WO2007077563A2 - Solid-fluid composition - Google Patents
Solid-fluid composition Download PDFInfo
- Publication number
- WO2007077563A2 WO2007077563A2 PCT/IL2007/000016 IL2007000016W WO2007077563A2 WO 2007077563 A2 WO2007077563 A2 WO 2007077563A2 IL 2007000016 W IL2007000016 W IL 2007000016W WO 2007077563 A2 WO2007077563 A2 WO 2007077563A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nanostructures
- liquid composition
- liquid
- water
- composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/08—Solutions
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N1/00—Preservation of bodies of humans or animals, or parts thereof
- A01N1/10—Preservation of living parts
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N1/00—Preservation of bodies of humans or animals, or parts thereof
- A01N1/10—Preservation of living parts
- A01N1/12—Chemical aspects of preservation
- A01N1/122—Preservation or perfusion media
- A01N1/125—Freeze protecting agents, e.g. cryoprotectants or osmolarity regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/02—Local antiseptics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2527/00—Reactions demanding special reaction conditions
- C12Q2527/125—Specific component of sample, medium or buffer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2561/00—Nucleic acid detection characterised by assay method
- C12Q2561/113—Real time assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/155—Particles of a defined size, e.g. nanoparticles
Definitions
- the present invention relates to a solid-fluid composition and, more particularly, to a nanostructure and liquid composition having the nanostructure and characterized by a plurality of distinguishing physical, chemical and biological characteristics.
- Nanoscience is the science of small particles of materials and is one of the most important research frontiers in modern science. These small particles are of interest from a fundamental view point since all properties of a material, such as its melting point and its electronic and optical properties, change when the of the particles that make up the material become nanoscopic. With new properties come new opportunities for technological and commercial development, and applications of nanoparticles have been shown or proposed in areas as diverse as micro- and nanoelectronics, nanoiluidics, coatings and paints and biotechnology.
- MEMS Micro Electro Mechanical Systems
- nanoparticles are frequently used in nanometer-scale equipment for probing the real-space structure and function of biological molecules.
- Auxiliary nanoparticles such as calcium alginate nanospheres, have also been used to help improve gene transfection protocols.
- resonant collective oscillations of conduction electrons also known as particle plasmons
- the resonance frequency of a particle plasmon is determined mainly by the dielectric function of the metal, the surrounding medium and by the shape of the particle. Resonance leads to a narrow spectrally selective absorption and an enhancement of the local field confined on and close to the surface of the metal particle.
- the laser wavelength is tuned to the plasmon resonance frequency of the particle, the local electric field in proximity to the nanoparticles can be enhanced by several orders of magnitude.
- nanoparticles are used for absorbing or refocusing electromagnetic radiation in proximity to a cell or a molecule, e.g., for the purpose of identification of individual molecules in biological tissue samples, in a similar fashion to the traditional fluorescent labeling.
- nanoparticles are also exploited in the area of solar energy conversion, where gallium selenide nanoparticles are used for selectively absorbing electromagnetic radiation in the visible range while reflecting electromagnetic radiation at the red end of the spectrum, thereby significantly increasing the conversion efficiency.
- nanofluids are typically liquid compositions in which a considerable amount of nanoparticles are suspended in liquids such as water, oil or ethylene glycol.
- the resulting nanofluids possess extremely high thermal conductivities compared to the liquids without dispersed nanoparticles.
- nanoparticles are synthesized from a molecular level up, by the application of arc discharge, laser evaporation, pyrolysis process, use of plasma, use of sol gel and the like.
- Widely used nanoparticles are the fullerene carbon nanotubes, which are broadly defined as objects having a diameter below about 1 ⁇ m.
- a material having the carbon hexagonal mesh sheet of carbon substantially in parallel with the axis is called a carbon nanotube, and one with amorphous carbon surrounding a carbon nanotube is also included within the category of carbon nanotube.
- nanoshells which are nanoparticles having a dielectric core and a conducting shell layer.
- Nanoshells are also manufactured from a molecular level up, for example, by bonding atoms of metal on a dielectric substrate. Nanoshells are particularly useful in applications in which it is desired to exploit the above mention optical field enhancement phenomenon. Nanoshells, however, are known to be useful only in cases of near infrared wavelengths applications.
- nanoparticles produced from a molecular level up tends to loose the physical properties of characterizing the bulk, unless further treatment is involved in the production process.
- nanoparticles retaining physical properties of larger, micro-sized, particles are of utmost importance.
- PCR polymerase chain reaction
- PCR amplification is being used to carry out a variety of tasks in molecular cloning and analysis of DNA. These tasks include the generation of specific sequences of DNA for cloning or use as probes, the detection of segments of DNA for genetic mapping, the detection and analysis of expressed sequences by amplification of particular segments of cDNA, the generation of libraries of cDNA from small amounts of mRNA, the generation of large amounts of DNA for sequencing, the analysis of mutations, and for chromosome crawling. It is expected that PCR, as well as other nucleic acid amplification techniques, will find increasing application in many other aspects of molecular biology.
- a strand of DNA is comprised of four different nucleotides, as determined by their bases: Adenine, Thymine, Cytosine and Guanine, respectively designated as A, T, C, G.
- Each strand of DNA matches up with a homologous strand in which A pairs with T, and C pairs with G.
- a specific sequence of bases which codes for a protein is referred to as a gene.
- DNA is often segmented into regions which are responsible for protein compositions (exons) and regions which do not directly contribute to protein composition (introns).
- the PCR described generally in U.S. Patent No. 4,683,195, allows in vitro amplification of a target DNA fragment lying between two regions of a known sequence. Double stranded target DNA is first melted to separate the DNA strands, and then oligonucleotide are annealed to the template DNA.
- the primers are chosen in such a way that they are complementary and hence specifically bind to desired, preselected positions at the 5' and 3' boundaries of the desired target fragment.
- the oligonucleotides serve as primers for the synthesis of new complementary DNA strands using a DNA polymerase enzyme in a process known as primer extension.
- the orientation of the primers with respect to one another is such that the
- each primer contains, when extended far enough, the sequence which is complementary to the other oligonucleotide.
- each newly synthesized DNA strand becomes a template for synthesis of another DNA strand beginning with the other oligonucleotide as its primer.
- the cycle of (i) melting, (ii) annealing of oligonucleotide primers, and (iii) primer extension can be repeated a great number of times resulting in an exponential amplification of the target fragment in between the primers.
- a DNA polymerase cofactor is a non- ' protein compound on which the enzyme depends for activity. Without the presence of the cofactor the enzyme is catalytically inactive.
- Known cofactors include compounds containing manganese or magnesium in such a form that divalent cations are released into an aqueous solution. Typically these cofactors are in a form of manganese or magnesium salts, such as chlorides, sulfates, acetates and fatty acid salts.
- thermostable DNA polymerases such as Thermus aquaticus (Taq) DNA polymerase, are magnesium-dependent. Therefore, a precise concentration of magnesium ions is necessary to both maximize the efficiency of the polymerase and the specificity of the reaction.
- a nanostructure comprising a core material of a nanometric size surrounded by an envelope of ordered fluid molecules, the core material and the envelope of ordered fluid molecules being in a steady physical state.
- a liquid composition comprising a liquid and nanostructures as described herein.
- the liquid composition is preferably characterized by an enhanced ultrasonic velocity relative to water.
- a liquid composition comprising a liquid and nanostructures, the liquid composition being characterized by an enhanced ability to dissolve or disperse a substance relative to water, wherein each of the nanostructures comprises a core material of a nanometric size surrounded by an envelope of ordered fluid molecules, the core material and the envelope of ordered fluid molecules being in a steady physical state.
- a liquid composition comprising a liquid and nanostructures, wherein each of the nanostructures comprises a core material of a nanometric size surrounded by an envelope of ordered fluid molecules, the nanostructures being formulated from hydroxyapatite, the core material and the envelope of ordered fluid molecules being in a steady physical state.
- a liquid composition comprising a liquid and nanostructures, the liquid composition being characterized by an enhanced buffering capacity relative to water, wherein each of the nanostructures comprises a core material of a nanometric size surrounded by an envelope of ordered fluid molecules, the core material and the envelope of ordered fluid molecules being in a steady physical state.
- a method of dissolving or dispersing a substance comprising contacting the substance with nanostructures and liquid under conditions which allow dispersion or dissolving of the substance, wherein the nanostructures comprise a core material of a nanometric size enveloped by ordered fluid molecules of the liquid, the core material and the envelope of ordered fluid molecules being in a steady physical state.
- the substance is selected from the group consisting of a protein, a nucleic acid, a small molecule and a carbohydrate.
- the substance is a pharmaceutical agent.
- the pharmaceutical agent is a therapeutic agent, cosmetic agent or a diagnostic agent.
- the composition comprises a buffering capacity greater than a buffering capacity of water.
- the composition comprises an enhanced ability to dissolve or disperse an agent relative to water.
- the method further comprises dissolving or dispersing the agent in a solvent prior to the contacting.
- the method further comprises dissolving or dispersing the agent in a solvent following the contacting.
- the solvent is a polar solvent.
- the solvent is a non-polar solvent.
- the solvent is an organic solvent.
- the organic solvent is ethanol or acetone.
- the solvent is a non-organic solvent.
- the method further comprises evaporating the solvent following the dissolving or dispersing.
- the evaporating is effected by heat or pressure.
- the nanostructures are designed such that when the liquid composition is first contacted with a surface and then washed by a predetermined wash protocol, an electrochemical signature of the composition is preserved on the surface.
- a liquid composition comprising a liquid and nanostructures as described herein, the liquid composition facilitates increment of bacterial colony expansion rate.
- liquid composition comprising liquid and nanostructures as described herein, the liquid composition facilitates increment of phage-bacteria or virus-cell interaction.
- a liquid composition comprising liquid and nanostructures as described herein, the liquid composition is characterized by a zeta potential which is substantial larger than a zeta potential of the liquid per se.
- a liquid composition comprising a liquid and nanostructures as described herein, each of the nanostructures having a specific gravity lower than or equal to a specific gravity of the liquid.
- the nanostructures are designed such that when the liquid composition is mixed with a dyed solution, spectral properties of the dyed solution are substantially changed.
- a liquid composition comprising liquid and nanostructures as described herein; the nanostructures are designed such that when the liquid composition is mixed with a dyed solution, spectral properties of the dyed solution are substantially changed.
- liquid composition comprising liquid and nanostructures as described herein, the liquid composition enhances macromolecule binding to solid phase matrix.
- composition wherein the solid phase matrix is hydrophilic. According to still further features in the described preferred embodiments the solid phase matrix is hydrophobic.
- the solid phase matrix comprises hydrophobic regions and hydrophilic regions.
- the macromolecule is an antibody.
- the antibody is a polyclonal antibody.
- the macromolecule comprises at least one carbohydrate hydrophilic region.
- the macromolecule comprises at least one carbohydrate hydrophobic region.
- the macromolecule is a lectin. According to still further features in the described preferred embodiments the macromolecule is a DNA molecule.
- the macromolecule is an RNA molecule.
- liquid composition comprising liquid and nanostructures as described herein, the liquid composition is capable of at least partially de-folding DNA molecules.
- liquid composition comprising liquid and nanostructures as described herein, the liquid composition is capable of altering bacterial adherence to biomaterial, whereby each nanostructure comprises a core material of a nanometric size surrounded by an envelope of ordered fluid molecules, the core material and the envelope of ordered fluid molecules being in a steady physical state.
- composition of the present invention decreases its adherence to biomaterial.
- biomaterial is selected from the group consisting of plastic, polyester and cement.
- the biomaterial is suitable for being surgically implanted in a subject.
- the bacterial adherence is Staphylococcus epidermidis adherence.
- the Staphylococcus epidermidis adherence is selected from the group consisting of Staphylococcus epidermidis RP 62 A adherence, Staphylococcus epidermidis M7 adherence and Staphylococcus epidermidis (API-6706112) adherence.
- liquid composition comprising liquid and nanostructures as described herein, the liquid composition is capable of stabilizing enzyme activity.
- the enzyme activity is of an unbound enzyme.
- the enzyme activity is of a bound enzyme.
- the enzyme activity is of an enzyme selected from the group consisting of Alkaline Phosphatase, and ⁇ -Galactosidase.
- liquid composition comprising liquid and nanostructures as described herein, the liquid composition is capable of improving affinity binding of nucleic acids to a resin and improving gel electrophoresis separation.
- liquid composition comprising liquid and nanostructures as described herein, the liquid composition is capable of increasing a capacity of a column.
- liquid composition comprising liquid and nanostructures as described herein, the liquid composition is capable of improving efficiency of nucleic acid amplification process.
- the nucleic acid amplification process is a polymerase chain reaction.
- the polymerase chain reaction is a real-time polymerase chain reaction.
- the composition is capable of enhancing catalytic activity of a DNA polymerase of said polymerase chain reaction.
- the polymerase chain reaction is magnesium free.
- the polymerase chain reaction is manganese free.
- kits for polymerase chain reaction comprising, in separate packaging (a) a thermostable DNA polymerase; and (b) a liquid composition having liquid and nanostructures as described herein.
- the kit further comprises at least one dNTP.
- the kit further comprises at least one control template DNA.
- the kit further comprises at least one control primer.
- kits for real-time polymerase chain reaction comprising, (a) a thermostable DNA polymerase; (b) a double-stranded DNA detecting molecule; and (c) a liquid composition having a liquid and nanostructures as described herein.
- the double stranded DNA detecting molecule is a double stranded DNA intercalating detecting molecule.
- the stranded DNA detecting molecule is selected from the group consisting of ethidium bromide, YO-PRO-I, Hoechst 33258, SYBR Gold, and SYBR Green I.
- the double stranded DNA detecting molecule is a primer-based double stranded DNA detecting molecule.
- the primer-based double stranded DNA detecting molecule is selected from the group consisting of fluorescein, FAM, JOE, HEX, TET, Alexa Fluor 594, ROX, TAMRA, rhodamine and BODIPY-FI.
- a method of amplifying a DNA sequence comprising (a) providing a liquid composition having a liquid and nanostructures as described herein; and (b) in the presence of the liquid composition, executing a plurality of polymerase chain reaction cycles on the DNA sequence, thereby amplifying the DNA sequence.
- liquid composition comprising a liquid and nanostructures as described herein, the liquid composition being capable of allowing the manipulation of at least one macromolecule in the presence of a solid support.
- the macromolecule is a polynucleotide.
- the polynucleotide is selected from the group consisting of DNA and RNA.
- the solid support comprises glass beads.
- the glass beads are between about 80 and 150 microns in diameter.
- the manipulation is effected by a chemical reaction.
- the chemical reaction is selected from the group consisting of an amplification reaction, a ligation reaction, a transformation reaction, transcription reaction, reverse transcription reaction, restriction digestion and transfection reaction.
- a liquid composition comprising a liquid, beads and nanostructures, the liquid composition being capable of allowing the manipulation of at least one macromolecule in the presence of the beads, whereby each nanostructure comprises a core material of a nanometric size surrounded by an envelope of ordered fluid molecules, the core material and the envelope of ordered fluid molecules being in a steady physical state.
- each nanostructure comprises a core material of a nanometric size surrounded by an envelope of ordered fluid molecules, the core material and the envelope of ordered fluid molecules being in a steady physical state.
- at least a portion of the fluid molecules are in a gaseous state.
- the nanostructures are capable of clustering with at least one additional nanostructure. According to still further features in the described preferred embodiments the nanostructures are capable of maintaining long range interaction with at least one additional nanostructure.
- a concentration of the nanostructures is lower than 10 20 nanostructures per liter, more preferably lower than 10 15 nanostructures per liter.
- the nanostructures are capable of maintaining long range interaction thereamongst.
- the core material is selected from the group consisting of a ferroelectric core material, a ferromagnetic core material and a piezoelectric core material.
- the core material is a crystalline core material.
- the liquid is water.
- the nanostructures are designed such that a contact angle between the composition and a solid surface is smaller than a contact angle between the liquid and the solid surface.
- a method of producing a liquid composition from a solid powder comprising: (a) heating the solid powder, thereby providing a heated solid powder; (b) immersing the heated solid powder in a cold liquid; and (c) substantially contemporaneously with the step (b), irradiating the cold liquid and the heated solid powder by electromagnetic radiation, the electromagnetic radiation being characterized by a frequency selected such that nanostructures are formed from particles of the solid powder.
- a method of producing a liquid composition from hydroxyapatite comprising: (a) heating the hydroxyapatite, thereby providing a heated hydroxyapatite; (b) immersing the heated hydroxyapatite in a cold liquid; and (c) substantially contemporaneously with the step (b), irradiating the cold liquid and the heated solid powder by electromagnetic radiation, the electromagnetic radiation being characterized by a frequency selected such that nanostructures are formed from particles of the hydroxyapatite.
- the nanostructures are formulated from hydroxyapatite.
- the hydroxyapatite comprises micro-sized particles.
- the solid powder comprises micro-sized particles.
- the micro-sized particles are crystalline particles.
- the nanostructures are crystalline nanostructures.
- the solid powder is selected from the group consisting of a ferroelectric material and a ferromagnetic material. According to still further features in the described preferred embodiments the solid powder is selected from the group consisting OfBaTiO 3 , WO 3 and Ba 2 F 9 O 12 .
- the solid powder comprises a material selected from the group consisting of a mineral, a ceramic material, glass, metal and synthetic polymer.
- the electromagnetic radiation is in the radiofrequency range.
- the electromagnetic radiation is continues wave electromagnetic radiation.
- the electromagnetic radiation is modulated electromagnetic radiation.
- the present invention successfully addresses the shortcomings of the presently known configurations by providing a nanostructure and liquid composition having the nanostructure, which is characterized by numerous distinguishing physical, chemical and biological characteristics. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
- FIG. 1 is a schematic illustration of a nanostructure, according to a preferred embodiment of the present invention.
- FIG. 2a is a flowchart diagram of a method of producing a liquid composition, according to a preferred embodiment of the present invention
- FIG. 2b is a flowchart diagram of a method of amplifying a DNA sequence, according to a preferred embodiment of the present invention.
- FIGs. 3a-e are TEM images of the naiiostructures of the present invention.
- FIG. 4 shows the effect of dye on the liquid composition of the present invention
- FIGs. 5a-b show the effect of high g centrifugation on the liquid composition, where Figure 5a shows signals recorded of a lower portion of a tube and Figure 5b shows signals recorded of an upper portion of the tube;
- FIGs. 6a-c show results of pH tests, performed on the liquid composition of the present invention.
- FIG. 7 shows the absorption spectrum of the liquid composition of the present invention
- FIG. 8 shows results of ⁇ potential measurements of the liquid composition of the present invention
- FIGs. 9a-b show a bacteriophage reaction in the presence of the liquid composition of the present invention (left) and in the presence of a control medium (right);
- FIG. 10 shows a comparison between bacteriolysis surface areas of a control liquid and the liquid composition of the present invention
- FIG. 11 shows phage typing concentration at 100 routine test dilution, in the presence of the liquid composition of the present invention (left) and in the presence of a control medium (right);
- FIG. 12 shows optic density, as a function of time, of the liquid composition of the present invention and a control medium
- FIGs. 13a-c show optic density in slime-producing Staphylococcus epidermidis in an experiment directed to investigate the effect of the liquid composition of the present invention on the adherence of coagulase-negative staphylococci to microtiter plates;
- FIG. 14 is a histogram representing 15 repeated experiments of slime adherence to different micro titer plates
- FIG. 15 shows differences in slime adherence to the liquid composition of the present invention and the control on the same micro titer plate
- FIGs. 16a-c show an electrochemical deposition experimental setup
- FIGs. 17a-b show electrochemical deposition of the liquid composition of the present invention ( Figure 17a) and the control ( Figure 17b);
- FIG. 18 shows electrochemical deposition of reverse osmosis (RO) water in a cell which was in contact with the liquid composition of the present invention for a period of 30 minutes;
- FIGs. 19a-b show results of Bacillus subtilis colony growth for the liquid composition of the present invention ( Figure 19a) and a control medium ( Figure 19b);
- FIGs. 20a-c show results of Bacillus subtilis colony growth, for the water with a raw powder ( Figure 20a), reverse osmosis water (Figure 20b) and the liquid composition of the present invention (Figure 20c);
- FIGs. 21a-d show bindings of labeled and non-labeled antibodies to medium costar microtitration plate ( Figure 21a), non-sorp microtitration plate ( Figure 21b), maxisorp microtitration plate ( Figure 21c) and polysorp microtitration plate ( Figure 2Id) 5 using the liquid composition of the present invention or control buffer;
- FIGs. 22a-d show bindings of labeled antibodies to medium costar microtitration plate ( Figure 22a), non-sorp microtitration plate ( Figure 22b), maxisorp microtitration plate ( Figure 22c) and polysorp microtitration plate ( Figure 22d), using the liquid composition of the present invention or control buffer;
- FIGs. 23a-d show bindings of labeled antibodies after overnight incubation at 4 0 C, to non-sorp microtitration plate (Figure 23a), medium costar microtitration plate (Figure 23b), polysorp microtitration plate ( Figure 23 c) and maxisorp microtitration plate (Figure 23d), using the liquid composition of the present invention and using buffer;
- FIGs. 24a-d show bindings of labeled antibodies 2 hours post incubation at 37 0 C, to non-sorp microtitration plate (Figure 24a), medium costar microtitration plate (Figure 24b), polysorp microtitration plate (Figure 24c) and maxisorp microtitration plate (Figure 24d), using the liquid composition of the present invention or control buffer;
- FIGs. 25a-d show binding of labeled and non-labeled antibodies after overnight incubation at 4 0 C, to medium costar microtitration plate (Figure 25a), polysorp microtitration plate (Figure 25b), maxisorp microtitration plate (Figure 25c) and non-sorp microtitration plate (Figure 25d), using the liquid composition of the present invention or control buffer;
- FIGs. 26a-d show binding of labeled and non-labeled antibodies after overnight incubation at room temperature, to medium costar microtitration plate (Figure 25a), polysorp microtitration plate ( Figure 25b), maxisorp microtitration plate ( Figure 25c) and non-sorp microtitration plate ( Figure 25d), using the liquid composition of the present invention or control buffer;
- FIGs. 27a-b show binding results of labeled and non-labeled antibodies
- FIGs. 27c-d show binding results of labeled and non-labeled antibodies ( Figure 27a) and only labeled antibodies ( Figure 27b) using PBS washing buffer, for the liquid composition of the present invention or control buffer;
- FIGs. 28a-b show binding of labeled and non-labeled antibodies ( Figure 28a) and only labeled antibodies ( Figure 28a), after overnight incubation at 4 °C, to medium costar microtitration plate, using the liquid composition of the present invention or control buffer;
- FIG. 29a-c show binding of labeled lectin to non-sorp microtitration plate for acetate ( Figure 29a), carbonate ( Figure 29b) and phosphate (Figure 29c) buffers, using the liquid composition of the present invention or control buffer;
- FIGs. 30a-d show binding of labeled lectin to maxisorp microtitration plate for carbonate ( Figures 30a-b), acetate ( Figure 30c) and phosphate (Figure 3Od) buffers, using the liquid composition of the present invention or control buffer, where the graph shown in Figure 30b is a linear portion of the graph shown in Figure 30a.
- FIGs. 31a-b show an average binding enhancement capability of the liquid composition of the present invention for nucleic acid
- FIGs. 32-35b are images of PCR product samples before and after purifications for different buffer combinations and different elution steps;
- FIGs. 36-37 are an image ( Figure 36) and quantitative analysis (Figure 37) of PCR products having been passed through columns in varying amounts, concentrations and elution steps;
- FIGs. 38a-c are images of PCR products columns having been passed through columns 5-17 shown in Figure 36, in three elution steps;
- FIG. 39a shows the area of control buffer (designated CO) and the liquid composition of the present invention (designated LC) as a function of the loading volume for each of the three elution steps of Figures 38a-c;
- FIG. 39b shows the ratio LC/CO as a function of the loading volume for each of the three elution steps of Figures 38a-c;
- FIGs. 40a-42b are lane images comparing the migration speed of DNA in gel electrophoresis experiments in the presence of RO water ( Figures 40a, 41a and 42a) and in the presence of the liquid composition of the present invention ( Figures 40b,
- FIGs. 43a-45d are lane images captured in gel electrophoresis experiments in which the effect of the liquid composition of the present invention on running buffer was investigated;
- FIGs. 46a-48d are lane images captured in gel electrophoresis experiments in which the effect of the liquid composition of the present invention on the gel buffer was investigated;
- FIG. 49 shows values of a stability enhancement parameter, S e , as a function of the dilution, in an experiment in which the effect of the liquid composition of the present invention on the activity and stability of unbound form of alkaline phosphatase was investigated;
- FIG. 50 shows enzyme activity of alkaline phosphatase bound to Strept-
- FIGs. 51a-d show stability of ⁇ -Galactosidase after 24 hours (Figure 51a), 48 hours (Figure 51b), 72 hours (Figure 51c) and 120 hours (Figure 5 Id), in an experiment in which the effect of the liquid composition of the present invention on the activity and stability of ⁇ -Galactosidase was investigated;
- FIGs. 52a-d shows values of a stability enhancement parameter, S e , after 24 hours (Figure 52a), 48 hours (Figure 52b), 72 hours (Figure 52c) and 120 hours ( Figure 52d), in an experiment in which the effect of the liquid composition of the present invention on the activity and stability of ⁇ -Galactosidase was investigated;
- FIG. 53a shows remaining activity of alkaline phosphatase after drying and heat treatment
- FIG. 53b show values of the stability enhancement parameter, S e , of alkaline phosphatase after drying and heat treatment
- FIG. 54 shows lane images captured in gel electrophoresis experiments in which the effect of the liquid composition of the present invention on the ability of glass beads to affect DNA during a PCR reaction was investigated
- FIG. 55a is a standard curve of cDNA samples undergoing real-time PCR analysis in which dilutions were carried out using NeowaterTM with an automatic baseline determination;
- FIG. 55b is a dissociation curve of cDNA samples undergoing real-time PCR analysis in which dilutions were carried out using NeowaterTM with an automatic baseline determination;
- FIG. 56a is a standard curve of cDNA samples undergoing real-time PCR analysis in which dilutions were carried out using water with an automatic baseline determination
- FIG. 56b is a dissociation curve of cDNA samples undergoing real-time PCR analysis in which dilutions were carried out using water with an automatic baseline determination
- FIG. 57a is a standard curve of cDNA samples undergoing real-time PCR analysis in which dilutions were carried out using NeowaterTM with a manual background cut-off of 0.2;
- FIG. 57b is a standard curve of cDNA samples undergoing real-time PCR analysis in which dilutions were carried out using water with a manual background cut-off of 0.2;
- FIG. 60b is a curve of delta run vs.cycle of cDNA samples undergoing realtime PCR demonstrating the background noise when the reactions are carried out in the presence of water;
- FIG. 61a is an amplification plot of three real-time PCR reactions earned out in a 5 ⁇ l reaction volume in the presence of NeowaterTM;
- FIG. 61b is an amplification plot of three real-time PCR reactions carried out in a 10 ⁇ l reaction volume in the presence of NeowaterTM
- FIG. 61c is an amplification plot of three real-time PCR reactions carried out in a 15 ⁇ l reaction volume in the presence of NeowaterTM;
- FIG. 62a is an amplification plot of three real-time PCR reactions carried out in a 5 ⁇ l reaction volume in the presence of water;
- FIG. 62b is an amplification plot of three real-time PCR reactions carried out in a 10 ⁇ l reaction volume in the presence of water;
- FIG. 62c is an amplification plot of three real-time PCR reactions carried out in a 15 ⁇ l reaction volume in the presence of water;
- FIG. 63 shows results of isothermal measurement of absolute ultrasonic velocity in the liquid composition of the present invention as a function of observation time
- FIGs. 64a-d are photographs showing RNA enhanced hybridization to a DNA chip in the presence of the liquid composition of the present invention.
- Figures 64a and 64b depict hybridization to a DNA chip following a ten second exposure.
- Figures 64c and 64d depict hybridization to a DNA chip following a two second exposure.
- Figures 64a and 64c depict hybridization to a DNA chip in the absence of the liquid composition of the present invention.
- Figures 64b and 64d depict hybridization to a DNA chip in the presence of the liquid composition of the present invention.
- FIG. 65 is a graph illustrating Sodium hydroxide titration of various water compositions as measured by absorbence at 557 nm.
- FIGs. 66A-C are graphs of an experiment performed in triplicate illustrating
- FIGs. 67A-C are graphs illustrating Sodium hydroxide titration of water comprising nanostructures and RO water as measured by pH, each graph summarizing 3 triplicate experiments.
- FIGs. 68A-C are graphs of an experiment performed in triplicate illustrating Hydrochloric acid titration of water comprising nanostructures and RO water as measured by pH.
- FIG. 69 is a graph illustrating Hydrochloric acid titration of water comprising nanostructures and RO water as measured by pH, the graph summarizing 3 triplicate experiments.
- FIGs. 70 A-C are graphs illustrating Hydrochloric acid ( Figure 70A) and
- FIGs. 7 IA-B are photographs of cuvettes following Hydrochloric acid titration of RO ( Figure 71A) and water comprising nanostructures ( Figure 71B). Each cuvette illustrated addition of 1 ⁇ l of Hydrochloric acid.
- FIGs. 72A-C are graphs illustrating Hydrochloric acid titration of RF water (Figure 72A), RF2 water ( Figure 72B) and RO water (Figure 72C). The arrows point to the second radiation.
- FIG. 73 is a graph illustrating Hydrochloric acid titration of FR2 water as compared to RO water. The experiment was repeated three times. An average value for all three experiments was plotted for RO water.
- FIGs. 74A-J are photographs of solutions comprising red powder and NeowaterTM following three attempts at dispersion of the powder at various time intervals.
- Figures 74A-E illustrate right test tube C (50% EtOH+NeowaterTM) and left test tube B (dehydrated NeowaterTM) from Example 24 part C.
- Figures 74G-J illustrate solutions following overnight crushing of the red powder and titration of lOO ⁇ l NeowaterTM
- FIGs. 75 A-C are readouts of absorbance of 2 ⁇ l from 3 different solutions as measured in a nanodrop.
- Figure 75A represents a solution of the red powder following overnight crushing+100 ⁇ l Neowater.
- Figure 75B represents a solution of the red powder following addition of 100 % dehydrated NeowaterTM and
- Figure 75C represents a solution of the red powder following addition of EtOH+NeowaterTM (50 %-50 %).
- FIG. 76 is a graph of spectrophotometer measurements of vial #1 (CD-Dau +NeowaterTM), vial #4 (CD-Dau + 10 % PEG in NeowaterTM) and vial #5 (CD-Dau + 50 % Acetone + 50 % NeowaterTM).
- FIG. 77 is a graph of spectrophotometer measurements of the dissolved material in NeowaterTM (blue line) and the dissolved material with a trace of the solvent acetone (pink line).
- FIG. 78 is a graph of spectrophotometer measurements of the dissolved material in NeowaterTM (blue line) and acetone (pink line). The pale blue and the yellow lines represent different percent of acetone evaporation and the purple line is the solution without acetone.
- FIG. 79 is a graph of spectrophotometer measurements of CD-Dau at 200 — 800 nm.
- the blue line represents the dissolved material in RO while the pink line represents the dissolved material in NeowaterTM.
- FIG. 80 is a graph of spectrophotometer measurements of t-boc at 200 - 800 nm.
- the blue line represents the dissolved material in RO while the pink line represents the dissolved material in NeowaterTM.
- FIGs. 8 IA-D are graphs of spectrophotometer measurements at 200 - 800 nm.
- Figure 81 A is a graph of AG-14B in the presence and absence of ethanol immediately following ethanol evaporation.
- Figure 8 IB is a graph of AG-14B in the presence and absence of ethanol 24 hours following ethanol evaporation.
- Figure 81C is a graph of AG- 14A in the presence and absence of ethanol immediately following ethanol evaporation.
- Figure 8 ID is a graph of AG- 14A in the presence and absence of ethanol 24 hours following ethanol evaporation.
- FIG. 82 is a photograph of suspensions of AG- 14A and AG14B 24 hours following evaporation of the ethanol.
- FIGs. 83 A-G are graphs of spectrophotometer measurements of the peptides dissolved in NeowaterTM.
- Figure 83A is a graph of Peptide X dissolved in NeowaterTM.
- Figure 83B is a graph of X-5FU dissolved in NeowaterTM.
- Figure 83C is a graph of NLS-E dissolved in NeowaterTM.
- Figure 83D is a graph of PaIm- PFPSYK (CMFU) dissolved in NeowaterTM.
- Figure 83E is a graph of PFPSYKLRPG-NH 2 dissolved in NeowaterTM.
- FIG 83F is a graph of NLS-p2- LHRH dissolved in NeowaterTM
- Figure 83 G is a graph of F-LH-RH-palm kGFPSK dissolved in NeowaterTM.
- FIGs. 84A-G are bar graphs illustrating the cytotoxic effects of the peptides dissolved in NeowaterTM as measured by a crystal violet assay.
- Figure 84A is a graph of the cytotoxic effect of Peptide X dissolved in NeowaterTM.
- Figure 84B is a graph of the cytotoxic effect of X-5FU dissolved in NeowaterTM.
- Figure 84C is a graph of the cytotoxic effect of NLS-E dissolved in NeowaterTM.
- Figure 84D is a graph of the cytotoxic effect of Palm- PFPSYK (CMFU) dissolved in NeowaterTM.
- Figure 84E is a graph of the cytotoxic effect of PFPSYKLRPG-NH 2 dissolved in NeowaterTM.
- Figure 84F is a graph of the cytotoxic effect of NLS-p2-LHRH dissolved in
- NeowaterTM and Figure 84G is a graph of the cytotoxic effect of F-LH-RFf-palm kGFPSK dissolved in NeowaterTM.
- FIG. 85 is a graph of retinol absorbance in ethanol and NeowaterTM.
- FIG. 86 is a graph of retinol absorbance in ethanol and NeowaterTM following filtration.
- FIGs. 87A-B are photographs of test tubes, the left containing NeowaterTM and substance "X” and the right containing DMSO and substance "X".
- Figure 87A illustrates test tubes that were left to stand for 24 hours and
- Figure 87B illustrates test tubes that were left to stand for 48 hours.
- FIGs. 88A-C are photographs of test tubes comprising substance "X” with solvents 1 and 2 ( Figure 88A), substance “X” with solvents 3 and 4 ( Figure 88B) and substance “X” with solvents 5 and 6 ( Figure 88C) immediately following the heating and shaking procedure.
- FIGs. 89A-C are photographs of test tubes comprising substance "X” with solvents 1 and 2 ( Figure 89A), substance “X” with solvents 3 and 4 ( Figure 89B) and substance “X” with solvents 5 and 6 ( Figure 89C) 60 minutes following the heating and shaking procedure.
- FIGs. 90A-C are photographs of test tubes comprising substance "X” with solvents 1 and 2 ( Figure 90A), substance “X” with solvents 3 and 4 ( Figure 90B) and substance “X” with solvents 5 and 6 (Figure 90C) 120 minutes following the heating and shaking procedure.
- FIGs. 9 IA-C are photographs of test tubes comprising substance "X” with solvents 1 and 2 ( Figure 91 A), substance “X” with solvents 3 and 4 ( Figure 91B) and substance “X” with solvents 5 and 6 ( Figure 91C) 24 hours following the heating and shaking procedure.
- 92A-D are photographs of glass bottles comprising substance 1 X" in a solvent comprising NeowaterTM and a reduced concentration of DMSO, immediately following shaking ( Figure 92A), 30 minutes following shaking ( Figure 92B), 60 minutes following shaking (Figure 92C) and 120 minutes following shaking (Figure 32D).
- FIG. 93 is a graph illustrating the absorption characteristics of material "X" in RO/NeowaterTM 6 hours following vortex, as measured by a spectrophotometer.
- FIGs. 94 A-B are graphs illustrating the absorption characteristics of SPL2101 in ethanol ( Figure 94A) and SPL5217 in acetone ( Figure 94B), as measured by a spectrophotometer.
- FIGs. 95 A-B are graphs illustrating the absorption characteristics of SPL2101 in NeowaterTM ( Figure 95A) and SPL5217 in NeowaterTM ( Figure 95B), as measured by a spectrophotometer.
- FIGs. 96A-B are graphs illustrating the absorption characteristics of taxol in NeowaterTM ( Figure 96A) and DMSO ( Figure 96B), as measured by a spectrophotometer.
- FIG. 97 is a bar graph illustrating the cytotoxic effect of taxol in different solvents on 293 T cells.
- Control RO medium made up with RO water;
- Control Neo Neo
- Neo RO medium made up with RO water + 10 ⁇ l
- NeowaterTM; Taxol NW Neo medium made up with NeowaterTM + taxol dissolved in NeowaterTM.
- FIGs. 98A-B are photographs of a DNA gel stained with ethidium bromide illustrating the PCR products obtained in the presence and absence of the liquid composition comprising nanostructures following heating according to the protocol described in Example 32 using two different Taq polymerases.
- FIG. 99 is a photograph of a DNA gel stained with ethidium bromide illustrating the PCR products obtained in the presence and absence of the liquid composition comprising nanostructures following heating according to the protocol described in Example 33 using two different Taq polymerases.
- FIG. 100 is a photograph illustrating the multiplex capabilities of Neo waterTM in a heat dehydrated PCR mix.
- Figure IOOA illustrates a dehydrated mix with template and primers against human insulin gene.
- FIG. 101 is a photograph illustrating the ability of Neo waterTM to take part in a micro- volume PCR (MVP). MVP was effected on both an RO/ NeowaterTM base mix
- FIGs. 102A-C are amplification ( Figure 102A), Dissociation ( Figure 102B) and standard plots (Figure 102C) of Beta Actin amplification in NeowaterTM detected with syber green (SG). Blue: 50ng Genomic DNA; Red: 5ng Genomic DNA; Green: 0.5ng Genomic DNA 3 Black: NTC.
- FIGs. 103 A-C are amplification ( Figure 103A), Dissociation ( Figure 103B) and standard plots (Figure 103C) of PD-X amplification in NeowaterTM detected with syber green (SG). Blue: 50ng Genomic DNA; Red: 5ng Genomic DNA; Green: 0.5ng Genomic DNA, Black: NTC.
- FIG. 104 is a digital micrograph of electrochemical deposition ECD of Zn from ZnSO 4 as a solute within the hydroxyapatite (HA)-based NeowaterTM (HA- 18) slurry. This is the QC of NeowaterTM.
- FIGs. 105 A-H are HRSEM micrographs with increased magnification taken from the HA (HA- 18) source powder.
- FIGs. 106 A-H are HRSEM micrographs taken from the HA-based NeowaterTM (HA- 18) residing on a Si wafer.
- FIGs. 107A-H are TEM micrographs taken from the HA-based NeowaterTM (HA- 18) residing on a Copper 400 mesh Carbon film TEM grid.
- FIG. 108 is a digital micrograph of electrochemical deposition ECD of Zn from ZnSO 4 as a solute within the HA-based NeowaterTM (AB 1-22-1) slurry. This is the QC of NeowaterTM.
- FIGs. 109A-H are HRSEM micrographs with increased magnification taken from the HA (AB 1-22-1) source powder.
- FIGs. 110A-H are HRSEM micrographs taken from the HA-based NeowaterTM (AB 1-22-1) residing on a Si wafer.
- FIGs. 111A-H are TEM micrographs taken from the HA-based NeowaterTM
- FIG. 112 is a digital micrograph of electrochemical deposition ECD of Zn from ZnSO 4 as a solute within the HA-based NeowaterTM (AA99-X) slurry. This is the QC of NeowaterTM.
- FIGs. 113 A-H are HRSEM micrographs with increased magnification taken from the HA (AA99-X) source powder.
- FIGs. 114A-H are HRSEM micrographs taken from the HA-based NeowaterTM (AA99-X) residing on a Si wafer.
- FIGs. 115A-H are TEM micrographs taken from the HA-based NeowaterTM (AA99-X) residing on a Copper 400 mesh Carbon film TEM grid.
- FIG. 116 is a digital micrograph of electrochemical deposition ECD of Zn from ZnSO 4 as a solute within the HA-based NeowaterTM (AB 1-2-3) slurry. This is the QC of NeowaterTM.
- FIGs. 117A-H are HRSEM micrographs with increased magnification taken from the HA (AB 1-2-3) source powder.
- FIGs. 118A-H are HRSEM micrographs taken from the HA-based NeowaterTM (AB 1-2-3) residing on a Si wafer.
- FIGs. 119A-H are TEM micrographs taken from the HA-based NeowaterTM (AB 1-2-3) residing on a Copper 400 mesh Carbon film TEM grid.
- FIG. 120 is a digital micrograph of electrochemical deposition ECD of Zn from ZnSO 4 as a solute within the HA-based NeowaterTM (HAP) slurry. This is the QC of NeowaterTM.
- FIGs. 12 IA-H are HRSEM micrographs with increased magnification taken from the HA (HAP) source powder.
- FIGs. 122 A-H are HRSEM micrographs taken from the HA-based NeowaterTM
- FIGs. 123 A-H are TEM micrographs taken from the HA-based NeowaterTM (HAP) residing on a Copper 400 mesh Carbon film TEM grid.
- FIG. 124 is a digital micrograph of electrochemical deposition ECD of Zn from ZnSO 4 as a solute within the BaTiO 3 -based NeowaterTM slurry. This is the QC ofNeowaterTM.
- FIGs. 125A-J are HRSEM micrographs with increased magnification taken from the BaTiO 3 source powder.
- FIGs. 126 A-H are HRSEM micrographs taken from the BaTi ⁇ 3-based NeowaterTM residing on a Si wafer.
- FIGs. 127A-F are TEM micrographs taken from the BaTiO 3 -based NeowaterTM residing on a Copper 400 mesh Carbon film TEM grid.
- the present invention is of a nanostructure and liquid composition having the nanostructure and characterized by a plurality of distinguishing physical, chemical and biological characteristics.
- the liquid composition of the present invention can be used for many biological and chemical applications such as, but not limited to, bacterial colony growth, electrochemical deposition, nucleic acid amplification, a solvent and the like.
- Figure 1 illustrates a nanostructure 10 comprising a core material 12 of a nanometric size, surrounded by an envelope 14 of ordered fluid molecules. Core material 12 and envelope 14 are in a steady physical state.
- steady physical state is referred to a situation in which objects or molecules are bound by any potential having at least a local minimum.
- Representative examples, for such a potential include, without limitation,
- Van der Waals potential Yukawa potential
- Lenard- Jones potential and the like.
- Other forms of potentials are also contemplated.
- ordered fluid molecules is referred to an organized arrangement of fluid molecules having correlations thereamongst.
- the fluid molecules of envelope 14 may be either in a liquid state or in a gaseous state.
- envelope 14 comprises gaseous material
- the nanostructure is capable of floating when subjected to sufficient g-forces.
- Core material 12 is not limited to a certain type or family of materials, and can be selected in accordance with the application for which the nanostructure is designed. Representative examples include, without limitation, ferroelectric material, a ferromagnetic material and a piezoelectric material. As demonstrated in the Examples section that follows (see Example 1) core material 12 may also have a crystalline structure.
- a ferroelectric material is a material that maintains, over some temperature range, a permanent electric polarization that can be reversed or reoriented by the application of an electric field.
- a ferromagnetic material is a material that maintains permanent magnetization, which is reversible by applying a magnetic field.
- nanostructure 10 when core material 12 is ferroelectric or ferromagnetic, nanostructure 10 retains its ferroelectric or ferromagnetic properties. Hence, nanostructure 10 has a particular feature in which macro scale physical properties are brought into a nanoscale environment.
- nanostructure 10 is capable of clustering with at least one additional nanostructure. More specifically, when a certain concentration of nanostructure 10 is mixed in a liquid ⁇ e.g. , water), attractive electrostatic forces between several nanostractures may cause adherence thereamongst so as to form a cluster of nanostractures. Preferably, even when the distance between the nanostructures prevents cluster formation, nanostructure 10 is capable of maintaining long range interaction (about 0.5-10 ⁇ m), with the other nanostructures. Long range interactions between nanostructures present in a liquid, induce unique characteristics on the liquid, which can be exploited in many applications, such as, but not limited to, biological and chemical assays.
- nanostructure 10 may be accomplished, for example, by producing nanostructure 10 using a "top-down" process. More specifically, nanostructure 10 can be produced from a raw powder of micro-sized particles, say, above 1 ⁇ m or above 10 ⁇ m in diameter, which are broken in a controlled manner, to provide nanometer-sized particles. Typically, such a process is performed in a cold liquid (preferably, but not obligatorily, water) into which high-temperature raw powder is inserted, under condition of electromagnetic radiofrequency (RF) radiation.
- RF radiofrequency
- water is one of a remarkable substance, which has been very well studied. Although it appears to be a very simple molecule consisting of two hydrogen atoms attached to an oxygen atom, it has complex properties. Water has numerous special properties due to hydrogen bonding, such as high surface tension, high viscosity, and the capability of forming ordered hexagonal, pentagonal of dodecahedral water arrays by themselves of around other substances.
- the melting point of water is over 100 K higher than expected when considering other molecules with similar molecular weight.
- hexagonal ice phase of the water the normal form of ice and snow
- all water molecules participate in four hydrogen bonds (two as donor and two as acceptor) and are held relatively static.
- some hydrogen bonds must be broken to allow the molecules move around.
- the large energy required for breaking these bonds must be supplied during the melting process and only a relatively minor amount of energy is reclaimed from the change in volume.
- the free energy change must be zero at the melting point.
- the amount of hydrogen bonding in liquid water decreases and its entropy increases. Melting will only occur when there is a sufficient entropy change to provide the energy required for the bond breaking.
- the low entropy (high organization) of liquid water causes this melting point to be high.
- Water has high density, which increases with the temperature, up to a local maximum occurring at a temperature of 3.984 °C. This phenomenon is known as the density anomaly of water.
- the high density of liquid water is mainly due to the cohesive nature of the hydrogen-bonded network. This reduces the free volume and ensures a relatively high-density, compensating for the partial open nature of the hydrogen-bonded network.
- the anomalous temperature-density behavior of water can be explained utilizing the range of environments within whole or partially formed clusters with differing degrees of dodecahedral puckering.
- the density maximum (and molar volume minimum) is brought about by the opposing effects of increasing temperature, causing both structural collapse that increases density and thermal expansion that lowers density. At lower temperatures, there is a higher concentration of expanded structures whereas at higher temperatures there is a higher concentration of collapsed structures and fragments, but the volume they occupy expands with temperature.
- the change from expanded structures to collapsed structures as the temperature rises is accompanied by positive changes in entropy and enthalpy due to the less ordered structure and greater hydrogen bond bending, respectively.
- the hydrogen bonds of water create extensive networks, that can form numerous hexagonal, pentagonal of dodecahedral water arrays.
- the hydrogen- bonded network possesses a large extent of order. Additionally, there is temperature dependent competition between the ordering effects of hydrogen bonding and the disordering kinetic effects. As known, water molecules can form ordered structures and superstructures.
- shells of ordered water form around various biomolecules such as proteins and carbohydrates.
- the ordered water environment around these biomolecules are strongly involved in biological function with regards to intracellular function including, for example, signal transduction from receptors to cell nuclei. Additionally these water structures are stable and can protect the surface of the molecule.
- Other properties of water include a high boiling point, a high critical point, reduction of melting point with pressure (the pressure anomaly), compressibility which decreases with increasing temperature up to a minimum at about 46 °C, and the like.
- FIG. 2a is a flowchart diagram of the method, according to a preferred embodiment of the present invention.
- the method comprises the following method steps, in which in a first step, a solid powder (e.g., a mineral, a ceramic powder, a glass powder, a metal powder, a synthetic polymer, etc.) is heated, to a sufficiently high temperature, preferably more than about 500 °C, more preferably about 600 °C and even more preferably about 700 °C.
- Representative examples of solid powders which are contemplated include, without limitation, BaTiO 3 , WO 3 and Ba 2 F 9 O 12 .
- the present inventors unexpectedly found that hydroxyapatite (HA) may also be used in the formulation of the composition. Hydroxyapatite is specifically preferred as it is characterized by intoxocicty and is generally FDA approved for human therapy.
- the liquid composition of the present invention was generated from 5 different hydroxyapatite powders (HA- 18, AB 1-22-1, AA99-X, AB 1-2-3 and HAP), all of which are commercially available from Sigma Aldrich. It will be appreciated that many other hydroxyapatite powders are available from a variety of manufacturers such as Clarion Pharmaceuticals (e.g. Catalogue No. 1306- 06-5).
- the HA based liquid compositions of the present invention were all shown by electron microscopy to be very similar to the liquid compositions based on BaTiO 3 -
- Figures 104-127A-F Furthermore, as shown in Table 36, liquid compositions based on HA, all comprised enhanced buffering capacities as compared to water.
- the heated powder is immersed in a cold liquid, preferably water, below its density anomaly temperature, e.g., 3 °C or 2 °C.
- a cold liquid preferably water
- the cold liquid and the powder are irradiated by electromagnetic RF radiation, preferably above 500 MHz, which may be either continuous wave RF radiation or modulated RF radiation.
- electromagnetic RF radiation preferably above 500 MHz, which may be either continuous wave RF radiation or modulated RF radiation.
- the combination of cold liquid, and RF radiation influences the interface between the particles and the liquid, thereby breaking the liquid molecules and the particles.
- the broken liquid molecules are in the form of free radicals, which envelope the (nano-sized) debris of the particles. Being at a small temperature, the free radicals and the debris enter a steady physical state.
- the attraction of the free radicals to the nanostructures can be understood from the relatively small size of the nanostructures, compared to the correlation length of the liquid molecules. It has been argued [D. Bartolo, et al., Europhys. Lett., 2000, 49(6):729-734], that a small size perturbation may contribute to a pure Casimir effect, which is manifested by long-range interactions.
- a liquid composition having a liquid and nanostructures 10 is provided.
- envelope 14 of nanostructure 10 is preferably made of molecules which are identical to the molecule of the liquid.
- the nanostructure may be further mixed (with or without RF irradiation) with a different liquid, so that in the final composition, at least a portion of envelope 14 is made of molecules which are different than the molecules of the liquid.
- the nanostructures preferably have a specific gravity which is lower than or equal to a specific gravity of liquid.
- concentration of the nanostructures is not limited. A preferred concentration is below 10 20 nanostructures per liter, more preferably below 10 1 nanostructures per litter.
- concentrations the average distance between the nanostructures in the composition is rather large, of the order of microns.
- the liquid composition of the present invention has many unique characteristics. These characteristics may be facilitated, for example, by long range interactions between the nanostructures. In particular, long range interactions allow that employment of the above relatively low concentrations.
- ECD is a process in which a substance is subjected to a potential difference (for example using two electrodes), so that an electrochemical process is initiated.
- a particular property of the ECD process is the material distribution obtained thereby.
- the potential measured between the electrodes at a given current is the sum of several types of over- voltage and the Ohmic drop in the substrate.
- the size of the Ohmic drop depends on the conductivity of the substrate and the distance between the electrodes.
- the current density of a specific local area of an electrode is a function of the distance to the opposite electrode. This effect is called the primary current distribution, and depends on the geometry of the electrodes and the conductivity of the substrate.
- a predetermined morphology e.g., dense brandling and/or dendritic
- the liquid composition of the present invention is capable of preserving an electrochemical signature on the surface of the cell even when replaced by a different liquid (e.g., water).
- a different liquid e.g., water
- the long range interaction of the nanostructures can also be demonstrated by subjecting the liquid composition of the present invention to new environmental conditions (e.g., temperature change) and investigating the effect of the new environmental conditions on one or more physical quantities which are related to the interaction between the nanostructures in the composition.
- new environmental conditions e.g., temperature change
- ⁇ quantity is ultrasonic velocity.
- the liquid composition of the present invention is characterized by an enhanced ultrasonic velocity relative to water.
- An additional characteristic of the present invention is a small contact angle between the liquid composition and solid surface.
- the contact angle between the liquid composition and the surface is smaller than a contact angle between liquid (without the nanostructures) and the surface.
- small contact angle allows the liquid composition to "wet" the surface in larger extent. It is to be understood that this feature of the present invention is not limited to large concentrations of the nanostructures in the liquid, but rather also to low concentrations, with the aid of the above-mentioned long range interactions between the nanostructures.
- liquid composition of the present invention is solubility. As demonstrated in the Examples section that follows, the liquid composition of the present invention is characterized by an enhanced ability to dissolve or disperse a substance as compared to water ( Figures 74-97).
- dissolve refers to the ability of the liquid composition of the present invention to make soluble or more soluble in an aqueous environment.
- disperse relates to the operation of putting into suspension according to the degree of solubility of the substance.
- a method of dissolving or dispersing a substance comprising contacting the substance with nanostructures and liquid under conditions which allow dispersion or dissolving of the substance.
- the nanostructures and liquid of the present invention may be used to dissolve/disperse any substance (e.g. active agent) such as a protein, a nucleic acid, a small molecule and a carbohydrate, including pharmaceutical agents such as therapeutic agents, cosmetic agents and diagnostic agents.
- substance e.g. active agent
- pharmaceutical agents such as therapeutic agents, cosmetic agents and diagnostic agents.
- a therapeutic agent can be any biological active factor such as, for example, a drug, a nucleic acid construct, a vaccine, a hormone, an enzyme, small molecules such as for example iodine or an antibody.
- therapeutic agents include, but are not limited to, antibiotic agents, free radical generating agents, anti fungal agents, anti-viral agents, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, non-steroidal anti inflammatory drugs, immunosuppressants, antihistamine agents, retinoid agents, tar agents, antipuritic agents, hormones, psoralen, and scabicide agents.
- Nucleic acid constructs deliverable by the present invention can encode polypeptides (such as enzymes ligands or peptide drugs), antisense RNA, or ribozymes.
- a cosmetic agent of the present invention can be, for example, an anti- wrinkling agent, an anti-acne agent, a vitamin, a skin peel agent, a hair follicle stimulating agent or a hair follicle suppressing agent.
- cosmetic agents include, but are not limited to, retinoic acid and its derivatives, salicylic acid and derivatives thereof, sulfur-containing D and L amino acids and their derivatives and salts, particularly the N-acetyl derivatives, alpha-hydroxy acids, e.g., glycolic acid, and lactic acid, phytic acid, lipoic acid and many other agents which are known in the art.
- a diagnostic agent of the present invention may be an antibody, a chemical or a dye specific for a molecule indicative of a disease state.
- the substance may be dissolved in a solvent prior or following addition of the liquid composition of the present invention in order to aid in the solubilizing process. It will be appreciated that the present invention contemplates the use of any solvent including polar, non-polar, organic, (such as ethanol or acetone) or non-organic to further increase the solubility of the substance.
- the solvent may be removed (completely or partially) at any time during the solubilizing process so that the substance remains dissolved/dispersed in the liquid composition of the present invention.
- Methods of removing solvents are known in the art such as evaporation (i.e.by heating or applying pressure) or any other method.
- a further characteristic of the liquid composition of the present invention is buffering capacity. As demonstrated in the Examples section that follows, the liquid composition of the present invention is characterized by an enhanced buffering capacity as compared to water ( Figures 74-97).
- liquid composition of the present invention is protein stability. As demonstrated in the Examples section that follows, the liquid composition of the present invention is characterized by an enhanced ability to stabilize proteins (e.g. protect them from the effects of heat) as compared to water ( Figures 98A-B- Figure 99).
- the liquid composition of the present invention is capable of facilitating the increment of bacterial colony expansion rate and phage-bacteria or virus-cell interaction, even when the solid powder used for preparing the liquid composition is toxic to the bacteria.
- the unique process by which the liquid composition is produced which, as stated, allows the formation of envelope 14 surrounding core material 12, significantly suppresses any toxic influence of the liquid composition on the bacteria or phages.
- An additional characteristic of the liquid composition of the present invention is related to the so called zeta ( ⁇ ) potential
- ⁇ potential is related to physical phenomena called electrophoresis and dielectrophoresis in which particles can move in a liquid under the influence of electric fields present therein.
- the ⁇ potential is the electric potential at a shear plane, defined at the boundary between two regions of the liquid having different behaviors.
- the electrophoretic mobility of particles (the ratio of the velocity of particles to the field strength) is proportional to the ⁇ potential.
- the ⁇ potential is particularly important in systems with small particle size, where the total surface area of the particles is large relative to their total volume, so that surface related phenomena determine their behavior.
- the liquid composition is characterized by a ⁇ potential which is substantially larger than the ⁇ potential of the liquid per se.
- Large ⁇ potential corresponds to enhanced mobility of the nanostructures in the liquid, hence, it may contribute, for example, to the formation of special morphologies in the electrochemical deposition process.
- the present invention also relates to the field of molecular biology research and diagnosis, particularly to nucleic acid amplification techniques, such as, but not limited to, polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA) and self-sustained sequence replication (SSSR).
- PCR polymerase chain reaction
- LCR ligase chain reaction
- SDA strand displacement amplification
- SSSR self-sustained sequence replication
- the liquid composition of the present invention is capable of improving the efficiency of a nucleic acid amplification process.
- the phrase "improving the efficiency of a nucleic acid amplification process” refers to enhancing the catalytic activity of a DNA polymerase in PCR procedures, increasing the stability of the proteins required for the reaction, increasing the sensitivity and/or reliability of the amplification process and/or reducing the reaction volume of the amplification reaction.
- the enhancement of catalytic activity is preferably achieved without the use of additional cofactors such as, but not limited to, magnesium or manganese.
- the ability to employ a magnesium-free or manganese-free PCR is highly advantageous. This is because the efficiency of a PCR procedure is known to be very sensitive to the concentration of the cofactors present in the reaction. An expert scientist is often required to calculate in advance the concentration of cofactors or to perform many tests, with varying concentrations of cofactors, before achieving the desired amplification efficiency.
- liquid composition of the present invention thus allows the user to execute a simple and highly efficient multi-cycle PCR procedure without having to calculate or vary the concentration of cofactors in the PCR mix.
- a real-time PCR reaction refers to a PCR reaction which is carried out in the presence of a double stranded DNA detecting molecule (e.g., dye) during each PCR cycle.
- a double stranded DNA detecting molecule e.g., dye
- the present inventors have shown that the liquid composition of the present invention may be used in very small volume PCR reactions (e.g. 2 ⁇ ls). In addition, the present inventors have shown that the liquid composition of the present invention may be used in heat dehydrated multiplex PCR reactions.
- a kit for polymerase chain reaction The PCR kit of the present invention may, if desired, be presented in a pack which may contain one or more units of the kit of the present invention. The pack may be accompanied by instructions for using the kit. The pack may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of laboratory supplements, which notice is reflective of approval by the agency of the form of the compositions.
- the kit comprises, preferably in separate packaging, a thermostable DNA polymerase, such as, but not limited to, Taq polymerase and the liquid composition of the present invention.
- a thermostable DNA polymerase such as, but not limited to, Taq polymerase and the liquid composition of the present invention.
- the kit is used for realtime PCR kit and additionally comprises at least one real-time PCR reagent such as a double stranded DNA detecting molecule.
- the components of the kit may be packaged separately or in any combination.
- double stranded DNA detecting molecule refers to a double stranded DNA interacting molecule that produces a quantifiable signal (e.g., fluorescent signal).
- a double stranded DNA detecting molecule can be a fluorescent dye that (1) interacts with a fragment of DNA or an amplicon and (2) emits at a different wavelength in the presence of an amplicon in duplex formation than in the presence of the amplicon in separation.
- a double stranded DNA detecting molecule can be a double stranded DNA intercalating detecting molecule or a primer- based double stranded DNA detecting molecule.
- a double stranded DNA intercalating detecting molecule is not covalently linked to a primer, an amplicon or a nucleic acid template.
- the detecting molecule increases its emission in the presence of double stranded DNA and decreases its emission when duplex DNA unwinds. Examples include, but are not limited to, ethidium bromide, YO-PRO-I, Hoechst 33258, SYBR Gold, and SYBR Green I.
- Ethidium bromide is a fluorescent chemical that intercalates between base pairs in a double stranded DNA fragment and is commonly used to detect DNA following gel electrophoresis. When excited by ultraviolet light between 254 nm and 366 nm, it emits fluorescent light at 590 nm.
- the DNA-ethidium bromide complex produces about 50 times more fluorescence than ethidium bromide in the presence of single stranded DNA.
- SYBR Green I is excited at 497 nm and emits at 520 nm. The fluorescence intensity of SYBR Green I increases over 100 fold upon binding to double stranded DNA against single stranded DNA.
- SYBR Gold introduced by Molecular Probes Inc. Similar to SYBR Green I, the fluorescence emission of SYBR Gold enhances in the presence of DNA in duplex and decreases when double stranded DNA unwinds. However, SYBR Gold's excitation peak is at 495 nm and the emission peak is at 537 nm.
- Hoechst 33258 is a known bisbenzimide double stranded DNA detecting molecule that binds to the AT rich regions of DNA in duplex. Hoechst 33258 excites at 350 nm and emits at 450 nm. YO-PRO-I, exciting at 450 nm and emitting at 550 nm, has been reported to be a double stranded DNA specific detecting molecule. In a preferred embodiment of the present invention, the double stranded DNA detecting molecule is SYBR Green I.
- a primer-based double stranded DNA detecting molecule is covalently linked to a primer and either increases or decreases fluorescence emission when amplicons form a duplex structure. Increased fluorescence emission is observed when a primer- based double stranded DNA detecting molecule is attached close to the 3' end of a primer and the primer terminal base is either dG or dC.
- the detecting molecule is quenched in the proximity of terminal dC-dG and dG-dC base pairs and dequenched as a result of duplex formation of the amplicon when the detecting molecule is located internally at least 6 nucleotides away from the ends of the primer. The dequenching results in a substantial increase in fluorescence emission.
- Examples of these type of detecting molecules include but are not limited to fluorescein (exciting at 488 nm and emitting at 530 nm), FAM (exciting at 494 nm and emitting at 518 nm), JOE (exciting at 527 and emitting at 548), HEX (exciting at 535 nm and emitting at 556 nm), TET (exciting at 521 nm and emitting at 536 nm), Alexa Fluor 594 (exciting at 590 nm and emitting at 615 nm), ROX (exciting at 575 nm and emitting at 602 nm), and TAMRA (exciting at 555 nm and emitting at 580 nm).
- fluorescein exciting at 488 nm and emitting at 530 nm
- FAM exciting at 494 nm and emitting at 518 nm
- JOE exciting at 527 and emitting at 548
- HEX exciting at 535
- primer-based double stranded DNA detecting molecules decrease their emission in the presence of double stranded DNA against single stranded DNA.
- examples include, but are not limited to, rhodamine, and BODIPY-FI (exciting at 504 nm and emitting at 513 nm).
- These detecting molecules are usually covalently conjugated to a primer at the 5' terminal dC or dG and emit less fluorescence when amplicons are in duplex. It is believed that the decrease of fluorescence upon the formation of duplex is due to the quenching of guanosine in the complementary strand in close proximity to the detecting molecule or the quenching of the terminal dC-dG base pairs.
- the PCR and real-time PCR kits may comprise at least one dNTP, such as, but not limited to, dATP, dCTP, dGTP, dTTP.
- dNTP such as, but not limited to, dATP, dCTP, dGTP, dTTP.
- Analogues such as dITP and 7-deaza-dGTP are also contemplated.
- kits may further comprise at least one control template DNA and/or at least one at least one control primer to allow the user to perform at least one control test to ensure the PCR performance.
- a method of amplifying a DNA sequence comprises the following method steps illustrated in the flowchart of Figure 2b.
- the liquid composition of the present invention is provided, and in a second step, a plurality of PCR cycles is executed on the DNA sequence in the presence of the liquid composition.
- PCR cycles can be performed in any way known in the art, such as, but not limited to, the PCR cycles disclosed in U.S. Patent Nos. 4,683,195, 4,683,202, 4,800,159, 4,965,188, 5,512,462, 6,007,231, 6,150,094, 6,214,557, 6,231,812, 6,391,559, 6,740,510 and International Patent application No. WO99/11823.
- the DNA sequence is first treated to form single-stranded complementary strands.
- pair of oligonucleotide primers which are specific to the DNA sequence are added to the liquid composition.
- the primer pair is then annealed to the complementary sequences on the single- stranded complementary strands. Under proper conditions, the annealed primers extend to synthesize extension products which are respectively complementary to each of the single-strands.
- Anchoring polynucleotide to a solid support such as glass beads can be of utmost benefit in the field of molecular biology research and medicine.
- polynucleotides are defined as DNA or RNA molecules linked to form a chain of any size.
- Polynucleotides may be manipulated in many ways during the course of research and medical applications, including, but not limited to amplification, transcription, reverse transcription, ligation, restriction digestion, transfection and transformation.
- ligation is defined as the joining of the 3' end of one nucleic acid strand with the 5' end of another, forming a continuous strand.
- Transcription is defined as the synthesis of messenger RNA from DNA.
- reverse transcription is defined as the synthesis of DNA from RNA.
- Restriction digestion is defined as the process of cutting DNA molecules into smaller pieces with special enzymes called Restriction Endonucleases.
- Transformation is the process by which bacterial cells take up naked DNA molecules
- Transfection is the process by which cells take up DNA molecules.
- DNA manipulations comprise a sequence of reactions, one following the other.
- DNA can be initially restriction digested, amplified and then transformed into bacteria.
- Each reaction is preferably performed under its own suitable reaction conditions requiring its own specific buffer.
- the DNA or RNA sample must be precipitated and then reconstituted in its new appropriate buffer. Repeated precipitations and reconstitutions takes time and more importantly leads to loss of starting material, which can be of utmost relevance when this material is rare. By anchoring the polynucleotides to a solid support, this is avoided.
- a liquid composition comprising a liquid and nanostructures, the liquid composition is capable of allowing the manipulation of at least one macromolecule in the presence of a solid support, whereby each of the nanostructures comprise a core material of a nanometric size surrounded by an envelope of ordered fluid molecules, the core material and the envelope of ordered fluid molecules being in a steady physical state.
- the solid support can be any solid support capable of binding DNA and RNA while allowing access of other molecules to bind and interact with the DNA and RNA in subsequent reactions as discussed above.
- the inventor of the present invention found that glass beads, which are capable of anchoring polynucleotides, require the liquid composition of the present invention in order for the polynucleotides to remain intact.
- DNA undergoing PCR amplification in the presence of glass beads requires the presence of the liquid composition of the present invention for the PCR product to be visualized.
- the liquid composition of the present invention can be used as a buffer or an add-on to an existing buffer, for improving many chemical and biological assays and reactions.
- liquid composition of the present invention can be used to at least partially de-fold DNA molecules.
- liquid composition of the present invention can be used to facilitate isolation and purification of DNA.
- the liquid composition of the present invention can be used to enhance nucleic acid hybridization as demonstrated in Example 19.
- the nucleic acid may be a DNA and/or RNA molecule (i.e., nucleic acid sequence or a single base thereof).
- One of the nucleic acids may be bound to a solid support (e.g. a DNA chip).
- a solid support e.g. a DNA chip
- DNA chips include but are not limited to focus array chips, Affymetrix chips and Illumina bead array chips.
- the present invention may be particularly useful in detecting genes which have low expression levels.
- the liquid composition of the present invention can be used for stabilizing enzyme activity of many enzymes, either bound or unbound enzymes, such as, but not limited to, Alkaline Phosphatase or ⁇ - Galactosidase.
- the liquid composition of the present invention can also be used for enhancing binding of macromolecule to a solid phase matrix.
- the liquid composition of the present invention can enhance binding to both hydrophilic and hydrophobic substances.
- the liquid composition of the present invention can enhance binding to substances having hydrophobic regions and hydrophilic regions.
- the binding of many macromolecules to the above substances can be enhanced, including, without limitation macromolecule having one or more carbohydrate hydrophilic or carbohydrate hydrophobic regions, antibodies, polyclonal antibodies, lectin, DNA molecules, RNA moleculs and the like. Additionally, as demonstrated in the Examples section that follows (see
- liquid composition of the present invention can be used for increasing a capacity of a column, binding of nucleic acids to a resin and improving gel electrophoresis separation.
- a powder of micro-sized BaTiO 3 was heated, to a temperature of 880 °C.
- liquid compositions manufactured according to various exemplary embodiments of the present invention, are referred to as LCl, LC2, LC3, LC4, LC5, LC6, LC7, LC8 and LC9.
- trade name various liquid compositions, manufactured according to various exemplary embodiments of the present invention, are referred to by the trade name
- NeowaterTM a trade name of Do-Coop Technologies Ltd.
- EXAMPLE l Solid-Fluid Coupling and Clustering of the Nanostructure
- the coupling of the surrounding fluid molecules to the core material was investigated by Cryogenic-temperature transmission electron microscopy (cryo-TEM), which is a modern technique of structural fluid systems.
- the analysis involved the following steps in which in a first step, the liquid composition of the present invention (LCl) was cooled ultra-rapidly, so that vitreous sample was provided, and in a second step the vitreous sample was examined in via TEM at cryogenic temperatures.
- LCl liquid composition of the present invention
- Figures 3a-e show TEM images of the nanostructures of the present invention.
- Figure 3a is an image of a region, about 200 nm long and about 150 nm wide, occupied by four nanostructures.
- the nanostructures form a cluster via intermediate regions of fluid molecules; one such region is marked by a black arrow. Striations surrounding the nanostructures, marked by a white arrow in Figure 3 a, suggest a crystalline structure thereof.
- Figure 3 b is an image of a single nanostructure, about 20 nm in diameter.
- a bright corona marked by a white arrow, may be a consequence of an optical interference effect, commonly known as the Fresnel effect.
- An additional, darker, corona (marked by a black arrow in Figure 3 b) was observed at a further distance from the center of the nanostructure, as compared to the bright corona.
- the dark corona indicate an ordered structure of fluid molecules surrounding the core, so that the entire nanostructure is in a steady physical state.
- Figures 3c-e are of equal magnification, which is illustrated by a scale-bar shown in Figure 3 c.
- Figure 3 c further demonstrates, in a larger magnification than in Figure 3 a, the ability of the nanostructures of the present invention to cluster.
- Figure 3d shows a single nanostructure characterized by crystalline facets and
- Figure 3e shows a cluster of two nanostructures in which one is characterized by crystalline facets and the other has a well defined dark area which is also attributed to its crystalline structure.
- One cuvette containing the liquid composition of the present invention (LCl) was exposed to the dye solution for 24 hours.
- a second cuvette containing the liquid composition was exposed to the following protocol: (i) stirring, (ii) drying with air stream, and (iii) dying.
- Two additional cuvettes, containing pure water were subjected to the above tests as control groups.
- Figure 4 shows the results of the four tests. As shown in Figure 4 the addition of the dye results in the disappearance of the dye color (see the lower curves in Figure
- Figures 5a-b show results of five integrated light scattering (ILS) measurements of the liquid composition of the present invention (LCl) after centrifugation.
- Figure 5a shows signals recorded at the lower portion of the tubes. As shown, no signal from structures less that 1 ⁇ m was recorded from the lower portion.
- Figure 5b shows signals recorded at the upper portion of the tubes. A clear presence of structures less than 1 ⁇ m is shown. In all the measurements, the location of the peaks are consistent with nanostructures of about 200-300 nm. This experiment demonstrated that the nanostructures have a specific gravity which is lower than the specific gravity of the host liquid (water).
- the liquid composition of the present invention was subjected to two pH tests.
- caraminic indicator was added to the liquid composition of the present invention (LCl) so as to provide an indication of affective pH.
- Figure 6a shows the spectral change of the caraminic indicator during titration. These spectra are used to examine the pH of the liquid composition.
- Figure 6b shows that the liquid composition spectrum is close to the spectrum of water at pH 7.5.
- Figure 6c shows that unlike the original water used in the process several liquid composition samples have pH 7.5 spectra.
- the results of the first test indicate that the liquid composition has a pH of 7.5, which is more than the pH value of pure water.
- BTB Bromo Thymol Blue
- BTB are shown in Figure 7. These are peaks result in a yellow color for the more acidic case and green-blue when more basic. When added to liquid composition, a correlation between the color and the quality of the liquid composition was found. The green color (basic) of the liquid composition indicates higher quality.
- the ⁇ potential of the liquid composition of the present invention is significantly higher, indicating a high mobility of the nanostructures in the liquid.
- Phage typing concentration each bacteriophage was tested at 1 and 100 RTD (Routine Test Dilution).
- Figures 9a-b illustrate the bacteriophage reaction in the tested media, as follows: Figure 9a shows Bacteriophages No. 6 in a control medium (right hand side) and in the liquid composition of the present invention (left hand side); Figure 9b shows Bacteriophages No. 83 A in a control medium (right hand side) and in the liquid composition of the present invention.
- the bacteriophage reaction in the liquid composition of the present invention demonstrated an accelerated lysis of bacteria (within 1 hour in the liquid composition and 3 hours in the control media).
- Figure 10 is a histogram showing a comparison between the bacteriolysis surface areas of the control and liquid composition. Statistic significance was determined using 2 ways ANOVA for phage typing. The corresponding numbers are given in Tables 2 and 3, below.
- Figure 11 shows increased dilution by 10 times in each increment. Increased concentration of phages in the liquid composition of the present invention was observed in well 3 in which dilution was 100 times more than well 1.
- Figure 12 is a graph of the optical density (OD) in phage No. 6, as a function of time.
- the corresponding numbers for mean change from start and the OD of phage reaction are given in Tables 3 and 4, respectively.
- the ANOVA for repeated measures is presented in Table 5.
- the liquid composition of the present invention accelerates the phage reaction time (x3); and increases the bacteriolysis surface area; increases the RTD (xlOO or more)
- the bacteriophage reactions in the liquid composition of the present invention demonstrate opposite trends compare to control in OD measurements, and increased potency with time. Discussion
- the kinetics of phage-host interaction has been enhanced in media containing the liquid composition. This was observed in repeated experiments and in measured "growth curve kinetics.”
- the parameters influencing the kinetics are independent of measured factors (e.g., pH, temperature, etc.) Not only does phage concentration increase but also its potency, as was observed after 22 hours of reaction. Phages in control media are non effective at a time when phages in the liquid composition of the present invention are still effective.
- the propagating strains pre-treated with the liquid composition are much more effective.
- ⁇ phage is used in molecular biology for representing the genome DNA of organisms.
- the following experiment relies on standard ⁇ phage interaction applications.
- the materials in the test groups were prepared with the liquid composition as a solvent.
- the materials in control groups were prepared as described hereinbelow.
- the pH of the control groups was adjusted to the pH of the liquid composition solutions, which was between 7.2 and 7.4.
- E. coli XLl Blue MRA (Stratagene).
- XLl cells were dispersed on the LB plate with a bacteriological loop according to a common procedure of bacterial inoculation. The plates were incubated at 37 °C for 16 hours. 12) Bacterial cultivation in LB liquid medium 30 A single colony of XLl cells was picked from an LB plate and inoculated in LB liquid medium with subsequent incubation at 37 0 C for
- XLl cells were inoculated into the LB medium supplemented with 10 mM Of MgSO 4 and 0.2% of maltose. Incubation at 37 °C with shaking at 200 rpm continued, until turbidity of 0.6 at a wavelength of 600 run was achieved (4-5 hours). The grown culture was centrifuged at 4000 rpm for 5 minutes. Supernatant was discarded, and the bacteria were re-suspended into the 10 mM of MgSO 4 , until turbidity of 0.6 at wavelength of 600 nm was achieved. A required volume of SM buffer containing the phages was added to 200 ml of the re-suspended bacteria. After incubation at 37 °C for 15 minutes two alternative procedures were carried out:
- Bacterial lysates were centrifuged at 6000 rpm for 5-10 minutes for sedimentation of the bacterial debris. Supernatant was collected and centrifuged at 14000 rpm for 30 minutes for sedimentation of the phage particles. Supernatant was discarded and the phage pellet was re- suspended in SM buffer without gelatin. A mixture of nucleases
- Phage suspensions were prepared from phage stock in SM buffer in series of 1/10 dilutions: one in SM buffer based on liquid composition of the present invention and one in SM buffer based on ddH 2 O. 1 ⁇ l of each dilution was incubated with 200 ⁇ l of competent bacterial host (see methods, item 13). The suspension was incubated at 37 °C for 15 minutes to allow the bacteriophage to inject its DNA into the host bacteria. After incubation a hot (45- 50 °C) top agarose was added and dispersed on the LB plate. Nine replications of each dilution and treatment were prepared. Table 6 below presents the PFU levels which were counted after overnight incubation.
- Lysates were prepared as described in methods (item 13), centrifuged at 6000 rpm for 5-10 minutes to sediment bacterial debris and turbidity was measured at 600 nm. DNA was then extracted from lysates as described hereinabove in the methods (item 14). No significant differences were observed between control and the liquid composition treatments both in turbidity and extracted DNA concentration (0.726 ⁇ g/ ⁇ l in control; 0.718 ⁇ g/ ⁇ l in the liquid composition). Discussion
- the host compatibility depends on the ability of the phage to adopt bacterial mechanisms for phage reproduction. No correlation between the liquid composition of the present invention to the host compatibility was found. Increased compatibility can be established by the observation of either larger plaques than those of control (a greater distance from the initial infection site), or a greater number of phage particles than that of the control.
- liquid composition of the present invention did not affect DNA phage level supports the previous finding.
- the infectivity depends on essential phage particles and/or on the bacterial cell's capability to be infected by the phage.
- the significant increase in PFU when the liquid composition of the present invention was used (about 2-fold greater than the control) indicates that the liquid composition of the present invention affects the infectivity.
- Pre-infection treatments are required for increasing probability of infection by preparing competent bacteria, which are easier infected by phage than non-treated bacteria.
- Slime polysaccharide is crucial to biof ⁇ lm generation and maintenance, and plays a major part as a virulence factor in bacteria [Gotz F., "Staphylococcus and biofilms,” MoI Microbiol 2002, 43(6): 1367-78].
- the slime facilitates adherence of bacteria to a surface and their accumulation to form multi- layered clusters.
- Slime also protects against the host's immune defense and antibiotic treatment [Kolari M. et ah, "Colored moderately thermophilic bacteria in paper- machine biofilms," to apear in J Ind Microbiol Biotechnol 2003].
- Biofilm produced by bacteria can cause problems also in industry.
- the bacterial resistance of Staphylococcus epidermidis, a serious pathogen of implant-related infections, to antibiotics is related to the production of a glycocalyx slime that impairs antibiotic access and the killing by host defense mechanisms [Konig DP et al, "In vitro adherence and accumulation of Staphylococcus epidermidis RP 62 A and Staphylococcus epidermidis M7 on four different bone cements,” Langenbecks Arch Surg 2001, 386(5):328-32].
- In vitro studies of different bone cements containing antibiotics developed for the prevention of biomaterial-associated infection, could not always demonstrate complete eradication of biomaterial-adherent bacteria. Further efforts are done to find better protection from slime adherence.
- surface interaction can modify slime adherence. For example,
- the bacteria used were identified using Bio Merieux sa Marcy 1' Eoile, France (API) with 98.4 % confidence for Staphylococcus epidprmidis 6706112. Table 8, below summarizes the three bacterial strains which were used.
- OD of the stained adherent bacterial films was measured with a MicroElisa Auto reader (MR5000; Dynatech Laboratories, Alexandria VA.) by using wavelength of 550nm.
- OD of bacterial culture was measured before each staining using dual filter of 450nm and 630nm.
- the test of each bacterial strain was performed in quadruplicates. The experiment was designed to evaluate slime adherence at intervals.
- the time table for the kinetics assessment was 18, 20, 22, 24 and 43 hours. All three (3) strains were evaluated on the same plate.
- the liquid composition was used for standard media preparation and underwent standard autoclave sterilization.
- Adherence values were compared using ANOVA with repeated measurements for the same plate examination; grouping factors were plate and strain.
- a three-way ANOVA was used for the different plate examination using SPSSTM 11.0 for Microsoft WindowsTM.
- Figure 14 is a histogram representing 15 repeat experiments of slime adherence on different micro titer plates. As shown, the adherence in the presence of the liquid composition is higher than the adherence in the control.
- the extent of adherence is dependent on the strain, on the plate, and, on the water used.
- Table 10 summarizes the results of slime adherence on separate micro titer plates (Three-way ANOVA).
- Figure 15 shows slime adherence differences in the liquid composition of the present invention and the control on the same micro titer plate.
- Tables 11-12 summarizes the results of slime adherence on the same micro titer plat (ANOVA with repeated measurements).
- a significance difference in adherence between the strains and the plate points out the possibility of plate to plate variations.
- Plate to plate variations with the liquid composition indicate that there may be other factors on the plate surface or during plate preparation which could interact with the liquid composition.
- the ability of the liquid composition of the present invention to change bacterial adherence through its altered surface adhesion was studied.
- the media with the liquid composition contained identical buffers and underwent identical autoclave sterilization, as compared to control medium ruling out any organic or PH modification.
- Hydrophocity modification in the liquid composition can lead to an environmental preference for the slime to be less or more adherent.
- the change in surface characteristics may be explained by a new order, which is introduced by the nanostructures, leading to a change in water hydrophobic ability.
- the liquid composition of the present invention has been subjected to a series of electrochemical deposition tests, in a quasi-two-dimensional cell.
- Two concentric electrodes 26 were positioned in cell 20 and connected to a voltage source 28 of 12.4 + 0.1 V.
- the external electrode was shaped as a ring, 90 mm in diameter, and made of a 0.5 mm copper wire.
- the internal electrode was shaped as a disc having a thickness of 0.1 mm and diameter of 28 mm.
- the external electrode was connected to the positive pole of the voltage source and the internal electrode was connected to the negative pole thereof.
- the experimental setup was used to perform an electrochemical deposition process directly on the liquid composition of the present invention and, for comparison, on a control solution composed of Reverse Osmosis (RO) water.
- RO Reverse Osmosis
- the experimental setup was used to examine the capability of the liquid composition to leave an electrochemical deposition signature, as follows.
- the liquid composition was placed in cell 20. After being in contact with base 22 for a period of 30 minutes, the liquid composition was replaced with RO water and an electrochemical deposition process was performed on the RO water.
- Figures 17a-b show electrochemical deposition of the liquid composition of the present invention (Figure 17a) and the control ( Figure 17b).
- Figures 17a-b show electrochemical deposition of the liquid composition of the present invention ( Figure 17a) and the control ( Figure 17b).
- a transition between dense branching morphology and dendritic growth were observed in the liquid composition.
- the dense branching morphology spanned over a distance of several millimeters from the face of the negative electrode.
- the dense branching morphology was observed only in close proximity to the negative electrode and no morphology transition was observed.
- Figure 18 shows electrochemical deposition of RO water in a cell, which was in contact with the liquid composition of the present invention for a period of 30 minutes. Comparing Figures 18 and 17b, one can see that the liquid composition leaves a clear signature on the surface of the cell, hence allowing the formation of the branching and dendritic morphologies thereon. Such formation is absent in Figure 17b where the RO water was placed in a clean cell.
- the capability of the liquid composition to preserve an electrochemical deposition signature on the cell can be explained as a long range order which is induced on the RO water by the cell surface after incubation with the liquid composition.
- Colony growth of Bacillus subtilis was investigated in the presence of the liquid composition of the present invention.
- the control group included the same bacteria in the presence of RO water.
- Figures 19a-b show results of Bacillus subtilis colony growth after 24 hours, for the liquid composition ( Figure 19a) and the control ( Figure 19b). As shown, the liquid composition of the present invention significantly accelerates the colony growth.
- Figures 20a-c show the results of Bacillus subtilis colony growth, for the SP water (Figure 20a), RO water ( Figure 20b) and the liquid composition ( Figure 20c).
- the colony growth in the presence of the SP water is even slower than the colony growth in the RO water, indicating that the raw material per se has a negative effect on the bacteria.
- the liquid composition of the present invention significantly accelerates the colony growth, although, in principle, the liquid composition is composed of the same material.
- Solid phase matrices such as Microtitration plates, membranes, beads, chips and the like.
- Solid phase matrices may have different physical and chemical properties, including, for example, hydrophobic properties, hydrophilic properties, electrical (e.g., charged, polar) properties and affinity properties.
- microtitration plates all produced by NUNCTM were used: (i) MaxiSorpTM, which contains mixed hydrophilic/hydrophobic regions and is characterized by high binding capacity of and affinity for IgG and other molecules (binding capacity of IgG equals 650 ng/cm 2 ); (ii) PolySorpTM, which has a hydrophobic surface and is characterized by high binding capacity of and affinity for lipids; (iii) MedimSorpTM, which has a surface chemistry between PolySorpTM and MaxiSorpTM, and is characterized by high binding capacity of and affinity for proteins; (iv) Non-SorpTM, which is a non-treated microtitration plate characterized by low binding capacity of and affinity for biomolecules; and (v) MultiSorTM, which has a hydrophilic surface and is characterized by high binding capacity of and affinity for Glycans.
- MaxiSorpTM which contains mixed hydrophilic/hydrophobic regions and is characterized by high binding capacity of and affinity
- microtitration plates of CORNINGTM (Costar) were used: (i) a medium binding microtitration plate, which has a hydrophilic surface and a binding capacity to IgG of 250 ng/cm 2 ; (ii) a carbon binding microtitration plate, which covalently couples to carbohydrates; (iii) a high binding microtitration plate, which has a high adsorption capacity; and (iv) a high binding black microtitration plate, also having high adsorption capacity.
- the binding efficiency of bio-molecules to the above microtitration plates was tested in four categories: ionic strengths, buffer pH, temperature and time.
- the binding experiments were conducted by coating the microtitration plate with fluorescent-labeled bio-molecules or with a mixture of labeled and non-labeled bio-molecules of the same type, removal of the non-bound molecules by washing and measuring the fluorescent signal remaining on the plate.
- the following protocol was employed:
- Typical washing solution includes 1 x PBS, pH 7.4; 0.05 % Tween20TM; and 0.06 M NaCl.
- IgG is a polyclonal antibody composed of a mixture of mainly hydrophilic molecules.
- the molecules have a carbohydrate hydrophilic region, at the universal region and are slightly hydrophobic at the variable region. Such types of molecules are known to bind to MaxiSorpTM plates with very high efficiency (650 ng/cm 2 ).
- PNA agglutinin
- Figures 21a-22d show the results of the Ab*/Ab assays ( Figures 21a-d) and the Ab* assays ( Figure 22a-d) to the medium CostarTM (a), Non-SorpTM (b), MaxisorpTM (c) and Polyso ⁇ TM (d) plates.
- the results obtained using the liquid composition of the present invention are marked with filled symbols (triangles, squares, etc.) and the control results are marked with empty symbols.
- the lines correspond to linear regression fits.
- the binding efficiency can be estimated by the slope of the lines, whereby a larger slope corresponds to a better binding efficiency.
- the slopes obtained using the liquid composition of the present invention are steeper than the slopes obtained in the control experiments.
- the liquid composition of the present invention is capable of enhancing the binding efficiency.
- the enhancement binding capability of the liquid composition of the present invention is designated Sr and defined as the ratio of the two slopes in each Figure, such that Sr > 1 corresponds to binding enhancement and Sr ⁇ 1 corresponds to binding suppression.
- the values of the Sr parameter calculated for the slopes obtained in Figures 21a-d were, 1.32, 2.35, 1.62 and 2.96, respectively, and the values of the Sr parameter calculated for the slopes obtained in Figures 22a-d were, 1.42, 1.29, 1.10 and 1.71 , respectively.
- Figures 23a-24d show the results of the Ab* assays for the overnight incubation at 4 °C ( Figures 23a-d) and the 2 hours incubation at 37 °C ( Figure 24a-d) in NonSorpTM (a), medium CostarTM (b), PolySorpTM (c) and MaxiSorpTM (d) plates. Similar to Figures 21a-22d, the results obtained using the liquid composition of the present invention and the control are marked with filled and empty symbols, respectively. As shown in Figures 23a-24d, except for two occurrences (overnight incubation in the NonSorpTM plate, and 2 hours in the PolySorpTM plate), the slopes obtained using the liquid composition of the present invention are steeper than the slopes obtained in the control experiments.
- the calculated values of the Sr parameter obtained for Figures 23a-d were, 0.94, 1.10, 1.20 and 1.27, respectively, while the calculated values of the Sr parameter obtained for Figures 24a-d were, 1.16, 1.35, 0.94 and 1.11 , respectively.
- Figures 25a-26d show the results of the Ab*/Ab assays for the overnight incubation at 4 °C ( Figures 25a-d) and the overnight incubation at room temperature ( Figure 26a-d) in the medium CostarTM (a), PolySorpTM (b), MaxiSorpTM (c) and Non- SorpTM (d) plates. As shown in Figures 25a-26d, except for one occurrence
- the slopes obtained using the liquid composition of the present invention are steeper than the slopes obtained in the control.
- the calculated values of the Sr parameter obtained for Figures 25a-d were, 1.15, 1.25, 1.07 and 2.10, respectively
- the calculated values of the Sr parameter obtained for Figures 26a-d were, 1.30, 1.48, 1.38 and 0.84, respectively.
- Figures 27a-d Different washing protocols are compared in Figures 27a-d using the medium. CostarTM plate.
- Figures 27a-b show the results of the Ab*/Ab (Figure 27a) and Ab* (Figure 27b) assays when phosphate buffer was used as the washing buffer
- Figures 27c-d show the results of Ab*/Ab (Figure 27c) and Ab* (Figure 27d) assays using PBS.
- the calculated values of the Sr parameter for the Ab*/Ab and Ab* assays ( Figures 27a-d) were, respectively, 1.03, 0.97, 1.04 and 0.76.
- Figures 28a-b show the results of a single experiment in which the medium CostarTM plate was used for an overnight incubation at 4 °C (see the first experiment in Table 13). As shown in this experiment, the calculated values of the Sr parameter were 0.37 for the Ab*/Ab assay ( Figure 28a) and 0.67 for the Ab* assay ( Figure 28b).
- liquid composition of the present invention enhances IgG binding, with a more pronounced effect on the MaxiSorpTM and PolySorpTM plates.
- Figures 29a-c show the results of the PNA absorption assay to the Non-SorpTM plate for the acetate ( Figure 29a), carbonate ( Figure 29b) and phosphate (Figure 29c) buffers.
- Figures 29a-c the results obtained using the liquid composition of the present invention are marked with open symbols and results of the control are marked with filled symbols.
- the calculated values of the Sr parameter for the acetate, carbonate and phosphate buffers were 0.65, 0.75 and 0.78, respectively,.
- the liquid composition of the present invention significantly inhibits the binding of PNA.
- Figures 30a-d show the results of PNA absorption assay in which MaxiSorpTM plates in carbonate ( Figures 30a-b), acetate ( Figure 30c) and phosphate (Figure 30d) coating buffers were used. Similar symbols as in Figures 29a-c were used for presentation.
- Figure 30a with the carbonate buffer, a two-phase curve was obtained, with a linear part in low protein concentration in which no effect was observed and a nonlinear part in high protein concentration (above about 0.72) in which the liquid composition of the present invention significantly inhibits the binding of PNA.
- Figure 30b presents the linear part of the graph, and a calculated value of Sr parameter of 1.01 for the carbonate buffer.
- the calculated values of the Sr parameter for the acetate and phosphate buffers were 0.91 and 0.83, respectively, indicating a similar trend in which the liquid composition of the present invention inhibits the binding of PNA.
- the oligonucleotide was bound only to the MaxiSorpTM plates in acetate coating buffer.
- Table 19 summarizes the obtained values of the Sr parameter, for nine different concentrations of the oligonucleotide and four different experimental conditions, averaged over the assays in which MaxiSorpTM plates in acetate coating buffer were used.
- Figures 31a-b show the average values of the Sr parameter quoted in Table 19, where Figure 31a shows the average values for each experimental conditions and Figure 31b shows the overall average, with equal weights for all the experimental conditions.
- the liquid composition of the present invention is capable of enhancing binding efficiency with and without the addition of salt to the coating buffer. It is a common knowledge that acetate buffer is used to precipitate DNA in aqua's solutions. Under such conditions the DNA molecules interact to form "clumps" which precipitate at the bottom of the plate, creating regions of high concentration, thereby increasing the probability to bind and generating higher signal per binding event. Intra-molecular interactions compete with the mechanism of clump formations.
- the liquid composition of the present invention is capable of suppressing the enhancement of clump formations for higher concentration.
- Nucleic acids are the basic and most important material used by researchers in the life sciences. Gene function, biomolecule production and drug development (pharmacogenomics) are all fields that routinely apply nucleic acids techniques. Typically, PCR techniques are required for the expansion of a particular sequence of DNA or RNA. Extracted DNA or RNA is initially purified. Following amplification of a particular region under investigation, the sequence is purified from oligonucleotide primers, primer dimers, deoxinucleotide bases (A, T, C, G) and salt and subsequently verified.
- Promega WizardTM kit involves the following steps:
- step 5 Performing gel electrophoresis as further detailed hereinbelow. Reconstitution of the kit was performed with the original water supplied with the kit (hereinafter control) or by replacing aqua solutions of the kit with either RO water or the liquid composition of the present invention for steps 1, 2 and 4. In step 3 the identical 80 % isopropanol solution as found in the kit was used in all experiments.
- the following protocol was used for gel electrophoresis: (a) Gel solution: 8 % PAGE (+ Urea) was prepared with either RO water or the liquid composition of the present invention according to Table 20, below;
- control is abbreviated to "CO”
- Reverse Osmosis water is abbreviated to "RO”
- the liquid composition of the present invention is abbreviated to "LC.”
- Figure 32 is an image of 50 ⁇ l PCR product samples in an experiment, referred to herein as Experiment 3.
- lane 1 correspond to the PCR product before purification
- lane 7 is a ladder marker
- lanes 2-6, 8-11 correspond to the following combinations of the aforementioned steps 1, 2 and 4: CO/CO/CO elution 1 (lane 2), RO/RO/RO elution 1 (lane 3), LC/LC/LC elution 1 (lane 4), CO/CO/CO elution 2 (lane 5), RO/RO/RO elution 2 (lane 6), LC/LC/LC elution 2 (lane 8), CO/CO/CO elution 3 (lane 9), RO/RO/RO elution 3 (lane 10), and LC/LC/LC elution 3 (lane 11).
- AU three assays systems exhibit similar purification features. Efficient removal of the low M.W molecules (smaller than 100 bp) is demonstrated.
- the unwanted molecules include primers and their dimers as well as nucleotide bases.
- Figures 33a-b are images of 50 ⁇ l PCR product samples in an experiment, referred to herein as Experiment 4, for elution 1 ( Figure 33a) and elution 2 ( Figures 33a-b).
- Figures 34a-b are images of 50 ⁇ l PCR product samples in an experiment
- lane 4 is a ladder marker
- lanes 1-3, 5-13 correspond to the following combinations: CO/CO/CO (lane 1), RO/RO/RO (lane 2), LC/LC/LC (lane 3), CO/LC/LC (lane 5), CO/RO/RO (lane 6), CO/CO/LC (lane 7), CO/CO/RO (lane 8), CO/LC/CO (lane 9), CO/RO/CO (lane 10), LC/LC/CO (lane 11), RO/RO/CO (lane 1), RO/RO/RO (lane 2), LC/LC/LC (lane 3), CO/LC/LC (lane 5), CO/RO/RO (lane 6), CO/CO/LC (lane 7), CO/CO/RO (lane 8), CO/LC/CO (lane 9), CO/RO/CO (lane 10), LC/LC/CO (lane 11), RO/RO/CO (lane
- Lane 14 in Figure 34a corresponds to the combination RO/CO/CO.
- Figures 35a-b are images of 50 ⁇ l PCR product samples in an experiment, referred to herein as Experiment 6, for elution 1 (Figure 35a) and elution 2 (Figure 35b).
- Lanes 35a-b lanes 1-13 correspond to the same combinations as in Figure
- lane 15 corresponds to the PCR product before purification.
- step A was directed at examining the effect of volume applied to the columns on binding and elution
- step B was directed at investigating the effect of the liquid composition of the present invention on the column capacity.
- Step A four columns (columns 1-4) were applied with 50, 150, 300 or 600 ⁇ l stock PCR product solution, and 13 columns (5-17) were applied with 300 ⁇ l of stock PCR solution. All columns were eluted with 50 ⁇ l of water.
- the eluted solutions 0 were loaded in lanes 7-10 in the following order: lane 7 (original PCR, concentration factor x 1), lane 8 (original x 3), lane 9 (x 6) and lane 10 (x 12).
- a "mix” of all elutions from columns 5-17 (x 6) was loaded in lane 11.
- Lanes 1-5 were loaded with elutions from columns 1-4 and the "mix” of columns 5-17, pre-diluted to the original concentration (x 1). Lane 6 was the ladder marker.
- Step B the "mixed" elution of Step A was used as "concentrated PCR solution” and applied to 12 columns.
- Columns 1-5 were applied with 8.3 ⁇ l, 25 ⁇ l, 50 ⁇ l, 75 ⁇ l and 100 ⁇ l respectively using the kit reagents. The columns were eluted by 50 ⁇ l kit water and 5 ⁇ l of each elution was applied to the corresponding lane on the gel.
- Columns 7-11 were treated as column 1-5 but with the liquid composition of the present invention as binding and elution buffers. The samples were applied to the corresponding gel lanes.
- Column 13 served as a control with the "mix" of columns 5- 17 of Step A. ,
- Step 14 Repeat steps 11-13 for a second elution cycle. Visualization steps were the same as in Step A.
- Figures 36-37 show image ( Figure 36) and quantitative analysis using SionlmageTM software (Figure 37) of lanes 1-11 of Step A. As shown in Figure 36, lanes 8-11 are overloaded. Lanes 3 and 4 contain less DNA because columns 3 and 4 were overloaded and as a result less DNA was recovered after dilution of the eluted samples. As shown in Figure 37, DNA losing is higher when the DNA loading volume is bigger.
- Figures 38a-c show images of lanes 1-12 of Step B, for elution 1 ( Figure 38a), elution 2 ( Figure 38b) and elution 3 ( Figure 38c). The first elution figure shows that the columns were similarly overloaded,. The differences in binding capacity are clearly seen in the second elution. The band intensity increases correspondingly with the number of the lane.
- Figures 39a-b show quantitative analysis using SionlmageTM software, where Figure 39a represents the area of the control (designated CO in Figures 39a-b) and the liquid composition of the present invention (designated LC in Figures 39a-b) as a function of the loading volume for each of the three elutions, and Figure 39b shows the ratio LC/CO. As shown in Figures 39a-b in elution 3, the area is larger for the liquid composition of the present invention.
- Gel Electrophoresis is a routinely used method for determination and isolation of DNA molecules based on size and shape.
- DNA samples are applied to an upper part of the gel, serving as a running buffer surrounding the DNA molecules.
- the gel is positively charged and forces the negatively charged DNA fragments to move downstream the gel when electric current is applied.
- the migration rate is faster for smaller and coiled or folded molecules and slower for large and unfolded molecules.
- DNA can be tagged by fluorescent label and is visualized under UV illumination.
- the DNA can be also transferred to a membrane and visualized by enzymatic coloration at high sensitivity. DNA is evaluated according to its position on the gel and the band intensity.
- PCR product Two types were used: (i) PCR product, 280 base pair; and (ii) ladder DNA composed of eleven DNA fragments of the following sizes: 80, 100, 200, 300, 400, 500, 600, 700, 800, 900 and 1030 bp.
- ladder DNA composed of eleven DNA fragments of the following sizes: 80, 100, 200, 300, 400, 500, 600, 700, 800, 900 and 1030 bp.
- the gel was prepared according to the protocols of Example 12.
- Figures 40a-42b are DNA images comparing the migration speed in the presence of RO water ( Figures 40a, 41a and 42a) and in the presence of the liquid composition of the present invention ( Figures 40b, 41b and 42b) for Experiments 1, 2 and 3, respectively.
- both the running buffers and the gel buffers were composed of the same type of liquid, i.e., in Figures 40a, 41a and 42a both the running buffer and the gel buffer were composed of RO water, while in Figures 40b, 41b and 42b both the running buffer and the gel buffer were composed of the liquid composition of the present invention.
- Figures 43a-45d are images of Experiments 1 ( Figures 43a-d), 2 ( Figures 44a-d) and 3 ( Figures 45a-d), in which the effect of the liquid composition of the present invention on the running buffer are investigated.
- the gels are composed of the same liquid and the running buffer is different.
- Figures 43a-45d are images of RO/RO and RO/LC, respectively; Figures 43c-d are images of LC/LC and LC/RO respectively, Figures 44a-b are images of RO/RO and RO/LC, respectively; Figures 44c-d are images of LC/RO and LC/LC respectively, Figures 45a-b are images of RO/LC and RO/RO, respectively; and Figures 45c-d are images of LC/LC and LC/RO respectively.
- Figures 46a-48d are images of Experiments 1 ( Figures 46a-d), 2 ( Figures
- Figures 46a-b are images of RO/RO and LC/RO, respectively;
- Figures 46c-d are images of LC/LC and RO/LC respectively,
- Figures 47a-b are images of RO/RO and LC/RO, respectively;
- Figures 47c-d are images of RO/LC and LC/LC respectively,
- Figures 48a-b are images of RO/RO and LC/RO, respectively;
- Figures 48c-d are images of RO/LC and LC/LC respectively.
- the liquid composition of the present invention causes the retardation of DNA migration as compared to RO water. Note that no significant change in the electric field was observed. This effect is more pronounced when the gel buffer is composed of the liquid composition of the present invention and the running buffer is composed of RO water.
- the above experiments demonstrate that under the influence of the liquid composition of the present invention, the DNA configuration is changed, in a manner that the folding of the DNA is decreased (un-folding).
- the un-folding of DNA in the liquid composition of the present invention may indicate that stronger hydrogen boned interactions exists between the DNA molecule and the liquid composition of the present invention in comparison to RO water.
- Alkaline Phosphatase (Jackson INC) was serially diluted in either RO water or the liquid composition of the present invention. Diluted samples 1:1,000 and 1:10,000 were incubated in tubes at room temperature. At different time intervals, enzyme activity was determined by mixing 10 ⁇ l of enzyme with 90 ⁇ l pNPP solution (AP specific colorimetric substrate). The assay was performed in microtitration plates (at least 4 repeats for each test point). Color intensity was determined by an ELISA reader at wavelength of 405 nm.
- a stability enhancement parameter, S e was defined as the stability in the presence of the liquid composition of the present invention divided by the stability in RO water.
- Figure 49 shows the values of S e , for 22 hours (full triangles) and 48 hours (full squares), as a function of the dilution.
- the values of S e for LC7, LC8 and LC3 are shown in Figure 49 in blue, red, and green, respectively).
- the measured stabilizing effect is in the range of about 2 to 3.6 for enzyme dilution of 1:10,000, and in the range of about 1.5 to 3 for dilution of 1:1,000. The same phenomena were observed at low temperatures, although to a somewhat lesser extent.
- Bound Form of Alkaline Phosphatase Binding an enzyme to another molecule typically increases its stability.
- Enzymes are typically stored at high concentrations, and only diluted prior to use to the desired dilution. The following experiments are directed at investigating the stabilization effect of the liquid composition of the present invention in which the enzymes are stored at high concentrations for prolonged periods of time. Materials and Methods:
- Figure 50 is a chart showing the activity of the conjugated enzyme after 5 days of storage in a dilution of 1:10 (blue) and in a dilution of 1:10,000 (red), for the RO water and the liquid composition of the present invention.
- the enzyme activity is about 0.150 OD for both dilutions.
- the activity is about 3.5 times higher in the 1:10 dilution than in the 1:10,000 dilution.
- the enzyme is substantially more active in the liquid composition of the present invention than in RO water.
- the enzyme activity was determined at time intervals 0, 24 hours, 48 hours, 72 hours and 120 hours, by mixing 10 ⁇ l of enzyme with 100 ⁇ l of ONPG solution ( ⁇ -Gal specific colorimetric substrate) for 15 minutes at 37 °C and adding 50 ⁇ l stop solution (IM Na 2 HCO 3 ).
- ONPG solution ⁇ -Gal specific colorimetric substrate
- IM Na 2 HCO 3 50 ⁇ l stop solution
- the enzyme stability and the stability enhancement parameter, S e were calculated as further detailed hereinabove.
- the liquids RO, LC7, LC8, LC3 and LC4 are shown in Figures 51a-d in blue, red, green and purple, respectively, and average values of the stability are shown as circles.
- the activity in the presence of LC7, LC8 and LC3 is consistently above the activity in the presence of RO water.
- the measured stabilizing effect is in the range of about 1.3 to 2.21 for enzyme dilution of 1:1000, and in the range of about 0.83 to 1.3 for dilution of 1:330.
- the stabilizing effect liquid composition of the present invention on ⁇ - Galactosidase is similar to the stabilizing effect found for AP.
- the extent of stabilization is somewhat lower. This can be explained by the relatively low specific activity (464 u/mg) having high protein concentration in the assay, which has attenuated activity lost over time.
- Alkaline Phosphatase (Jackson INC) was diluted 1:5000 in RO water and in the aforementioned liquid compositions LC7, LC8 and LC3 of the present invention, as further detailed hereinabove.
- Figure 53 a shows the activity of the enzymes after drying (two repeats) and after 30 minutes of heat treatment at 60 °C (6 repeats). Average values are shown in Figure 53a by a "+" symbol. Both treatments substantially damaged the enzyme and their effect was additive.
- Figure 53b shows the stability enhancement parameter, S e .
- the liquid composition of the present invention has evidently stabilized the activity of the enzyme. For example, for LC7 the average value of the stability enhancement parameter was increased from 1.16 to 1.22.
- DNA manipulations comprise a sequence of reactions, one following the other, including PCR, ligation, restriction and transformation. Each reaction is preferably performed under its own suitable reaction conditions requiring its own specific buffer. Typically, in between each reaction, the DNA or RNA sample must be precipitated and then reconstituted in its new appropriate buffer. Repeated precipitations and reconstitutions takes time and more importantly leads to loss of starting material, which can be of utmost relevance when this material is rare. As an example, the inventors chose to investigate what effect the liquid composition of the present invention has on DNA in the presence of glass beads during a PCR reaction. Materials and Methods:
- PCR was prepared from a pBS plasmid cloned with a 750 base pair gene using a T7 forward primer (TAATACGACTCACTATAGGG) SEQ ID NO:5 and an M13 reverse primer (GGAAACAGCTATGACCATGA) SEQ ID NO:6 such that the fragment size obtained is 750 bp.
- the primers were constituted in PCR-grade water at a concentration of 200 ⁇ M (200pmol/ ⁇ l). These were subsequently diluted 1:20 in Neowater Tm , to a working concentration of lO ⁇ M each to make a combined mix.
- each primer from 200 ⁇ M stock
- 18 ⁇ l of Neowater Tm mixed and spun down
- the concentrated DNA was diluted 1:500 with Neowater Tm to a working concentration of 2pg/ ⁇ l.
- the PCR was performed in a Biometra T- Gradient PCR machine.
- the enzyme used was SAWADY Taq DNA Polymerase (PeqLab 01-1020) in buffer Y.
- a PCR mix was prepared as follows:
- the samples were mixed but not vortexed. They were placed in a PCR machine at 94°C for exactly 1 min and then removed. 4.5 ⁇ l of the PCR mix was then aliquoted into clean tubes to which 0.5 ⁇ l of primer mix and 5 ⁇ l of diluted DNA were added in that order. After mixing, but not vortexing or centrifugation, the samples were placed in the PCR machine and the following PCR program used:
- the PCR products loaded onto the gel were as follows:
- Lane 1 DNA diluted in Neowater Tm , Primers (mix) diluted in H 2 O 3 vol (to lO ⁇ l) with Neowater Tm (with glass beads). Lane 2: DNA diluted in Neowater Tm , Primers (mix) diluted in Neowater Tm , vol
- Lane 3 AU in H 2 O (positive control) (with glass beads). Lane 4: Negative control. No DNA, Primers inNeowater Tm (to lO ⁇ l) with H 2 O
- Lane 5 DNA diluted in Neowater Tm , Primers (mix) diluted in H 2 O, vol (to lO ⁇ l) with Neowater Tm (without glass beads). Lane 6: DNA diluted in Neowater Tm , Primers (mix) diluted in Neowater Tm , vol
- Neowater Tm without glass beads
- Lane 7 All in H 2 O (positive control) (without glass beads). Lane 8: Negative control. No DNA, Primers in Neowater Tm (to lO ⁇ l) with H 2 O (without glass beads). Results and conclusion
- Fig. 54 is a DNA image. As can be seen, when PCR is performed in the presence of glass beads, neowater is required for the reaction to take place. When neowater is not included in the reaction, no PCR product is observed (see lane 3).
- liquid composition of the present invention is required during a PCR reaction in the presence of glass beads.
- Real-time PCR monitors the fluorescence emitted during a PCR reaction as an indicator of amplicon production during each PCR cycle (i.e. in real time) as opposed to the endpoint detection of conventional PCR which relies on visualization of ethidium bromide in agarose gels. Due to its high sensitivity, real-time PCR is particularly relevant for detecting and quantifying very small amounts of DNA or cDNA. Improving sensitivity and reproducibility and decreasing the reaction volumes required for real-time PCR would aid in conserving precious samples.
- the cDNA sample was diluted in water or NeowaterTM in serial dilutions starting from 1:5 and ending with 1:2560 (10 dilutions in total).
- the 1:5 dilution was prepared using 3 ⁇ l of the original cDNA +12 ⁇ l H O or NeowaterTM.
- the dilutions which followed were prepared by taking 7.5 ⁇ l of sample and 7.5 ⁇ l of H O or
- the standard and dissociation curves with an automatic baseline determination are illustrated in Figures 55a-b for NeowaterTM and 56a-b for water.
- the dissociation curve slope value was -2.969 and regression value was 0.987 for NeowaterTM.
- the dissociation curve slope value was -4.048 and regression value was 0.875 for water.
- the standard curves with a baseline cut-off of 0.2 are illustrated in Figure 57a for NeowaterTM and 57b for water.
- the dissociation curve slope value was -2.965 and regression value was 0.986 for NeowaterTM.
- the dissociation curve slope value was - 4.094 and regression value was 0.885 for water.
- the standard curves following identical outlier value removal from each set and a manual background cut-off of 0.2 are illustrated in Figure 58a for NeowaterTM and 58b for water.
- the dissociation curve slope value was -3.338 and regression value was 0.994 for NeowaterTM.
- the dissociation curve slope value was -2.918 and regression value was 0.853 for water.
- the standard curves following separate outlier value removal from each set and a manual background cut-off of 0.2 are illustrated in Figures 59a for NeowaterTM and 59b for water.
- the dissociation curve slope value was -3.338 and regression value was 0.994 for NeowaterTM.
- the dissociation curve slope value was -3.399 and regression value was 0.999 for water.
- NeowaterTM Standard curve begins at a higher Ct value of 26.24 than the water standard curve (begins at a Ct value of -23.02).
- This phenomenon of high BG probably reflects one aspect of an elevated sensitivity in the presence of NeowaterTM.
- the other aspect of this elevated sensitivity is the linearity of the NeowaterTM Standard curve at high cDNA dilutions reflecting the ability to reliably detect rare target amplicons.
- NeowaterTM The higher regression value for NeowaterTM indicates that the presence of Neowater provides a more accurate assessment of quantity for a wider dynamic range of concentrations.
- Figures 57a and 57b illustrate the standard curves plotted at an equal BG cutoff of 0.2.
- the NeowaterTM standard curve has a lower R2 value but an equal Ct value at the high cDNA concentration as in the water standard curve (Ct-24.24 at 1:1 cDNA dilution). Dynamic range and efficiency of amplification are still higher in the presence of NeowaterTM.
- the outlier values corresponding to the cDNA concentrations 1:5, 1:640, 1:1280, 1:2560 were removed and standard curves were redrawn as illustrated in Figures 58a and 58b.
- the standard curves were redrawn as illustrated in Figures 59a and 59b demonstrating the higher dynamic range (more points), higher accuracy (less outlier values) and higher sensitivity reached in the presence of NeowaterTM.
- the optimal standard curve (slop value of -3.3) of the Neo waterTM set includes more measurement points than the standard curve of the water set, two of which represent higher template dilutions.
- reaction volumes tested were: 5ul, lOul and 15ul. Each of the three volume sets included a strip of 8 reactions: triplicates of reactions with and without NeowaterTM and one negative control (minus template). In addition to decreased reaction volumes the ratio between the SYBR green solution and the solvent (either water or NeowaterTM) was changed (as detailed in Table 33 below). The change of in ratio prevented comparison of results with those from the sensitivity test.
- Amplification curves of the three reaction triplicates (i.e. 5 ⁇ l, 10 ⁇ l and 15 ⁇ l) were plotted for NeowaterTM as illustrated in Figures 61a-c and for water as illustrated in Figures 62a-c.
- the liquid composition of the present invention has been subjected to a series of ultrasonic tests in an ultrasonic resonator.
- Cell 1 of the ResoScan® research system was used as reference and was filled with dest. Water (Roth Art. 34781 lot#48362077).
- Cell 2 was filled with the liquid composition of the present invention.
- Absolute Ultrasonic velocities were measured at 20 °C. In order to allow comparison of the experimental values, the ultrasonic velocities were corrected to 20.000 °C.
- Figure 63 shows the absolute ultrasonic velocity U as a function of observation time, as measured at 20.051 °C for the liquid composition of the present invention (U 2 ) and the dist. water (Ui)- Both samples displayed stable isothermal velocities in the time window of observation (35 min).
- Table 35 summarizes the measured ultrasonic velocities CZ 1 , U% and their correction to 20 °C. The correction was calculated using a temperature-velocity correlation of 3 m/s per degree centigrade for the dist. Water.
- RNA sample to the array was performed according to the Manufacturers protocol. Essentially the membrane was pre-wet in deionized water for five minutes following which it was incubated in pre-warmed GEAhyb Hybridization Solution (GEArray) for two hours at 60 °C. Labelled RNA was added to the hybridization solution and left to hybridize with the membrane overnight at 60 °C. Following rinsing, the membrane was exposed to an X ray film for autoradiography for a two second or ten second exposure time. Results
- RNA hybridization is increased in the presence of the liquid composition of the present invention to a DNA chip, as is evidenced by the signal strength following identical exposure periods.
- Phenol red solution (20mg/25ml) was prepared. 290 ⁇ l was added to 13 ml RO water or various batches of water comprising nanostructures (NeowaterTM - Do- Coop technologies, Israel). It was noted that each water had a different starting pH, but all of them were acidic, due to their yellow or light orange color after phenol red solution was added. 2.5 ml of each water + phenol red solution were added to a cuvette. Increasing volumes of Sodium hydroxide were added to each cuvette, and absorption spectrum was read in a spectrophotometer. Acidic solutions give a peak at 430 run, and alkaline solutions give a peak at 557 nm. Range of wavelength is 200- 800 nm, but the graph refers to a wavelength of 557 nm alone, in relation to addition of 0.02M Sodium hydroxide.
- Table 36 summarizes the absorbance at 557 nm of each water solution following sodium hydroxide titration.
- RO water shows a greater change in pH when adding Sodium hydroxide. It has a slight buffering effect, but when absorbance reaches 0.09 A, the buffering effect "breaks", and pH change is greater following addition of more Sodium hydroxide.
- HA- 99 water is similar to RO. NW (#150905-106) (NeowaterTM), AB water Alexander (AB 1-22-1 HA Alexander) has some buffering effect. HAP and HA- 18 shows even greater buffering effect than NeowaterTM.
- all new water types comprising nanostructures tested shows similar characters to NeowaterTM, except HA-99-X.
- the results for the Sodium hydroxide titration are illustrated in Figures 66A-C and 67A-C.
- the results for the Hydrochloric acid titration are illustrated in Figures 68A-C and Figure 69.
- the water comprising nanostructures has buffering capacities since it requires greater amounts of Sodium hydroxide in order to reach the same pH level that is needed for RO water. This characterization is more significant in the pH range of — 7.6- 10.5. hi addition, the water comprising nanostructures requires greater amounts of Hydrochloric acid in order to reach the same pH level that is needed for RO water. This effect is higher in the acidic pH range, than the alkali range.
- Phenol red solution (20mg/25ml) was prepared. 1 ml was added to 45 ml RO water or water comprising nanostructures (NeowaterTM - Do-Coop technologies,
- NeowaterTM (# 150604-109): 45 ml pH 8.8
- NeowaterTM (# 120104-107): 45 ml pH 8.68
- Bottle 1 no treatment (RO water)
- Bottle 2 RO water radiated for 30 minutes with 3OW. The bottle was left to stand on a bench for 10 minutes, before starting the titration (RP water).
- Bottle 3 RF water subjected to a second radiation when pH reached 5. After the radiation, the bottle was left to stand on a bench for 10 minutes, before continuing the titration.
- RF water and RF2 water comprise buffering properties similar to those of the carrier composition comprising nanostructures.
- compositions were as follows: A. lOmg powder (red/white) + 990 ⁇ l Neo waterTM. B. lOmg powder (red/white) + 990 ⁇ l NeowaterTM (dehydrated for 90 min).
- the red powder did dissolve however; it did sediment after a while.
- test tube C dissolved the powder better because the color changed to slightly yellow.
- NeowaterTM was added to lmg of the red powder (vial no.l) by titration of lO ⁇ l every few minutes.
- Figures 14A-J illustrate that following extensive crushing, it is possible to dissolve the red material, as the material remains stable for 24 hours and does not sink.
- Figures 14A-E show the material changing color as time proceeds (not stable).
- Neowater 3mg/ml Neowater.
- the material dissolves in DMSO 5 acetone, acetonitrile.
- Vial #5 CD-Dau was suspended first inside the acetone and after it dissolved completely NeowaterTM was added in order to exchange the acetone. At first acetone dissolved the material in spite of NeowaterTM' s presence. However, as the acetone evaporated the material partially sediment to the bottom of the vial. (The material however remained suspended.
- Spectrophotometer measurements illustrate the behavior of the material both in the presence and absence of acetone. With acetone there are two peaks in comparison to the material that is suspended with water or with 10 % PEG, which in both cases display only one peak.
- NeowaterTM was added to the vial that contained acetone. lOO ⁇ l acetone + lOO ⁇ l NeowaterTM were added to the remaining material.
- Daunorubicine + ImI RO was prepared in a second vial. RESULTS
- Daunorubicine dissolves without difficulty in NeowaterTM and RO.
- the optimal method to dissolve the materials was first to dissolve the material with a solvent (Acetone, Acetic-Acid or Ethanol) followed by the addition of the hydrophilic fluid (NeowaterTM) and subsequent removal of the solvent by heating the solution and evaporating the solvent.
- a solvent Acetone, Acetic-Acid or Ethanol
- hydrophilic fluid NaeowaterTM
- the tubes were vortexed and heated to 50 °C so as to evaporate the ethanol.
- NeowaterTM in the presence and absence of ethanol are illustrated in Figures 8 IA-D. CONCLUSION
- NeowaterTM A further 62.5 ⁇ l of NeowaterTM were added. The tubes were vortexed and heated to 50 °C so as to evaporate the ethanol.
- Retinol (vitamin A) was purchased from Sigma (Fluka, 99 % HPLC). Retinol was solubilized in NeowaterTM under the following conditions.
- ⁇ bsorbance spectrum of retinol in EtOH Retinol solutions were made in absolute EtOH, with different retinol concentrations, in order to create a calibration graph; absorbance spectrum was detected in a spectrophotometer.
- Neo waterTM was added to 1 mg of material "X”.
- DMSO was added to lmg of material "X”. Both test tubes were vortexed and heated to 60 0 C and shaken for 1 hour on a shaker.
- NeowaterTM did not dissolve material "X” and the material sedimented, whereas DMSO almost completely dissolved material "X”.
- NeowaterTM 10 % NeowaterTM+sucrose
- NeowaterTM was achieved by dehydration of NeowaterTM for 90 min at 60 °C.
- test tubes comprising the 6 solvents and substance X at time 0 are illustrated in Figures 88A-C.
- the test tubes comprising the 6 solvents and substance X at 60 minutes following solubilization are illustrated in Figures 89A-C.
- the test tubes comprising the 6 solvents and substance X at 120 minutes following solubilization are illustrated in Figures 90A-C.
- the test tubes comprising the 6 solvents and substance X 24 hours following solubilization are illustrated in Figures 91A-C.
- test tube 6 contains dehydrated Neowater 1 which is more hydrophobic than non-dehydrated NeowaterTM.
- DMSO may be decreased by 20-80 % and a solution based on NeowaterTM may be achieved that hydrates material "X" and disperses it in the NeowaterTM.
- SPL 2101 was dissolved in its optimal solvent (ethanol) — Figure94A and SPL 5217 was dissolved in its optimal solvent (acetone) — Figure 94B. The two compounds were put in glass vials and kept in dark and cool environment.
- NeowaterTM was added to the solution until there was no trace of the solvents.
- Cell viability assay 150,000 293T cells were seeded in a 6 well plate with 3 ml of DMEM medium. Each treatment was grown in DMEM medium based on RO or NeowaterTM. Taxol (dissolved in NeowaterTM or DMSO) was added to final concentration of 1.666 ⁇ M (lO ⁇ l of 0.5mM Taxol in 3ml medium). The cells were harvested following a 24 hour treatment with taxol and counted using trypan blue solution to detect dead cells. RESULTS
- the viability of the 293T cells following various solutions of taxol is illustrated in Figure 97.
- Taxol comprised a cytotoxic effect following solution in NeowaterTM.
- Taq polymerase (Peq-lab, Taq DNA polymerase, 5 U/ ⁇ l) Three samples were set up and placed in a PCR machine at a constant temperature of 95 °C. Incubation time was: 60, 75 and 90 minutes.
- genomic DNA 35 ⁇ g/ ⁇ l
- Positive control was without boiling the enzyme.
- Negative control was without boiling the enzyme and without DNA in the reaction.
- a PCR mix was made for the boiled taq assays as well for the control reactions.
- the liquid composition comprising nanostructures protected both the enzymes from heat stress for up to 1.5 hours.
- Standard PCR mixture was prepared (KCl buffer, dNTPs, Taq, BPB) which also included the following ingredients:
- MVP was performed at a final volume of 2ul.
- the target DNA was a plasmid; comprising the PDX gene.
- a mix was prepared and 2ul of complete mix (containing both DNA, primer and NeowaterTM) was aliquoted into tubes and PCR was performed.
- QPCR was performed with Syber Green against several DNA targets (plasmid and genomic) and gene targets (Beta Actin, PDX, PCT etc.).
- RESULTS As can be seen in Figures 102 A-C, QPCR of Beta Actin with NeowaterTM is proficient and utilizes amplification in an exponential manner (efficiency 103%, exponential slope) with no primer-dimer formations.
- QPCR of PDX plasmid with NeowaterTM is proficient and utilizes amplification in an exponential manner (efficiency 101%, exponential slope) with no primer-dimer formations.
- HA powders Five different Hydroxyapatite (HA) powders, labeled 1-5, were used to generate the Neowater as follows.
- RO water maintained below the anomaly point i.e. below 4 0 C
- RF signal at 915 MHz at a power of 15 watt.
- sub-micron size powder of Hydroxyapetite heated to about 900 °C was dropped from the furnace into the water.
- the RF irradiation continued for an additional 5 minutes, and the water was then placed at room temperature for two days. Most of the source powder (that contains larger particles/agglomerates) sunk to the bottom and the clear part of the water was separated.
- the source powders were characterized by high resolution scanning electron microscope (HRSEM, Ziess, Leo 982) operated at 4 KV.
- HRSEM high resolution scanning electron microscope
- the samples were prepared by spreading the powders on a carbon adhesive tape.
- Neowaters were also characterized. First, the Neowater QC test was performed and all 5 solutions were found to be positive. Second, the HA-based
- NeowaterTM and the source powders were characterized both by HRSEM (Leo 982) and transmission electron microscope (TEM, Tecnai T20, FEI) operated at 200 KV and equipped with a Gatan CCD.
- Samples for HRSEM were prepared by putting 3 drops of the HA-based Neowater on a Si wafer (in order to have a good contrast), and for TEM by putting one drop on a Copper 400 mesh Carbon film TEM grid. All samples were dried in a vacuum desiccator in order to prevent any possible degradation of the substrates.
- AU 5 slurries were found to contain separate rounded particles with a diameter range of 10-100 nm.
- Figures 104- 127 A-F the electron microscopy revealed that the HA-based NeowaterTM was very similar to those of BaTiO 3 -based NeowaterTM.
- Figure 104 presents a digital micrograph of the QC test which examines the quality of the NeowaterTM with numbers ranging 1-10. In this case it was positive 10, which means high quality NeowaterTM.
- Figures 105 A-H present HRSEM micrographs taken from the source powder. It can be seen that the source powder
- FIG. 5 contains large agglomerates of spheres, while each sphere is built from smaller particles with diameter in the order of ⁇ 50 nm.
- Figures 106 A-H present HRSEM micrographs taken from the HA-based NeowaterTM. It can be seen that what is left following the NeowaterTM manufacturing process contains mostly fine separate particles with a diameter of 10-100 nm.
- Figure 107 present TEM micrographs of the 0 HA-based NeowaterTM. Using the higher resolution of the TEM the particles shape and size can be seen more easily.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Oncology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Nanotechnology (AREA)
- Communicable Diseases (AREA)
- Medical Informatics (AREA)
- Crystallography & Structural Chemistry (AREA)
- Epidemiology (AREA)
- Medicinal Preparation (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Cosmetics (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US12/087,432 US20090253613A1 (en) | 2006-01-04 | 2007-01-04 | Solid-Fluid Composition |
| AU2007203961A AU2007203961A1 (en) | 2006-01-04 | 2007-01-04 | Solid-fluid composition |
| JP2008549109A JP2009524600A (ja) | 2006-01-04 | 2007-01-04 | 固液組成物 |
| EP07700709A EP1981989A2 (en) | 2006-01-04 | 2007-01-04 | Solid-fluid composition |
| CA002635978A CA2635978A1 (en) | 2006-01-04 | 2007-01-04 | Solid-fluid composition |
| IL192615A IL192615A0 (en) | 2006-01-04 | 2008-07-03 | Solid-fluid composition |
Applications Claiming Priority (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US75585006P | 2006-01-04 | 2006-01-04 | |
| US75585106P | 2006-01-04 | 2006-01-04 | |
| US75585206P | 2006-01-04 | 2006-01-04 | |
| US11/324,586 US20060177852A1 (en) | 2001-12-12 | 2006-01-04 | Solid-fluid composition |
| US11/324,586 | 2006-01-04 | ||
| US60/755,851 | 2006-01-04 | ||
| US60/755,852 | 2006-01-04 | ||
| US60/755,850 | 2006-01-04 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007077563A2 true WO2007077563A2 (en) | 2007-07-12 |
| WO2007077563A3 WO2007077563A3 (en) | 2009-02-12 |
Family
ID=39735923
Family Applications (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2007/000016 Ceased WO2007077563A2 (en) | 2006-01-04 | 2007-01-04 | Solid-fluid composition |
| PCT/IL2007/000013 Ceased WO2007077560A2 (en) | 2006-01-04 | 2007-01-04 | Cryoprotective compositions and methods of using same |
| PCT/IL2007/000014 Ceased WO2007077561A2 (en) | 2001-12-12 | 2007-01-04 | Compositions and methods for enhancing in-vivo uptake of pharmaceutical agents |
| PCT/IL2007/000015 Ceased WO2007077562A2 (en) | 2006-01-04 | 2007-01-04 | Antiseptic compositions and methods of using same |
Family Applications After (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2007/000013 Ceased WO2007077560A2 (en) | 2006-01-04 | 2007-01-04 | Cryoprotective compositions and methods of using same |
| PCT/IL2007/000014 Ceased WO2007077561A2 (en) | 2001-12-12 | 2007-01-04 | Compositions and methods for enhancing in-vivo uptake of pharmaceutical agents |
| PCT/IL2007/000015 Ceased WO2007077562A2 (en) | 2006-01-04 | 2007-01-04 | Antiseptic compositions and methods of using same |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20090029340A1 (https=) |
| EP (4) | EP1981987A2 (https=) |
| JP (4) | JP2009523128A (https=) |
| KR (4) | KR20080087148A (https=) |
| AU (4) | AU2007203958A1 (https=) |
| CA (4) | CA2635968A1 (https=) |
| WO (4) | WO2007077563A2 (https=) |
Families Citing this family (59)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060177852A1 (en) * | 2001-12-12 | 2006-08-10 | Do-Coop Technologies Ltd. | Solid-fluid composition |
| US20090004296A1 (en) * | 2006-01-04 | 2009-01-01 | Do-Coop Technologies Ltd. | Antiseptic Compositions and Methods of Using Same |
| US20090253613A1 (en) * | 2006-01-04 | 2009-10-08 | Do-Coop Technologies Ltd. | Solid-Fluid Composition |
| EP2122350A4 (en) * | 2007-01-04 | 2010-10-27 | Do Coop Technologies Ltd | PROOF OF ANALYTES |
| JP2010515432A (ja) * | 2007-01-04 | 2010-05-13 | ドゥ−コープ テクノロジーズ リミテッド | 細胞増殖および細胞融合を高めるための組成物および方法 |
| GB0705626D0 (en) * | 2007-03-23 | 2007-05-02 | Royal Veterinary College | Method for enhancing sperm survival |
| WO2009033690A1 (en) * | 2007-09-11 | 2009-03-19 | Mondobiotech Laboratories Ag | Bfgf (119-126) for therapeutic applications |
| KR20100061481A (ko) * | 2007-09-11 | 2010-06-07 | 몬도바이오테크 래보래토리즈 아게 | 치료제로서의 미니가스트린 |
| US20090081785A1 (en) | 2007-09-24 | 2009-03-26 | Hememics Biotechnologies, Inc. | Desiccated Biologics And Methods Of Preparing The Same |
| JP5043199B2 (ja) * | 2007-11-09 | 2012-10-10 | プラクスエア・テクノロジー・インコーポレイテッド | 生物材料を制御された速度で冷凍する方法及びシステム |
| EP2240176A2 (en) * | 2008-01-03 | 2010-10-20 | Do-Coop Technologies Ltd | Compositions and methods for enhancing the activity of podophyllotoxin |
| TWI573806B (zh) | 2008-04-17 | 2017-03-11 | 巴克斯歐塔公司 | 生物活性胜肽 |
| WO2010054083A2 (en) * | 2008-11-05 | 2010-05-14 | Pharmacaribe | Inhalation formulation for treating and prophylatic use in bacteria, mycobacterial and fungal respiratory infections |
| ES2846854T3 (es) | 2009-02-11 | 2021-07-29 | Univ Ramot | Composiciones antisépticas que comprenden iones de plata y mentol y usos de las mismas |
| US9700038B2 (en) | 2009-02-25 | 2017-07-11 | Genea Limited | Cryopreservation of biological cells and tissues |
| KR101092411B1 (ko) * | 2009-07-22 | 2011-12-09 | (주)시지바이오 | 이식용 동종 피부의 처리 방법 및 그로부터 제조된 동결보존동종피부 |
| EP2636676A3 (en) * | 2009-09-08 | 2014-01-01 | Heraeus Precious Metals GmbH & Co. KG | Crystallization of epidaunorubicin x HCl |
| JP5697099B2 (ja) * | 2009-10-23 | 2015-04-08 | 学校法人産業医科大学 | 掻痒抑制剤 |
| EP2547760A4 (en) * | 2010-02-17 | 2014-01-01 | Hememics Biotechnologies Inc | PRESERVATION SOLUTIONS FOR BIOLOGICS AND RELATED METHODS |
| US8529883B2 (en) * | 2010-05-07 | 2013-09-10 | Fibrocell Technologies, Inc. | Dosage unit formulations of autologous dermal fibroblasts |
| CN103179852B (zh) | 2010-05-28 | 2015-04-08 | 格尼亚有限公司 | 改良的显微操作和储存装置以及方法 |
| US20120128845A1 (en) * | 2010-11-22 | 2012-05-24 | Carol Ann Tosaya | Ice, toxicity, thermal-stress and cold-fracture management during cryopreserving encapsulation of specimens using controlled ice nucleation |
| CN102206285B (zh) * | 2011-04-19 | 2013-02-13 | 兰州大学 | 基于内吗啡肽2和神经肽ff的嵌合肽及其合成和应用 |
| US9486507B2 (en) | 2011-06-10 | 2016-11-08 | Biogen Ma Inc. | Pro-coagulant compounds and methods of use thereof |
| US11021733B2 (en) | 2011-09-26 | 2021-06-01 | Qiagen Gmbh | Stabilization and isolation of extracellular nucleic acids |
| ES2971646T3 (es) | 2011-09-26 | 2024-06-06 | Preanalytix Gmbh | Estabilización y aislamiento de ácidos nucleicos extracelulares |
| ES2574956T3 (es) | 2011-09-26 | 2016-06-23 | Preanalytix Gmbh | Estabilización y aislamiento de ácidos nucleicos extracelulares |
| US20140308364A1 (en) * | 2011-11-16 | 2014-10-16 | The University Of North Carolina At Chapel Hill | Gelatinous hydroxyapatite-nanocomposites |
| WO2013096659A1 (en) * | 2011-12-20 | 2013-06-27 | Cook General Biotechnology Llc | Methods and compositions for storage of animal cells |
| AU2013232381B2 (en) * | 2012-03-14 | 2018-08-30 | Membrane Protective Technologies, Inc. | System and substances for cryopreservation of viable cells |
| WO2013185113A1 (en) | 2012-06-08 | 2013-12-12 | Biogen Idec Ma Inc. | Procoagulant compounds |
| KR101410589B1 (ko) * | 2012-07-19 | 2014-06-20 | 주식회사 바이오에프디엔씨 | 뉴로펩타이드 유도체 및 이를 함유하는 피부 외용제 조성물 |
| CA2884915C (en) | 2012-09-25 | 2022-05-17 | Qiagen Gmbh | Stabilisation of biological samples |
| US20160015025A1 (en) * | 2013-03-15 | 2016-01-21 | Regents Of The University Of Minnesota | Cryopreservative compostions and methods |
| EP2976424B1 (en) * | 2013-03-18 | 2018-10-03 | Qiagen GmbH | Stabilisation of biological samples |
| WO2014146782A1 (en) | 2013-03-18 | 2014-09-25 | Qiagen Gmbh | Stabilization and isolation of extracellular nucleic acids |
| AU2015287760B2 (en) * | 2014-07-09 | 2019-06-20 | Genentech, Inc. | pH adjustment to improve thaw recovery of cell banks |
| BR112017006533A2 (pt) * | 2014-09-29 | 2017-12-19 | Cook General Biotechnology Llc | usos de trealose em suspensões celulares |
| CN104931611A (zh) * | 2015-06-03 | 2015-09-23 | 福建中烟工业有限责任公司 | 一种检测样品中肌醇的方法、试剂盒及其用途 |
| CN105230610B (zh) * | 2015-11-13 | 2017-10-27 | 中国科学院化学研究所 | 一种冷冻保存液及其制备方法和应用 |
| CN114457068B (zh) | 2015-11-20 | 2025-03-14 | 普瑞阿那利提克斯有限公司 | 用于稳定细胞外核酸的已灭菌组合物的制备方法 |
| US11122796B1 (en) | 2016-02-19 | 2021-09-21 | Regents Of The University Of Minnesota | Cryoprotection compositions and methods |
| US11311008B2 (en) | 2016-04-19 | 2022-04-26 | Regents Of The University Of Minnesota. | Cryopreservation compositions and methods involving nanowarming |
| GB201608356D0 (en) * | 2016-05-12 | 2016-06-29 | Univ Leeds And Asymptote Ltd | Formulation |
| WO2018017843A1 (en) * | 2016-07-22 | 2018-01-25 | Tissue Testing Technologies Llc | Enhancement of cell cryopreservation with glycolipids |
| DE112017007639T5 (de) * | 2017-06-13 | 2020-06-04 | Chung Chin SUN | Neues verfahren zum blutplasmaprotein-aktivitätserhalt |
| CN111182887A (zh) * | 2017-06-14 | 2020-05-19 | 株式会社生物解决方案有限公司 | 用于改善皮肤皱纹或抗炎活性的包括物质p的化妆品组合物 |
| JP7072147B2 (ja) * | 2018-09-13 | 2022-05-20 | 極東製薬工業株式会社 | 間葉系幹細胞の凍害保護液とその利用 |
| WO2020166711A1 (ja) * | 2019-02-15 | 2020-08-20 | イビデン株式会社 | 凍結保存液 |
| WO2020176498A1 (en) | 2019-02-28 | 2020-09-03 | Regents Of The University Of Minnesota | High throughput system for production and vitrification of biomaterials in cryoprotectant droplets |
| CA3145701A1 (en) * | 2019-07-31 | 2021-02-04 | University Of South Carolina | Alginate-based microcapsulation for the delivery of alpha-cgrp in cardiovascular diseases |
| CN110720452B (zh) * | 2019-11-05 | 2021-11-19 | 南通大学 | 一种优化病理大体标本保存的方法 |
| US12501897B2 (en) * | 2019-11-08 | 2025-12-23 | Triangle Biotechnology, Inc. | Methods of using nanoparticles and microparticles for the disruption and prevention of biofilms |
| CN110754464B (zh) * | 2019-11-13 | 2021-08-10 | 四川仟众生物科技有限公司 | 一种自体颅骨深低温保存方法 |
| KR102116954B1 (ko) * | 2019-12-26 | 2020-05-29 | 주식회사 엠케이바이오텍 | 태아 유래 줄기세포의 동결 보존 및 동결 건조용 배지 조성물 |
| AU2021267900A1 (en) | 2020-05-08 | 2023-01-19 | Gallant Pet Inc. | Uterine-derived regenerative cell compositions and uses thereof |
| JP2025537877A (ja) * | 2022-11-21 | 2025-11-20 | フラウンホッファー-ゲゼルシャフト ツァ フェルダールング デァ アンゲヴァンテン フォアシュンク エー.ファオ | 細胞および細胞凝集体の凍結保存のための凍結保護物質の同定 |
| CN117378598B (zh) * | 2023-12-08 | 2024-03-19 | 金宝医学科技(深圳)有限公司 | 一种卵母细胞冻存液及其制备方法 |
| CN118661721B (zh) * | 2024-08-26 | 2025-03-11 | 青岛宝迈得生物科技有限公司 | 一种低温冻存nk细胞的冻存液及其使用方法 |
Family Cites Families (61)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4690890A (en) * | 1984-04-04 | 1987-09-01 | Cetus Corporation | Process for simultaneously detecting multiple antigens using dual sandwich immunometric assay |
| US6223064B1 (en) * | 1992-08-19 | 2001-04-24 | Lawrence A. Lynn | Microprocessor system for the simplified diagnosis of sleep apnea |
| US6342039B1 (en) * | 1992-08-19 | 2002-01-29 | Lawrence A. Lynn | Microprocessor system for the simplified diagnosis of sleep apnea |
| US6818199B1 (en) * | 1994-07-29 | 2004-11-16 | James F. Hainfeld | Media and methods for enhanced medical imaging |
| US5472749A (en) * | 1994-10-27 | 1995-12-05 | Northwestern University | Graphite encapsulated nanophase particles produced by a tungsten arc method |
| US5585020A (en) * | 1994-11-03 | 1996-12-17 | Becker; Michael F. | Process for the production of nanoparticles |
| US7011812B1 (en) * | 1996-05-03 | 2006-03-14 | Immunomedics, Inc. | Targeted combination immunotherapy of cancer and infectious diseases |
| IL120881A (en) * | 1996-07-30 | 2002-09-12 | It M R Medic L Cm 1997 Ltd | Method and device for continuous and non-invasive monitoring of peripheral arterial tone |
| US6103868A (en) * | 1996-12-27 | 2000-08-15 | The Regents Of The University Of California | Organically-functionalized monodisperse nanocrystals of metals |
| US6884842B2 (en) * | 1997-10-14 | 2005-04-26 | Alnis Biosciences, Inc. | Molecular compounds having complementary surfaces to targets |
| US6198281B1 (en) * | 1997-11-12 | 2001-03-06 | The Research Foundation Of State University Of New York | NMR spectroscopy of large proteins |
| US6370423B1 (en) * | 1998-10-05 | 2002-04-09 | Juan R. Guerrero | Method for analysis of biological voltage signals |
| US6142950A (en) * | 1998-12-10 | 2000-11-07 | Individual Monitoring Systems, Inc. | Non-tethered apnea screening device |
| US20070021979A1 (en) * | 1999-04-16 | 2007-01-25 | Cosentino Daniel L | Multiuser wellness parameter monitoring system |
| US6608562B1 (en) * | 1999-08-31 | 2003-08-19 | Denso Corporation | Vital signal detecting apparatus |
| US6480733B1 (en) * | 1999-11-10 | 2002-11-12 | Pacesetter, Inc. | Method for monitoring heart failure |
| US7206636B1 (en) * | 1999-11-10 | 2007-04-17 | Pacesetter, Inc. | Pacing optimization based on changes in pulse amplitude and pulse amplitude variability |
| US6409675B1 (en) * | 1999-11-10 | 2002-06-25 | Pacesetter, Inc. | Extravascular hemodynamic monitor |
| US6527729B1 (en) * | 1999-11-10 | 2003-03-04 | Pacesetter, Inc. | Method for monitoring patient using acoustic sensor |
| US6752765B1 (en) * | 1999-12-01 | 2004-06-22 | Medtronic, Inc. | Method and apparatus for monitoring heart rate and abnormal respiration |
| US6519490B1 (en) * | 1999-12-20 | 2003-02-11 | Joseph Wiesel | Method of and apparatus for detecting arrhythmia and fibrillation |
| US7806831B2 (en) * | 2000-03-02 | 2010-10-05 | Itamar Medical Ltd. | Method and apparatus for the non-invasive detection of particular sleep-state conditions by monitoring the peripheral vascular system |
| AU2001251514A1 (en) * | 2000-04-10 | 2001-10-23 | The Research Foundation Of State University Of New York | Method for detecting cheyne-stokes respiration in patients with congestive heart failure |
| US6839581B1 (en) * | 2000-04-10 | 2005-01-04 | The Research Foundation Of State University Of New York | Method for detecting Cheyne-Stokes respiration in patients with congestive heart failure |
| US6589188B1 (en) * | 2000-05-05 | 2003-07-08 | Pacesetter, Inc. | Method for monitoring heart failure via respiratory patterns |
| SG98393A1 (en) * | 2000-05-19 | 2003-09-19 | Inst Materials Research & Eng | Injectable drug delivery systems with cyclodextrin-polymer based hydrogels |
| US6480734B1 (en) * | 2000-06-30 | 2002-11-12 | Cardiac Science Inc. | Cardiac arrhythmia detector using ECG waveform-factor and its irregularity |
| US6856829B2 (en) * | 2000-09-07 | 2005-02-15 | Denso Corporation | Method for detecting physiological condition of sleeping patient based on analysis of pulse waves |
| SE0004417D0 (sv) * | 2000-11-28 | 2000-11-28 | St Jude Medical | Implantable device |
| US6529752B2 (en) * | 2001-01-17 | 2003-03-04 | David T. Krausman | Sleep disorder breathing event counter |
| US6918946B2 (en) * | 2001-07-02 | 2005-07-19 | Board Of Regents, The University Of Texas System | Applications of light-emitting nanoparticles |
| US7186814B2 (en) * | 2001-11-09 | 2007-03-06 | Nanosphere, Inc. | Bioconjugate-nanoparticle probes |
| WO2005079153A2 (en) * | 2004-02-20 | 2005-09-01 | Do-Coop Technologies Ltd. | Solid-fluid composition and uses thereof |
| US20060177852A1 (en) * | 2001-12-12 | 2006-08-10 | Do-Coop Technologies Ltd. | Solid-fluid composition |
| US6829501B2 (en) * | 2001-12-20 | 2004-12-07 | Ge Medical Systems Information Technologies, Inc. | Patient monitor and method with non-invasive cardiac output monitoring |
| US7386340B2 (en) * | 2002-03-26 | 2008-06-10 | United States Of America As Represented By The Administrator Of The National Aeronautics And Space Administration | System for the diagnosis and monitoring of coronary artery disease, acute coronary syndromes, cardiomyopathy and other cardiac conditions |
| US6881192B1 (en) * | 2002-06-12 | 2005-04-19 | Pacesetter, Inc. | Measurement of sleep apnea duration and evaluation of response therapies using duration metrics |
| US6689342B1 (en) * | 2002-07-29 | 2004-02-10 | Warner-Lambert Company | Oral care compositions comprising tropolone compounds and essential oils and methods of using the same |
| US7024234B2 (en) * | 2002-09-20 | 2006-04-04 | Lyle Aaron Margulies | Method and apparatus for monitoring the autonomic nervous system |
| US7160252B2 (en) * | 2003-01-10 | 2007-01-09 | Medtronic, Inc. | Method and apparatus for detecting respiratory disturbances |
| AU2003901877A0 (en) * | 2003-04-16 | 2003-05-08 | Richard Charles Clark | Sleep management device |
| US7524292B2 (en) * | 2003-04-21 | 2009-04-28 | Medtronic, Inc. | Method and apparatus for detecting respiratory disturbances |
| US20050266090A1 (en) * | 2003-04-29 | 2005-12-01 | Ales Prokop | Nanoparticular targeting and therapy |
| IL155955A0 (en) * | 2003-05-15 | 2003-12-23 | Widemed Ltd | Adaptive prediction of changes of physiological/pathological states using processing of biomedical signal |
| US20050239108A1 (en) * | 2004-02-23 | 2005-10-27 | University Of Maryland, Baltimore | Immuno-PCR method for the detection of a biomolecule in a test sample |
| US20050191270A1 (en) * | 2004-02-27 | 2005-09-01 | Hydromer, Inc. | Anti-infectious hydrogel compositions |
| US7413549B1 (en) * | 2004-03-17 | 2008-08-19 | Pacesetter, Inc. | Detecting and quantifying apnea using ventilatory cycle histograms |
| JP3987053B2 (ja) * | 2004-03-30 | 2007-10-03 | 株式会社東芝 | 睡眠状態判定装置および睡眠状態判定方法 |
| DE102004016883A1 (de) * | 2004-04-06 | 2005-10-27 | Coripharm Medizinprodukte Gmbh & Co. Kg. | Verfahren zur Herstellung eines Knochen-Implantat-materials mit verbesserter mechanischer Beanspruchbarkeit auf der Basis von Formkörpern aus porösem Implantatmaterial sowie nach dem Verfahren hergestelltes Implantatmaterial |
| US7276088B2 (en) * | 2004-04-15 | 2007-10-02 | E.I. Du Pont De Nemours And Company | Hair coloring and cosmetic compositions comprising carbon nanotubes |
| US20070208269A1 (en) * | 2004-05-18 | 2007-09-06 | Mumford John R | Mask assembly, system and method for determining the occurrence of respiratory events using frontal electrode array |
| US7578793B2 (en) * | 2004-11-22 | 2009-08-25 | Widemed Ltd. | Sleep staging based on cardio-respiratory signals |
| US7680532B2 (en) * | 2005-02-25 | 2010-03-16 | Joseph Wiesel | Detecting atrial fibrillation, method of and apparatus for |
| US20070149870A1 (en) * | 2005-12-28 | 2007-06-28 | Futrex, Inc. | Systems and methods for determining an organism's pathology |
| US20090004296A1 (en) * | 2006-01-04 | 2009-01-01 | Do-Coop Technologies Ltd. | Antiseptic Compositions and Methods of Using Same |
| US7819816B2 (en) * | 2006-03-29 | 2010-10-26 | Cardiac Pacemakers, Inc. | Periodic disordered breathing detection |
| US20080003576A1 (en) * | 2006-06-30 | 2008-01-03 | Jingwu Zhang | Assay platforms and detection methodology using surface enhanced Raman scattering (SERS) upon specific biochemical interactions |
| US7972691B2 (en) * | 2006-12-22 | 2011-07-05 | Nanogram Corporation | Composites of polymers and metal/metalloid oxide nanoparticles and methods for forming these composites |
| EP2122350A4 (en) * | 2007-01-04 | 2010-10-27 | Do Coop Technologies Ltd | PROOF OF ANALYTES |
| JP2010515432A (ja) * | 2007-01-04 | 2010-05-13 | ドゥ−コープ テクノロジーズ リミテッド | 細胞増殖および細胞融合を高めるための組成物および方法 |
| US20080300500A1 (en) * | 2007-05-30 | 2008-12-04 | Widemed Ltd. | Apnea detection using a capnograph |
-
2007
- 2007-01-04 KR KR1020087018944A patent/KR20080087148A/ko not_active Withdrawn
- 2007-01-04 WO PCT/IL2007/000016 patent/WO2007077563A2/en not_active Ceased
- 2007-01-04 EP EP07700707A patent/EP1981987A2/en not_active Withdrawn
- 2007-01-04 EP EP07700708A patent/EP1981988A2/en not_active Withdrawn
- 2007-01-04 AU AU2007203958A patent/AU2007203958A1/en not_active Abandoned
- 2007-01-04 AU AU2007203960A patent/AU2007203960A1/en not_active Abandoned
- 2007-01-04 JP JP2008549108A patent/JP2009523128A/ja not_active Abandoned
- 2007-01-04 US US12/087,429 patent/US20090029340A1/en not_active Abandoned
- 2007-01-04 CA CA002635968A patent/CA2635968A1/en not_active Abandoned
- 2007-01-04 WO PCT/IL2007/000013 patent/WO2007077560A2/en not_active Ceased
- 2007-01-04 WO PCT/IL2007/000014 patent/WO2007077561A2/en not_active Ceased
- 2007-01-04 AU AU2007203959A patent/AU2007203959A1/en not_active Abandoned
- 2007-01-04 JP JP2008549107A patent/JP2009526754A/ja not_active Abandoned
- 2007-01-04 KR KR1020087018947A patent/KR20080098600A/ko not_active Withdrawn
- 2007-01-04 WO PCT/IL2007/000015 patent/WO2007077562A2/en not_active Ceased
- 2007-01-04 CA CA002635976A patent/CA2635976A1/en not_active Abandoned
- 2007-01-04 CA CA002635975A patent/CA2635975A1/en not_active Abandoned
- 2007-01-04 EP EP07700709A patent/EP1981989A2/en not_active Withdrawn
- 2007-01-04 JP JP2008549106A patent/JP2009521949A/ja not_active Abandoned
- 2007-01-04 EP EP07700706A patent/EP1981986A2/en not_active Withdrawn
- 2007-01-04 KR KR1020087018946A patent/KR20080090489A/ko not_active Withdrawn
- 2007-01-04 AU AU2007203961A patent/AU2007203961A1/en not_active Abandoned
- 2007-01-04 KR KR1020087018945A patent/KR20080098599A/ko not_active Withdrawn
- 2007-01-04 CA CA002635978A patent/CA2635978A1/en not_active Abandoned
- 2007-01-04 JP JP2008549109A patent/JP2009524600A/ja not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| AU2007203958A1 (en) | 2007-07-12 |
| AU2007203961A1 (en) | 2007-07-12 |
| JP2009524600A (ja) | 2009-07-02 |
| KR20080098599A (ko) | 2008-11-11 |
| CA2635968A1 (en) | 2007-07-12 |
| WO2007077561A2 (en) | 2007-07-12 |
| KR20080098600A (ko) | 2008-11-11 |
| WO2007077560A3 (en) | 2009-02-12 |
| WO2007077561A3 (en) | 2008-12-31 |
| WO2007077563A3 (en) | 2009-02-12 |
| US20090029340A1 (en) | 2009-01-29 |
| JP2009526754A (ja) | 2009-07-23 |
| WO2007077562A3 (en) | 2009-04-16 |
| WO2007077560A2 (en) | 2007-07-12 |
| JP2009523128A (ja) | 2009-06-18 |
| CA2635976A1 (en) | 2007-07-12 |
| AU2007203959A1 (en) | 2007-07-12 |
| EP1981988A2 (en) | 2008-10-22 |
| WO2007077562A2 (en) | 2007-07-12 |
| KR20080090489A (ko) | 2008-10-08 |
| EP1981986A2 (en) | 2008-10-22 |
| EP1981987A2 (en) | 2008-10-22 |
| JP2009521949A (ja) | 2009-06-11 |
| AU2007203960A1 (en) | 2007-07-12 |
| CA2635978A1 (en) | 2007-07-12 |
| KR20080087148A (ko) | 2008-09-30 |
| CA2635975A1 (en) | 2007-07-12 |
| EP1981989A2 (en) | 2008-10-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2007077563A2 (en) | Solid-fluid composition | |
| US20100267007A1 (en) | Solid-fluid composition and uses thereof | |
| Song et al. | Label-free and non-enzymatic detection of DNA based on hybridization chain reaction amplification and dsDNA-templated copper nanoparticles | |
| Giri et al. | Rapid screening of genetic biomarkers of infectious agents using quantum dot barcodes | |
| ES2294287T3 (es) | Empleo de un material de silice en una reaccion de amplificacion. | |
| US8911938B2 (en) | Reaction chamber having pre-stored reagents | |
| CN108064339A (zh) | 元荧光团的触发组装 | |
| Bai et al. | Nanoparticles affect PCR primarily via surface interactions with PCR components: using amino-modified silica-coated magnetic nanoparticles as a main model | |
| WO2012056192A1 (en) | Preparation and analysis of samples in micro-/nano-fluidic devices | |
| US20050059042A1 (en) | Colorimetric and fluorescent methods for sensing of oligonucleotides | |
| JP2010523114A (ja) | 組成物および検出方法 | |
| US20090253613A1 (en) | Solid-Fluid Composition | |
| Saleh et al. | Gold nanoparticles as a potential tool for diagnosis of fish diseases | |
| AU2010203023A1 (en) | Solid-Fluid Composition and Uses Thereof | |
| WO2023218068A1 (en) | Methods and kits for detection of targets using pcr and padlock probes | |
| JP7317959B2 (ja) | 液滴中で粒子を多重化するためのシステムおよび方法 | |
| Potrich et al. | One-shot genetic analysis in monolithic Silicon/Pyrex microdevices | |
| Xun et al. | Improved thermal cycling durability and PCR compatibility of polymer coated quantum dot | |
| He et al. | Label-free palindromic DNA nanospheres as naked-eye colorimetric assay platform for detection of telomerase activity | |
| Santaus et al. | Microwave-accelerated metal-enhanced fluorescence (MAMEF): a rapid,< 10 copy number detection platform | |
| Xu et al. | Portable SERS sensor for sensitive detection of food-borne pathogens | |
| US20240409985A1 (en) | Nucleic acid hybridization cascade enhanced by droplet evaporation | |
| JP5219435B2 (ja) | 核酸検出方法及び検査キット | |
| Chen et al. | Quantum dot probes for observation of single molecule DNA and a synthetic polyelectrolyte higher-order structure | |
| JP2007089446A (ja) | センス鎖とアンチセンス鎖を含むpcr増幅産物からいずれか一方の一本鎖核酸を単離する方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2635978 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12087432 Country of ref document: US Ref document number: 192615 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008549109 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007203961 Country of ref document: AU Ref document number: 1020087018947 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007700709 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 4071/CHENP/2008 Country of ref document: IN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2007203961 Country of ref document: AU |