WO2006103009A1 - Antibakterielle amid-makrozyklen vi - Google Patents
Antibakterielle amid-makrozyklen vi Download PDFInfo
- Publication number
- WO2006103009A1 WO2006103009A1 PCT/EP2006/002564 EP2006002564W WO2006103009A1 WO 2006103009 A1 WO2006103009 A1 WO 2006103009A1 EP 2006002564 W EP2006002564 W EP 2006002564W WO 2006103009 A1 WO2006103009 A1 WO 2006103009A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hydrogen
- formula
- hydroxy
- salts
- amino
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 CCC(C)(C)C(*)C(C)(C)C(C)(C)CC(C)(C)N* Chemical compound CCC(C)(C)C(*)C(C)(C)C(C)(C)CC(C)(C)N* 0.000 description 11
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
- C07K5/02—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing at least one abnormal peptide link
- C07K5/0202—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing at least one abnormal peptide link containing the structure -NH-X-X-C(=0)-, X being an optionally substituted carbon atom or a heteroatom, e.g. beta-amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D245/00—Heterocyclic compounds containing rings of more than seven members having two nitrogen atoms as the only ring hetero atoms
- C07D245/04—Heterocyclic compounds containing rings of more than seven members having two nitrogen atoms as the only ring hetero atoms condensed with carbocyclic rings or ring systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
- C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
- C07K5/08—Tripeptides
- C07K5/0802—Tripeptides with the first amino acid being neutral
- C07K5/0812—Tripeptides with the first amino acid being neutral and aromatic or cycloaliphatic
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
- C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
- C07K5/10—Tetrapeptides
- C07K5/1002—Tetrapeptides with the first amino acid being neutral
- C07K5/1016—Tetrapeptides with the first amino acid being neutral and aromatic or cycloaliphatic
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/02—Linear peptides containing at least one abnormal peptide link
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
Definitions
- the invention relates to antibacterial amide macrocycles and processes for their preparation, their use for the treatment and / or prophylaxis of diseases and their use for the preparation of medicaments for the treatment and / or prophylaxis of diseases, in particular of bacterial infections.
- WO 03/106480, WO 04/012816, WO 05/033129, WO 05/058943, WO 05/100380 and WO 05/118613 describe antibacterial macrocycles of the biphenomycin B type with amide or ester substituents.
- biphenomycin B is described as having antibacterial activity. Partial steps in the synthesis of biphenomycin B are described in Synlett (2003), 4, 522-526.
- the natural substances do not correspond in their properties to the requirements placed on antibacterial drugs. Although structurally different antibacterial agents are present on the market, development of resistance can regularly occur. New means for a good and more effective therapy are therefore desirable.
- An object of the present invention is therefore to provide new and alternative compounds having the same or improved antibacterial activity for the treatment of bacterial diseases in humans and animals.
- the invention relates to compounds of the formula
- R 1 is hydrogen or hydroxy
- R 6 is a group of the formula
- R 11 is hydrogen, amino or hydroxy
- R 12 is hydrogen or methyl
- k is a number 0 or 1
- 1 is a number 1, 2, 3 or 4,
- n and n are independently of one another a number 1, 2 or 3,
- R 7 is hydrogen, amino or hydroxy
- R 8 , R 9 and R 10 independently represent a group of the formula
- R 13 is hydrogen, amino or hydroxy
- R 14 is hydrogen or methyl
- R ls and R 16 independently of one another are hydrogen, aminoethyl or hydroxyethyl,
- o is a number 0 or 1
- p, q and w are independently of one another a number 1, 2, 3 or 4,
- R 4 is hydrogen, hydroxy, halogen, amino or methyl
- Compounds of the invention are the compounds of the formula (I) and their salts, solvates and solvates of the salts, as well as those of formula (T), hereinafter referred to as embodiment (e) compounds and their salts, solvates and solvates of the salts, as far as the compounds of formula (T) mentioned below are not already salts, solvates and solvates of the salts.
- the compounds according to the invention can exist in stereoisomeric forms (enantiomers, diastereomers).
- the invention therefore relates to the enantiomers or diastereomers and their respective mixtures. From such mixtures of enantiomers and / or diastereomers can be isolated by known methods such as chromatography on chiral phase or crystallization with chiral amines or chiral acids the stereoisomerically uniform components in a known manner.
- the invention also relates to tautomers of the compounds, depending on the structure of the compounds.
- Physiologically acceptable salts of the compounds (I) include acid addition salts of mineral acids, carboxylic acids and sulfonic acids, e.g. Salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, benzenesulfonic acid, naphthalenedisulfonic acid, acetic acid, propionic acid, lactic acid, tartaric acid, malic acid, citric acid, fumaric acid, maleic acid, trifluoroacetic acid and benzoic acid.
- Physiologically acceptable salts of the compounds (T) also include salts of conventional bases, such as, by way of example and by way of preference, alkali metal salts (eg sodium and potassium salts), alkaline earth salts (eg calcium and magnesium salts) and ammonium salts derived from ammonia or organic amines having 1 to 16 carbon atoms.
- alkali metal salts eg sodium and potassium salts
- alkaline earth salts eg calcium and magnesium salts
- ammonium salts derived from ammonia or organic amines having 1 to 16 carbon atoms such as, by way of example and by way of preference, alkali metal salts (eg sodium and potassium salts), alkaline earth salts (eg calcium and magnesium salts) and ammonium salts derived from ammonia or organic amines having 1 to 16 carbon atoms.
- Atoms such as, by way of example and by way of preference, ethylamine, diethylamine, triethylamine, ethyldiisopropylamine, monoethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, dimethylaminoethanol, procaine, dibenzylamine, N-methylmorpholine, dihydroabietylamine, arginine, lysine, ethylenediamine and methylpiperidine.
- Solvates in the context of the invention are those forms of the compounds which form a complex in the solid or liquid state by coordination with solvent molecules. Hydrates are a special form of solvates that coordinate with water.
- Halogen is fluorine, chlorine, bromine and iodine.
- a symbol # on a carbon atom means that the compound is in enantiomerically pure form with respect to the configuration at this carbon atom, which in the context of the present invention is understood to have an enantiomeric excess of more than 90% (> 90% ee).
- Ki the formulas of the groups which stand for R 3 , is the end point of the line, next to each a * is not a carbon atom or a CH 2 group but is part of the bond to the carbonyl group, to the R 3 is bound.
- the end point of the line next to each one * is not a carbon atom or a CH 2 group but is part of the bond to the nitrogen atom to which R 6 , R 8 , R 9 and R 10 are bonded.
- R 1 is hydrogen or hydroxy
- R 2 is hydrogen, methyl or ethyl
- R 3 is as defined above
- R 4 is hydrogen, hydroxy, halogen, amino or methyl
- R 2 is hydrogen
- R 4 is hydrogen, hydroxy, chlorine or methyl.
- R 4 is hydroxy
- R 5 is a group of the formula
- R 1 is hydrogen or hydroxy.
- R 5 is a group of the formula
- R 1 is hydrogen or hydroxy
- R 2 is hydrogen
- R 3 is a group of the formula
- R 6 is a group of the formula
- R 11 is hydrogen, amino or hydroxy
- R 12 is hydrogen or methyl, k is a number 0 or 1,
- 1 is a number 1, 2, 3 or 4,
- n and n are independently of one another a number 1, 2 or 3,
- R 4 is hydroxy
- R 5 is a group of the formula
- R 1 is hydrogen or hydroxy
- R 2 is hydrogen
- R 3 is a group of the formula
- R 7 is hydrogen, amino or hydroxy
- R 8 and R 10 independently represent a group of the formula
- R 13 is hydrogen, amino or hydroxy
- R 14 is hydrogen or methyl
- R 15 and R 16 are independently hydrogen, aminoethyl or
- o is a number 0 or 1
- p, q and w are independently of one another a number 1, 2, 3 or 4,
- R 4 is hydroxy
- R 5 is a group of the formula
- R 1 is hydrogen or hydroxy
- R 2 is hydrogen
- R 3 is a group of the formula
- R 9 is a group of the formula
- R 13 is hydrogen, amino or hydroxy
- R 14 is hydrogen or methyl
- R 15 and R 16 independently of one another are hydrogen, aminoethyl or hydroxyethyl
- o is a number 0 or 1
- p, q and w are independently of one another a number 1, 2, 3 or 4,
- R 4 is hydroxy
- the invention furthermore relates to a process for the preparation of the compounds of the formula (I) or their salts, their solvates or the solvates of their salts, according to processes
- R 2 , R 4 and R 5 have the abovementioned meaning and boc is ferf-butoxycarbonyl
- R 3 has the meaning given above
- R, R and R have the abovementioned meaning and Z is benzyloxycarbonyl
- R 3 has the meaning given above
- the free base of the salts can be obtained, for example, by chromatography on a reversed-phase column with an acetonitrile-water gradient with addition of a base, in particular by using a RPl 8 Phenomenex Luna Cl 8 (2) column and diethylamine as base.
- the invention further provides a process for the preparation of the compounds of the formula (I) or their solvates according to claim 1, in which salts of the compounds or solvates of the salts of the compounds are converted into the compounds by chromatography with addition of a base.
- the hydroxy group on R 1 is optionally protected during the reaction with compounds of the formula (DI) with a tert-butyldimethylsilyl group, which is cleaved off in the second reaction step.
- Reactive functionalities in the radical R 3 of compounds of the formula (IE) are already protected with introduced into the synthesis, preferred are acid labile protecting groups (eg boc).
- acid labile protecting groups eg boc
- the protective groups can be eliminated by deprotection reaction. This is done by standard methods Protecting group chemistry. Deprotection reactions under acidic conditions or by hydrogenolysis are preferred.
- the reaction of the first stage of the processes [A] and [B] is generally carried out in inert solvents, if appropriate in the presence of a base, preferably in a temperature range from 0 ° C. to 40 ° C. under atmospheric pressure.
- Suitable dehydrating here for example, carbodiimides such as N 1 N'-diethyl-, N, N'-dipropyl-, N, N'-diisopropyl-, N, N'-dicyclohexylcarbodiimide, N- (3-dimethylamino-isopropyl) are - N'-ethylcarbodiimide hydrochloride (EDC), N-cyclohexylcarbodiimide-N'-propyloxymethyl-polystyrene (PS-carbodiimide) or carbonyl compounds such as carbonyldiimidazole, or 1,2-oxazolium compounds such as 2-ethyl-5-phenyl-1,2 oxazolium-3-sulfate or 2-tert-butyl-5-methylisoxazolium perchlorate, or acylamino compounds such as 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquino
- Bases are, for example, alkali carbonates, e.g. Sodium or potassium carbonate, or bicarbonate, or organic bases such as trialkylamines e.g. Triethylamine, N-methylmorpholine, N-methylpiperidine, 4-dimethylaminopyridine or diisopropylethylamine.
- alkali carbonates e.g. Sodium or potassium carbonate, or bicarbonate
- organic bases such as trialkylamines e.g. Triethylamine, N-methylmorpholine, N-methylpiperidine, 4-dimethylaminopyridine or diisopropylethylamine.
- the condensation is preferably carried out with HATU in the presence of a base, in particular diisopropylethylamine, or with PyBOP in the presence of a base, in particular diisopropylethylamine.
- Inert solvents are, for example, halogenated hydrocarbons such as dichloromethane or trichloromethane, hydrocarbon such as benzene, or omitromethane, dioxane, dimethylformamide or acetonitrile. It is likewise possible to use mixtures of the solvents. Particularly preferred is dimethylformamide.
- the reaction with an acid in the second stage of the processes [A] and [B] is preferably carried out in a temperature range from 0 0 C to 40 0 C at atmospheric pressure.
- Suitable acids are hydrogen chloride in dioxane, hydrogen bromide in acetic acid or trifluoroacetic acid in methylene chloride.
- the hydrogenolysis in the second stage of the process [B] is generally carried out in a solvent in the presence of hydrogen and palladium on activated carbon, preferably in a temperature range from 0 ° C to 40 ° C at atmospheric pressure.
- Solvents are, for example, alcohols such as methanol, ethanol, n-propanol or isopropanol, in a mixture with water and glacial acetic acid, preferably a mixture of ethanol, water and glacial acetic acid.
- the compounds of formula (HI) are known or can be prepared analogously to known processes.
- the compounds of the formula ( ⁇ ) are known or can be prepared by reacting compounds of the formula
- R 2 , R 4 and R 5 have the abovementioned meaning
- the reaction is generally carried out in a solvent, preferably in a temperature range from 0 ° C to 40 ° C at atmospheric pressure.
- bases examples include alkali metal hydroxides, such as sodium or potassium hydroxide, or alkali metal carbonates, such as cesium carbonate, sodium or potassium carbonate, or other bases, such as DBU, triethylamine or diisopropylethylamine.
- Sodium hydroxide or sodium carbonate is preferred.
- Solvents are, for example, halogenated hydrocarbons such as methylene chloride or 1,2-dichloroethane, alcohols such as methanol, ethanol or isopropanol, or water.
- the reaction is carried out with sodium hydroxide in water or sodium carbonate in methanol.
- the compounds of the formula (V) are known or can be prepared by reacting compounds of the formula
- R 2 , R 4 and R 5 have the meaning given above, and
- R 17 is benzyl, methyl or ethyl
- the saponification can be carried out, for example, as described in the reaction of compounds of the formula (VI) to give compounds of the formula (IV).
- the compounds of the formula (IV) are known or can be prepared by saponifying in compounds of the formula (VI) the benzyl, methyl or ethyl ester.
- the reaction is generally carried out in a solvent, in the presence of a base, preferably in a temperature range from 0 ° C to 40 ° C at atmospheric pressure.
- Bases are, for example, alkali metal hydroxides such as lithium, sodium or potassium hydroxide, lithium hydroxide is preferred.
- Solvents are, for example, halogenated hydrocarbons, such as dichloromethane or trichloromethane, ethers, such as tetrahydrofuran or dioxane, or alcohols, such as methanol, ethanol or isopropanol, or dimethylformamide. It is likewise possible to use mixtures of the solvents or mixtures of the solvents with water. Particularly preferred are tetrahydrofuran or a mixture of methanol and water.
- the compounds of the formula (VI) are known or can be prepared by reacting compounds of the formula
- R 2 , R 4 , R 5 and R 17 have the abovementioned meaning
- the reaction with bases is generally carried out in a solvent, preferably in a temperature range from 0 ° C to 40 ° C at atmospheric pressure.
- Bases are, for example, alkali metal hydroxides such as sodium or potassium hydroxide, or alkali metal carbonates such as cesium carbonate, sodium or potassium carbonate, or other bases such as DBU, triethylamine or diisopropylethylamine, triethylamine being preferred.
- Solvents are, for example, halogenated hydrocarbons such as chloroform, methylene chloride or 1,2-dichloroethane, or tetrahydrofuran, or mixtures of the solvents, preferably methylene chloride or tetrahydrofuran.
- R, R, R and R are as defined above, with pentafluorophenol in the presence of dehydrating reagents as described for the first step of processes [A] and [B].
- the reaction is preferably carried out with DMAP and EDC in dichloromethane in a temperature range from -40 0 C to 40 0 C at atmospheric pressure.
- R 2 , R 4 , R 5 and R 17 have the abovementioned meaning
- fluoride in particular with tetrabutylammonium fluoride.
- the reaction is generally carried out in a solvent, preferably in a temperature range from -10 0 C to 30 0 C at atmospheric pressure.
- Inert solvents are, for example, halogenated hydrocarbons such as dichloromethane, or hydrocarbons such as benzene or toluene, or ethers such as tetrahydrofuran or dioxane, or dimethylformamide. It is likewise possible to use mixtures of the solvents. Preferred solvents are tetrahydrofuran and dimethylformamide.
- R 2 , R 4 and R 17 have the abovementioned meaning
- R 5 has the meaning given above
- the compounds of the invention show an unpredictable, valuable pharmacological and pharmacokinetic activity spectrum.
- the compounds according to the invention can be used alone or in combination with other active compounds for the treatment and / or prophylaxis of infectious diseases, in particular of bacterial infections.
- Gram-positive cocci eg staphylococci (Staph aureus, Staph epidermidis) and streptococci (Strept agalactiae, Strept faecalis, Strept pneumoniae, Strept pyogenes); Gram-negative cocci (Neisseria gonorrhoeae) as well as Gram-negative rods such as Enterobacteriaceae, eg Escherichia coli, Hemophilus influenzae, Citrobacter (Citrobanthusii, Citrob. divernis), Salmonella and Shigella; Klebsiella (Klebs. pneumoniae, Klebs. oxytocy), Enterobacter (Ent. aerogenes, Ent.
- staphylococci Staph aureus, Staph epidermidis
- streptococci Strept agalactiae, Strept faecalis, Strept pneumoniae, Strept pyogenes
- the antibacterial spectrum includes the genus Pseudomonas (Ps. Aeruginosa, Ps. Maltophilia) and strictly anaerobic bacteria such as Bacteroides fragilis, members of the genus Peptococcus, Peptostreptococcus and the genus Clostridium; also mycoplasmas (M. pneumoniae, M. hominis, M. urealyticum) as well as mycobacteria, eg Mycobacterium tuberculosis.
- pathogens are merely exemplary and by no means limiting.
- diseases which are caused by the mentioned pathogens or mixed infections and which can be prevented, ameliorated or cured by the topically applicable preparations according to the invention are:
- Infectious diseases in humans such as, for example, septic infections, bone and joint infections, skin infections, postoperative wound infections, abscesses, phlegmon, wound infections, infected burns, burns, infections in the mouth, infections after dental operations, septic arthritis, mastitis, tonsillitis, genital infections and ocular infections ,
- bacterial infections can also be treated in other species. Examples include:
- Pig coli-diarrhea, enterotoxemia, sepsis, dysentery, salmonellosis, metritis-mastitis-agactiae syndrome, mastitis;
- Ruminants (cattle, sheep, goats): diarrhea, sepsis, bronchopneumonia, salmonellosis, pasteurellosis, mycoplasmosis, genital infections;
- Horse bronchopneumonia, foal disease, puerperal and postpuerperal infections, salmonellosis;
- Dog and cat bronchopneumonia, diarrhea, dermatitis, otitis, urinary tract infections, prostatitis;
- Poultry (chicken, turkey, quail, pigeon, ornamental birds and others): mycoplasmosis, E. coli infections, chronic respiratory diseases, salmonellosis, pasteurellosis, psittacosis.
- bacterial diseases in the rearing and keeping of farmed and ornamental fish can be treated, the antibacterial spectrum on the aforementioned pathogens on other pathogens such as Pasteurella, Brucella, Campylobacter, Listeria, Erysipelothris, Corynebacteria, Borellia, Treponema, Nocardia , Rikettsie, Yersinia, expanded.
- Another object of the present invention is the use of the compounds of the invention for the treatment and / or prophylaxis of diseases, preferably of bacterial diseases, in particular of bacterial infections.
- Another object of the present invention is the use of the compounds of the invention for the treatment and / or prophylaxis of diseases, in particular the aforementioned diseases.
- Another object of the present invention is the use of the compounds of the invention for the manufacture of a medicament for the treatment and / or prophylaxis of diseases, in particular the aforementioned diseases.
- Another object of the present invention is a method for the treatment and / or prophylaxis of diseases, in particular the aforementioned diseases, using an antibacterially effective amount of the compounds of the invention.
- the compounds according to the invention can act systemically and / or locally.
- they may be applied in a suitable manner, e.g. oral, parenteral, pulmonary, nasal, sublingual, lingual, buccal, rectal, dermal, transdermal, conjunctival, otic or as an implant or stent.
- the compounds according to the invention can be administered in suitable administration forms.
- Tablets uncoated or coated tablets, for example, with enteric or delayed-dissolving or insoluble coatings containing the
- Soft gelatin capsules Soft gelatin capsules
- dragees granules, pellets, powders, emulsions, suspensions, aerosols or solutions.
- parenteral administration can be done bypassing a resorption step (eg, intravenous, intraarterial, intracardiac, intraspinal, or intralumbar) or with involvement of resorption (eg, intramuscular, subcutaneous, intracutaneous, percutaneous, or intraperitoneal).
- a resorption step eg, intravenous, intraarterial, intracardiac, intraspinal, or intralumbar
- suitable application forms include injection and infusion preparations in the form of solutions, suspensions, emulsions, lyophilisates or sterile powders.
- Inhalation medicines including powder inhalers, nebulizers
- nasal drops solutions, sprays
- lingual, sublingual or buccal tablets films / wafers or capsules
- suppositories ear or ophthalmic preparations
- vaginal capsules aqueous suspensions (lotions, shake mixtures)
- lipophilic suspensions ointments
- creams transdermal therapeutic systems (such as patches)
- milk Pastes, foams, scattering powders, implants or stents.
- the compounds according to the invention can be converted into the stated administration forms. This can be done in a conventional manner by mixing with inert, non-toxic, pharmaceutically suitable excipients.
- These adjuvants include, among others. Carriers (for example microcrystalline cellulose, lactose, mannitol), solvents (for example liquid polyethylene glycols), emulsifiers and dispersants or wetting agents (for example sodium dodecyl sulfate, polyoxysorbitanoleate), binders (for example polyvinylpyrrolidone), synthetic and natural polymers (for example albumin ), Stabilizers (eg, antioxidants such as ascorbic acid), dyes (eg, inorganic pigments such as iron oxides), and flavor and / or odor remedies.
- Carriers for example microcrystalline cellulose, lactose, mannitol
- solvents for example liquid polyethylene glycols
- emulsifiers and dispersants or wetting agents for example sodium dodecy
- compositions containing at least one compound of the invention usually together with one or more inert, non-toxic, pharmaceutically suitable excipients, and their use for the purposes mentioned above.
- Method 5 Instrument: Micromass Platform LCZ with HPLC Agilent Series 1100; Column: Thermo HyPURITY Aquastar 3 ⁇ 50 mm x 2.1 mm; Eluent A: 1 l of water + 0.5 ml of 50% formic acid, eluent B: 1 l of acetonitrile + 0.5 ml of 50% formic acid; Gradient: 0.0 min 100% A -> 0.2 min 100% A - »2.9 min 30% A -» 3.1 min 10% A -> 5.5 min 10% A; Oven: 50 ° C .; Flow: 0.8 ml / min; UV detection: 210 nm.
- Method 6 Instrument: Micromass Platform LCZ with HPLC Agilent Series 1100; Column: Thermo Hypersil GOLD-3 ⁇ 20 x 4 mm; Eluent A: 1 l of water + 0.5 ml of 50% formic acid, eluent B: 1 l of acetonitrile + 0.5 ml of 50% formic acid; Gradient: 0.0 min 100% A ⁇ »0.2 min 100% A -> 2.9 min 30% A ⁇ » 3.1 min 10% A -> 5.5 min 10% A; Oven: 50 ° C .; Flow: 0.8 ml / min; UV detection: 210 nm.
- Example 3A The preparation is analogous to Example 3A from 57 mg (0.216 mmol) of (4i?) - l - [(benzyl-oxy) carbonyl] -4-hydroxy-Z-proline and 93 mg (0.28 mmol) of the compound of Example 8A in 6 ml of dimethylformamide with addition of 54 mg (0.28 mmol) EDC and 8.7 mg (0.065 mmol) HOBt.
- the product is purified by preparative RP-HPLC (mobile phase water / acetonitrile gradient: 90:10 - »5:95).
- Example 4A The preparation is carried out analogously to Example 4A from 41 mg (0.071 mmol) of the compound from Example 9A in 20 ml of ethanol with the addition of 7.5 mg of palladium on activated carbon (10%). The product is reacted without further purification.
- Example 12A The preparation is carried out analogously to Example 12A from 300 mg (1.098 mmol) of 2- ⁇ [(benzyloxy) carbonyl] amino ⁇ ethyl methanesulfonate (Example IIA), 386 mg (2.19 mmol) of tert-butyl (2-aminoethyl) methyl carbamate and 455 mg (3.30 mmol) of potassium carbonate in 10 ml of acetonitrile.
- Example 12A The preparation is carried out analogously to Example 12A from 270 mg (0.98 mmol) of 2- ⁇ [(benzyloxy) carbonyl] amino ⁇ ethyl-methanesulfonate (Example IIA), 379 mg (1.98 mmol) of tert-butyl (3-amino) 2-hydroxypropyl) carbamate and 409 mg (2.96 mmol) of potassium carbonate in 10 ml of acetonitrile.
- Example 17A The preparation is carried out analogously to Example 12A from 2 g (5.443 mmol) of tert-butyl-N- (tert-butoxycarbonyl) -5 - [(methylsulfonyl) oxy] -L-norvalinate (Example 17A), 1.78 g (10.89 mmol). tert-butyl (2-aminoethyl) carbamate and 2.26 g (16.33 mmol) of potassium carbonate in 100 ml of acetonitrile. The crude product is reacted without further purification. Yield: 4.2 g (53% of theory)
- Example 12A The preparation is carried out analogously to Example 12A from 1 g (3.66 mmol) of 2 - ⁇ [(benzyloxy) carbonyl] amino ⁇ ethyl methanesulfonate (Example IIA), 1.56 g (7.31 mmol) of fer ⁇ butyl-2- (aminomethyl) - piperidine-1-carboxylate and 1.52 g (10.98 mmol) of potassium carbonate in 70 ml of acetonitrile.
- Example 12A After stirring at RT for 30 min, 12.7 mg (0.046 mmol) of benzyl ⁇ 2 - [(2-hydroxyethyl) amino] ethyl ⁇ carbamate (Example 12A) are added. The reaction mixture is stirred at RT for 15 h. The solvent is then evaporated and the residue taken up in dichloromethane. The organic phase is washed with water, dried over magnesium sulfate and concentrated. The crude product is purified by preparative HPLC.
- Example 36A Analogously to the procedure of Example 36A, the examples 37A to 45A listed in the following table are prepared.
- Example 46A Analogously to the procedure of Example 46A, the examples 47A to 50A listed in the following table are prepared.
- Example 51A Analogously to the procedure of Example 51A, the examples 52A to 56A listed in the following table are prepared.
- Example 1 as a tetrahydrochloride salt is converted into the tetra (hydrotrifluoroacetate) by preparative HPLC (Reprosil ODS-A, eluent acetonitrile / 0.2% aqueous trifluoroacetic acid 5:95 -> 95: 5).
- cAMP 11.25 mg / ml
- 50 ⁇ l reaction mixture is added to the reaction mix of the in vitro transcription-translation test.
- the test batch is 105 ⁇ l, with 5 ⁇ l of the be submitted to the substance to be tested in 5% DMSO.
- the transcription template used is 1 ⁇ g / 100 ⁇ l of the plasmid pBESTLuc (Promega, Germany).
- luciferin solution (20 mM Tricine, 2.67 mM MgSO 4, 0.1 mM EDTA, 33.3 mM DTT pH 7.8, 270 uM CoA, 470 uM luciferin, 530 uM ATP) is added and the resulting bioluminescence measured for 1 minute in a luminometer.
- the IC 50 is the concentration of an inhibitor that leads to a 50% inhibition of the translation of firefly luciferase.
- plasmid pBESTluc Promega Corporation, USA
- E. coli tac promoter present in this plasmid in front of the firefly luciferase is exchanged for the capAl promoter with corresponding Shine-Dalgarno sequence from S. aureus.
- the primers CAPFor 5 '-CGGCC- AAGCTTACTCGGATCCAGAGTTTGCAAATATACAGGGGATTATATATAATGGAAAAC AAGAAAGGAAAATAGGAGGTTTATATGGAAGACGCCA-S' and CAPRev 5 1 - GTCATCGTCGGGAAGACCTG-3 ' are used.
- the primer CAPFor contains the capAl promoter, the ribosome binding site and the 5 'region of the luciferase gene. After PCR using pBESTluc as a template, a PCR product containing the firefly luciferase gene with the fused capAl promoter can be isolated.
- BHI medium Six liters of BHI medium are inoculated with a 250 ml overnight culture of a S. aureus strain and grown at 37 ° C to an OD600nm of 2-4.
- the cells are harvested by centrifugation and washed in 500 ml of cold buffer A (10 mM Tris-acetate, pH 8.0, 14 mM magnesium acetate, 1 mM DTT, 1 M KCl). After renewed centrifugation, the cells are washed in 250 ml of cold buffer A with 50 mM KCl and the resulting pellets are frozen at -20 ° C for 60 min.
- the pellets are thawed on ice in 30 to 60 minutes and taken up to a total volume of 99 ml in buffer B (10 mM Tris-acetate, pH 8.0, 20 mM magnesium acetate, 1 mM DTT, 50 mM KCl).
- buffer B 10 mM Tris-acetate, pH 8.0, 20 mM magnesium acetate, 1 mM DTT, 50 mM KCl.
- 1.5 ml each of lysostaphin (0.8 mg / ml) in Buffer B are introduced into 3 pre-cooled centrifuge beakers and mixed with 33 ml each of the cell suspension.
- the Samples are incubated for 45-60 minutes at 37 ° C with occasional shaking before adding 150 ⁇ l of a 0.5 M DTT solution.
- the lysed cells are centrifuged off at 30,000 xg for 30 min at 4 ° C.
- the cell pellet after uptake in Buffer B, is recentrifuged under the same conditions and the collected supernatants are pooled.
- the supernatants are again centrifuged under the same conditions and to the upper 2/3 of the supernatant 0.25 volume of buffer C (670 mM Tris-acetate, pH 8.0, 2O mM magnesium acetate, 7 mM Na 3 phosphoenolpyruvate, 7 mM DTT, 5.5 mM ATP , 70 ⁇ M amino acids (complete from Promega), 75 ⁇ g pyruvate kinase (Sigma, Germany)) / ml.
- the samples are incubated for 30 min at 37 ° C.
- the supernatants are dialyzed overnight at 4 ° C. against 2 l dialysis buffer (10 mM Tris-acetate, pH 8.0, 14 mM magnesium acetate, 1 mM DTT, 60 mM potassium acetate) with a buffer change in a dialysis tube with 3500 Da exclusion.
- the dialysate is concentrated to a protein concentration of about 10 mg / ml by covering the dialysis tube with cold PEG 8000 powder (Sigma, Germany) at 4 ° C.
- the S30 extracts can be stored in aliquots at -70 0 C.
- Inhibition of protein biosynthesis of the compounds can be demonstrated in an in vitro transcription-translation assay.
- the assay is based on the cell-free transcription and translation of firefly luciferase using the reporter plasmid pla as template and cell-free S30 extracts obtained from S. aureus. The activity of the resulting luciferase can be detected by luminescence measurement.
- the amount of S30 extract or plasmid pla to be used must be re-tested for each preparation in order to ensure an optimal concentration in the test. 3 ⁇ l of the substance to be tested dissolved in 5% DMSO are placed in an MTP. Subsequently, 10 ⁇ l of a suitably concentrated plasmid solution pla are added.
- MMK Minimal Inhibitory Concentrations
- the minimum inhibitory concentration is the minimum concentration of antibiotic used to inhibit a test bacterium in its growth for 18-24 h.
- the inhibitor concentration can be determined according to standard microbiological procedures (see, for example, The National Committee for Clinical Laboratory Standards, Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobic, approved standard-fifth edition, NCCLS document M7-A5 [ISBN 1-56238-394 NCCLS, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-98 USA, 2000).
- the MIC of the compounds according to the invention is determined in the liquid dilution test in a 96-well microtiter plate scale.
- the bacterial germs are suspended in a minimal medium (18.5 mM Na 2 HPO 4 , 5.7 mM KH 2 PO 4 , 9.3 mM NH 4 Cl, 2.8 mM MgSO 4 , 17.1 mM NaCl, 0.033 ⁇ g / ml thiamine hydrochloride, 1.2 ⁇ g / ml nicotinic acid, 0.003 ⁇ g / ml biotin, 1% glucose, 25 ⁇ g / ml of each proteinogenic amino acid except phenylalanine; [H.P. Kroll, unpublished]) cultured with the addition of 0.4% BH broth (test medium).
- a minimal medium (18.5 mM Na 2 HPO 4 , 5.7 mM KH 2 PO 4 , 9.3 mM NH 4 Cl, 2.8 mM MgSO 4 , 17.1 mM NaCl, 0.033 ⁇ g / ml thiamine hydrochloride, 1.2
- the lowest substance concentration at which no visible bacterial growth occurs is defined as MIC.
- the minimum inhibitory concentration is the minimum concentration of antibiotic used to inhibit a test bacterium in its growth for 18-24 h.
- the inhibitor concentration can be determined by standard microbiological procedures using modified medium as part of an agar dilution test (see, for example, The National Committee for Clinical Laboratory Standards, Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobic, approved standard-fifth edition, NCCLS document M7 -A5 [ISBN 1-56238- 394-9], NCCLS, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-98 USA, 2000). The bacteria are cultured on 1.5% agar plates containing 20% defibrinated horse blood.
- test bacteria which are incubated overnight on Columbia blood agar plates (Becton-Dickinson) are diluted in PBS, adjusted to a bacterial count of about 5x10 5 germs / ml and dropped on test plates (1-3 ul).
- the test substances contain different Dilutions of the test substances (dilution stages 1: 2).
- the cultures are incubated at 37 ° C for 18-24 hours in the presence of 5% CO 2 .
- the lowest substance concentration at which no visible bacterial growth occurs is defined as MIC and expressed in ⁇ g / ml.
- Concentration data MIC in ⁇ g / ml; IC 50 in ⁇ M.
- the suitability of the compounds of the invention for the treatment of bacterial infections can be demonstrated in various animal models.
- the animals are generally infected with a suitable virulent germ and then treated with the compound to be tested, which is present in a formulation adapted to the respective therapeutic model.
- the suitability of the compounds of the invention for the treatment of bacterial infections in a sepsis model in mice after infection with S. aureus can be demonstrated.
- S. aureus 133 cells are grown overnight in BH broth (Oxoid, Germany). The overnight culture was diluted 1: 100 in fresh BH broth and spun for 3 hours. The bacteria in the logarithmic growth phase are centrifuged off and washed twice with buffered, physiological saline. Thereafter, a cell suspension in saline solution with an extinction of 50 units is set on the photometer (Dr. Lange LP 2W). After a dilution step (1:15), this suspension is mixed 1: 1 with a 10% mucin suspension. 0.2 ml / 20 g mouse ip is administered from this infectious solution. This corresponds to a cell number of about 1-2 x 10 6 germs / mouse.
- the iv therapy is 30 Minutes after infection.
- Female CFWl mice are used.
- the survival of the animals is recorded over 6 days.
- the animal model is adjusted so that untreated animals die within 24 hours of infection.
- the spontaneous resistance rates of the compounds according to the invention are determined as follows: the bacterial germs are dissolved in 30 ml of a minimal medium (18.5 mM Na 2 HPO 4 , 5.7 mM EH 2 PO 4 , 9.3 mM NH 4 Cl, 2.8 mM MgSO 4 , 17.1 mM NaCl, 0.033 ⁇ g / ml thiamin hydrochloride, 1.2 ⁇ g / ml nicotinic acid, 0.003 ⁇ g / ml biotin, 1% glucose, 25 ⁇ g / ml of each proteinogenic amino acid with addition of 0.4% BH broth) at 37 ° C overnight, 10 min at ⁇ .00 Oxg centrifuged and resuspended in 2 ml of phosphate-buffered physiological NaCl solution (about 2xlO 9 germs / ml).
- 100 ⁇ l of this cell suspension or 1:10 and 1: 100 dilutions are diluted on predried agar plates (1.5% agar, 20% defibrinated horse blood or 1.5% agar, 20% bovine serum in 1/10 Müller-Hinton medium diluted with PBS), which the test compound according to the invention in a concentration corresponding to 5xMHK or 1 OxMHK contain plated and incubated at 37 ° C for 48 h. The resulting colonies (cfu) are counted.
- the S. aureus strain RN4220Bi R is isolated in vitro.
- 100 ⁇ l of a S. aureus RN4220 cell suspension (approximately 1.2 ⁇ 10 8 cfu / ml) are applied to an antibiotic-free agar plate (18.5 mM Na 2 HPO 4 , 5.7 mM KH 2 PO 4 , 9.3 mM NH 4 Cl, 2.8 mM MgSO 4 , 17.1 mM NaCl, 0.033 ⁇ g / ml thiamine hydrochloride, 1.2 ⁇ g / ml nicotinic acid, 0.003 ⁇ g / ml biotin, 1% glucose, 25 ⁇ g / ml of each proteinogenic amino acid with the addition of 0.4% BH broth and 1% agarose) and a Agar plate containing 2 ug / ml Biphenomycin B (1 OxMHK), and incubated overnight at 37 0 C incuba
- the S. aureus strain T17 is isolated in vivo. CFWl mice are challenged with 4x10 ⁇ S. aureus 133 cells per mouse intraperitoneally. 0.5 hours after infection, the animals are treated intravenously with 50 mg / kg biphenomycin B. The surviving animals will be on day 3 the infection is taken from the kidneys. After homogenizing the organs, the homogenates are plated on antibiotic-free and antibiotic-containing agar plates as described for RN4220Bi R and incubated overnight at 37 ° C. About half of the colonies isolated from the kidney show growth on the antibiotic-containing plates (2.2 ⁇ 10 6 colonies), which demonstrates the accumulation of biphenomycin B-resistant S. aureus cells in the kidney of the treated animals. Approximately Twenty of these colonies are tested for biphenomycin B MIC and a colony with a MIC> 50 ⁇ M is selected for further culture and the strain is designated T17.
- the compounds according to the invention can be converted into pharmaceutical preparations as follows:
- the compound of the present invention is dissolved in the water with stirring together with polyethylene glycol 400.
- the solution is sterile-filled (pore diameter 0.22 ⁇ m) and filled under aseptic conditions into heat-sterilized infusion bottles. These are closed with infusion stoppers and crimp caps.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Crystallography & Structural Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Plural Heterocyclic Compounds (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE502006004234T DE502006004234D1 (de) | 2005-03-30 | 2006-03-21 | Antibakterielle amid-makrozyklen vi |
| JP2008503404A JP2008534537A (ja) | 2005-03-30 | 2006-03-21 | 抗菌性アミドマクロサイクルvi |
| EP06723578A EP1866291B1 (de) | 2005-03-30 | 2006-03-21 | Antibakterielle amid-makrozyklen vi |
| CA002602743A CA2602743A1 (en) | 2005-03-30 | 2006-03-21 | Antibacterial amide macrocycles vi |
| US11/904,550 US20080300231A1 (en) | 2005-03-30 | 2007-09-26 | Antibacterial amide macrocycles VI |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE102005014247.8 | 2005-03-30 | ||
| DE102005014247A DE102005014247A1 (de) | 2005-03-30 | 2005-03-30 | Antibakterielle Amid-Makrozyklen VI |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/904,550 Continuation US20080300231A1 (en) | 2005-03-30 | 2007-09-26 | Antibacterial amide macrocycles VI |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2006103009A1 true WO2006103009A1 (de) | 2006-10-05 |
Family
ID=36228560
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2006/002564 Ceased WO2006103009A1 (de) | 2005-03-30 | 2006-03-21 | Antibakterielle amid-makrozyklen vi |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20080300231A1 (https=) |
| EP (1) | EP1866291B1 (https=) |
| JP (1) | JP2008534537A (https=) |
| CA (1) | CA2602743A1 (https=) |
| DE (2) | DE102005014247A1 (https=) |
| ES (1) | ES2327444T3 (https=) |
| WO (1) | WO2006103009A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007006548A3 (de) * | 2005-07-14 | 2007-03-22 | Aicuris Gmbh & Co Kg | Antibakterielle amid-makrozyklen vii |
| US7655643B2 (en) | 2003-12-16 | 2010-02-02 | Aicuris Gmbh & Co. Kg | Antibacterial macrocycles with substituted biphenyl |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10501493B2 (en) | 2011-05-27 | 2019-12-10 | Rqx Pharmaceuticals, Inc. | Broad spectrum antibiotics |
| EA201590871A1 (ru) * | 2012-11-21 | 2015-11-30 | АрКьюЭкс ФАРМАСЪЮТИКЛС, ИНК. | Макроциклические антибиотики широкого спектра действия |
| BR112016027232A2 (pt) | 2014-05-20 | 2018-06-26 | Genentech Inc | antibióticos macrocíclicos de amplo espectro |
| US11072635B2 (en) | 2015-11-20 | 2021-07-27 | Rqx Pharmaceuticals, Inc. | Macrocyclic broad spectrum antibiotics |
| ES2961566T3 (es) | 2019-05-28 | 2024-03-12 | Hoffmann La Roche | Antibióticos macrocíclicos de amplio espectro |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10226921A1 (de) * | 2002-06-17 | 2003-12-24 | Bayer Ag | Antibakterielle Amid-Makrozyklen |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3452136A (en) * | 1968-04-17 | 1969-06-24 | American Cyanamid Co | Antibiotic af283 and production thereof |
| FR2720066B1 (fr) * | 1994-05-20 | 1996-06-28 | Rhone Poulenc Rorer Sa | Peptides antagonistes de la neurotensine. |
| DE10234422A1 (de) * | 2002-07-29 | 2004-02-12 | Bayer Ag | Antibakterielle Ester-Makrozyklen |
| CA2540646A1 (en) * | 2003-10-01 | 2005-04-14 | Bayer Healthcare Ag | Antibacterial amide macrocycles |
| DE10358824A1 (de) * | 2003-12-16 | 2005-07-21 | Bayer Healthcare Ag | Antibakterielle Makrozyklen mit substituiertem Biphenyl |
| DE102005014240A1 (de) * | 2004-09-24 | 2006-03-30 | Bayer Healthcare Ag | Antibakterielle Amid-Makrozyklen IV |
-
2005
- 2005-03-30 DE DE102005014247A patent/DE102005014247A1/de not_active Withdrawn
-
2006
- 2006-03-21 WO PCT/EP2006/002564 patent/WO2006103009A1/de not_active Ceased
- 2006-03-21 EP EP06723578A patent/EP1866291B1/de not_active Expired - Lifetime
- 2006-03-21 DE DE502006004234T patent/DE502006004234D1/de not_active Expired - Lifetime
- 2006-03-21 ES ES06723578T patent/ES2327444T3/es not_active Expired - Lifetime
- 2006-03-21 JP JP2008503404A patent/JP2008534537A/ja not_active Withdrawn
- 2006-03-21 CA CA002602743A patent/CA2602743A1/en not_active Abandoned
-
2007
- 2007-09-26 US US11/904,550 patent/US20080300231A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE10226921A1 (de) * | 2002-06-17 | 2003-12-24 | Bayer Ag | Antibakterielle Amid-Makrozyklen |
| EP1515983A1 (de) * | 2002-06-17 | 2005-03-23 | Bayer HealthCare AG | Antibakterielle amid-makrozyklen |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7655643B2 (en) | 2003-12-16 | 2010-02-02 | Aicuris Gmbh & Co. Kg | Antibacterial macrocycles with substituted biphenyl |
| WO2007006548A3 (de) * | 2005-07-14 | 2007-03-22 | Aicuris Gmbh & Co Kg | Antibakterielle amid-makrozyklen vii |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2602743A1 (en) | 2006-10-05 |
| DE502006004234D1 (de) | 2009-08-27 |
| EP1866291A1 (de) | 2007-12-19 |
| US20080300231A1 (en) | 2008-12-04 |
| DE102005014247A1 (de) | 2006-10-05 |
| EP1866291B1 (de) | 2009-07-15 |
| ES2327444T3 (es) | 2009-10-29 |
| JP2008534537A (ja) | 2008-08-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1515983B1 (de) | Antibakterielle amid-makrozyklen | |
| EP1697400B1 (de) | Antibakterielle makrozyklen mit substituiertem biphenyl | |
| EP1869068A1 (de) | Antibakterielle amid-makrozyklen v | |
| EP1526896A1 (de) | Antibakterielle ester-makrozyklen | |
| WO2005033129A1 (de) | Antibakterielle amid-makrozyklen | |
| US20080300231A1 (en) | Antibacterial amide macrocycles VI | |
| EP1981903A1 (de) | Asparagin-10-substituierte nonadepsipeptide | |
| DE10208256A1 (de) | Piperidinouracile | |
| EP1809657A1 (de) | Cyclische nonapeptidamide | |
| EP1797110B1 (de) | Antibakterielle amid-makrozyklen iv | |
| DE102004025731A1 (de) | Antibakterielle Amid-Makrozyklen III | |
| EP1809653B1 (de) | Substituierte nonadepsipeptide | |
| DE102004051023A1 (de) | Desoxo-Nonadepsipeptide | |
| DE102004018405A1 (de) | Antibakterielle Amid-Makrozyklen II | |
| EP1907413A2 (de) | Antibakterielle amid-makrozyklen vii | |
| WO2007059908A1 (de) | Neue cyclische iminopeptid-derivate und ein verfahren zur herstellung von cyclischen iminopeptid-derivaten | |
| DE102005055946A1 (de) | Cyclische Iminopeptid-Derivate |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2602743 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008503404 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006723578 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: RU |
|
| WWW | Wipo information: withdrawn in national office |
Country of ref document: RU |
|
| WWP | Wipo information: published in national office |
Ref document number: 2006723578 Country of ref document: EP |