage immunotherapeutics
JP2010526091A (ja) * 2007-04-30 2010-07-29 インテザイン テクノロジーズ, インコーポレイテッド 癌の処置のための生物学的な標的基の改変
US20080306007A1 (en) * 2007-04-30 2008-12-11 Newcastle Innovation Limited Agents for prophylaxis or treatment of neurological related diseases and conditions
US8143372B2 (en) * 2007-05-21 2012-03-27 Children's Hospital & Research Center Oakland Synthetic regulators of ferritin protein nanocage pores and methods of use thereof
US20090176664A1 (en) * 2007-06-01 2009-07-09 Keting Chu High density peptide arrays containing kinase or phosphatase substrates
US8618121B2 (en) 2007-07-02 2013-12-31 Cancer Research Technology Limited 9H-pyrimido[4,5-B]indoles, 9H-pyrido[4',3':4,5]pyrrolo[2,3-D]pyridines, and 9H 1,3,6,9 tetraaza-fluorenes as CHK1 kinase function inhibitors
US9018138B2 (en) * 2007-08-16 2015-04-28 The Johns Hopkins University Compositions and methods for generating and screening adenoviral libraries
CA2695309A1 (en) * 2007-09-07 2009-03-12 Symphogen A/S Methods for recombinant manufacturing of anti-rsv antibodies
GB0719644D0 (en) 2007-10-05 2007-11-14 Cancer Rec Tech Ltd Therapeutic compounds and their use
US20100298368A1 (en) 2007-11-06 2010-11-25 Amira Pharmaceuticals, Inc. Antagonists of pgd2 receptors
WO2009111088A2 (en) 2008-01-02 2009-09-11 The Johns Hopkins University Antitumor immunization by liposomal delivery of vaccine to the spleen
US8568709B2 (en) 2008-03-20 2013-10-29 University Health Network Thymidylate kinase fusions and uses thereof
ES2500616T3 (es) * 2008-05-09 2014-09-30 Evonik Corporation Polímeros elastoméricos biocompatibles y biodegradables
EP2772251B1 (en) 2008-05-26 2021-03-03 Universität Zürich Protamine/RNA nanoparticles for immunostimulation
US8071807B2 (en) 2008-07-03 2011-12-06 Panmira Pharmaceuticals, Llc Antagonists of prostaglandin D2 receptors
US8148088B2 (en) * 2008-07-18 2012-04-03 Abgent Regulation of autophagy pathway phosphorylation and uses thereof
EP2309853A4 (en) 2008-08-01 2012-04-25 Lixte Biotechnology Inc METHOD FOR CELL MITITULATING BY INHIBITION OF SERIN / THREONINE PHOSPHATASE
US9126953B2 (en) 2008-08-08 2015-09-08 Synta Pharmaceuticals Corp. Triazole compounds that modulate HSP90 activity
WO2010033240A2 (en) 2008-09-19 2010-03-25 Nektar Therapeutics Carbohydrate-based drug delivery polymers and conjugates thereof
WO2010037408A1 (en) 2008-09-30 2010-04-08 Curevac Gmbh Composition comprising a complexed (m)rna and a naked mrna for providing or enhancing an immunostimulatory response in a mammal and uses thereof
CA2740900C (en) 2008-11-03 2019-09-24 Alethia Biotherapeutics Inc. Antibodies that specifically block the biological activity of a tumor antigen
WO2011054112A1 (en) 2009-11-03 2011-05-12 Alethia Biotherapeutics Inc. Antibodies that specifically block the biological activity of kidney associated antigen 1

Patent Citations (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999058546A1 (en) * 1998-05-13 1999-11-18 Ludwig Institute For Cancer Research Tumor associated antigen encoded by the reverse strand of a new ubiquitously expressed gene
US20020106678A1 (en) * 1998-06-30 2002-08-08 Robishaw Janet D. cDNA clones encoding human G protein gamma subunits
US20030024579A1 (en) 1999-07-07 2003-02-06 Blackmore Donald Ian Diverter valve
WO2001070979A2 (en) * 2000-03-21 2001-09-27 Millennium Pharmaceuticals, Inc. Genes, compositions, kits, and method for identification, assessment, prevention and therapy of ovarian cancer
WO2001098468A2 (en) * 2000-06-16 2001-12-27 Incyte Genomics, Inc. Proteases
US6812339B1 (en) * 2000-09-08 2004-11-02 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
WO2002070539A2 (en) * 2001-03-05 2002-09-12 Hyseq, Inc. Novel nucleic acids and polypeptides
US20030087250A1 (en) 2001-03-14 2003-05-08 Millennium Pharmaceuticals, Inc. Nucleic acid molecules and proteins for the identification, assessment, prevention, and therapy of ovarian cancer
US20050214831A1 (en) 2001-03-14 2005-09-29 Millennium Pharmaceuticals, Inc. Nucleic acid molecules and proteins for the identification, assessment, prevention, and therapy of ovarian cancer
US20030065157A1 (en) * 2001-04-04 2003-04-03 Lasek Amy W. Genes expressed in lung cancer
WO2002086443A2 (en) * 2001-04-18 2002-10-31 Protein Design Labs, Inc Methods of diagnosis of lung cancer, compositions and methods of screening for modulators of lung cancer
WO2002102235A2 (en) * 2001-06-18 2002-12-27 Eos Biotechnology Inc. Methods of diagnosis of ovarian cancer, compositions and methods of screening for modulators of ovarian cancer
US20030099974A1 (en) * 2001-07-18 2003-05-29 Millennium Pharmaceuticals, Inc. Novel genes, compositions, kits and methods for identification, assessment, prevention, and therapy of breast cancer
US20050009851A1 (en) 2001-08-31 2005-01-13 Vasilios Bavetsias Use of cyclopeta[g]quinazoline derivatives for treating cancer
US20040242606A1 (en) 2001-08-31 2004-12-02 Vasilios Bavetsias Anti-cancer cyclopenta (g)quinazoline compounds
US20030219760A1 (en) 2001-09-05 2003-11-27 The Brigham And Women's Hospital, Inc. Diagnostic and prognostic tests
US20050095592A1 (en) 2002-02-13 2005-05-05 Jazaeri Amir A. Identification of ovarian cancer tumor markers and therapeutic targets
WO2003068054A2 (en) * 2002-02-13 2003-08-21 The Government Of The United States Of America As Represented By The Secretary, Department Of Health Services Identification of ovarian cancer tumor markers and therapeutic targets
WO2004030615A2 (en) * 2002-10-02 2004-04-15 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
WO2004076622A2 (en) * 2003-02-10 2004-09-10 National Institute Of Advanced Industrial Science And Technology Regulation of gene expression by dna interference
US20060078941A1 (en) 2003-06-09 2006-04-13 Santin Alessandro D Gene expression profiling in primary ovarian serous papillary tumors and normal ovarian epithelium
WO2005024055A1 (en) * 2003-09-05 2005-03-17 Garvan Institute Of Medical Research Methods of diagnosis and prognosis of ovarian cancer ii
US20060014686A1 (en) 2004-02-06 2006-01-19 Wyeth Diagnoses and therapeutics for cancer
US20050214826A1 (en) 2004-02-19 2005-09-29 Yale University Identification of cancer protein biomarkers using proteomic techniques

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] CHEN J.M. ET AL., XP008101379, Database accession no. (NM_022357) *
DATABASE GENBANK [online] STRAUSBERG R.L. ET AL., XP008101277, Database accession no. (BC037243) *
See also references of EP2032701A4

Cited By (61)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9296822B2 (en) 2005-12-08 2016-03-29 E.R. Squibb & Sons, L.L.C. Human monoclonal antibodies to O8E
US9988453B2 (en) 2005-12-08 2018-06-05 E. R. Squibb & Sons, L.L.C. Human monoclonal antibodies to O8E
US20120128661A1 (en) * 2006-06-23 2012-05-24 Alethia Biotherapeutics Inc. Polynucleotide and polypeptide sequences involved in cancer
US20120288498A1 (en) * 2006-06-23 2012-11-15 Alethia Biotherapeutics Inc. Polynucleotides and polypeptide sequences involved in cancer
US9855291B2 (en) 2008-11-03 2018-01-02 Adc Therapeutics Sa Anti-kidney associated antigen 1 (KAAG1) antibodies
AU2009321508B2 (en) * 2008-11-03 2015-03-12 Adc Therapeutics Sa Antibodies that specifically block the biological activity of a tumor antigen
CN104829714A (zh) * 2008-11-03 2015-08-12 阿莱斯亚生物疗法股份有限公司 特异性地阻滞肿瘤抗原的生物活性的抗体
EP2362908A4 (en) * 2008-11-03 2013-09-18 Alethia Biotherapeutics Inc ANTIBODIES FOR THE SPECIFIC BLOCKING OF THE BIOLOGICAL ACTIVITY OF A TUMORANT
JP2015142592A (ja) * 2008-11-03 2015-08-06 アレシア・バイオセラピューティクス・インコーポレーテッド 腫瘍抗原の生物活性を特異的にブロックする抗体
WO2010060186A1 (en) * 2008-11-03 2010-06-03 Alethia Biotherapeutics Inc. Antibodies that specifically block the biological activity of a tumor antigen
CN102245773B (zh) * 2008-11-03 2014-08-27 阿莱斯亚生物疗法股份有限公司 特异性地阻滞肿瘤抗原的生物活性的抗体
JP2012507266A (ja) * 2008-11-03 2012-03-29 アレシア・バイオセラピューティクス・インコーポレーテッド 腫瘍抗原の生物活性を特異的にブロックする抗体
EP3130674A1 (en) * 2008-11-03 2017-02-15 Alethia Biotherapeutics Inc. Antibodies that specifically block the biological activity of a tumor antigen
US8932990B2 (en) 2009-08-24 2015-01-13 National University Corporation Kanazawa University Detection of digestive organ cancer, gastric cancer, colorectal cancer, pancreatic cancer, and biliary tract cancer by gene expression profiling
US9512490B2 (en) 2009-08-24 2016-12-06 Kubix Inc. Detection of digestive organ cancer, gastric cancer, colorectal cancer, pancreatic cancer, and biliary tract cancer by gene expression profiling
WO2011024618A1 (ja) * 2009-08-24 2011-03-03 国立大学法人金沢大学 遺伝子発現プロファイルによる消化器癌、胃癌、大腸癌、膵臓癌及び胆道癌の検出
US9512491B2 (en) 2009-08-24 2016-12-06 Kubix Inc. Detection of digestive organ cancer, gastric cancer, colorectal cancer, pancreatic cancer, and biliary tract cancer by gene expression profiling
US9441276B2 (en) 2009-08-24 2016-09-13 National University Corporation Kanazawa University Detection of digestive organ cancer, gastric cancer, colorectal cancer, pancreatic cancer, and biliary tract cancer by gene expression profiling
WO2011054112A1 (en) * 2009-11-03 2011-05-12 Alethia Biotherapeutics Inc. Antibodies that specifically block the biological activity of kidney associated antigen 1
US9670280B2 (en) 2010-02-24 2017-06-06 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9657100B2 (en) 2010-02-24 2017-05-23 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9670278B2 (en) 2010-02-24 2017-06-06 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9133275B2 (en) 2010-02-24 2015-09-15 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US8557966B2 (en) 2010-02-24 2013-10-15 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9670279B2 (en) 2010-02-24 2017-06-06 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US10301385B2 (en) 2010-02-24 2019-05-28 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US10752683B2 (en) 2010-02-24 2020-08-25 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US9598490B2 (en) 2010-02-24 2017-03-21 Immunogen, Inc. Folate receptor 1 antibodies and immunoconjugates and uses thereof
US10802026B2 (en) 2010-08-13 2020-10-13 Arizona Board of Regents, a body corporate acting for and on behalf of Arizona State University Biomarkers for the early detection of breast cancer
US11624747B2 (en) 2010-08-13 2023-04-11 Arizona Board Of Regents Biomarkers for the early detection of breast cancer
US9857374B2 (en) 2010-08-13 2018-01-02 Arizona Board of Regents, a body corporate acting for and on behalf of Arizona State University Biomarkers for the early detection of breast cancer
EP3054299A3 (en) * 2010-08-13 2016-11-30 Arizona Board of Regents, a body corporate acting on behalf of Arizona State University Biomarkers for the early detection of breast cancer
US12540940B2 (en) 2010-08-13 2026-02-03 President And Fellows Of Harvard College Biomarkers for the early detection of breast cancer
US10597450B2 (en) 2011-03-31 2020-03-24 Adc Therapeutics Sa Antibodies against kidney associated antigen 1 and antigen binding fragments thereof
EP3511345A1 (en) 2011-03-31 2019-07-17 ADC Therapeutics SA Antibodies against kidney associated antigen 1 and antigen binding fragments thereof
US9393302B2 (en) 2011-03-31 2016-07-19 Alethia Biotherapeutics Inc. Antibodies against kidney associated antigen 1 and antigen binding fragments thereof
US9828426B2 (en) 2011-03-31 2017-11-28 Adc Therapeutics Sa Antibodies against kidney associated antigen 1 and antigen binding fragments thereof
EP3173427A1 (en) 2011-03-31 2017-05-31 Alethia Biotherapeutics Inc. Antibodies against kidney associated antigen 1 and antigen binding fragments thereof
WO2012129668A1 (en) 2011-03-31 2012-10-04 Alethia Biotherapeutics Inc. Antibodies against kidney associated antigen 1 and antigen binding fragments thereof
US8937163B2 (en) 2011-03-31 2015-01-20 Alethia Biotherapeutics Inc. Antibodies against kidney associated antigen 1 and antigen binding fragments thereof
US8709432B2 (en) 2011-04-01 2014-04-29 Immunogen, Inc. Methods for increasing efficacy of FOLR1 cancer therapy
US11135305B2 (en) 2011-04-01 2021-10-05 Immunogen, Inc. Methods for increasing efficacy of FOLR1 cancer therapy
EP3533468A1 (en) 2012-01-09 2019-09-04 ADC Therapeutics SA Method for treating breast cancer
EA034414B1 (ru) * 2012-01-09 2020-02-05 Адс Терапьютикс Са Способ лечения тройного негативного рака молочной железы
US11084872B2 (en) 2012-01-09 2021-08-10 Adc Therapeutics Sa Method for treating breast cancer
WO2013104050A3 (en) * 2012-01-09 2015-04-02 Alethia Biotherapeutics Inc. Methods of treating triple negative breast cancer and basal-like breast cancer using inhibitors against kidney associated 1 (kaag1) inhibitor
US10533225B2 (en) 2012-05-20 2020-01-14 Trustees Of Boston University Methods and systems for monitoring, diagnosing, and treating chronic obstructive pulmonary disease
US9677138B2 (en) 2012-05-20 2017-06-13 Trustees Of Boston University Methods and systems for monitoring, diagnosing, and treating chronic obstructive pulmonary disease
WO2013177060A3 (en) * 2012-05-20 2015-08-20 Trustees Of Boston University Methods and systems for monitoring, diagnosing, and treating chronic obstructive polmonary disease
US10180432B2 (en) 2012-08-31 2019-01-15 Immunogen, Inc. Diagnostic assays and kits for detection of folate receptor 1
US9200073B2 (en) 2012-08-31 2015-12-01 Immunogen, Inc. Diagnostic assays and kits for detection of folate receptor 1
US10613093B2 (en) 2012-08-31 2020-04-07 Immunogen, Inc. Diagnostic assays and kits for detection of folate receptor 1
US9702881B2 (en) 2012-08-31 2017-07-11 Immunogen, Inc. Diagnostic assays and kits for detection of folate receptor 1
US9637547B2 (en) 2013-08-30 2017-05-02 Immunogen, Inc. Monoclonal antibodies for detection of folate receptor 1
US10017578B2 (en) 2013-08-30 2018-07-10 Immunogen, Inc. Methods of treating cancer in a patient by administering anti-folate-receptor-1 (FOLR1) antibodies
US11198736B2 (en) 2013-08-30 2021-12-14 Immunogen, Inc. Method for identifying an ovarian cancer in a subject likely to respond to anti-folate receptor 1 (FOLR1) antibody
US10544230B2 (en) 2013-08-30 2020-01-28 Immunogen, Inc. Methods of using antibodies to detect folate receptor 1 (FOLR1)
US11932701B2 (en) 2013-08-30 2024-03-19 Immunogen, Inc. Method for increasing the efficacy of cancer therapy by administering an anti-FOLR1 immunoconjugate
CN109575136A (zh) * 2013-12-12 2019-04-05 艾伯维施特姆森特克斯有限责任公司 新型抗dpep3抗体和使用方法
US10172875B2 (en) 2015-09-17 2019-01-08 Immunogen, Inc. Therapeutic combinations comprising anti-FOLR1 immunoconjugates
US11033564B2 (en) 2015-09-17 2021-06-15 Immunogen, Inc. Therapeutic combinations comprising anti-FOLR1 immunoconjugates

Also Published As

Publication number Publication date
US20120288498A1 (en) 2012-11-15
JP2009540803A (ja) 2009-11-26
EP2502628B1 (en) 2016-12-14
US20180346563A1 (en) 2018-12-06
ES2444695T3 (es) 2014-02-26
CA2655933C (en) 2014-09-09
EP2502628A2 (en) 2012-09-26
EP2032701B1 (en) 2013-11-27
EP3231442A1 (en) 2017-10-18
EP2032701A4 (en) 2009-12-09
JP2014098023A (ja) 2014-05-29
EP3231442B1 (en) 2019-12-25
US20100086537A1 (en) 2010-04-08
CA2655933A1 (en) 2007-12-27
AU2007262635A1 (en) 2007-12-27
AU2007262635B2 (en) 2014-09-11
US8216582B2 (en) 2012-07-10
EP2032701A1 (en) 2009-03-11
US20160039930A1 (en) 2016-02-11
DK2032701T3 (da) 2014-02-10
JP5589149B2 (ja) 2014-09-17
EP2502628A3 (en) 2012-11-07
JP5564249B2 (ja) 2014-07-30

Similar Documents

Publication Publication Date Title
US8216582B2 (en) Polynucleotides and polypeptide sequences involved in cancer
US8168586B1 (en) Cancer targets and uses thereof
US8444975B2 (en) Method for inhibiting bone resorption
US20120128661A1 (en) Polynucleotide and polypeptide sequences involved in cancer
CA2826738A1 (en) Polynucleotides and polypeptide sequences involved in cancer
HK1238539B (en) Polynucleotides and polypeptide sequences involved in cancer
HK1238539A1 (en) Polynucleotides and polypeptide sequences involved in cancer
US20110286924A1 (en) Novel human endogenous retroviral erv3 variant and uses thereof in the diagnosing ovarian cancer
CA2773614A1 (en) Method of treating cancer by inhibiting trim59 expression or activity
KR101115441B1 (ko) 대장암 진단용 조성물 및 그 용도
KR101115449B1 (ko) 대장암 진단용 조성물 및 그 용도
KR101115446B1 (ko) 대장암 진단용 조성물 및 그 용도
KR101115443B1 (ko) 대장암 진단용 조성물 및 그 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07720048

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2007262635

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2655933

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2009515683

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007720048

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2007262635

Country of ref document: AU

Date of ref document: 20070622

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 12305648

Country of ref document: US