WO2006086402A2 - Compositions and methods related to soluble g-protein coupled receptors(sgpcrs) - Google Patents

Compositions and methods related to soluble g-protein coupled receptors(sgpcrs) Download PDF

Info

Publication number
WO2006086402A2
WO2006086402A2 PCT/US2006/004321 US2006004321W WO2006086402A2 WO 2006086402 A2 WO2006086402 A2 WO 2006086402A2 US 2006004321 W US2006004321 W US 2006004321W WO 2006086402 A2 WO2006086402 A2 WO 2006086402A2
Authority
WO
WIPO (PCT)
Prior art keywords
scrfr2
protein
nucleic acid
gpcr
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2006/004321
Other languages
English (en)
French (fr)
Other versions
WO2006086402A3 (en
Inventor
Alon Chen
Marilyn Perrin
Wylie Vale
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Research Development Foundation
Original Assignee
Research Development Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Research Development Foundation filed Critical Research Development Foundation
Priority to DK06734527.2T priority Critical patent/DK1885746T3/da
Priority to CN2006800078724A priority patent/CN101137668B/zh
Priority to JP2007554332A priority patent/JP4859248B2/ja
Priority to EP06734527A priority patent/EP1885746B1/en
Priority to CA2597065A priority patent/CA2597065C/en
Priority to AT06734527T priority patent/ATE540970T1/de
Priority to AU2006212813A priority patent/AU2006212813B2/en
Publication of WO2006086402A2 publication Critical patent/WO2006086402A2/en
Publication of WO2006086402A3 publication Critical patent/WO2006086402A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/1796Receptors; Cell surface antigens; Cell surface determinants for hormones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/18Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/22Anxiolytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/24Antidepressants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/30Drugs for disorders of the nervous system for treating abuse or dependence
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants

Definitions

  • the present invention is directed generally to method and compositions related to molecular biology, neurology, and endocrinology. In certain aspects it is directed to compositions comprising and methods of using soluble G-protein coupled receptors
  • GPCRs as modulators of GPCR activity and/or modulators of the pharmacologic effects of the ligands that bind such soluble GPCRs.
  • BACKGROUND OF THE INVENTION Receptors in general, are molecular structures located in the cell membrane or within a cell that form a weak, reversible bond with an agent such as an antigen, hormone, or neurotransmitter. Each receptor is designed to bind with a specific agent(s).
  • a specific family of receptors is the seven transmembrane ("7TM") or G-Protein- Coupled Receptor ("GPCR"). These receptors link with a Guanine Nucleotide-Binding G-protein (“G-protein”) in order to signal when an appropriate agent has bound the receptor.
  • GDP Guanine Diphosphate
  • GTP Guanine Triphosphate
  • GPCRs share a common structural motif. All these receptors have seven sequences of between 22 to 24 hydrophobic amino acids that form seven alpha helices, each of which spans the membrane ⁇ i.e., transmembrane- 1 (TM-I), transmebrane-2 (TM-2), etc.).
  • transmembrane helices are joined by strands of amino acids between transmembrane-2 and transmembrane-3, transmembrane-4 and transmembrane-5, and transmembrane-6 and transmembrane-7 on the exterior, or "extracellular” side, of the cell membrane (these are referred to as “extracellualr loops” or “extracellular” regions).
  • transmembrane helices are also joined by strands of amino acids between transmembrane- 1 and transmembrane-2, transmembrane-3 and transmembrane-4, and transmembrane-5 and transmembrane-6 on the interior, or "intracellular” side, of the cell membrane (these are referred to as "intracellular loops" or “intracellular” regions).
  • the "carboxy" (“C") terminus of the receptor lies in the intracellular space within the cell, and the "amino" (“N”) terminus of the receptor lies in the extracellular space outside of the cell.
  • GPCRs are "promiscuous" with respect to G-proteins, i.e., that a GPCR can interact with more than one G-protein (Kenakin, 1988). Although other G-proteins exist, currently, Gq, Gs, Gi, and Go are G-proteins that have been identified.
  • Ligand-activated GPCR coupling with the G-protein begins a signaling cascade process or signal transduction. Under normal conditions, signal transduction ultimately results in cellular activation or cellular inhibition. It is thought that the third intracellular loop (IC-3) as well as the carboxy terminus of the receptor interact with the G-protein.
  • GPCRs protein mediated transmembrane signaling via GPCRs.
  • Signals from a specific GPCR cause activation of a G-protein in the cell.
  • the majority of signals are transmitted by means of GPCRs into the cell interior.
  • the signal transduction may result in an overall or partial activation or inactivation of an intracellular process or processes depending upon the proteins that are involved.
  • Important signaling molecules or neurotransmitters which bind to GPCRs include, but are not limited to corticotropin releasing factor, parathyroid hormone, moiphine, dopamine, histamine, 5-hydroxytrytamine, adenosine, calcitonin, gastric inhibitory peptide (GIP), glucagon, growth hormone-releasing hormone (GHRH), parathyroid hormone (PTH), PACAP, secretin, vasoactive intestinal polypeptide (VIP), diuretic hormone, EMRl, latropliilin, brain-specific angiogenesis inhibitor (BAI), cadherin, EGF, LAG, (CELSR) 5 and other similar proteins or molecules.
  • GPCRs constitute a superfamily of proteins.
  • GPCRs There are currently over 2000 GPCRs reported in literature, which are divided into at least three families: rhodopsin- like family (family A), the calcitonin receptors (family B), and metabotropic glutamate family (family C) (Ji et al, 1998).
  • the reported GPCRs include both characterized receptors and orphan receptors for which ligands have not yet been identified. (Wilson et al, 1999; Wilson et al, 1998; Marchese et al, 1999).
  • each GPCR share a similar molecular structure.
  • Each GPCR comprises a string of amino acid residues of various lengths. GPCRs lie within the cell membrane in seven distinct coils called transmembranes. The amino terminus of the GPCR lies outside the cell with the extracellular loops, while the carboxy-terminus lies inside the cell with the intracellular loops.
  • the ligands for GPCRs comprise small molecules as well as peptides and small proteins.
  • the interactions between these ligands and their receptors vary from system to system but they may require the interaction with residues in several of the four extracellular domains and the N-terminus. In some instances the N-terminus alone may maintain an ability to interact with or bind ligands.
  • GPCRs with known ligands have been associated with many diseases including multiple sclerosis, diabetes, rheumatoid arthritis, asthma, allergies, inflammatory bowel disease, several cancers, thyroid disorders, heart disease, retinitis pigmentosa, obesity, neurological disorders, osteoporosis, Human Immunodeficiency Virus (“HIV”) infection and Acquired Immune Deficiency Syndrome (“AIDS”) (Murphy et al, 2000; Mannstadt et al, 1999; Berger et al, 1999; Jacobson et al, 1997; Meij, 1996;).
  • HIV Human Immunodeficiency Virus
  • AIDS Acquired Immune Deficiency Syndrome
  • the present invention is directed to compositions and methods related to a sGPCR ligand binding domains, as well as effects of the sGPCR on GPCR signaling and interaction between GPCR ligands and their GPCRs.
  • An embodiment of the invention includes an isolated soluble G-protein coupled receptor (sGPCR) ligand binding domain.
  • a sGPCR comprises all or part of a GPCR extracellular domain.
  • the sGPCR is an soluble form of a GPCR family B member.
  • the sGPCR is a GPCR subfamily Bl member.
  • a sGPCR is a soluble secretin receptor, VPAC 1 receptor, VPAC 2 receptor, PAC 1 receptor, glucagon receptor, growth hormone releasing hormone (GHRH) receptor, glucagon-related peptide 1 (GLP-I) receptor, glucagon- related peptide 2 (GLP-2) receptor, gastric inhibitory polypeptide (GIP) receptor, corticotropin releasing factor 1 (CRFl) receptor, cortisotropin releasing factor 2 (CRF2) receptor, parathyroid hormone 1 (PTHl) receptor, parathyroid hormone 2 (PTH2) receptor, calcitonin receptor-like receptor, or calcitoinin receptor.
  • the sGPCR can be a soluble PTHl receptor or PTH2 receptor.
  • An embodiment of the invention also includes a sGPCR that is a soluble form of the corticotropin releasing factor receptor type 2 ⁇ (sCRFR2 ⁇ ).
  • the amino acid sequence of a sCRFR2 ⁇ may comprise an amino acid sequence encoded by exons 3, 4, and 5 of the CRFR2 ⁇ gene or does not contain exon 6 or greater.
  • a recombinant sGPCR of the invention may include 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 130, 135, 140, 150, 155, 160, 180, 200 or more amino acids, including all ranges there between, of an GPCR extracellular domain(s), including all or part of the amino terminal extracellular domain, hi certain apsects, a sGPCR ligand binding domain may comprise an amino acid sequence at least 70, 75, 80, 85, 90, 95, or 98% similar to 50, 75, 100, 125, 150 or more amino acids of SEQ ID NO:4 (sCRFR2 ⁇ ), SEQ ID NO:8 (sCRFR2 ⁇ ), SEQ ID NO:12 (sCRFR2 ⁇ ), or SEQ ID NO:15 (mCRFR2 ⁇ ).
  • a sCRFR comprises the amino acid sequence of SEQ ID NO:4, 8, 12, 15 or a combination thereof
  • the invention includes an isolated sGPCR further comprising an affinity tag, a label, a detectable or therapeutic chemical moiety, a biotin/avidin label, a radionuclide, a detectable or therapeutic enzyme, a fluorescent marker, a chemiluminescent marker, an immunoglobulin domain or any combination thereof.
  • the GPCR comprises an immunoglobulin domain, in particular an Fc domain.
  • the sGPCR can be conjugated to a polymer, which includes, but is not limited to polyethylene glycol (PEG).
  • Embodiments of the invention include polynucleotides encoding sGPCR of the invention.
  • Polynucleotide may further comprise a promoter operably coupled to the polynucleotide encoding the sGPCR.
  • the sGPCR encoding sequence can be included in an expression cassette.
  • the expression cassette may be comprised in an expression vector.
  • the expression vector may include, but is not limited to a linear nucleic acid, a plasmid expression vector, or a viral expression vector.
  • an expression vector is comprised in a delivery vector, which may include, but is not limited to a liposome, a polypeptide, a polycation, a lipid, a bacterium, or a virus.
  • Still further embodiments of the invention include methods of modulating the activity of G-protien coupled receptor (GPCR) comprising: a) contacting a target tissue with a sGPCR; and b) binding a GPCR ligand in the vicinity of the target tissue, wherein the activity of the GPCR in the tissue is modulated.
  • GPCR G-protien coupled receptor
  • the ligand is a corticotropin releasing factor (CRF), urocortin 1, urocortin 2, installmentcortin 3, stresscopin, parathyroid hormone, PTH-related hormone, TIP39, calcitonin, amylin, CGRP (CALCA and CALCB), adrenomedullin, secretin, VIP, PACAP, glucagon, GHRH, GLP-I, GLP- 2, GIP or any combination thereof.
  • CCF corticotropin releasing factor
  • the methods may also include contacting a target tissue comprising the steps of: a) preparing sGPCR ligand binding domain in an apprpriate pharmaceutical solution; and b) adminstering the pharmaceutical solution to an animal, human, subject, and/or patient in an amount to affect binding of a target ligand in the target tissue of the animal.
  • Administration can be, but is not limited to ingestion, injection, endoscopy or perfusion.
  • Injection includes, but is not limited to intravenous, intramuscular, subcutaneous, intradermal, intracranial or intraperitoneal injection.
  • Disorders that may be treated, ameliorated, modulation, reduced in severity include disorders resulting from hyperactivation of a GPCR or hypersecretion of GPCR ligand.
  • the disorder is insulin sensitivity or type II diabetes.
  • the disorder may also include an anxiety-related disorder; a mood disorder; a post-traumatic stress disorder; supranuclear palsy; immune suppression; drug or alcohol withdrawal symptoms; inflammatory disorders; pain; asthma; psoriasis and allergies; phobias; sleep disorders induced by stress; fibromyalgia; dysthemia; bipolar disorders; cyclothymia; fatigue syndrome; stress-induced headache; cancer; human immunodeficiency virus infections; neurodegenerative diseases; gastrointestinal diseases; eating disorders; hemorrhagic stress; stress-induced psychotic episodes; euthyroid sick syndrome; syndrome of inappropriate antidiarrhetic hormone; obesity; infertility; head traumas; spinal cord trauma; ischemic neuronal damage; excitotoxic neuronal damage; epilepsy; cardiovascular and heart related disorders; immune dysfunctions; muscular spasms; urinary incontinence; senile dementia of the Alzheimer's type; multiinfarct dementia; am
  • the disorder is an anxiety-related disorder; a mood disorder; bipolar disorder; post-traumatic stress disorder; inflammatory disorder; chemical dependency and addiction; gastrointestinal disorder; or skin disorder.
  • the anxiety-related disorder is generalized anxiety or the mood disorder is depression.
  • the gastrointestinal disorder is irratable bowel syndrome.
  • Other embodiments of the invention include methods of detecting a GPCR ligand comprising: a) contacting a sample suspected of containing a GPCR ligand with a sGPCR polypeptide; and b) assessing the presence or absence of sGPCR polypeptide bound ligand.
  • the methods may further comprise characterizing the bound ligand. Characterizing a bound ligand includes, but is not limited to various chromatographies, mass spectrometry, peptide sequencing and the like.
  • the sGPCR polypeptide may or may not be operably coupled to a substrate or surface.
  • the method can further comprise: c) adminstering a radiolabled GPCR ligand; and d) assessing binding or competition for binding of the radiolabeled GPCR ligand to the sGPCR.
  • the GPCR ligand may include, but is not limited to corticotropin releasing factor (CRF), urocortin 1, urocortin 2, setupcortin 3, parathyroid hormone, PTH-related hormone, TIP39, calcitonin, amylin, CGRP (CALCA and CALCB), adrenomedullin, secretin, VIP, PACAP, glucagon, GHRH, GLP-I, GLP-2, or GIP.
  • Still other embodiments include methods of detecting a sGPCR comprising: a) contacting a sample suspected of containing a sGPCR with a ligand that binds the sGPCR or a related surface bound GPCR; and b) assessing binding of GPCR ligand with components of the sample.
  • the method can further comprise characterizing the bound sGPCR, which can include chromatography, mass spectrometry, protein fragmentation and sequencing, and the like.
  • a GPCR ligand may be operably coupled to a substrate or surface.
  • the methods can further compris: c) adminstering a radiolabled sGPCR; and d) assessing binding or competition for binding of the radiolabeled sGPCR to the GPCR ligand in the presence and absence of the sample being tested.
  • ligands include corticotropin releasing factor (CRF), urocortin 1, urocortin 2, setupcortin 3, parathyroid hormone, PTH-related hormone, TIP39, calcitonin, amylin, CGRP (CALCA and CALCB), adrenomedullin, secretin, VIP, PACAP, glucagon, GHRH, GLP-I, GLP-
  • GIP GIP 2
  • an antibody may bind the amino terminus or carboxy terminus of the sGPCR.
  • aspects of the invention include an antibody that binds a carboxy terminal 5, 10 , 15, 20 or more amino acid sequence, which may be derived from an alternative reading frame of a nucleotide sequenc that encodes a transmembrane region of a GPCR (typically the result of alternative splicing and may be engineered into a recombinant polynucleotide of the invention) .
  • Embodiments of the invention include methods of detecting the expression of a sGPCR, either using protein, nucleic acid or both protein and nucleic acid evaluation or assessment.
  • aspects of the invention include methods of detecting a sGPCR mRNA comprising: a) obtaining a nucleic acid sample to be analyzed; and b) assessing the presence of a sGPCR nucleic acid comprising a splice junction resulting in a sGPCR.
  • the method may include assessing the presence of a particular species of mRNA by nucleic hybridization, nucleic acid amplification or other methods of analyzing nucleic acids.
  • a sGPCR is a soluble B type GPCR, a soluble Bl type GPCR, a soluble CRFR, a sCRFRl, a sCRFR2, or a sCRFR2 ⁇ .
  • a polynucleotide can include an exon/exon junction that includes the amino terminal amino acids of a GPCR and none or part of an exon encoding a portion of a transmembrane domain.
  • the splice junction of a sCRFR2 ⁇ is an exon 5/exon 7 junction, wherein exon desigantion is based on the genomic designation of CRFR2 exons. Based on the CRFR2a transcript the exons would be designated 3 and 5, respectively (see FIG. 1 for an example).
  • a "soluble" GPCR means a GPCR that comprises all or part of an extracellular domain of a receptor, but lacks all or part of one or more transmembrane domains which normally retains the full length receptor in the cell membrane, the soluble form is not integrated into the cell membrane.
  • a soluble receptor of the invention is soluble in an aqueous solution.
  • the receptor can be in the form of an inclusion body, which is readily solubilized by standard procedures.
  • Such sGPCR may be derived from an engneered nucleic acid, a processed protein (e.g., protealized protein), a synthesized protein, or an isolated splice variant.
  • a polynucleitide encoding such a sGPCR maybe isolated or engineered.
  • isolated and purified are used interchangeably to refer to nucleic acids or polypeptides or biologically active portions thereof that are substantially or essentially free from components that normally accompany or interact with the nucleic acid or polypeptide as found in its naturally occurring environment.
  • an isolated or purified nucleic acid or polypeptide is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • an “isolated" nucleic acid is free of sequences (preferably protein-encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
  • the isolated nucleic acids can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the nucleic acids in genomic DNA of the cell from which the nucleic acid is derived.
  • the term "isolated” or “purified” as it is used to refer to a polypeptide of the invention means that the isolated protein is substantially free of cellular material and includes preparations of protein having less than about 30%, 20%, 10%, 5% or less (by dry weight) of contaminating protein.
  • culture medium represents less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or non-protein-of-interest chemicals.
  • FIGs. 1A-1B Illustrate an exemplary nucleotide and translated amino acid sequence of a soluble GPCR, the CRF receptor type 2 ⁇ (sCRFR2 ⁇ ) (FIG. IA). Underlined amino acids indicate the unique C-terminal tail. Boxed residues indicate putative N-linked glycosylation sites. Schematic representation of the structure of the mouse CRFR2 gene (upper panel), the two known functional transcripts in mouse, ⁇ and ⁇ (middle panels) and the novel sCRFR2 ⁇ splice variant (lower panel) (FIG. IB). The locations of the translation start sites (ATG) are indicated.
  • ATG translation start sites
  • ECD N- terminal extracellular domain
  • 7TM seven transmembrane domains
  • CD C-terminal cytoplasmic domain
  • FIGs. 2A-2C Show expression of CRFR2 ⁇ and sCRFR2 ⁇ mRNA in mouse brain and pituitary.
  • FIG. 2A is a schematic representation and the oligonucleotide primer locations of the amplified portion of mouse CRFR2 ⁇ (upper panel) and sCRFR2 ⁇ (lower panel) transcripts. The locations of the oligonuleotide primers, at exons three and seven, which result in the amplification of two products of 418 and 309 corresponding to CRFR2 ⁇ and sCRFR2 ⁇ , respectively, are indicated.
  • FIG. 1A Show expression of CRFR2 ⁇ and sCRFR2 ⁇ mRNA in mouse brain and pituitary.
  • FIG. 2A is a schematic representation and the oligonucleotide primer locations of the amplified portion of mouse CRFR2 ⁇ (upper panel) and sCRFR2 ⁇ (lower panel) transcripts. The locations of the oligonuleotide primers, at ex
  • FIG. 2B is a representative image of electrophoretic analysis of the semiquantitative RT-PCR for mCRFR2 ⁇ and sCRFR2 ⁇ mRNA and the ribosomal protein Sl 6 mRNA (upper panels). Southern blot hybridization of amplified mCRFR2 ⁇ and sCRFR2 ⁇ cDNA and the ribosomal protein Sl 6 cDNA fragments were also performed (lower panels). The radioactive bands were quantified by Phosphorlmager and normalized values (relative to the S16 expression) are presented as relative densitometry units (FIG. 2C).
  • FIGs. 3A-3C A highly specific antiserum raised in rabbit using a synthetic peptide fragment encoding the unique C-terminal tail of mouse sCRFR2 ⁇ protein (aa 113-143) was used to develop a sCRFR2 ⁇ radioimmunoassay, used for immunoblot analysis and for immunocytochemistry.
  • FIG. 3A is a western immunoblot of mouse sCRFR2 ⁇ isolated from the medium of COS-M6 cells transiently transfected with sCRFR2 ⁇ FLAG construct reacted with anti-sCRFR2 ⁇ -(l 13-143) serum (left panel) or monoclonal M2 anti-FLAG (right panel).
  • Lanes 1, 2, and 3 correspond to 0.1, 1.0, and 10 ⁇ l of sCRFR2 ⁇ - FLAG extract, respectively.
  • FIG. 3B Displacement of [ 125 I]TyT 113 sCRFR2 ⁇ (aa 113-143) binding to rabbit anti-sCRFR2 ⁇ (aal 13-143) by synthetic sCRFR2 ⁇ (aa 113-143) and by purified COS-M6 expressed sCRFR2 ⁇ (aa 113-143)- FLAG.
  • FIG. 3B Displacement of [ 125 I]TyT 113 sCRFR2 ⁇ (aa 113-143) binding to rabbit anti-sCRFR2 ⁇ (aal 13-143) by synthetic sCRFR2 ⁇ (aa 113-143) and by purified COS-M6 expressed sCRFR2 ⁇ (aa 113-143)- FLAG.
  • FIG. 3 C Immunofluorescence staining of COS-M6 cells transiently transfected with mouse sCRFR2 ⁇ construct visualized with the anti-sCRFR2 ⁇ (aa 113-143) serum followed by a Cy3 -conjugated secondary antibody (FIG. 3C(b)). The slides were counterstained with DAPI to visualize both transfected and non transfected cells (FIG. 3C(a)). Cells incubated with normal rabbit serum (NRS), as negative control, followed by a Cy3 -conjugated secondary antibody did not show any staining (FIG. 3C(c)). FIGs. 4A-4G.
  • FIGs. 4A- 4F show immunoperoxidase staining for sCRFR2 ⁇ in select mouse brain regions.
  • Major sites of cellular expression included the principal output neurons of the olfactory bulb (FIG.-4A); the medial septal nucleus (FIG. 4B); and the basolateral (BLA), but not the central (CeA) nucleus of the amygdala (FIG. 4C); cerebral cortex, where stained cells were localized mainly in layers 5 and 2/3 (FIG. 4D); and red nucleus (FIG. 4E).
  • FIG. 4G sCRFR2 ⁇ -like immunoreactivity in acid- extracted and partially purified tissue isolated from mouse brain was measured by radioimmunoassay. Tissue extracts were tested at 5-7 dose levels and displaced [ 125 I]- labeled Tyr 113 sCRFR2 ⁇ (aa 113-143) binding to rabbit anti-sCRFR2 ⁇ (aa 113-143) in a dose-dependent manner.
  • FIGs. 5A-5B sCRFR2 ⁇ protein interferes with the induction of cAMP and MAPK signaling mediated by Ucn 1 or CRF.
  • FIG. 5A shows activation of CRE- luciferase reporter by Ucn 1 or CRF, with or without sCRFR2 ⁇ preincubation, in 293T cells transiently transfected with mouse CRFR2 ⁇ . Luciferase reporter containing a fragment of the CRE promoter of the EVXl gene was cotransfected into 293T cells with CRFR2 ⁇ expression vectors.
  • Luciferase activity was measured following treatment (4h) with 0.0001-100 nM Ucn 1 or CRF, in the presence or absence of 0.1 nM sCRFR2 ⁇ . Assays were normalized to cotransfected ⁇ -galactosidase activity. The representative means of six replicates from one experiment is shown in the graph.
  • FIG. 5B Equilibrated CATH.a cells were treated with Ucn 1 (10 nM) with or without sCRFR2 ⁇ (0.4 or 4 nM). After 5 min of receptor stimulation, cell lysates were harvested and subjected to SDS-PAGE immunoblot analysis using phospho-ERKl/2-p42,44 antibody and ERK2-p44 antibody.
  • the ERK activation was calculated by normalizing the levels of phosphorylated ERKl/2-p42, 44 to total ERK2-p44.
  • GPCRs and associated signalling pathways include the inhibition or modulation of the activation or inhibition of the GPCR.
  • One approach is the development of small molecule inhibitors, which are costly to develop and bring to market.
  • a drawback of the treatment with small molecule inhibitors or antagonists of GPCRs is the risk of toxicity, particularly with repeated application.
  • many GPCRs have no small molecule receptor antagonists.
  • the development of a GPCR anatagonist that is less costly and/or less toxic than small molecule inhibitors is worthwhile.
  • Embodiments of the invention are directed to compositions and methods related to soluble GPCR (sGPCR) ligand binding domains, as well as its effects on GPCR signaling and interaction between GPCR ligands and their GPCRs.
  • sGPCRs may be used to antagonize the activation or inhibition of GPCRs in vitro and/or in vivo.
  • GPCRs constitute a superfamily of proteins, which are divided into three families: rhodopsin-like family (family A), the calcitonin receptors (family B), and metabotropic glutamate family (family C) (Ji et al, 1998), each of which may further be divided into subfamilies.
  • the reported GPCRs include both characterized receptors and orphan receptors, those for which ligands have not yet been identified (Wilson et al, 1999; Wilson et al, 1998; Marchese et al, 1999).
  • each GPCR share a similar molecular structure.
  • Each GPCR comprises a string of amino acid residues of various lengths. GPCRs lie within the cell membrane in seven distinct coils called transmembranes. The amino terminus of the GPCR is outside the cell as are the extracellular loops, while the carboxy-terminus is inside the cell with the intracellular loops.
  • GPCR family A includes, but is not limited to amine, peptide, hormone protein, rhodopsin, olfactory, prostanoid, nucleotide-like, cannabinoid, platelet activating factor, gonadotropin-releasing hormone, thyrotropin-releasing hormone and secretagogue, melatonin, viral, lysosphingolipid and LPA (EDG), leukotriene B4 receptor and other similar receptor proteins.
  • Rhodopsin like includes, but is not limited to amine, peptide, hormone protein, rhodopsin, olfactory, prostanoid, nucleotide-like, cannabinoid, platelet activating factor, gonadotropin-releasing hormone, thyrotropin-releasing hormone and secretagogue, melatonin, viral, lysosphingolipid and LPA (EDG), leukotriene B4 receptor and other similar receptor proteins.
  • EDG leukotriene B
  • GPCR family B includes, but is not limited to receptors for calcitonin, corticotropin releasing factor (CRF), gastric inhibitory peptide (GIP), glucagon, growth hormone-releasing hormone (GHRH), parathyroid hormone (PTH), pituitary adenylate cyclase-activating polypeptide (PACAP), secretin, vasoactive intestinal polypeptide (VIP), diuretic hormone, EMRl, latrophilin, brain-specific angiogenesis inhibitor (BAI), methuselah-like proteins (MTH), cadherin/EGF/LAG (CELSR), and other similar ligands. Harmar (2001) describes three subfamilies of GPCR family B, subfamily B 1 , B2 and B3.
  • Subfamily Bl includes, but is not limited to the classical hormone receptors, which are encoded by at least 15 genes in humans, with at least five putative members in Drosophila and three in C. elegans.
  • the ligands for receptors in this family are polypeptide hormones of approximately 27-141 amino-acid residues; at least nine of the mammalian receptors respond to ligands that are structurally related to one another (glucagon, glucagon-like peptides (GLP-I, GLP-2), glucose-dependent insulinotropic polypeptide, secretin, vasoactive intestinal peptide (VIP), PACAP, and growth-hormone-releasing hormone (GHRH).
  • AU members of this subfamily have been shown to be capable of regulating intracellular concentrations of cAMP by coupling to adenylate cyclase through a stimulatory G protein (Gs).
  • Gs stimulatory G protein
  • Some members of the subfamily are capable of signaling through additional G-protein-coupled signaling pathways, for example through activation of phospholipase C.
  • Subfamily B2 consists of a large number of family-B GPCRs with long extracellular amino termini, containing diverse structural elements linked to the core 7TM motif.
  • the prototype members of this subfamily were an EGF-module- containing, mucin-like hormone receptor (EMRl) isolated from a human neuroectodermal cDNA library (Baud et al. , 1995) and the leukocyte cell-surface antigen CD97 (Hamann et al, 1995).
  • EMRl mucin-like hormone receptor
  • Subfamily B2 also includes the calcium-independent receptors for ⁇ -latrotoxin. Three genes encoding calcium-independent latrotoxin receptors (CL-I CL-2 and CL-3) have been identified.
  • the brain-specific angiogenesis inhibitors 1, 2 and 3 (BAIl, BAI2, BAD), a group of proteins that have been implicated in , the vascularization of glioblastomas are also included in this subfamily.
  • the protein encoded by the Drosophila gene flamingo and its orthologs in humans (the cadherin EGF LAG seven-pass G-type receptors Celsrl, Celsr2 and Celsr3) and in C. elegans (F15B9.7) is also included in the B2 subfamily.
  • the subfamily includes a fourth, diverse group of receptors that contain some motifs common to receptors in subfamily B2 but are otherwise structurally unrelated (human epididymis 6 (HE6), EGF-TM7-latrophilin-related protein (ETL), the immunoglobulin- repeat-containing receptor Ig hepta, G-protein-coupled receptor 56 (GPR56) and very large G-protein-coupled receptor 1 (VLGRl)).
  • HE6 human epididymis 6
  • ETL EGF-TM7-latrophilin-related protein
  • VLGRl very large G-protein-coupled receptor 1
  • Subfamily B3 The prototype of a third group (subfamily B3) of family-B GPCRs is methuselah (mth), a gene isolated in a screen for single-gene mutations that extended average lifespan in D. melanogaster (Lin et al, 1998). The gene encodes a polypeptide that displays sequence similarity to other family-B GPCRs solely within the TM7 region. A least eight paralogs of methuselah are encoded within the Drosophila genome sequence.
  • family-B GPCRs The characteristic feature of all family-B GPCRs is the 7TM motif, which is distantly related to comparable regions of some other GPCR families but much more highly conserved within family B. conserveed cysteine residues within extracellular loops ECl and EC2 probably form a disulphide bridge, by analogy with family-A GPCRs in which this feature is also conserved (Palczewski et al, 2000). In contrast to family-A GPCRs, however, many of which appear to rely on internal hydrophobic sequences for targeting to the plasma membrane, most family-B GPCRs appear to have an amino-terminal signal peptide.
  • Receptors in subfamily B2 contain a variety of additional structural motifs in their large amino-terminal extracellular domains that suggest a role for this domain in cell-cell adhesion and signaling. These include EGF domains (in Celsrl, Celsr2, Celsr3,
  • EMRl, EMR2, EMR3, CD97 and Flamingo laminin and cadherin repeats (in Flamingo and its human orthologs Celsrl, Celsr2 and Celsr3), olfactomedin-like domains (in the latrotoxin receptors), thrombospondin type 1 repeats (in BAIl, BAI2 and BAI3) and, in Ig hepta, an immunoglobulin C-2-type domain also found in fibroblast growth factor
  • VLGRl has two copies of a motif (Calx-beta) present in Na+-Ca2+exchangers and integrin subunit ⁇ 4.
  • Family C (Metabotropic glutamate/pheromone) GPCR includes Metabotropic glutamate, calcium-sensing like, putative pheromone receptors, GABA-B, orphan GPRC5, orphan GPCR6, bride of sevenless proteins (BOSS), taste receptors (TlR) and other similar proteins.
  • the sGPCRs of the invention are class B receptors.
  • the sGPCRs of the invention are subfamily Bl receptors, and in a further aspect, the sGCPRs are CRFRl and CRFR2, and parathyroid hormone receptor.
  • Table 1 includes a non-limiting set of exemplary members of the GPCR family, accession numbers and associated UNIGENE and OMEVI entries are incorporated herein by reference as of the priority date and the date of filing of this application. Unigene entries can be accessed by internet links contained in OMIM webpage. Numerous other GPCRs and their accession numbers may be found at the website defined by the following address on the world wide web gpcr.org/7tm/htmls/entries.html.
  • CRF Corticotropin releasing factor
  • the CRP receptors are described in detail.
  • One of skill in the art would be able to adapt these specific teachings to other members of the GPCR family, particularly type B and more particularly to subfamily Bl receptors.
  • the invention includes, but is not limited to the sGPCR derived from the soluble corticotropin releasing factor receptors (sCRFR), in particular sCRFR2 ⁇ .
  • sCRFR soluble corticotropin releasing factor receptors
  • hypothalamic hypophysiotropic peptide corticotropin releasing factor (CRF), originally isolated from the hypothalamus (Vale et al, 1981), plays an important role in the regulation of the hypothalamo-pituitary-adrenal (HPA) axis under basal and stress conditions (River and Vale, 1983; Muglia et al, 1995). Further, CRF acts to integrate endocrine, autonomic, and behavioral responses to stressors (River and Vale, 1983; Muglia et al, 1995; Koob and Heinrichs, 1999).
  • HPA hypothalamo-pituitary-adrenal
  • the mammalian CRF peptide family comprises urocortin 1 (Ucn 1) (Vaughan et al, 1995) and the peptides, urocortin 2 (Ucn 2) and urocortin 3 (Ucn 3) also known as stresscopin- related peptide (Reyes et al, 2001; Hsu and Hsueh, 2001), and stresscopin (Hsu and Hsueh, 2001; Lewis et al, 2001), respectively.
  • Ucn 1 urocortin 1
  • Ucn 2 urocortin 2
  • Ucn 3 urocortin 3
  • CRF-related peptides are mediated through activation of two high affinity membrane receptors, CRFRl (Chen et al, 1993; Vita et al, 1993; Chang et al, 1993) and CRFR2 (Perrin et al, 1995; Stenzel et al, 1995; Kishimoto et al, 1995; Lovenberg et al, 1995; Chen et al, 2005), which belong to the Bl subfamily of seven- transmembrane domain (7TMD) receptors that signal by coupling to G-proteins.
  • TMD seven- transmembrane domain
  • the CRFR2 has three functional splice variants in human ( ⁇ , ⁇ , and ⁇ ) and two rodent variants ( ⁇ and ⁇ ) that are produced by the use of alternate 5' exons (Perrin et al, 1995; Stenzel et al, 1995; Kishimoto et al, 1995; Lovenberg et al, 1995; Chen et al, 2005; Grammatopoulos et al, 1999; Kostich et al, 1998).
  • CRFRl mRNA is widely expressed in mammalian brain and pituitary, with high levels found in the anterior pituitary, cerebral cortex, cerebellum, amygdala, hippocampus, and olfactory bulb (Van Pett et al, 2000). In the periphery, CRFRl is expressed in testes, ovary, skin, and spleen.
  • CRFR2 mRNA is expressed in a discrete pattern in the brain with highest densities in the lateral septal nucleus (LS), bed nucleus of stria terminalis (BNST), ventromedial hypothalamic nucleus (VMH), olfactory bulb, and mesencephalic raphe nuclei (Van Pett et al, 2000).
  • the CRFR2 ⁇ is the major splice variant expressed in the rodent brain (Lovenberg et al. 1995) while CRFR2 ⁇ is expressed in peripheral tissues, with highest levels in the skeletal muscle, heart, and skin (Perrin et al, 1995).
  • CRFRl and CRFR2 are distinct and imply diverse physiological functions, as demonstrated by the divergent phenotypes of the CRFRl or CRFR2 null mice.
  • Mice deficient for CRFRl display decreased anxiety-like behavior and have an impaired stress response (Smith et al, 1998; Timpl et al, 1998), while the CRFR2-null mice have increased anxiety-like behaviors and an exaggerated HPA response to stress (Zhu et al, 1999; Valerio et al, 2001; Khan et al, 1993).
  • the responses to administration of CRFR2 agonists and antagonists into specific brain regions reveal both anxiolytic and anxiogenic roles for CRFR2 (Bale and Vale, 2004).
  • CRFRl and CRFR2 differ pharmacologically: Ucn 1 has equal affinities for both receptors and is more potent than CRF on CRFR2, whereas Ucn 2 and Ucn 3 appear to be selective for CRFR2
  • CRFRs in distinct tissues or cell types by receptor-selective CRF peptides initiates a variety of signaling pathways, including coupling to different G-proteins, stimulation of PKB, PKC, intracellular calcium, and mitogen-activated protein kinase (MAPK) (for reviews see Bale and Vale, 2004; Perrin and Vale, 1999; Brar et al, 2002).
  • MAPK mitogen-activated protein kinase
  • CRFRl and CRFR2 both exist as multiple splice variants.
  • the inventors have identified a cDNA from mouse brain encoding an exemplary splice variant of sCRFR2 ⁇ in which exon six is deleted from the nucleic acid encoding CRFR2 ⁇ . Translation of this isoform produces a predicted 143 amino acid soluble protein.
  • the translated protein includes a majority of the first extracellular domain (ECDl) of the CRFR2 ⁇ followed by a unique 38 amino acid hydrophilic C-terminus resulting from a frame shift produced by deletion of exon six. Studies have demonstrated high levels of expression of sCRFR2 ⁇ in the olfactory bulb, cortex, and midbrain regions.
  • a protein corresponding to sCRFR2 ⁇ expressed and purified from either mammalian or bacterial cell systems, binds several CRF family ligands with low nanomolar affinities. Further, the purified sCRFR2 ⁇ protein inhibits cellular responses to CRF and urocortin 1.
  • a sCRFR2 ⁇ protein can be a biological modulator of CRF family ligands. The modulation of CRF family ligands is not limited to brain and may be used in any tissue that is exposed to one or more members of the CRF family of ligands.
  • aspects of the invention generally relate to compositions and methods of achieving a therapeutic effect, including the modulation of GPCR ligand activity, such as CRF family ligands, using a soluble GPCR ligand binding polypeptide, such as CRF binding polypeptide, as an antagonist either alone or together with one or more other hormone antagonist (e.g., small molecule antagonist), including but not limited to antagonist of ligand(s) of the CRF family.
  • GPCR ligand activity such as CRF family ligands
  • a soluble GPCR ligand binding polypeptide such as CRF binding polypeptide
  • an antagonist e.g., small molecule antagonist
  • One manner in which to antagonize the action of a ligand is to subject the ligand to a decoy or soluble receptor so as to limit the local concentration of ligand(s) that bind the decoy and modulate the ligands ability to signal via its cell surface receptor.
  • Soluble proteins related to membrane receptors can be generated by enzymatic truncation of membrane bound receptors as suggested for the GHRH receptor (Rekasld et al, 2000), dopamine D3 receptor (Liu et al, 1994), and calcitonin receptor (Seek et al, 2003), or by alternative splicing in the case of the glutamate receptors (Malherbe et al, 1999; Zhu et al, 1999; Valerio et al, 2001).
  • CRFRIe Two partial cDNA fragments (CRFRIe and CRFRIh), comprising deletion of exon 3 and 4, and addition of a cryptic exon in CRFRl were identified in human skin and predicted to exist as a soluble proteins (Pisarchik and Slominski, 2004).
  • CRFRIe One of these fragments, CRFRIe, exhibited dominant negative effects when co- transfected with the wildtype CRFRl.
  • CRF corticotropin releasing factor
  • CRF antagonists are described as being effective in the treatment of stress- related illnesses; mood disorders such as depression, major depressive disorder, single episode depression, recurrent depression, child abuse induced depression, postpartum depression, dysthemia, bipolar disorders, and cyclothymia; chronic fatigue syndrome; eating disorders such as anorexia and bulimia nervosa; generalized anxiety disorder; panic disorder; phobias; obsessive-compulsive disorder; post-traumatic stress disorder; pain perception such as fibromyalgia; headache; gastrointestinal diseases; hemorrhagic stress; ulcers; stress-induced psychotic episodes; fever; diarrhea; post-operative ileus; colonic hypersensitivity; irritable bowel syndrome; Crohn's disease; spastic colon; inflammatory disorders such as rheumatoid arthritis and osteoarthritis; pain; asthma; psoriasis; allergies; osteoporosis; premature birth
  • Polypeptides of the invention include soluble forms of GPCRs or soluble receptors.
  • Soluble receptors of the invention may comprise subunits which have been changed from a membrane bound to a soluble form.
  • soluble peptides may be produced by truncating the polypeptide to remove, for example, the 7 transmembrane regions and/or the cytoplasmic tail.
  • the transmembrane domains may be abolished by deletion, or by substitutions of the normally hydrophobic amino acid residues which comprise a transmembrane domain with hydrophilic ones. In either case, a substantially hydrophilic or soluble polypeptide is created which will reduce lipid affinity and improve aqueous solubility.
  • Soluble receptors of the invention may include any number of well-known leader sequences at the N-terminus. Such a sequence would allow the peptides to be expressed and targeted to the secretion pathway in a eukaryotic system.
  • Receptors are powerful tools to elucidate biological pathways and to treat various disease states via their easy conversion to immunoglobulin fusion proteins. These dimeric soluble receptor forms are good inhibitors of events mediated by either secreted or surface bound ligands. By binding to these ligands they prevent the ligand from interacting with cell associated receptors. Not only are these receptor-Ig fusion proteins useful in an experimental sense, but they have been successfully used clinically in the case of TNF-R-Ig to treat inflammatory bowel disease, rheumatoid arthritis, and the acute clinical syndrome accompanying OKT3 administration (Eason et al, 1996; van Dullemen et al, 1995).
  • stable plasma proteins which typically have a half-life greater than hours in the circulation of a mammal - can be used to construct the receptor fusion proteins.
  • plasma proteins include but are not limited to: immunoglobulins, serum albumin, lipoproteins, apolipoproteins and transferrin. Sequences that can target the soluble receptors to a particular cell or tissue type may also be attached to the receptor ligand binding domain to create a specifically localized soluble receptor fusion protein.
  • All or a functional fragment of GPCR extracellular region comprising the GPCR ligand binding domain may be fused to an immunoglobulin constant region like the Fc domain of a human IgGl heavy chain.
  • Soluble receptor-IgG fusions proteins are common immunological reagents and methods for their construction are well known in the art (see, for example U.S. Patent 5,225,538, which is incorporated herein in its entirety by reference).
  • a functional GPCR ligand binding domain may be fused to an immunoglobulin
  • the Ig Fc may be derived from an immunoglobulin class or subclass including but not limited to IgGl.
  • the Fc domains of antibodies belonging to different Ig classes or subclasses can activate diverse secondary effector functions. Activation occurs when the Fc domain is bound by a cognate Fc receptor. Secondary effector functions include the ability to activate the complement system or to cross the placenta. The properties of the different classes and subclasses of immunoglobulins are described in the art.
  • junction point of the receptor-Ig fusion protein may alter the structure, stability and ultimate biological activity of the sGPCR fusion protein.
  • One or more amino acids may be added to the C- terminus of the selected sGPCR fragment to modify the junction point with the selected fusion domain.
  • the N-tercninus of the sGPCR fusion protein may also be varied by changing the position at which the selected sGPCR DNA fragment is cleaved at its 5' end for insertion into the recombinant expression vector.
  • the stability and activity of each sGPCR fusion protein may be tested and optimized using routine experimentation, including but not limited to assays for ligand binding.
  • amino acid sequence variants may also be constructed to modify the affinity of the sGPCR molecules for their ligands.
  • the soluble molecules of this invention can compete for binding with endogenous receptors. It is envisioned that any soluble molecule comprising a GPCR ligand binding domain that can compete with native receptors for ligand binding is a receptor blocking agent or ligand trapping agent that falls within the scope of the present invention.
  • one way to increase the circulation half- life of a protein is to ensure a reduction in the clearance of the protein, in particular via renal clearance and receptor-mediated clearance.
  • This may be achieved by conjugating the protein to a chemical moiety which is capable of increasing the apparent size, thereby reducing renal clearance and increasing the in vivo half-life.
  • attachment of a chemical moiety to the protein may effectively block proteolytic enzymes from physical contact with the protein, thus preventing degradation by non-specific proteolysis.
  • Polyethylene glycol (PEG) is one such chemical moiety that has been used in the preparation of therapeutic protein products.
  • G-CSF molecule modified with a single, N-terminally linked 20 kDa PEG group (Neulastam) was approved for sale in the United States.
  • This PEGylated G-CSF molecule has been shown to have an increased half-life compared to non-PEGylated G-CSF and thus may be administered less frequently than current G-CSF products, but it does not reduce the duration of neutropenia significantly compared to non-PEGylated G-CSF.
  • PEG modification is important for pharmaceutical and biotechnological applications.
  • PEGylation the covalent attachment of PEG leads for example to shielding of antigenic or immunogenic epitopes. Moreover, it reduces receptor-mediated uptake by the reticuloendothelial system or prevents recognition and degradation by proteolytic enzymes. PEGylation of proteins has been shown to increase their bioavailability by reducing the renal filtration.
  • conjugate is intended to indicate a heterogeneous molecule formed by the covalent attachment of one or more polypeptides, typically a single polypeptide, to one or more non-polypeptide moieties such as polymer molecules, lipophilic compounds, carbohydrate moieties or organic derivatizing agents.
  • covalent attachment means that the polypeptide and the non-polypeptide moiety are either directly covalently joined to one another, or else are indirectly covalently joined to one another through an intervening moiety or moieties, such as a bridge, spacer, or linkage moiety or moieties.
  • the conjugate is soluble at relevant concentrations and conditions, i.e., soluble in physiological fluids such as blood.
  • compositions and methods for preparing a conjugate of the invention are described in U.S. Patent 6,831,158, which is incorporated herein by reference in its entirety.
  • the methods described in U.S. Patent 6,831,158 are directed to conjugation of G-CSF, but can be readily adapted to conjugation of the sGPCRs of the present invention.
  • the "polymer molecule” is a molecule formed by covalent linkage of two or more monomers.
  • the term “polymer” may be used interchangeably with the term “polymer molecule”.
  • the term is intended to cover carbohydrate molecules including carbohydrate molecules attached to the polypeptide by in vivo N- or O-glycosylation, such molecule is also referred to as "an oligosaccharide moiety".
  • attachment group is intended to indicate an amino acid residue group of the polypeptide capable of coupling to the relevant non-polypeptide moiety.
  • a frequently used attachment group is the ⁇ -amino group of lysine or the N-terminal amino group.
  • Other polymer attachment groups include a free carboxylic acid group (e.g., that of the C-terminal amino acid residue or of an aspartic acid or glutamic acid residue), suitably activated carbonyl groups, oxidized carbohydrate moieties and mercapto groups.
  • Useful attachment groups and their matching non-peptide moieties are exemplified in Table 2.
  • amino acid sequence variants of a polypeptide can be prepared. These may, for instance, be minor sequence variants of polypeptides that arise due to natural variation within the population or they may be homologs found in other species. They also may be sequences that do not occur naturally but that are sufficiently similar that they function similarly and/or elicit an immune response that cross-reacts with natural forms of the polypeptide. Sequence variants can be prepared by standard
  • Amino acid sequence variants of the polypeptide can be substitutional, insertional, or deletion variants.
  • Deletion variants lack one or more residues of the native protein which are not essential for function or immunogenic activity, and are exemplified by the variants of a receptor lacking a transmembrane sequence.
  • substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and may be designed to modulate one or more properties of the polypeptide such as stability against proteolytic cleavage or immunogenicity. Substitutions preferably are conservative, that is, one amino acid is replaced with one of similar shape and charge.
  • Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.
  • Insertional variants include fusion proteins such as those used to allow rapid purification of the polypeptide and also can include hybrid proteins containing sequences from other proteins and polypeptides.
  • an insertional variant could include portions of the amino acid sequence of a polypeptide from one species, together with portions of the homologous polypeptide from another species.
  • Other insertional variants can include those in which additional amino acids are introduced within the coding sequence of the polypeptide, for example a protease cleavage site(s) may be introduced.
  • Modification and changes may be made in the structure of a polynucleotide and still obtain a functional molecule that encodes a protein or polypeptide with desirable characteristics.
  • the following is a discussion based upon changing the amino acids of a protein to create an equivalent, or even an improved, second-generation molecule.
  • the amino acid changes may be achieved by changing the codons of the DNA sequence, according to the following data.
  • certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules. Since it is the interactive capacity and nature of a protein that defines that protein's biological activity certain amino acid substitutions can be made in a protein sequence still obtain a protein with like properties.
  • an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent and immunologically equivalent protein.
  • substitution of amino acids whose hydrophilicity values are within ⁇ 2 is preferred, those that are within ⁇ 1 are particularly preferred, and those within ⁇ 0.5 are even more particularly preferred.
  • Site-specific mutagenesis is a technique useful in the preparation of individual peptides, or biologically functional equivalent proteins or peptides, through specific mutagenesis of the underlying DNA.
  • the technique further provides a ready ability to prepare and test sequence variants, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA.
  • the technique of site-specific mutagenesis is well known in the art.
  • the technique typically employs a bacteriophage vector that exists in both a single stranded and double stranded form.
  • Typical vectors useful in site-directed mutagenesis include vectors such as the M 13 phage.
  • phage vectors are commercially available and their use is generally well known to those skilled in the art.
  • Double stranded plasmids are also routinely employed in site-directed mutagenesis, which eliminates the step of transferring the gene of interest from a phage to a plasmid.
  • sequence variants of a GPCR including but not limted to sCRFR2 ⁇ , polynucleotide using site-directed mutagenesis is provided as a means of producing potentially useful species, i.e., species with altered ligand binding properties that include an increased affinity for a particular ligand, and is not meant to be limiting, as there are other ways in which sequence variants of nucleic acids may be obtained.
  • recombinant vectors encoding the desired gene may be treated with mutagenic agents, such as hydroxylamine, to obtain sequence variants.
  • mutagenic agents such as hydroxylamine
  • the polynucleotides of the invention in particular 100, 150, 200 250, 300, 400, 450, 500, 550 or more contiguous nucleotides of the DNA encoding a GPCR, a family B GPCR, a family Bl GPCR, or a polynucleotide that is 70, 75, 80, 85, 90, 95, 98, or 100% identical to the sequence specified in the accompaning sequence listing, e.g., SEQ ID NO:1, 3, 5, 7, 9, 11, 13, or 14 can be expressed as encoded peptides or proteins.
  • the DNA encodes all or part of a GPCR extracellular domain and in particular an amino terminal extracellular domain.
  • DNA segment(s) for expression in a prokaryotic or eukaryotic system may be performed by techniques generally known to those of skill in recombinant expression. It is believed that virtually any expression system may be employed in the expression of the claimed nucleic acid sequences.
  • the present invention concerns novel compositions comprising at least one proteinaceous molecule, such as sGPCR, asCRFR, or a sCRFR2.
  • a "proteinaceous molecule,” “proteinaceous composition,” “proteinaceous compound,” “proteinaceous chain” or “proteinaceous material” generally refers, but is not limited to, a protein of greater than about 200 amino acids or the full length endogenous sequence translated from a gene; a polypeptide of greater than about 100 amino acids; and/or a peptide of from about 3 to about 100 amino acids. All the “proteinaceous” terms described above may be used interchangeably herein. Furthermore, these terms may be applied to fusion proteins as well.
  • the size of the at least one proteinaceous molecule may comprise, but is not limited to, about or at least 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1750, 2000, 2250, 2500 or greater amino molecule residues, and any range derivable therein, particularly 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or more contiguous amino acid sequences of such lengths of a GPCR, a family B GPCR, a family Bl GPCR, or SEQ ID NO:2, 4, 6, 8, 10, 12
  • engineered and recombinant cells are intended to refer to a cell into which an exogenous DNA segment or polynucleotide, such as a cDNA or polynucleotide has been introduced. Therefore, engineered cells are distinguishable from naturally occurring cells which do not contain a recombinantly introduced exogenous DNA segment or gene. Engineered cells are thus cells having a gene or genes introduced through the hand of man.
  • Recombinant cells include those having an introduced cDNA or genomic DNA, and may also include genes positioned adjacent to a promoter not naturally associated with the particular introduced gene.
  • a recombinant protein or polypeptide, whether mutant or wild-type in accordance with the present invention one would prepare an expression vector that comprises one of the claimed isolated nucleic acids under the control of one or more promoters.
  • To bring a coding sequence "under the control of a promoter one positions the 5' end of the translational initiation site of the reading frame generally between about 1 and 50 nucleotides "downstream" of (i.e., 3' of) the chosen promoter.
  • the "upstream" promoter stimulates transcription of the inserted DNA and promotes expression of the encoded recombinant protein. This is the meaning of "recombinant expression” in the context used here.
  • E. coli a variety of host-expression systems.
  • Cell types available for expression include, but are not limited to, bacteria, such as E. coli, B. subtilis, E. coli strain RRl, E. coli LE392, E. coli B, E. coli ⁇ 1776 (ATCC No. 31537) as well as E. coli W3110 (F-, lambda-, prototrophic, ATCC No.
  • bacilli such as Bacillus subtilis
  • enterobacteriaceae such as Salmonella typhimurium, Serratia marcescens, and various Pseudomonas species transformed with recombinant phage DNA, plasmid DNA or cosmid DNA expression vectors.
  • polynucleotide or polynucleotide fragment encoding a polypeptide can be inserted into an expression vector by standard subcloning techniques.
  • an E. coli expression vector is used that produces the recombinant polypeptide as a fusion protein, allowing rapid affinity purification of the protein.
  • fusion protein expression systems examples include the glutathione ⁇ -transferase system (Pharmacia, Piscataway, NJ), the maltose binding-protein system (New England Biolabs, Beverley, MA), the FLAG system (IBI, New Haven, CT), and the ⁇ xHis system
  • GST glutathione S-transferase
  • the plasmid YRp7 for example, is commonly used (Stinchcomb et al, 1979; Kingsman et al, 1979; Tschemper et al, 1980).
  • This plasmid contains the t ⁇ l gene, which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, 1977).
  • the presence of the trp ⁇ lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
  • Suitable promoting sequences in yeast vectors include the promoters for
  • 3-phosphoglycerate kinase (Hitzeman et al, 1980) or other glycolytic enzymes (Hess et al, 1968; Holland et al, 1978), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokiiiase, glucose-6- phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
  • the termination sequences associated with these genes are also ligated into the expression vector 3' of the sequence desired to be expressed to provide polyadenylation of the mRNA and termination.
  • promoters which have the additional advantage of transcription controlled by growth conditions, include the promoter region for alcohol dehydrogenase
  • isocytochrome C isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.
  • cultures of cells derived from multicellular organisms may also be used as hosts.
  • any such cell culture is workable, whether from vertebrate or invertebrate culture including mammalian and insect cells (e.g., U.S. Patent No. 4,215,051).
  • Examples of useful mammalian host cell lines are VERO and HeLa cells,
  • CHO Chinese hamster ovary
  • WI38 Chinese hamster ovary
  • BHK BHK
  • COS-7 293, HepG2, NIH3T3, RIN and MDCK cell lines.
  • a host cell may be chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products maybe important for the function of the encoded protein.
  • Specific initiation signals may also be required for efficient translation of the claimed isolated nucleic acid coding sequences. These signals include the ATG initiation codon and adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may additionally need to be provided. One of ordinary skill in the art would readily be capable of determining this need and providing the necessary signals. It is well known that the initiation codon must be in-frame (or in- phase) with the reading frame of the desired coding sequence to ensure translation of the entire insert. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements or transcription terminators (Bittner et al,
  • telomeres For long-term, high-yield production of recombinant proteins, stable expression is preferred.
  • cell lines that stably express constructs encoding G-proteins may be engineered.
  • host cells can be transformed with vectors controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
  • appropriate expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
  • engineered cells may be allowed to grow for 1-2 days in an enriched medium, and then are switched to a selective medium.
  • the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci, which in turn can be cloned and expanded into cell lines.
  • a number of selection systems may be used, including, but not limited, to the herpes simplex virus thymidine kinase (Wigler et al, 1977), hypoxanthine-guanine phosphoribosyltransferase (Szybalska et al, 1962) and adenine phosphoribosyltransferase genes (Lowy et al, 1980), in tk ⁇ , hgprf or aprf cells, respectively.
  • antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler et al, 1980; O'Hare et al, 1981); gpt, which confers resistance to mycophenolic acid (Mulligan et al, 1981); neo, which confers resistance to the aminoglycoside G-418 (Colbere-Garapin et al, 1981); and hygro, which confers resistance to hygromycin. 21
  • the polynucleotide sequence coding a particular polypeptide can be inserted into an appropriate expression system.
  • the inventors contemplate a polynucleotide encoding a sGPCR ligand binding domain polypeptide.
  • the polynucleotide can be expressed in any number of different recombinant DNA expression systems to generate large amounts of the polypeptide product, which can then be purified and/or isolated to be used as a therapeutic or to vaccinate animals to generate antisera, or in certain aspects of the invention as an antagonist of GPCR ligand and/or GPCR activation.
  • sGPCRs of the invention can be used in methods to detect, screen, or identify ligands, receptors, or agonist and/or antagonist of GPCRs.
  • a polynucleotide of the invention may be expressed to obtain a GPCR ligand binding domain, a family B GPCR ligand binding domain, a family Bl GPCR ligand binding domain, a sCRFR ligand binding domain or a CRFR2 ligand binding domain polypeptide comprising an amino acid sequence including all or part of the amino acid sequence as set forth in the sequence listing, e.g., SEQ ID NO:2, 4, 6, 8, 10, 12, or 15.
  • synthetic peptides corresponding to the polypeptides of the invention can be prepared, including antigenic peptides.
  • antigenic peptides are at least six amino acid residues long, and may contain up to approximately 35 residues.
  • Automated peptide synthesis machines include those available from Applied Biosystems (Foster City, CA). Use of such small peptides for vaccination typically requires conjugation of the peptide to an immunogenic carrier protein such as hepatitis B surface antigen, keyhole limpet hemocyanin or bovine serum albumin. Methods for performing this conjugation are well known in the art.
  • purification of Expressed Proteins Further aspects of the present invention concern the purification for isolation, and in particular embodiments, the substantial purification, of a protein or peptide comprising all or part of a sGPCR ligand binding domain.
  • the term "purified or isolated protein or peptide" as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein, polypeptide or peptide is purified to any degree relative to its naturally-obtainable state, i.e., in this case, relative to its purity within a organism or tissue.
  • a purified or isolated protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur.
  • a purified or isolated protein or polypeptide may have a purity greater than or at least 70, 75, 80, 85, 90, 95, 98, or 99% purity.
  • purified will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed activity. Where the term “substantially purified” is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50% or more of the proteins in the composition.
  • a preferred method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a "-fold purification number.”
  • the actual units used to represent the amount of activity, which may include binding activity or affinity, will, of course, be dependent upon the particular assay technique chosen.
  • Various techniques suitable for use in protein purification will be well known to those of skill in the art.
  • Partial purification may be accomplished by using fewer purification steps in combination, or by utilizing different 21
  • an antibody preparation is contemplated that recognizes or binds the c-terminus of a GPCR, particularly a splice variant such as a sCRFR2 ⁇ splice variant and thus can be used to distingush a sGPCR polypeptide from a membrane associated receptor.
  • Such antibodies may be used in any of a variety of applications known to those of skill in the art, including but not limited to: immunodetection methods, immunoprecipitation methods, ELISA assays, protein purification methods, etc. Means for preparing and characterizing antibodies are well known in the art ⁇ See, e.g., Harlow and Lane, 1988, incorporated herein by reference).
  • a polyclonal antibody is prepared by immunizing an animal with an antigenic composition and collecting antisera from that immunized animal.
  • an antigenic composition A wide range of animal species can be used for the production of antisera.
  • the animal used for production of antisera is a rabbit, a mouse, a rat, a hamster, a guinea pig, a horse, or a goat. Because of the relatively large blood volume of rabbits, a rabbit is a preferred choice for production of polyclonal antibodies.
  • a given composition may vary in its immunogenicity.
  • a peptide or polypeptide immunogen it is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier.
  • exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA).
  • KLH keyhole limpet hemocyanin
  • BSA bovine serum albumin
  • Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin can also be used as carriers.
  • Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, 21
  • the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants.
  • adjuvants include complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvants and aluminum hydroxide adjuvant.
  • Monoclonal antibodies may be readily prepared through use of well- known techniques, such as those exemplified in U.S. Patent 4,196,265, incorporated herein by reference.
  • this technique involves immunizing a suitable animal with a selected immunogen composition, e.g., a purified or partially purified expressed protein, polypeptide or peptide.
  • the immunizing composition is administered in a manner that effectively stimulates antibody producing cells.
  • the animals are injected with antigen as described above.
  • somatic cells with the potential for producing antibodies specifically B lymphocytes (B cells) are selected for use in the MAb generating protocol.
  • B cells B lymphocytes
  • a panel of animals will have been immunized and the spleen of the animal with the highest antibody titer will be removed and the spleen lymphocytes obtained by homogenizing the spleen with a syringe.
  • the antibody-producing B lymphocytes from the immunized animal are then fused with cells of an immortal myeloma cell, generally one of the same species as the animal that was immunized.
  • Myeloma cell lines suited for use in hybridoma-producing fusion procedures preferably are non-antibody-producing, have high fusion efficiency, and have enzyme deficiencies that render them incapable of growing in certain selective media that support the growth of only the desired fused cells (hybridomas). Any one of a number of myeloma cells may be used, as are known to those of skill in the art (Goding, 1986).
  • the immunized animal is a mouse
  • rats one may use R210.RCY3, Y3-Ag 1.2.3, IR983F and 4B210; and U-266, GM1500-GRG2, LICR-LON-HMy2 and UC729-6 are all useful in connection with human cell fusions.
  • 006/004321
  • NS-I myeloma cell line (also termed
  • mouse myeloma cell line that may be used is the 8-azaguanine-resistant mouse murine myeloma SP2/0 non-producer cell line.
  • Monoclonal antibodies of the present invention may also be obtained by multiplying hybridoma cells in vivo.
  • Cell clones are injected into mammals that are histocompatible with the parent cells, e.g., syngeneic mice, to cause growth of antibody-producing tumors.
  • the animals are primed with a hydrocarbon, especially oils such as pristane (tetramethylpentadecane) prior to injection.
  • fragments of a monoclonal antibody can be obtained by methods which include digestion with enzymes such as pepsin or papain and/or cleavage of disulfide bonds by chemical reduction.
  • monoclonal antibody fragments encompassed by the present invention can be synthesized using an automated peptide synthesizer, or by expression of full-length polynucleotide or of polynucleotide fragments encoding all or part of Mab.
  • Antibody conjugates may be prepared by methods known in the art, e.g., by reacting an antibody with an enzyme in the presence of a coupling agent such as glutaraldehyde or periodate. Conjugates with fluorescein markers are prepared in the presence of these coupling agents or by reaction with an isothiocyanate. Conjugates with metal chelates are similarly produced. Other moieties to which antibodies may be conjugated include radionuclides such as 3 H, 125 1, 131 1 32 P, 35 S, 14 C, 51 Cr, 36 Cl, 57 Co, 58 Co, 59 Fe, 75 Se, 152 Eu, and 99m Tc. Radioactively labeled antibodies of the present invention can be produced according to well-known methods.
  • antibodies can be iodinated by contact with sodium or potassium iodide and a chemical oxidizing agent such as sodium hypochlorite, or an enzymatic oxidizing agent, such as lactoperoxidase.
  • Antibodies according to the invention may be labeled with technetium- 99 by ligand exchange process, for example, by reducing pertechnate with stannous solution, chelating the reduced technetium onto a Sephadex column and applying the antibody to this column or by direct labelling techniques, e.g., by incubating pertechnate, a reducing agent such as SnCl 2 , a buffer solution such as sodium-potassium phthalate solution, and the antibody.
  • a reducing agent such as SnCl 2
  • a buffer solution such as sodium-potassium phthalate solution
  • the present invention includes nucleic acids that encode all or part of a sGPCR, such as but not limited to a GPCR, a family B GPCR, a family Bl GPCR, a CRFR, or a CRFR2 polypeptide, and may include various nucleic acid sequences needed for delivery of the nucleic acid sequence as well as the transcription and/or translation of the nucleic acid seqeunce.
  • a sGPCR such as but not limited to a GPCR, a family B GPCR, a family Bl GPCR, a CRFR, or a CRFR2 polypeptide
  • Nucleic acid molecules of the invention may include various contiguous stretches of the nucleic acid, for example about 10, 15, 17, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, 1000, 1250, 1500, 1750, 2000, 2100, including all or part of the full length nucleic acid sequences in the sequence listing, e.g., SEQ ID NO:1, 3, 5, 7, 9, 11, 13, or 14, or polynucleotides of those GPCRs referenced herein, fragments thereof, mRNAs, or cDNAs comprising sequences described or referenced herein, and mutants of each are contemplated. Also contemplated are molecules that are complementary to the above mentioned sequences and that bind to these sequences under high stringency conditions. These probes will be useful in a variety of hybridization embodiments, such as Southern and northern blotting.
  • probes and primers can be designed around the disclosed nucleotide sequences.
  • Primers may be of any length but, typically, are 10-20 bases in length.
  • the probe or primer can be used to identify or screen for the presence of an alternatively spliced form of a GPCR, such as but not limited to the CRFR2 gene that includes an exon 5/exon 7 splice junction (may also be described as an exon 3/exon 5 juction as it relates to CRFR2 ⁇ transcrition).
  • These probes or primers may either hybridize unique sequence of the engineered nulceic acid or splice junction, or amplify a nucleic acid characteristic of the engineered nucleic acid or the splice junction.
  • n to n + y where n is an integer from 1 to the last number of the sequence and y is the length of the primer minus one, where n + y does not exceed the last number of the sequence.
  • the probes correspond to bases 1 to 10, 2 to 11, 3 to 12 ... and so on.
  • the probes correspond to bases 1 to 15, 2 to 16, 3 to 17 ... and so on.
  • the probes correspond to bases 1 to 20, 2 to 21, 3 to 22 ... and so on.
  • the nucleic acid seqeunces of the invention may be used to encode various polypeptides described herein.
  • the nucleic acid sequences may be used as hybridization probes or amplification primers.
  • these probes and primers consist of oligonucleotide fragments. Such fragments should be of sufficient length to provide specific hybridization to an RNA or DNA sample extracted from tissue.
  • the sequences typically will be 10-20 nucleotides, but may be longer. Longer sequences, e.g., 40, 50, 100, 500 and even up to full length, are preferred for certain embodiments.
  • hybridization probe of between 17 and 100 nucleotides in length allows the formation of a duplex molecule that is both stable and selective.
  • Molecules having complementary sequences over stretches greater than 20 bases in length are generally preferred, in order to increase stability and selectivity of the hybrid, and thereby improve the quality and degree of particular hybrid molecules obtained.
  • Such fragments may be readily prepared by, for example, directly synthesizing the fragment by chemical means or by introducing selected sequences into recombinant vectors for recombinant production.
  • nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of genes, polynucleotides or RNAs, or to provide primers for amplification of DNA or RNA from tissues.
  • relatively stringent or high stringency conditions For applications requiring high selectivity, one will typically desire to employ relatively stringent or high stringency conditions to form the hybrids, e.g., one will select relatively low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 50°C to about 70°C.
  • relatively low salt and/or high temperature conditions such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 50°C to about 70°C.
  • Such high stringency conditions tolerate little, if any, mismatch between the probe and the template or target strand, and would be particularly suitable for isolating specific genes or detecting specific mRNA transcripts. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.
  • nucleic acid sequences of the present invention in combination with an appropriate means of detection, such as a fluorescent or radiolabel, for determining hybridization.
  • an appropriate means of detection such as a fluorescent or radiolabel
  • appropriate indicator means include fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of being detected.
  • nucleic acid segments of the present invention are incorporated into expression vectors, such as plasmids, cosmids or viral polynucleotides
  • these segments may be combined with other DNA sequences, such as promoters, polyadenylation signals, restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol.
  • DNA segments encoding a specific polynucleotide may be introduced into recombinant host cells and employed for expressing a sGPCR, such as but not limited to a sCRFR2 ⁇ polypeptide.
  • a sGPCR such as but not limited to a sCRFR2 ⁇ polypeptide.
  • subportions or derivatives of selected polynucleotides may be employed.
  • expression construct is meant to include any type of genetic construct containing a nucleic acid having a sequence defining a product, such as but not limited to a product encoding a polypeptide, in which part or all of the nucleic acid sequence is capable of being transcribed.
  • the transcript may be translated into a protein, but it need not be.
  • expression includes both transcription of a polynucleotide and translation of a RNA into a polypeptide product.
  • the nucleic acid is under transcriptional control of a promoter.
  • a “promoter” refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide.
  • under transcriptional control means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the polynucleotide.
  • the term promoter will be used here to refer to a group of transcriptional control modules that are clustered around the initiation site for a RNA polymerase, in particular RNA polymerase II. In certain aspects, at least one module in each promoter functions to position the start site for RNA synthesis.
  • TATA box in some promoters lacking a TATA box, such as the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation.
  • the particular promoter that is employed to control the expression of a nucleic acid is not believed to be critical, so long as it is capable of expressing the nucleic acid in the targeted cell.
  • a human cell it is preferable to position the nucleic acid coding region adjacent to and under the control of a promoter that is capable of being expressed in a human cell.
  • a promoter might include either a human or viral promoter.
  • the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter and the Rous sarcoma virus long terminal repeat can be used to obtain high-level expression of transgenes.
  • EPDB could also be used to drive expression of a polynucleotide.
  • T3, T7 or SP6 cytoplasmic expression system is another possible embodiment.
  • Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.
  • Use of the baculovirus system will involve high level expression from the powerful polyhedrin promoter.
  • Promoters include, but are not limited to Immunoglobulin Heavy Chain, Immunoglobulin Light Chain, T-CeIl Receptor, HLA DQ ⁇ and DQ ⁇ , ⁇ -Interferon, Interleukin-2, Interleukin-2 Receptor, MHC Class II 5, MHC Class II HLA-DR ⁇ , ⁇ - Actin, Muscle Creatine Kinase, Prealbumin (Transthyretin), Elastase /, Metallothionein, Collagenase, Albumin Gene, ⁇ -Fetoprotein, ⁇ -Globin, ⁇ -Globin, c-fos, c-HA-ras, Insulin, Neural Cell Adhesion Molecule (NCAM), ⁇ i-Anti-trypsin, H2B (TH2B) Histone, Mouse or Type I Collagen, Glucose-Regulated Proteins (GRP94 and GRP78), Rat Growth Hormone, Human Serum Amyloid A (SAA),
  • Various element include, but are not limited to MT II (Phorbol Ester (TPA)Heavy metals); MMTV (Glucocorticoids, ⁇ -Interferon, poly(rI)X, poly(rc)); Adenovirus 5 E2 (EIa); c-jun (Phorbol Ester (TPA), H 2 O 2 ); Collagenase (Phorbol Ester (TPA)); Stromelysin (Phorbol Ester (TPA), IL-I); SV40 (Phorbol Ester (TPA)); Murine MX Gene (Interferon, Newcastle Disease Virus); GRP78 Gene (A23187); ⁇ -2- Macroglobulin (IL-6); Vimentin (Serum); MHC Class I Gene H-2kB (Interferon); HSP70 (EIa, SV40 Large T Antigen); Proliferin (Phorbol Ester-TPA); Tumor Necrosis Factor (FMA); and Thyroid
  • polyadenylation signal to effect proper polyadenylation of the transcript.
  • the nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed.
  • Preferred embodiments include the SV40 polyadenylation signal and the bovine growth hormone polyadenylation signal, convenient and known to function well in various target cells.
  • a terminator as an element of an expression cassette. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
  • an expression construct may comprise a virus or engineered construct derived from a viral genome.
  • the first viruses used as vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986) and adeno-associated viruses. Retroviruses also are attractive gene transfer vehicles (Nicolas and Rubenstein, 1988; Temin, 1986) as are vaccina virus (Ridgeway, 1988) and adeno-associated virus (Ridgeway, 1988). Such vectors may be used to (i) transform cell lines in vitro for the 21
  • the sGPCR encoding nucleic acids employed may actually encode antisense constructs that hybridize, under intracellular conditions, to a sGPCR or other encoding nucleic acid.
  • antisense construct is intended to refer to nucleic acids, preferably oligonucleotides, complementary to the base sequences of a target DNA or RNA.
  • nucleic acid sequences that are substantially complementary over their entire length and have very few base mismatches.
  • nucleic acid sequences of fifteen bases in length may be termed complementary when they have a complementary nucleotide at thirteen or fourteen positions with only a single mismatch.
  • nucleic acid sequences which are "completely complementary” will be nucleic acid sequences which are entirely complementary throughout their entire length and have no base mismatches.
  • One embodiment of the instant invention comprises a method for identification of sGPCR nucleic acid, such as but not limited to CRFR2 ⁇ nucleic acids, in a biological sample by amplifying and detecting nucleic acids corresponding to sGPCR.
  • the biological sample can be any tissue or fluid in which the polynucleotide might be present.
  • Nucleic acid used as a template for amplification is isolated from cells contained in the biological sample, according to standard methodologies (Sambrook et al. , 1989).
  • the nucleic acid may be fractionated or whole cell RNA.
  • Pairs of primers that selectively hybridize to nucleic acids corresponding to sGPCR are contacted with the isolated nucleic acid under conditions that permit selective hybridization.
  • the nucleic acid:primer complex is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis.
  • Multiple rounds of amplification, also referred to as "cycles,” are conducted until a sufficient amount of amplification product is produced.
  • the amplification products may be detected. In certain applications, the detection may be performed by visual means. Alternatively, the detection may involve indirect identification of the product via chemiluminescence, radioactive scintigraphy of incorporated radiolabel or fluorescent 21
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • U.S. Patent 4,883,750 describes a method similar to LCR for binding probe pairs to a target sequence.
  • Qbeta Replicase described in PCT Application No. PCT7US87/00880, may be used as still another amplification method in the present invention.
  • An isothermal amplification method in which restriction endonucleases and ligases are used to achieve the amplification of target molecules that contain nucleotide 5'-[alpha-thio]- triphosphates in one strand of a restriction site may also be useful in the amplification of nucleic acids in the present invention, Walker et al, (1992), incorporated herein by reference in its entirety. Still further, Strand Displacement Amplification (SDA) is another method of carrying out isothermal amplification of nucleic acids which involves multiple rounds of strand displacement and synthesis, i.e., nick translation.
  • SDA Strand Displacement Amplification
  • RCR Repair Chain Reaction
  • CPR cyclic probe reaction
  • nucleic acid amplification procedures include transcription- based amplification systems (TAS), including nucleic acid sequence based amplification (NASBA) and 3SR (Kwoh et al, 1989); PCT Application WO 88/10315, incorporated herein by reference in their entirety).
  • TAS transcription- based amplification systems
  • NASBA nucleic acid sequence based amplification
  • 3SR Kiwoh et al, 1989
  • PCT Application WO 88/10315 PCT Application WO 88/10315, incorporated herein by reference in their entirety.
  • amplification products are separated by agarose, agarose-acrylamide or polyacrylamide gel electrophoresis using standard methods. See Sambrook et al. , 1989.
  • Chromatographic techniques may be employed to effect separation.
  • chromatography There are many kinds of chromatography which may be used in the present invention: adsorption, partition, ion-exchange and molecular sieve, and many specialized techniques for using them including column, paper, thin-layer and gas chromatography (Freifelder, 1982).
  • RESULTS FOR sGPCR GENE EXPRESSION hi one embodiment of the present invention there are provided methods for increased sGPCR expression in a cell, such as but not limited to sCRFR2 ⁇ expression. This is particularly useful where there is an aberration in the protein or protein expression is not sufficient for normal function. This will allow for the alleviation of symptoms of disease experienced as a result of deficiency of sGPCR, hyperactivation of GPCR or an abundance of GPCR ligand.
  • the general approach to increasing sGPCR is to contact or administer to a cell, tissue, animal, or subject a sGPCR polypeptide. While it is preferred that the protein may be delivered directly, a conceivable embodiment involves providing a nucleic acid encoding a sGPCR polypeptide to the cell or neighboring cells. Following this provision, the sGPCR polypeptide is synthesized by the host cell's transcriptional and translational machinery, as well as any that maybe provided by the expression construct. C ⁇ -acting regulatory elements necessary to support the expression of the sGPCR polynucleotide will be provided, in the form of an expression construct. It also is possible that expression of virally-encoded sGPCR could be stimulated or enhanced, or the expressed polypeptide be stabilized, thereby achieving the same or similar effect.
  • the expression construct In order to effect expression of constructs encoding sGPCR polynucleotides, the expression construct must be delivered by a delivery vector into a cell.
  • One mechanism for delivery is via viral infection, where the expression construct is encapsidated in a viral particle which will deliver either a replicating or non-replicating nucleic acid.
  • the first viruses used as gene vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986). These have a relatively low capacity for foreign DNA sequences and have a restricted host spectrum. Furthermore, their oncogenic potential and cytopathic effects in permissive cells raise safety concerns. They can accommodate only up to 8 kb of foreign genetic material but can be readily introduced in a variety of cell lines and laboratory animals (Nicolas and Rubenstein, 1988; Temin, 1986).
  • the retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells; they can also be used as vectors.
  • Other viral vectors may be employed as expression constructs in the present invention.
  • Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988) adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska, 1984) and herpesviruses may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988; Horwich et al, 1990).
  • Non-viral methods for the transfer of expression constructs into cultured mammalian cells include calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al, 1990) DEAE-dextran (Gopal, 1985), electroporation (Tur-Kaspa et al, 1986; Potter et al, 1984), direct microinjection (Harland and Weintraub, 1985), DNA- loaded liposomes (Nicolau and Sene, 1982; Fraley et al, 1979) and lipofectamine-DNA complexes, cell sonication (Fechheimer et al, 1987), gene bombardment using high velocity microprojectiles (Yang et. al, 1990), and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988). Some of these techniques may be successfully adapted for in vivo or ex vivo use, as discussed below.
  • the expression construct may simply consist of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned above which physically or chemically permeabilize the cell membrane. This is particularly applicable for transfer in vitro, but it may be applied to in vivo use as well.
  • Another embodiment of the invention for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et ah, 1987). Several devices for accelerating small particles have been developed.
  • the expression constructs may be entrapped in a liposome.
  • Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution.
  • lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991).
  • lipofectamine-DNA complexes are also contemplated.
  • receptor-mediated delivery vehicles These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because of the cell type-specific distribution of various receptors, the delivery can be highly specific (Wu and Wu, 1993).
  • the present invention concerns formulation of one or more of the polynucleotide, polypeptide, and/or antibody compositions disclosed herein in pharmaceutically-acceptable solutions for administration to a cell, tissue, animal, patient, or subject either alone, or in combination with one or more other modalities of therapy.
  • Aqueous pharmaceutical compositions of the present invention will have an effective amount of a sGPCR expression construct, an expression construct that encodes a therapeutic gene along with sGPCR, or a sGPCR protein and/or compound that modulates GPCR ligand activity or sensititvy, or other endocrine function.
  • Such compositions generally will be dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
  • An "effective amount,” for the purposes of therapy, is 21
  • phrases "pharmaceutically or pharmacologically acceptable” refer to molecular entities and compositions that do not produce a significant adverse, allergic or other untoward reaction when administered to an animal, or human.
  • pharmaceutically or pharmacologically acceptable refer to molecular entities and compositions that do not produce a significant adverse, allergic or other untoward reaction when administered to an animal, or human.
  • “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients, its use in the therapeutic compositions is contemplated.
  • other pharmaceutically acceptable forms include, e.g., tablets or other solids for oral administration; time release capsules; and any other form currently used, including creams, lotions, inhalants and the like.
  • the active compounds of the present invention will often be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, subcutaneous, or even intraperitoneal routes.
  • parenteral administration e.g., formulated for injection via the intravenous, intramuscular, subcutaneous, or even intraperitoneal routes.
  • the preparation of an aqueous composition that contains sGPCR alone or in combination with a conventional therapeutic agent as active ingredients will be known to those of skill in the art in light of the present disclosure.
  • such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier also can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, tbimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • solutions Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, with even drug release capsules and the like being employable.
  • aqueous solutions For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
  • sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure.
  • one dosage could be dissolved in 1 mL of isotonic NaCl solution and either added to 1000 mL of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences” (1980)).
  • the route the therapeutic composition is administered may be by parenteral administration.
  • the parenteral administration may be intravenous injection, subcutaneous injection, intramuscular injection, intramedullary injection, ingestion or a combination thereof.
  • the composition comprising sGPCR is administered from about 0.1 to about 10 microgram/kg/body weight per dose. In certain aspects, the composition comprising sGPCR is administered from about 1 to about 5 microgram/kg/body weight per dose. In certain aspects, the composition comprising sGPCR is administered from about 1.2 to about 3.6 microgram/kg/body weight per dose.
  • the composition comprising sGPCR is administered from about 1.2 to about 2.4 microgram/kg/body weight per dose.
  • the amount of sGPCR administered per dose may be about 0. 1, about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1. 4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.
  • alimentary delivery refers to the administration, directly or otherwise, to a portion of the alimentary canal of an animal.
  • the term “alimentary canal” refers to the tubular passage in an animal that functions in the digestion and absorption of food and the elimination of food residue, which runs from the mouth to the anus, and any and all of its portions or segments, e.g., the oral cavity, the esophagus, the stomach, the small and large intestines and the colon, as well as compound portions thereof such as, e.g., the gastro-intestinal tract.
  • the term “alimentary delivery” encompasses several routes of administration including, but not limited to, oral, rectal, endoscopic and sublingual/buccal administration. A common requirement for these modes of administration is absorption over some portion or all of the alimentary tract and a need for efficient mucosal penetration of the nucleic acid(s) so administered.
  • compositions disclosed herein may be delivered via oral administration to an animal, patient, or subject.
  • these compositions may be formulated with an inert diluent or with an assimilable edible carrier, or they may be enclosed in hard- or soft- shell gelatin capsule, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet.
  • the active components may even be incorporated with excipients and used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and the like (Mathiowitz et al, 1997; Hwang et al, 1998; U.S. Patents
  • the tablets, troches, pills, capsules and the like may also contain the following: a binder, as gum tragacanth, acacia, cornstarch, or gelatin; excipients, such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid and the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin may be added or a flavoring agent, such as peppermint, oil of wintergreen, or cherry flavoring.
  • a binder as gum tragacanth, acacia, cornstarch, or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as corn starch, potato starch, alginic acid and the like
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, lactose or saccharin may be added or a flavor
  • the dosage unit form When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar, or both.
  • a syrup of elixir may contain the active component sucrose as a sweetening agent methyl and propylparabens as preservatives, a dye and flavoring, such as cherry or orange flavor.
  • any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed.
  • the active compounds may be incorporated into sustained-release preparation and formulations.
  • these formulations may contain at least about 0.1% of the active compound or more, although the percentage of the active ingredient(s) may, of course, be varied and may conveniently be between about 1 or 2% and about 60% or 70% or more of the weight or volume of the total formulation.
  • the amount of active compound(s) in each therapeutically useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
  • Therapeutics administered by the oral route can often be alternatively administered by the lower enteral route, i.e., through the anal portal into the rectum or lower intestine. Rectal suppositories, retention enemas or rectal catheters can be used for this purpose and may be preferred when patient compliance might a otherwise be difficult to achieve ⁇ e.g., in pediatric and geriatric applications, or when the patient is vomiting or unconscious). Rectal administration may result in more prompt and higher blood levels than the oral route, but the converse may be true as well (Harvey, 1990). Because about 50% of the therapeutic that is absorbed from the rectum will bypass the liver, administration by this route significantly reduces the potential for first-pass metabolism (Benet et al, 1996).
  • parenteral delivery refers to the administration of a therapeutic of the invention to an animal, patient or subject in a manner other than through the digestive canal. Means of preparing and administering parenteral pharmaceutical compositions are known in the art (see, e.g., Avis, 1990). C. Intraluminal administration
  • Intraluminal administration for the direct delivery of a therapeutic to an isolated portion of a tubular organ or tissue (e.g., such as an artery, vein, ureter or urethra), may be desired for the treatment of patients with diseases or conditions afflicting the lumen of such organs or tissues.
  • a catheter or cannula is surgically introduced by appropriate means. After isolation of a portion of the tubular organ or tissue for which treatment is sought, a composition comprising a therapeutic of the invention is infused through the cannula or catheter into the isolated segment.
  • compositions of the invention may also be combined with a biocompatible matrix, such as a hydrogel material, and applied directly to vascular tissue in vivo.
  • a biocompatible matrix such as a hydrogel material
  • Intraventricular administration for the direct delivery of a therapeutic to the brain of a patient, maybe desired for the treatment of patients with diseases or conditions afflicting the brain.
  • a silicon catheter is surgically introduced into a ventricle of the brain of a human patient, and is connected to a subcutaneous infusion pump (Medtronic Inc., Minneapolis, Minn.) that has been surgically implanted in the abdominal region (Zimm et al, 1984; Shaw, 1993).
  • the pump is used to inject the therapeutic and allows precise dosage adjustments and variation in dosage schedules with the aid of an external programming device.
  • the reservoir capacity of the pump is 18-20 mL and infusion rates may range from 0.1 mL/h to 1 mL/h.
  • the pump reservoir may be refilled at 3-10 week intervals. Refilling of the pump may be accomplished by percutaneous puncture of the self-sealing septum of the pump.
  • Intrathecal drug administration for the introduction of a therapeutic into the spinal column of a patient may be desired for the treatment of patients with diseases of the central nervous system.
  • a silicon catheter may be surgically implanted into the L3-4 lumbar spinal interspace of a human patient, and is connected to a subcutaneous infusion pump which has been surgically implanted in the upper abdominal region (Luer and Hatton, 1993; Ettinger et al, 1978; Yaida et al, 1995).
  • the pump is used to inject the therapeutic and allows precise dosage adjustments and variations in dose schedules with the aid of an external programming device.
  • the reservoir capacity of the pump is 18-20 mL, and infusion rates may vary from 0.1 mL/h to 1 mL/h.
  • the pump reservoir may be refilled at 3 - 10 week intervals. Refilling of the pump is accomplished by a single percutaneous puncture to the self- sealing septum of the pump.
  • the silicon catheter is configured to connect the subcutaneous infusion pump to, e.g., the hepatic artery, for delivery to the liver (Kemeny et al , 1993).
  • Vaginal delivery provides local treatment and avoids first pass metabolism, degradation by digestive enzymes, and potential systemic side-effects.
  • Vaginal suppositories (Block, Chapter 87 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 1609-1614) or topical ointments can be used to effect this mode of delivery.
  • compositions of the present invention may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.
  • Such formulations may be preferred for the introduction of pharmaceutically- acceptable formulations of the nucleic acids or constructs disclosed herein.
  • liposomes are generally known to those of skill in the art (see for example, Couvreur et al, 1977; Lasic, 1998; which describes the use of liposomes and nanocapsules in the targeted antibiotic therapy for intracellular bacterial infections and diseases).
  • liposomes were developed with improved serum stability and circulation half-times (Gabizon and Papahadjopoulos, 1988; Allen and Choun, 1987; U.S. Patent 5,741,516, specifically incorporated herein by reference in its entirety).
  • Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also termed multilamellar vesicles (MLVs).
  • MLVs generally have diameters of from 25 nm to 4 ⁇ m.
  • Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 A, containing an aqueous solution in the core.
  • SUVs small unilamellar vesicles
  • liposomes The fate and disposition of intravenously injected liposomes depend on their physical properties, such as size, fluidity, and surface charge. They may persist in tissues for h or days, depending on their composition, and half lives in the blood range from min to several h. Larger liposomes, such as MLVs and LUVs, are taken up rapidly by phagocytic cells of the reticuloendothelial system, but physiology of the circulatory system restrains the exit of such large species at most sites. They can exit only in places where large openings or pores exist in the capillary endothelium, such as the sinusoids of the liver or spleen. Thus, these organs are the predominate site of uptake.
  • MLVs and LUVs are taken up rapidly by phagocytic cells of the reticuloendothelial system, but physiology of the circulatory system restrains the exit of such large species at most sites. They can exit only in places where large openings or pores exist in the ca
  • SUVs show a broader tissue distribution but still are sequestered highly in the liver and spleen, hi general, this in vivo behavior limits the potential targeting of liposomes to only those organs and tissues accessible to their large size. These include the blood, liver, spleen, bone marrow, and lymphoid organs.
  • the invention provides for phaimaceutically-acceptable nanocapsule formulations of the compositions of the present invention.
  • Nanocapsules can generally entrap compounds in a stable and reproducible way (Henry-Michelland et al., 1987; Quintanar-Guerrero et al., 1998; Douglas et al., 1987).
  • ultrafine particles sized around 0.1 ⁇ m
  • Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use in the present invention.
  • Such particles may be are easily made, as described (Couvreur et al., 1980; 1988; zur Muhlen et al., 1998; Zambaux et al. 1998; Pinto- Alphandry et al. , 1995 and U.S. Pat. No. 5,145,684, specifically incorporated herein by reference in its entirety).
  • PCR primers were designed based on the homology between known mammalian CRFR2 genes. The following oligonucleotide primers, 5' CCCCGAAGCTGCCCGACTGG 3' (SEQ ID NO: 16) (sense) and 5' GGAAGGCTGTAAAGGATGGAGAAG 3' (SEQ ID NO: 17) (antisense) were used to screen cDNA prepared from mouse whole brain poly(A)+ RNA which was reverse transcribed using oligo dT or random primers.
  • PCR was performed at 62 0 C for 35 cycles with 90 sec extension at 72°C.
  • the amplified fragments were subcloned into pCRIITOPO vector (Invitrogen, Carlsbad, CA), sequenced, and found to encode the full-length CRFR2 ⁇ novel splice variant lacking exon six, sCRFR2 ⁇ (Chen et al., 2005).
  • RNA isolation was used as previously described (Chen et al, 2005): total brain, olfactory bulb, hypothalamus, cortex, cerebellum, hippocampus, midbrain, pons/medulla oblongata, spinal cord and pituitary.
  • the cDNA products were used as templates for semi-quantitative and RT PCR analysis using specific primers for CRFR2 ⁇ , sCRFR2 ⁇ and the ribosomal protein S 16.
  • ERK1/2 Extracellular receptor kinase 1/2
  • CATH.a cells were equilibrated with DMEM supplemented with 1% (w/v) bovine serum albumin (BSA) for 6 hr and then stimulated with 0.1 % DMEM/BSA (vehicle) or 10 nM Ucn I in the presence or absence of 0.4 or 4 nM sCRFR2 ⁇ diluted in 0.1% DMEM/BSA.
  • BSA bovine serum albumin
  • Cells were harvested immediately and analyzed for phosphorylated ERKl/2-p42, 44, as previously described (Chen et al , 2005).
  • the HEK293T cells were transfected with a luciferase reporter containing a fragment of the EVXl gene containing a potent CRE site. The cells were harvested and the luciferase reporter activity was assayed as previously described (Chen et al, 2005). Twenty hours posttransfection, cells were treated for 4h with vehicle or with Ucn 1 (0.0001-100 nM) in the presence or absence of 0.1 nM sCRFR2 ⁇ .
  • Radio-Immuno Assays Antisera was raised in rabbits immunized with a synthetic peptide fragment encoding the unique C-terminal tail (aa 113-143) of mouse sCRFR2 ⁇ conjugated to Keyhole Limpet Hemocyanin using a protocol previously described for inhibin subunits (Vaughan et al, 1989).
  • the analog Tyr 113 sCRFR2 ⁇ (113- 143) was radiolabeled with Na 125 I using chloramine-T and purified by HPLC (Vaughan et al, 1989) for use as tracer in the HA.
  • the procedure for sCRFR2 ⁇ RIA was similar to that previously described in detail for inhibin subunits (Vaughan et al, 2005).
  • anti-sCRFR2 ⁇ was used at 1/300,000 final dilution and synthetic sCRFR2 ⁇ (113-143) was used as standard.
  • Murine tissues were acid extracted and partially purified using octadecyl silica cartridges as described (Vaughan et al, 1989). Lyophilized samples were tested at three to seven dose levels. Free tracer was separated from bound by the addition of sheep anti-rabbit ⁇ -globulins and 10% (wt/vol) polyethylene glycol.
  • the EC50 and minimum detectable dose for sCRFR2 ⁇ are ⁇ 5 pg and 100 pg per tube, respectively.
  • sCRFR2 ⁇ A cDNA corresponding to amino acids 1-143, modified by PCR to include a FLAG epitope following amino acid 143, was subcloned into pSec-Tag2 HygroA (Invitrogen, Carlsbad, CA) and used for transfection of COSM6 cells as described (Perrin et al, 2001). After 4 days, the media was collected and sCRFR2 ⁇ was enriched by purification using FLAG-agarose (Sigma, St. Louis, MO) immunoaffinity chromatography. The protein was detected by immunoblot analysis using either the anti-FLAG antibody or the antibody generated to the unique sCRFR2 ⁇ C-terminus.
  • Bacterial expression of sCRFR2 ⁇ A cDNA corresponding to amino acids 20-
  • 143 was generated by PCR using mCRFR2 ⁇ as the template.
  • the cDNA was subcloned into pET-32a(+) (Novagen, La Jolla, CA) and the protein purified by S-protein affinity chromatography as described (Perrin et al, 2001).
  • the protein was detected by immunoblot analysis using the antibody generated to the unique sCRFR2 ⁇ C-terminus. Radioreceptor assays.
  • the soluble protein, purified either from COS M6 cell media or E.coli was incubated in triplicate wells with [ 125 I-DTyr°]-astressin and increasing concentration of unlabeled peptides as described (Perrin et al, 2003).
  • a cDNA transcript of smaller (-100 bp) size was observed during the isolation of the mouse CRFR2 ⁇ (Van Pett et al, 2000). This smaller fragment was isolated and found to encode a variant of CRFR2 ⁇ bearing a deletion of exon six. Translation of the variant transcript predicts a novel 143 amino acid protein, sCRFR2 ⁇ , comprising the majority of the first extracellular domain of CRFR2 ⁇ followed by a unique 38 amino acid C terminus (FIG. IA). Screening of GenBank showed homology of the C-terminus to no other protein. The genomic arrangement of the sCRFR2 ⁇ is shown in FIG. IB.
  • sCRFR2 ⁇ mRNA is merely a product of splicing errors, it should be much less abundant than the correctly spliced RNA.
  • semiquantitative RT-PCR followed by Southern hybridization analysis was used to compare the relative abundance of CRFR2 ⁇ and sCRFR2 ⁇ mRNA in several brain regions.
  • Total RNA prepared from mouse tissues was reverse-transcribed to generate cDNAs that were used as templates for semi-quantitative RT-PCR analysis, followed by Southern hybridization, using specific primers and probes for CRFR2 ⁇ and sCRFR2 ⁇ (FIG. 2).
  • the oligonucleotide primer pair (located in exons three and seven) allowed the simultaneous amplification of both the soluble form and the full-length membrane bound receptor in a single reaction (FIG. 2A).
  • the sCRFR2 ⁇ is highly expressed in the olfactory, cortex, midbrain and the pituitary (FIGs. 2B and 2C). Lower levels of expression were found in the hippocampus, hypothalamus, pons, medulla and spinal cord (FIGs. 2B and 2C). As shown in FIG. 2, the abundance of sCRFR2 ⁇ mRNA is lower, but comparable, to that of CRFR2 ⁇ mRNA.
  • the sequences of cDNA fragments from RT-PCR were found to encode a splice variant of the mouse CRFR2 ⁇ gene (FIG. IA).
  • sCRFR2 ⁇ In order to obtain a larger quantity of sCRFR2 ⁇ , a protein lacking the putative signal peptide was expressed as a fusion protein in E. coli (Perrin et al, 2001). Following cleavage and purification, the protein was visualized (using the anti- sCRFR2 ⁇ ) by immunoblot analysis as a narrow band of size ⁇ 20kD. The anti- sCRFR2 ⁇ serum detects the sCRFR2 ⁇ proteins both in radioimmunoassay (FIG. 3B) as well as in immonocytochemistry (FIG. 3C).
  • Immunohistochemical studies using anti-sCRFR2 ⁇ serum revealed the distribution of sCRFR2 ⁇ -ir in rodent brain.
  • the cellular distribution of immunolabeling for sCRFR2 ⁇ -ir was widespread and conformed more closely to the location of CRFRl mRNA expression pattern than to that of CRFR2 (FIGs. 4A-4F).
  • the results described are from studies in mice; a similar pattern of labeling was observed in rats.
  • Major sites of cellular expression include mitral and tufted cells of the olfactory bulb, the medial septavdiagonal band complex, piriform cortex, substantia nigra, red nucleus, basolateral amygdaloid, deep cerebellar and dorsal column nuclei, all of which are prominent sites of CRFRl expression.
  • sCRFR2 ⁇ -ir cell bodies are numerous throughout isocortex, although the laminar distributions are only partly overlapping.
  • both CRFRl- and sCRFR2 ⁇ -expressing cell bodies are numerous in layer 2/3, the dominant cortical seat of CRFRl expression is in layer 4, while that of sCRFR2 ⁇ is in layer 5.
  • CRFR2 ⁇ -stained cell bodies Major sites of CRFR2 expression, including the lateral septal, midbrain raphe, ventromedial hypothalamic and medial amygdaloid nuclei were all lacking in sCRFR2 ⁇ -stained cell bodies, although interestingly the latter two sites were among the few invested with labeled varicosities that the inventors take to be representative of sCRFR2 ⁇ -ir terminal fields.
  • the paraventricular nucleus of the hypothalamus also contained a presumed sCRFR2 ⁇ -ir terminal field of moderate density.
  • the interactions of the sCRFR2 ⁇ with CRF family ligands were assessed by radioreceptor assay using competitive displacement of [ 125 I-D Tyr°]-astressin bound to sCRFR2 ⁇ .
  • the soluble proteins, secreted by COS M6 cells or produced in bacteria, bind the agonists, Ucn 1 and CRF, as well as the antagonist, astressin, with nanomolar
  • 25 sCRFR2 ⁇ proteins inhibit, in a dose dependent manner, the cAMP response to Ucn 1 and CRF in HEK293T cells transfected with mouse CRFR2 ⁇ as measured by the CRE luciferase activity of the EVXl gene (FIG. 5A). Because the urocortins activate MAPK signaling (Brar et al, 2002), the inventors measured the ability of sCRFR2 ⁇ to inhibit the activation by Ucn 1 of ERKl/2- ⁇ 42,44 in CATH.a cells, which endogenously
  • Nicolas and Rubinstein In: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and Denliardt, eds., Stoneham: Butterworth, pp. 494-513,

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Diabetes (AREA)
  • Cell Biology (AREA)
  • Neurosurgery (AREA)
  • Endocrinology (AREA)
  • Psychiatry (AREA)
  • Epidemiology (AREA)
  • Pain & Pain Management (AREA)
  • Addiction (AREA)
  • Emergency Medicine (AREA)
  • Rheumatology (AREA)
  • Obesity (AREA)
  • Dermatology (AREA)
  • Hematology (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2006/004321 2005-02-08 2006-02-08 Compositions and methods related to soluble g-protein coupled receptors(sgpcrs) Ceased WO2006086402A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
DK06734527.2T DK1885746T3 (da) 2005-02-08 2006-02-08 Sammensætninger relateret til opløselige G-protein-koblede receptorer (sGPCRs)
CN2006800078724A CN101137668B (zh) 2005-02-08 2006-02-08 与可溶性G蛋白偶联受体(sGPCR)有关的组合物与方法
JP2007554332A JP4859248B2 (ja) 2005-02-08 2006-02-08 可溶性Gタンパク質共役型レセプター(sGPCR)に関する組成物および方法
EP06734527A EP1885746B1 (en) 2005-02-08 2006-02-08 Compositions related to soluble g-protein coupled receptors (sgpcrs)
CA2597065A CA2597065C (en) 2005-02-08 2006-02-08 Compositions and methods related to soluble g-protein coupled receptors (sgpcrs)
AT06734527T ATE540970T1 (de) 2005-02-08 2006-02-08 Zusammensetzungen in zusammenhang mit löslichen, g-proteingekoppelten rezeptoren (sgpcrs)
AU2006212813A AU2006212813B2 (en) 2005-02-08 2006-02-08 Compositions and methods related to soluble G-protein coupled receptors (sGPCRs)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US65086605P 2005-02-08 2005-02-08
US60/650,866 2005-02-08

Publications (2)

Publication Number Publication Date
WO2006086402A2 true WO2006086402A2 (en) 2006-08-17
WO2006086402A3 WO2006086402A3 (en) 2006-12-14

Family

ID=36793648

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2006/004321 Ceased WO2006086402A2 (en) 2005-02-08 2006-02-08 Compositions and methods related to soluble g-protein coupled receptors(sgpcrs)

Country Status (11)

Country Link
US (2) US7507794B2 (enExample)
EP (1) EP1885746B1 (enExample)
JP (1) JP4859248B2 (enExample)
KR (1) KR20070112155A (enExample)
CN (1) CN101137668B (enExample)
AT (1) ATE540970T1 (enExample)
AU (1) AU2006212813B2 (enExample)
CA (1) CA2597065C (enExample)
DK (1) DK1885746T3 (enExample)
RU (1) RU2423378C2 (enExample)
WO (1) WO2006086402A2 (enExample)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007090087A3 (en) * 2006-01-27 2007-11-29 Res Dev Foundation Use of corticotropin releasing factor receptor-2 inhibitors for treating insulin-related diseases
WO2009040027A1 (en) * 2007-09-11 2009-04-02 Mondobiotech Laboratories Ag Use of the peptide stresscopin as a therapeutic agent
WO2009046874A1 (en) * 2007-09-11 2009-04-16 Mondobiotech Laboratories Ag Therapeutic combination of trh-potentiating peptide and stresscopin
WO2009040047A3 (en) * 2007-09-11 2009-05-14 Mondobiotech Lab Ag Therapeutic uses of ghrelin and combinations with stresscopin
CN104220098A (zh) * 2012-02-14 2014-12-17 加利福尼亚大学董事会 用于心血管疾病和其它病况的旁分泌基因的全身性递送和受调节的表达
WO2018132768A1 (en) * 2017-01-13 2018-07-19 Sanna Pietro P Methods and compositions for treating hpa hyperactivity
USD905935S1 (en) 2019-02-20 2020-12-29 Legionarius, Llc Shirt with back pocket
US11173992B2 (en) 2017-12-28 2021-11-16 Legionarus, Llc Buoyancy garment
US11471112B2 (en) 2018-11-21 2022-10-18 Legionarius, Llc Mobile application for wearable device
US12478324B2 (en) 2019-02-20 2025-11-25 Legionarius, Llc Sensors for wearable devices

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009040019A2 (en) * 2007-09-11 2009-04-02 Mondobiotech Laboratories Ag Use of a peptide as a therapeutic agent
EP2470560B1 (en) 2009-08-28 2015-06-10 Research Development Foundation Urocortin 2 analogs and uses thereof
WO2011062935A1 (en) * 2009-11-17 2011-05-26 The Regents Of The University Of California Compositions and assay systems for intracellular processes
AR081066A1 (es) * 2010-04-02 2012-06-06 Hanmi Holdings Co Ltd Conjugado de insulina donde se usa un fragmento de inmunoglobulina
US9981017B2 (en) 2010-04-02 2018-05-29 Hanmi Science Co., Ltd. Insulin conjugate using an immunoglobulin fragment
CA2827187C (en) * 2011-02-23 2019-01-08 Massachusetts Institute Of Technology Water soluble membrane proteins and methods for the preparation and use thereof
JOP20170153A1 (ar) 2016-07-15 2019-01-30 Lilly Co Eli نظائر urocortin-2 جديدة معدلة بحمض دهني لعلاج داء السكري وأمراض الكلى المزمنة
WO2018136856A1 (en) 2017-01-23 2018-07-26 Massachusetts Institute Of Technology Multiplexed signal amplified fish via splinted ligation amplification and sequencing
WO2018157074A1 (en) 2017-02-24 2018-08-30 Massachusetts Institute Of Technology Methods for diagnosing neoplastic lesions
WO2018157048A1 (en) 2017-02-24 2018-08-30 Massachusetts Institute Of Technology Methods for examining podocyte foot processes in human renal samples using conventional optical microscopy
US11180804B2 (en) 2017-07-25 2021-11-23 Massachusetts Institute Of Technology In situ ATAC sequencing
US11293923B2 (en) 2017-09-01 2022-04-05 Massachusetts Institute Of Technology S-layer protein 2D lattice coupled detergent-free GPCR bioelectronic interfaces, devices, and methods for the use thereof
US11873374B2 (en) 2018-02-06 2024-01-16 Massachusetts Institute Of Technology Swellable and structurally homogenous hydrogels and methods of use thereof
WO2020013833A1 (en) 2018-07-13 2020-01-16 Massachusetts Institute Of Technology Dimethylacrylamide (dmaa) hydrogel for expansion microscopy (exm)
CA3130889A1 (en) 2019-02-22 2020-08-27 Massachusetts Institute Of Technology Iterative direct expansion microscopy
US12265004B2 (en) 2019-11-05 2025-04-01 Massachusetts Institute Of Technology Membrane probes for expansion microscopy
US11802822B2 (en) 2019-12-05 2023-10-31 Massachusetts Institute Of Technology Multiplexed expansion (MultiExM) pathology

Citations (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4196265A (en) 1977-06-15 1980-04-01 The Wistar Institute Method of producing antibodies
US4215051A (en) 1979-08-29 1980-07-29 Standard Oil Company (Indiana) Formation, purification and recovery of phthalic anhydride
US4554101A (en) 1981-01-09 1985-11-19 New York Blood Center, Inc. Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US4883750A (en) 1984-12-13 1989-11-28 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
US5063245A (en) 1990-03-28 1991-11-05 Nova Pharmaceutical Corporation Corticotropin-releasing factor antagonism compounds
US5145684A (en) 1991-01-25 1992-09-08 Sterling Drug Inc. Surface modified drug nanoparticles
US5225538A (en) 1989-02-23 1993-07-06 Genentech, Inc. Lymphocyte homing receptor/immunoglobulin fusion proteins
US5552157A (en) 1990-08-27 1996-09-03 Kabushiki Kaisha Vitamin Kenkyusya Liposome for entrapping gene, liposomal preparation and process for the manufacture of the preparation
US5565213A (en) 1990-07-26 1996-10-15 Taisho Pharmaceutical Co., Ltd. Stable liposome aqueous suspension
US5567434A (en) 1989-03-31 1996-10-22 The Regents Of The University Of California Preparation of liposome and lipid complex compositions
US5580579A (en) 1995-02-15 1996-12-03 Nano Systems L.L.C. Site-specific adhesion within the GI tract using nanoparticles stabilized by high molecular weight, linear poly (ethylene oxide) polymers
US5641515A (en) 1995-04-04 1997-06-24 Elan Corporation, Plc Controlled release biodegradable nanoparticles containing insulin
US5738868A (en) 1995-07-18 1998-04-14 Lipogenics Ltd. Liposome compositions and kits therefor
US5741516A (en) 1994-06-20 1998-04-21 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
US5792451A (en) 1994-03-02 1998-08-11 Emisphere Technologies, Inc. Oral drug delivery compositions and methods
US5795587A (en) 1995-01-23 1998-08-18 University Of Pittsburgh Stable lipid-comprising drug delivery complexes and methods for their production
US6831158B2 (en) 2000-01-10 2004-12-14 Maxygen Holdings Ltd. G-CSF conjugates

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5786203A (en) * 1994-06-14 1998-07-28 Neurocrine Biosciences, Inc. Isolated nucleic acid encoding corticotropin-releasing factor2 receptors
RU2251838C2 (ru) * 1999-07-15 2005-05-20 Рисерч Дивелопмент Фаундейшн Способ получения неприродной трансгенной мыши с дефицитом гена рецептора 2 кортиколиберина и ее использование
US7869958B2 (en) * 2004-08-09 2011-01-11 Research Development Foundation Structure-based modulators of B1 G-protein coupled receptors

Patent Citations (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4196265A (en) 1977-06-15 1980-04-01 The Wistar Institute Method of producing antibodies
US4215051A (en) 1979-08-29 1980-07-29 Standard Oil Company (Indiana) Formation, purification and recovery of phthalic anhydride
US4554101A (en) 1981-01-09 1985-11-19 New York Blood Center, Inc. Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity
US4883750A (en) 1984-12-13 1989-11-28 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (enExample) 1985-03-28 1990-11-27 Cetus Corp
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
US4683195B1 (enExample) 1986-01-30 1990-11-27 Cetus Corp
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US5225538A (en) 1989-02-23 1993-07-06 Genentech, Inc. Lymphocyte homing receptor/immunoglobulin fusion proteins
US5567434A (en) 1989-03-31 1996-10-22 The Regents Of The University Of California Preparation of liposome and lipid complex compositions
US5063245A (en) 1990-03-28 1991-11-05 Nova Pharmaceutical Corporation Corticotropin-releasing factor antagonism compounds
US5565213A (en) 1990-07-26 1996-10-15 Taisho Pharmaceutical Co., Ltd. Stable liposome aqueous suspension
US5552157A (en) 1990-08-27 1996-09-03 Kabushiki Kaisha Vitamin Kenkyusya Liposome for entrapping gene, liposomal preparation and process for the manufacture of the preparation
US5145684A (en) 1991-01-25 1992-09-08 Sterling Drug Inc. Surface modified drug nanoparticles
US5792451A (en) 1994-03-02 1998-08-11 Emisphere Technologies, Inc. Oral drug delivery compositions and methods
US5741516A (en) 1994-06-20 1998-04-21 Inex Pharmaceuticals Corporation Sphingosomes for enhanced drug delivery
US5795587A (en) 1995-01-23 1998-08-18 University Of Pittsburgh Stable lipid-comprising drug delivery complexes and methods for their production
US5580579A (en) 1995-02-15 1996-12-03 Nano Systems L.L.C. Site-specific adhesion within the GI tract using nanoparticles stabilized by high molecular weight, linear poly (ethylene oxide) polymers
US5641515A (en) 1995-04-04 1997-06-24 Elan Corporation, Plc Controlled release biodegradable nanoparticles containing insulin
US5738868A (en) 1995-07-18 1998-04-14 Lipogenics Ltd. Liposome compositions and kits therefor
US6831158B2 (en) 2000-01-10 2004-12-14 Maxygen Holdings Ltd. G-CSF conjugates

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ALLEN; CHOUN, FEBS LETT., vol. 223, 1987, pages 42 - 46
ANDRESZ ET AL., MAKROMOL. CHEM, vol. 179, 1978, pages 301
AVIS: "Remington's Pharmaceutical Sciences", vol. 84, 1990, MACK PUBLISHING CO., pages: 1545 - 1569
BAICHWAL; SUGDEN: "Gene Transfer", 1986, PLENUM PRESS, pages: 117 - 148
BALE; VALE, ANNU. REV PHARMACOL. TOXICOL., vol. 44, 2004, pages 525 - 557

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007090087A3 (en) * 2006-01-27 2007-11-29 Res Dev Foundation Use of corticotropin releasing factor receptor-2 inhibitors for treating insulin-related diseases
US7815905B2 (en) 2006-01-27 2010-10-19 Research Development Foundation Methods of increasing insulin sensitivity or decreasing insulin secretion by administering corticotropin releasing factor receptor-2 inhibitors
WO2009040027A1 (en) * 2007-09-11 2009-04-02 Mondobiotech Laboratories Ag Use of the peptide stresscopin as a therapeutic agent
WO2009046874A1 (en) * 2007-09-11 2009-04-16 Mondobiotech Laboratories Ag Therapeutic combination of trh-potentiating peptide and stresscopin
WO2009040047A3 (en) * 2007-09-11 2009-05-14 Mondobiotech Lab Ag Therapeutic uses of ghrelin and combinations with stresscopin
AU2013221615B2 (en) * 2012-02-14 2018-02-22 The Regents Of The University Of California Systemic delivery and regulated expression of paracrine genes for cardiovascular diseases and other conditions
EP2814513A4 (en) * 2012-02-14 2016-01-13 Univ California SYSTEMIC ADMINISTRATION AND REGULATED EXPRESSION OF PARA RINGENES FOR CARDIOVASCULAR DISEASES AND OTHERS
RU2642605C2 (ru) * 2012-02-14 2018-01-25 Те Риджентс Оф Те Юниверсити Оф Калифорния Системная доставка и регулируемая экспрессия паракринных генов для лечения сердечно-сосудистых и иных заболеваний
CN104220098A (zh) * 2012-02-14 2014-12-17 加利福尼亚大学董事会 用于心血管疾病和其它病况的旁分泌基因的全身性递送和受调节的表达
EP3311830A1 (en) * 2012-02-14 2018-04-25 The Regents of The University of California Systemic delivery and regulated expression of paracrine genes for cardiovascular diseases and other conditions
US10202618B2 (en) 2012-02-14 2019-02-12 The Regents Of The University Of California Method of treating type I diabetes using an AAV vector encoding uracortin 2
US10918738B2 (en) 2012-02-14 2021-02-16 The Regents Of The University Of California Method of treating type I diabetes using an AAV vector encoding uracortin 2
WO2018132768A1 (en) * 2017-01-13 2018-07-19 Sanna Pietro P Methods and compositions for treating hpa hyperactivity
US11173992B2 (en) 2017-12-28 2021-11-16 Legionarus, Llc Buoyancy garment
US11471112B2 (en) 2018-11-21 2022-10-18 Legionarius, Llc Mobile application for wearable device
USD905935S1 (en) 2019-02-20 2020-12-29 Legionarius, Llc Shirt with back pocket
USD943244S1 (en) 2019-02-20 2022-02-15 Legionarius, Llc Shirt with back pocket
US12478324B2 (en) 2019-02-20 2025-11-25 Legionarius, Llc Sensors for wearable devices

Also Published As

Publication number Publication date
JP2008529500A (ja) 2008-08-07
DK1885746T3 (da) 2012-03-26
US20070042954A1 (en) 2007-02-22
AU2006212813B2 (en) 2012-02-02
CA2597065C (en) 2014-10-14
CN101137668A (zh) 2008-03-05
JP4859248B2 (ja) 2012-01-25
US20090117649A1 (en) 2009-05-07
KR20070112155A (ko) 2007-11-22
US8258279B2 (en) 2012-09-04
CN101137668B (zh) 2011-08-17
ATE540970T1 (de) 2012-01-15
RU2007133648A (ru) 2009-03-20
EP1885746A2 (en) 2008-02-13
EP1885746B1 (en) 2012-01-11
RU2423378C2 (ru) 2011-07-10
CA2597065A1 (en) 2006-08-17
AU2006212813A1 (en) 2006-08-17
US7507794B2 (en) 2009-03-24
WO2006086402A3 (en) 2006-12-14

Similar Documents

Publication Publication Date Title
US8258279B2 (en) Isolated nucleic acids encoding soluble corticotropin releasing factor receptor type 2 (sCRFR2) polypeptides
RU2430113C2 (ru) Химерный полипептид, селективно взаимодействующий с родственным ему рецептором хемокина, фармацевтическая композиция и применение химерного полипептида (варианты)
JP5631595B2 (ja) N型カルシウムチャネルを阻害せずに卒中および他の疾患を治療する方法
US8945557B2 (en) Use of immunesuppressant receptor
JP4472256B2 (ja) ウロコルチンiii及びその利用
PT1287133E (pt) Regulação do receptor acoplado à proteína g tipo dopamina humano
JP2000083669A (ja) Cxcr4ケモカイン受容体のヒトスプライス変異体cxcr4b
JP4326326B2 (ja) Epf受容体アッセイ、化合物および治療用組成物
US20040096847A1 (en) Regulation of human secretin receptor-like gpcr
US20040136981A1 (en) Regulation of human histamine h2-like g protein-coupled receptor
US20030143590A1 (en) Regulation of human dopamine-like g protein- coupled receptor
US20040058350A1 (en) Regulation of human secretin receptor-like gpcr
WO2004009630A1 (en) Regulation of human serotonin receptor
WO2004009631A2 (en) Human gnrh (type 2) receptor
HK1117171A (en) G protein coupled receptor agonists and antagonists and methods of use
WO2004029086A2 (en) Regulation of human calcium-independent alpha-latrotoxin receptor homolog 3

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200680007872.4

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2597065

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2007554332

Country of ref document: JP

Ref document number: 2006212813

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2006212813

Country of ref document: AU

Date of ref document: 20060208

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020077020593

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2007133648

Country of ref document: RU

Ref document number: 2006734527

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application