WO2004029086A2 - Regulation of human calcium-independent alpha-latrotoxin receptor homolog 3 - Google Patents

Regulation of human calcium-independent alpha-latrotoxin receptor homolog 3 Download PDF

Info

Publication number
WO2004029086A2
WO2004029086A2 PCT/EP2003/010665 EP0310665W WO2004029086A2 WO 2004029086 A2 WO2004029086 A2 WO 2004029086A2 EP 0310665 W EP0310665 W EP 0310665W WO 2004029086 A2 WO2004029086 A2 WO 2004029086A2
Authority
WO
WIPO (PCT)
Prior art keywords
calcium
receptor homolog
independent alpha
polypeptide
latrotoxin receptor
Prior art date
Application number
PCT/EP2003/010665
Other languages
French (fr)
Other versions
WO2004029086A3 (en
Inventor
Alex Smolyar
Original Assignee
Bayer Healthcare Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Healthcare Ag filed Critical Bayer Healthcare Ag
Priority to AU2003275986A priority Critical patent/AU2003275986A1/en
Publication of WO2004029086A2 publication Critical patent/WO2004029086A2/en
Publication of WO2004029086A3 publication Critical patent/WO2004029086A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor

Definitions

  • the invention relates to the regulation of human calcium-independent alpha- latrotoxin receptor homolog 3.
  • GPCR G protein-coupled receptors
  • GPCRs include receptors for such diverse agents as calcitonin, adrenergic hormones, endothelin, cAMP, adenosine, acetylcholine, serotonin, dopamine, histamine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1, rhodopsins, odorants, cytomegalovirus, G proteins themselves, effector proteins such as phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins such as protein kinase A and protein kinase C.
  • the GPCR protein superfamily now contains over 250 types of paralogues, receptors that represent variants generated by gene duplications (or other processes), as opposed to orthologues, the same receptor from different species.
  • the superfamily can be broken down into five families: Family I, receptors typified by rhodopsin and the ⁇ 2-adrenergic receptor and currently represented by over 200 unique members (reviewed by Dohlman et al., Ann. Rev. Biochem.
  • Family II the recently characterized parathyroid hormone/calcitonin/- secretin receptor family (Juppner et al., Science 254, 1024-26, 1991; Lin et al., Science 254, 1022-24, 1991); Family III, the metabotropic glutamate receptor family in mammals (Nakanishi, Science 258, 597-603, 1992); Family IN, the cAMP receptor family, important in the chemotaxis and development of D. discoideum (Klein et al, Science 241, 1467-72, 1988; and Family N, the fmgal mating pheromone receptors such as STE2 (reviewed by Kurjan, Ann. Rev. Biochem. 61, 1097-129, 1992).
  • GPCRs possess seven conserved membrane-spanning domains connecting at least eight divergent hydrophilic loops. GPCRs (also known as 7TM receptors) have been characterized as including these seven conserved hydrophobic stretches of about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops. Most GPCRs have single conserved cysteine residues in each of the first two extracellular loops, which form disulfide bonds that are believed to stabilize functional protein, structure. The seven transmembrane regions are designated as TM1, TM2, TM3, TM4, TM5, TM6, and TM7. TM3 has been implicated in signal transduction.
  • Phosphorylation and lipidation (palmitylation or farnesylation) of cysteine residues can influence signal transduction of some GPCRs.
  • Most GPCRs contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus.
  • phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization.
  • the ligand binding sites of GPCRs are believed to comprise hydrophilic sockets formed by several GPCR transmembrane domains.
  • the hydrophilic sockets are surrounded by hydrophobic residues of the GPCRs.
  • the hydrophilic side of each GPCR transmembrane helix is postulated to face inward and form a polar ligand binding site.
  • TM3 has been implicated in several GPCRs as having a ligand binding site, such as the TM3 aspartate residue.
  • TM5 serines, a TM6 asparagine, and TM6 or TM7 phenylalanines or tyrosines also are implicated in ligand binding.
  • GPCRs are coupled inside the cell by heterotrimeric G proteins to various intra- cellular enzymes, ion channels, and transporters (see Johnson et al., Endoc. Rev. 10,
  • G protein alpha subunits preferentially stimulate particular effectors to modulate various biological functions in a cell.
  • Phosphorylation of cytoplasmic residues of GPCRs is an important mechanism for the regulation of some GPCRs.
  • the effect of hormone binding is the activation inside the cell of the enzyme, adenylate cyclase. Enzyme activation by hormones is dependent on the presence of the nucleotide GTP. GTP also influences hormone binding.
  • a G protein connects the hormone receptor to adenylate cyclase. G protein exchanges GTP for bound GDP when activated by a hormone receptor.
  • the GTP-carrying form then binds to activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G protein itself, returns the G protein to its basal, inactive form.
  • the G protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.
  • Alpha-latrotoxin a neurotoxic protein contained in black widow spider venom, stimulates a robust release of neurotransmitters and the subsequent degeneration of the affected nerve terminals. This effect is mediated by ALX binding to a G protein-coupled receptor called latropbilin (Ichtchenko et al, J. Biol. Chem. 274, 5491-98, 1999; Rahman et al, Philos. Trans. R. Soc. Lond. B Biol. Sci.
  • Fig. 1 shows the DNA-sequence encoding a calcium-independent alpha- latrotoxin receptor homolog 3 Polypeptide (SEQ ID NO: 1).
  • Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of
  • Fig.l SEQ ID NO: 2.
  • the invention relates to an isolated polynucleotide from the group consisting of:
  • amino acid sequences which are at least about 95% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
  • e a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a Calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide.
  • a newly identified human calcium-independent alpha-latrotoxin receptor homolog 3 comprises the amino acid sequence shown in SEQ LD NO: 2.
  • a coding sequence for human calcium-independent alpha-latrotoxin receptor homolog 3 is shown in SEQ ID NO: 1. This sequence is located on chromosome 4ql3.1.
  • Related ESTs (BI460679; BF969782; BQ340423; H15996; T10303; H29414; BE938352; H24417; BF933505; N69327) are expressed in testis, adrenal cortex carcinoma, infant brain, and cochlea.
  • a galactose binding lectin domain In the protein of the present invention a galactose binding lectin domain, an olfactomedin-like domain, a hormone receptor domain, a lafrophilin/ CL-1-like GPS domain, and a seven transmembrane receptor (secretm family) and latrophilm cytoplasmic C-terminal region were identified. The location of these domains are shown in FIG. 1.
  • Human calcium-independent alpha-latrotoxin receptor homolog 3 of the invention is expected to be useful for the same purposes as previously identified calcium- independent alpha-latrotoxin receptors. Human calcium-independent alpha- latrotoxin receptor homolog 3 is believed to be useful in therapeutic methods to treat disorders such as cardiovascular disorders, CNS disorders, diabetes, and obesity. Human calcium-independent alpha-latrotoxin receptor homolog 3 also can be used to screen for human calcium-independent alpha-latrotoxin receptor homolog 3 activators and inhibitors.
  • One embodiment of the present invention is an expression vector containing any polynucleotide of the present invention.
  • Yet another embodiment of the present invention is a host cell containing any expression vector of the present invention.
  • Still another embodiment of the present invention is a substantially purified Calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide encoded by any polynucleotide of the present invention.
  • Yet another embodiment of the present invention is a method of producing a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide of the present invention, wherein the method comprises the following steps:
  • Yet another embodiment of the present invention is a method for detecting a polynucleotide encoding a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide in a biological sample comprising the following steps:
  • Still another embodiment of the present invention is a method for detecting a polynucleotide of the present invention or a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide of the present invention comprising the steps of:
  • a contacting a biological sample with a reagent which specifically interacts with the polynucleotide or the Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide and
  • Yet another embodiment of the present invention is a diagnostic kit for conducting any method of the present invention.
  • Yet another embodiment of the present invention is a method of screening for agents which decrease the activity of a Calcium-mdependent alpha-latrotoxin receptor homolog 3, comprising the steps of:
  • a test compound contacting a test compound with a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide encoded by any polynucleotide of the present invention; b. detecting binding of the test compound to the Calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3.
  • Still another embodiment of the present invention is a method of screening for agents which regulate the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3, comprising the steps of:
  • Yet another embodiment of the present invention is a method of screening for agents which decrease the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3, comprising the step of:
  • test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of Calcium-independent alpha-latrotoxin receptor homolog 3.
  • Yet another embodiment of the present invention is a method of reducing the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3, comprising the step of:
  • Still another embodiment of the present invention is a reagent that modulates the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide or a polynucleotide wherein said reagent is identified by any methods of the present invention.
  • composition comprising
  • an expression vector of the present invention or a reagent of the present invention and a pharmaceutically acceptable carrier is provided.
  • Yet another embodiment of the present invention is the use of an expression vector of the present invention or a reagent of the present invention for modulating the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3 in a disease, preferably a cardiovascular disorder, a CNS disorder, diabetes or obesity.
  • the invention thus provides a human calcium-independent alpha-latrotoxin receptor homolog 3 that can be used to identify test compounds that may act, for example, as activators or inhibitors.
  • Human calcium-independent alpha-latrotoxin receptor homolog 3 and fragments thereof also are useful in raising specific antibodies that can block the protein and effectively reduce its activity.
  • Human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, or 1551 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO: 2 or a biologically active variant thereof, as defined below.
  • a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide of the invention therefore can be a portion of a calcium-independent alpha-latrotoxin receptor homolog 3 protein, a full-length calcium-independent alpha-latrotoxin receptor homolog 3 protein, or a fusion protein comprising all or a portion of a calcium- independent alpha-latrotoxin receptor homolog 3 protein.
  • Human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide variants that are biologically active, e.g., retain functional activity, also are human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides.
  • naturally or non-naturally occurring human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide variants have amino acid sequences which are at least about 95, 96, 97, 98, or 99% identical to the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof.
  • Percent identity between a putative human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide variant and an amino acid sequence of SEQ ID NO: 2 is determined by conventional methods. See, for example, Altschul et al, Bull. Math. Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl. Acad. Sci.
  • the ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed" to include only those residues that contribute to the highest score.
  • the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps.
  • the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch- Sellers algorithm (Needleman & Wunsch, J Mol. Biol.48:444 (1970); Sellers, SIAM J. Appl. Math.26:181 (1974)), which allows for amino acid insertions and deletions.
  • % identity of a first sequence towards a second sequence means the % identity which is calculated as follows: First the optimal global alignment between the two sequences is determined with the CLUSTALW algorithm [Thomson JD, Higgins DG, Gibson TJ. 1994. ClustalW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22:
  • FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above.
  • the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
  • Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions.
  • Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
  • Amino acid insertions or deletions are changes to or within an amino acid sequence.
  • the invention additionally, encompasses calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides that are differentially modified during or after translation, e.g., by gly cosy lation, acety lation, phosphorylation, amidation, derivati- zation by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications can be carried out by known techniques including, but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, N8 protease,
  • Additional post-translational modifications encompassed by the invention include, for example, e.g., N-lin ed or O-linked carbohydrate chains, processing of N- terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression.
  • the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
  • the invention also provides chemically modified derivatives of calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptides that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Patent No. 4,179,337).
  • the chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethyl- cellulose, dextran, polyvinyl alcohol, and the like.
  • the polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
  • Fusion proteins are useful for generating antibodies against calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
  • a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond.
  • the first polypeptide segment comprises a calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide, such as those described above.
  • the first polypeptide segment also can comprise full-length calcium-independent alpha- latrotoxin receptor homolog 3 protein.
  • the second polypeptide segment can be a full-length protein or a protein fragment.
  • Proteins commonly used in fusion protein construction include ⁇ -galactosidase, ⁇ - glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
  • epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, NSN-G tags, and thioredoxin (Trx) tags.
  • Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a D ⁇ A binding domain (DBD) fusions, GAL4 D ⁇ A binding domain fusions, and herpes simplex virus (HSN) BP16 protein fusions.
  • a fusion protein also can be engineered to contain a cleavage site located between the calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide-encoding sequence and the heterologous protein sequence, so that the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be cleaved and purified away from the heterologous moiety.
  • a fusion protein can be synthesized chemically, as is known in the art.
  • a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology.
  • Recombinant D ⁇ A methods can be used to prepare fusion proteins, for example, by making a D ⁇ A construct which comprises coding sequences selected from SEQ ID NO: 1 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art.
  • kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).
  • Species homologs of human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be obtained using calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of calcium-inde- pendent alpha-latrotoxin receptor homolog 3 polypeptide, and expressing the cDNAs as is known in the art.
  • a human calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide.
  • a coding sequence for human calcium-independent alpha- latrotoxin receptor homolog 3 is shown in SEQ ID NO: 1.
  • nucleotide sequences encoding human calcium-independent alpha- latrotoxin receptor homolog 3 polypeptides as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID NO: 1 or its complement also are calcium-mdependent alpha-latrotoxin receptor homolog 3 polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2.
  • cDNA Complementary DNA
  • species homologs, and variants of calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides that encode biologically active calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides also are calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides.
  • Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO: 1 or its complement also are calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides. Identification of polynucleotide variants and homologs
  • Variants and homologs of the calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides described above also are calcium-independent alpha- latrotoxin receptor homolog 3 polynucleotides.
  • homologous calcium- independent alpha-latrotoxin receptor homolog 3 polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known calcium- independent alpha-latrotoxin receptor homolog 3 polynucleotides under stringent conditions, as is known in the art.
  • homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
  • Species homologs of the calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast.
  • Human variants of calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T m of a double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et al, J. Mol. Biol. 81, 123 (1973).
  • Variants of human calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides or calcium-mdependent alpha-latrotoxin receptor homolog 3 polynucleotides of other species can therefore be identified by hybridizing a putative homologous calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO: 1 or the complement thereof to form a test hybrid.
  • the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising poly- nucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
  • Nucleotide sequences which hybridize to calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides or their complements following stringent hybridization and/or wash conditions also are calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides.
  • Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
  • T m of a hybrid between a calcium- independent alpha-latrotoxin receptor homolog 3 polynucleotide having a nucleotide sequence shown in SEQ ID NO: 1 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
  • T m 81.5°C - 16.6(log ⁇ o[Na + ]) + 0.41(%G + C) - 0.63(%formamide) - 600/1), .
  • / the length of the hybrid in basepairs.
  • Stringent wash conditions include, for example, 4X SSC at 65°C, or 50%o formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C.
  • Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
  • a human calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
  • Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such teclmique for obtaining a polynucleotide can be used to obtain isolated calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides.
  • restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise calcium-independent alpha-latrotoxin receptor homolog 3 nucleotide sequences.
  • Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules.
  • Human calcium-independent alpha-latrotoxin receptor homolog 3 cDNA molecules can be made with standard molecular biology techniques, l ⁇ sing calcium-independent alpha-latrotoxin receptor homolog 3 mRNA as a template. Human calcium- independent alpha-latrotoxin receptor homolog-3 cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
  • PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements.
  • Sarkar PCR Methods Applic. 2, 318-322, 1993; Triglia et al, Nucleic Acids Res. 16, 8186, 1988; Lagersfrom et al, PCR Methods Applic. 1, 111-119, 1991; Parker et al, Nucleic Acids Res. 19, 3055-3060, 1991).
  • PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA (CLONTECH, Palo Alto, Calif). See WO 01/98340.
  • Human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides can be obtained, for example, by purification from human cells, by expression of calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides, or by direct chemical synthesis.
  • Human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides.
  • a purified calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide is separated from other compounds that normally associate with the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chroma- tography, affinity chromatography, and preparative gel electrophoresis.
  • a preparation of purified calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis. Expression of polynucleotides
  • the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding calcium- independent alpha-latrotoxin receptor homolog 3 polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.
  • a variety of expression vector/host systems can be utilized to contain and express sequences encoding a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems. See WO 01/98340.
  • a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide in the desired fashion.
  • modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function.
  • CHO, HeLa, MDCK, HEK293, and WI38 Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38) are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein. See WO 01/98340.
  • marker gene expression suggests that the calcium- independent alpha-latrotoxin receptor homolog 3 polynucleotide is also present, its presence and expression may need to be confirmed.
  • a sequence encoding a human calcium-independent alpha-latrotoxin receptor homolog 3 poly- peptide is inserted within a marker gene sequence, transformed cells containing sequences which encode a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be identified by the absence of marker gene function.
  • a marker gene can be placed in tandem with a sequence encoding a calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide.
  • host cells which contain a human calcium-independent alpha- latrotoxin receptor homolog 3 polynucleotide and which express a human calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide can be identified by a variety of procedures known to those of skill in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RLA), and fluorescence activated cell sorting (FACS).
  • ELISA enzyme-linked immunosorbent assay
  • RLA radioimmunoassay
  • FACS fluorescence activated cell sorting
  • sequences encoding a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be cloned into a vector for the production of an mRNA probe.
  • vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical).
  • Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromo genie agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
  • Host cells transformed with nucleotide sequences encoding a human calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides can be designed to contain signal sequences which direct secretion of soluble calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide. See WO 01/98340. - 2A -
  • Sequences encoding a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl. Acids Res. Symp. Ser. 225-232, 1980).
  • a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques
  • Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
  • fragments of calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptides can be separately synthesized and combined using chemical methods to produce a full- length molecule.
  • codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product.
  • DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences.
  • site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
  • Antibody as used herein includes intact immunogiobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide.
  • Fab fragment antigen binding protein
  • F(ab') 2 fragment antigen binding protein
  • Fv fragment antigen binding protein binding protein binding protein binding protein binding protein sequence.
  • at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope.
  • epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
  • An antibody which specifically binds to an epitope of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • immunochemical assays such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
  • an antibody that specifically binds to a human calcium-mdependent alpha- latrotoxin receptor homolog 3 polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay.
  • antibodies that specifically bind to calcium- independent alpha-latrotoxin receptor homolog 3 polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a human calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide from solution. See WO 01/98340.
  • Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation.
  • an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, - or 50 or more nucleotides long. Longer sequences also can be used.
  • Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level pf calcium-independent alpha-latrotoxin receptor homolog 3 gene products in the cell.
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combi- nation of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.
  • Modifications of calcium-independent alpha-latrotoxin receptor homolog 3 gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the calcium-independent alpha- latrotoxin receptor homolog 3 gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes. See WO 01/98340.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin.
  • Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673).
  • the mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage..
  • Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a human calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide.
  • Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591,
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201). See WO 01/98340.
  • genes may represent genes that are differentially expressed in disorders including, but not limited to, cardiovascular disorders, CNS disorders, diabetes, and obesity. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions.
  • the human calcium-independent alpha-latrotoxin receptor homolog 3 gene or gene product may itself be tested for differential expression.
  • the degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques.
  • standard characterization techniques such as differential display techniques.
  • Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
  • RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
  • Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subfractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S.
  • the differential expression information may itself suggest relevant methods for the treatment of disorders involving the human calcium-independent alpha-latrotoxin receptor homolog 3.
  • treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human calcium- independent alpha-latrotoxin receptor homolog 3.
  • the differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human calcium-independent alpha-latrotoxin receptor homolog 3 gene or gene product are up-regulated or down-regulated.
  • the invention provides assays for screening test compounds that bind to or modulate the activity of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide or a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polynucleotide.
  • a test compound preferably binds to a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide or polynucleotide. More preferably, a test compound decreases or increases functional activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
  • Test compounds preferably binds to a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide or polynucleotide. More preferably, a test compound decreases or increases functional activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
  • Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
  • the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced re- combinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
  • Test compounds can be screened for the ability to bind to calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides or polynucleotides or to affect calcium-independent alpha-latrotoxin receptor homolog 3 activity or calcium- independent alpha-latrotoxin receptor homolog 3 gene expression using high throughput screening.
  • high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
  • the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
  • many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
  • free format assays or assays that have no physical barrier between samples, can be used.
  • an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994).
  • the cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose.
  • the combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells -to change colors.
  • Chelsky "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 7-10, 1995).
  • Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel.
  • beads carrying combi- natorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
  • test samples are placed in a porous matrix.
  • One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • the test compound is preferably a small molecule that binds to the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide, such that normal biological activity is prevented.
  • small molecules include, but are not limited. to, small peptides or peptide-like molecules.
  • either the test compound or the calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • a detectable label such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase.
  • Detection of a test compound that is bound to the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
  • binding of a test compound to a human calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide can be determined without labeling either of the interactants.
  • a microphysiometer can be used to detect binding of a test compound with a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide.
  • a microphysiometer e.g., CytosensorTM
  • CytosensorTM is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS).
  • Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide (McConnell et al, Science 257, 1906-1912, 1992).
  • Determining the ability of a test compound to bind to a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct.
  • BiA Bimolecular Interaction Analysis
  • BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcoreTM). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • SPR surface plasmon resonance
  • a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem.
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
  • the assay utilizes two different DNA constructs.
  • polynucleotide encoding a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a • known transcription factor (e.g., GAL-4).
  • a DNA sequence that encodes an unidentified protein (“prey" or "sample” can be fused to a polynucleotide that codes for the activation domain of the known transcription factor.
  • the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide.
  • a reporter gene e.g., LacZ
  • either the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide (or polynucleotide) or the test compound can be bound to a solid support.
  • Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
  • any method known in the art can be used to attach the polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support.
  • Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
  • the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide is a fusion protein comprising a domain that allows the calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide to be bound to a solid support.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St.
  • the test compound or the test compound and the non-adsorbed calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide are then combined with the test compound or the test compound and the non-adsorbed calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
  • a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide or polynucleotide
  • a test compound can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N- hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • antibodies which specifically bind to a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site can be derivatized to the wells of the plate.
  • Unbound target or protein can be trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies which specifically bind to the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide or test compound and SDS gel electrophoresis under non- reducing conditions.
  • Screening for test compounds which bind to a human calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a calcium-independent alpha-lafrotoxin receptor homolog 3 polypeptide or polynucleotide can be used in a cell-based assay system. .
  • a calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide or polynucleotide is determined as described above.
  • Test compounds can be tested for the ability to increase or decrease the functional activity of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide. Functional activity can be measured, for example, as described in the specific examples, below.
  • Functional assays can be carried out after contacting either a purified calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide, a cell membrane preparation, or an intact cell with a test compound.
  • a test compound that decreases functional activity of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing calcium-mdependent alpha-latrotoxin receptor homolog 3 activity.
  • a test compound that increases functional activity of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human calcium-independent alpha-latrotoxin receptor homolog 3 activity.
  • test compounds that increase or decrease calcium-independent alpha-latrotoxin receptor homolog 3 gene expression are identified.
  • a calcium-mdependent alpha-latrotoxin receptor homolog 3 polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide is determined.
  • the level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound.
  • the test compound can then be identified as a modulator of expression based on this comparison.
  • test compound when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression.
  • test compound when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
  • the level of calcium-independent alpha-latrotoxin receptor homolog 3 mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used.
  • the presence of polypeptide products of a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
  • polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide.
  • screening can be carried out either in a cell-free assay system or in an intact cell.
  • Any cell that expresses a human calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide can be used in a cell-based assay system.
  • the calcium- independent alpha-latrotoxin receptor homolog 3 polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
  • compositions of the invention can comprise, for example, a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide, calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide, or mimetics, activators, or inhibitors of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide activity.
  • compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • agent such as stabilizing compound
  • the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, infra-arterial, intramedullary, i ntrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
  • Pharmaceutical compositions for, oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i. e. , dosage.
  • compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as
  • Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides,. or liposomes. Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
  • the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
  • compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
  • Human calcium-independent alpha-latrotoxin receptor homolog 3 can be regulated to treat cardiovascular disorders, CNS disorders, diabetes, and obesity.
  • Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular arrhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
  • Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right- sided or left-sided, systolic or diastolic, independent of the underlying cause.
  • MI Myocardial infarction
  • Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which inadequate to , meet the myocardial requirement for oxygen.
  • This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
  • Arrhythmias include all forms of atrial and ventricular tachyarrhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of arrhythmias.
  • vascular diseases include primary as well as all kinds of secondary arterial hyper- tension (renal, endocrine, neurogenic, others).
  • the disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications.
  • Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
  • PAOD peripheral arterial occlusive disease
  • acute arterial thrombosis and embolism inflammatory vascular disorders
  • Raynaud's phenomenon Raynaud's phenomenon
  • venous disorders venous disorders.
  • Nuclear hormone receptors are involved in biochemical pathways that regulate cholesterol and lipid homeostasis. These receptors are ligand-activated transcription factors, which translate the effects of lipid soluble factors such as hormones, vitamins, fatty acids and various drugs into gene expression.
  • LXR alpha is a member of the nuclear hormone receptor superfamily. The physiologic ligands for this receptor are likely to be specific intermediates in the cholesterol biosynthetic pathways, such as 24(S),25-epoxycholesterol and 22(R)- hydroxycholesterol. LXR alpha modulates the transcription of genes implicated in lipid and lipoprotein metabolism including ABCA1, ABCG1, Apolipoprotein E, SREBP1, FAS, SCD and LPL. It was demonstrated in animal models that activation of LXR alpha increases HDL and reduces arteriosclerotic lesion size. Thus, LXR alpha activation will protect patients with hypoalphalipoproteinemia from CAD via an increase of reverse cholesterol transport.
  • Interference with the function of these receptors will have a substantial benefit in patients with CAD, including but not limited to, atherosclerosis, ischemia/- reperfusion, hypertension, restenosis, and arterial inflammation.
  • Central and peripheral nervous system disorders also can be treated, such as primary and secondary disorders after brain injury, disorders of mood, anxiety disorders, disorders of thought and volition, disorders of sleep and wakefulness, diseases of the motor unit, such as neurogenic and myopathic disorders, neurodegenerative disorders such as Alzheimer's and Parkinson's disease, and processes of peripheral and chronic pain.
  • Pain that is associated with CNS disorders also can be treated. Pain which can be treated includes that associated with central nervous system disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation).
  • central nervous system disorders such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation).
  • Non-central neuropathic pain includes that associated with post mastectomy pain, reflex sympathetic dystrophy (RSD), trigeminal neuralgiara- dioculopathy, post-surgical pain, HIV/AIDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease), paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-herpetic neuralgia.
  • RSD reflex sympathetic dystrophy
  • Pain associated with cancer and cancer treatment also can be treated, as can headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic and chronic tension-type headache,, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania.
  • headache pain for example, migraine with aura, migraine without aura, and other migraine disorders
  • episodic and chronic tension-type headache for example, migraine with aura, migraine without aura, and other migraine disorders
  • tension-type like headache for example, migraine with aura, migraine without aura, and other migraine disorders
  • tension-type like headache for example, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania.
  • Diabetes mellitus is a common metabolic disorder characterized by an abnormal elevation in blood glucose, alterations in lipids and abnormalities (complications) in the cardiovascular system, eye, kidney and nervous system. Diabetes is divided into two separate diseases: type 1 diabetes (juvenile onset), which results from a loss of cells which make and secrete insulin, and type 2 diabetes (adult onset), which is caused by a defect in insulin secretion and a defect in insulin action.
  • type 1 diabetes juvenile onset
  • type 2 diabetes adult onset
  • Type I diabetes is initiated by an autoimmune reaction that attacks the insulin secreting cells (beta cells) in the pancreatic islets.
  • Agents that prevent this reaction from occurring or that stop the reaction before destruction of the beta cells has been accomplished are potential therapies for this disease.
  • Other agents that induce beta cell proliferation and regeneration also are potential therapies.
  • Type II diabetes is the most common of the two diabetic conditions (6% of the population).
  • the defect in insulin secretion is an important cause of the diabetic condition and results from an inability of the beta cell to properly detect and respond to rises in blood glucose levels with insulin release.
  • Therapies that increase the response by the beta cell to glucose would offer an important new treatment for this disease.
  • the defect in insulin action in Type II diabetic subjects is another target for therapeutic intervention.
  • Agents that increase the activity of the insulin receptor in muscle, liver, and fat will cause a decrease in blood glucose and a normalization of plasma lipids.
  • the receptor activity can be increased by agents that directly stimulate the receptor or that increase the intracellular signals from the receptor.
  • Other therapies can directly activate the cellular end process, i.e. glucose transport or various enzyme systems, to generate an insulin-like effect and therefore a produce beneficial outcome. Because overweight subjects have a greater susceptibility to Type II diabetes, any agent that reduces body weight is a possible therapy.
  • Type I and Type II diabetes can be freated with agents that mimic insulin action or that treat diabetic complications by reducing blood glucose levels.
  • agents that reduces new blood vessel growth can be used to treat the eye complications that develop in both diseases.
  • Obesity and overweight are defined as an excess of body fat relative to lean body mass. An increase in caloric intake or a decrease in energy expenditure or both can bring about this imbalance leading to surplus energy being stored as fat. Obesity is associated with important medical morbidities and an increase in mortality. The causes of obesity are poorly understood and may be due to genetic factors, environmental factors or a combination of the two to cause a positive energy balance. In contrast, anorexia and cachexia are characterized by an imbalance in energy intake versus energy expenditure leading to a negative energy balance and weight loss.
  • Agents that either increase energy expenditure and/or decrease energy intake,, absorption or storage would be useful for treating obesity, overweight, and associated comorbidities.
  • Agents that either increase energy intake and/or decrease energy expenditure or increase the amount of lean tissue would be useful for treating cachexia, anorexia and wasting disorders.
  • This gene, translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity, overweight, anorexia, cachexia, wasting disorders, appetite suppression, appetite enhancement, increases or decreases in satiety, modulation of body weight, and/or other eating disorders such as bulimia.
  • this gene translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity/overweight-associated comorbidities including hypertension, type 2 diabetes, coronary artery disease, hyper- lipidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea, and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities, hirsutism, stress incontinence, and depression.
  • obesity/overweight-associated comorbidities including hypertension, type 2 diabetes, coronary artery disease, hyper- lipidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea, and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregular
  • G protein-coupled receptors are integral membrane proteins characterized by seven transmembrane spanning helical domains that mediate the actions of many extracellular signals. GPCRs interact with hetero trimeric guanine nucleotide binding regulatory proteins (G proteins) that modulate a variety of second messenger systems or ionic conductances to effect physiological responses. In fact, almost 50% of currently marketed drugs elicit their therapeutic effects by interacting with GPCRs (Kirkpatrick, Nat. Rev. Drug Disc. 1, 7, 2002).
  • a number of peripherally and centrally acting signaling molecules produce a sense of hunger/satiety or produce elevation in lipid mobilization/oxidation through their interactions with GPCRs.
  • Endocannabinoids, melanin concentrating hormone, serotonin, dopamine, ⁇ PY, ⁇ -MSH, GLP-1, ghrelin and orexin serve as few examples of neurotransmitters/ hormones that modulate satiety and/or energy expenditure through GPCRs (Di Marzo et al, Nature 410:822-25, 2001;
  • GPCRs In addition to modulation of central pathways, GPCRs also play a critical role in regulating energy expenditure in the periphery. For example, selective agonist ligands of ⁇ 3-adrenergic receptors (AR) induce increase in lipolysis and lipid oxidation in rodents resulting in a decrease in body weight (Arch, Eur. J. Pharmacol. 440: 99-107, 2002). A number of ⁇ 3-AR agonists are currently being evaluated in clinical trials for their anti-obesity and anti-diabetic effects. In summary, GPCRs constitute an attractive drug target for the development of effective anti-obesity agents.
  • AR ⁇ 3-adrenergic receptors
  • Small lipophilic molecules such as steroid and thyroid hormones play an important role in the growth, differentiation, metabolism, reproduction, and morphogenesis of higher organisms and humans. Most cellular actions of these molecules are mediated through binding to nuclear receptors that act as ligand-inducible transcription factors by directly interacting as monomers, homodimers, or heterodimers with the retinoid ' X receptor with DNA response elements of target genes, as well as by "cross-talking" to other signaling pathways.
  • ligands have been found for several of these orphan receptors. Some of these ligands are products of lipid metabolism. It is now known that compounds such as fatty acids, leukotrienes, prostaglandin and cholesterol derivatives, bile acids, and pregnanes can regulate gene expression through their binding to nuclear receptors. Therefore, as opposed to classic hormones, other ligands originate intra- cellularly as metabolic products, which may explain why their role as regulators of nuclear receptors was not previously identified by physiological experimentation. Many other orphan receptors may have a still unidentified ligand, but others may act in a constitutive manner or could be activated by other means, i.e., phosphorylation.
  • That orphan receptors also play key roles in development, homeostasis, and disease has been proven by targeted deletion in mice and by their association with different diseases including obesity, cancer, diabetes, or lipid disorders. These findings have opened new strategies for treatment of these diseases, and orphan receptors at this point, together with the search for new agonist and antagonist ligands for classical receptors, constitute important targets for drug discovery. See Physiological Reviews
  • This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model.
  • an agent identified as described herein e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a human calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide binding molecule
  • an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent.
  • this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
  • a reagent which affects calcium-independent alpha-latrotoxin receptor homolog 3 activity can be administered to a human cell, either in vitro or in vivo, to reduce calcium-independent alpha-latrotoxin receptor homolog 3 activity.
  • the reagent preferably binds to an expression product of a human calcium-independent alpha- latrotoxin receptor homolog 3 gene. If the expression product is a protein, the reagent is preferably an antibody.
  • an antibody can be added to a preparation of stem cells that have been removed from the body.
  • the cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
  • the reagent is delivered using a liposome.
  • the liposome is stable in the animal into which it has been administered for at least about
  • a liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human.
  • the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
  • a liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell.
  • the transfection efficiency of a liposome is about
  • a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about
  • Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid com- position and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
  • a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
  • a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151).
  • a reagent such as an antisense oligonucleotide or ribozyme
  • from about 0.1 ⁇ g to about 10 ⁇ g of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ⁇ g to about 5 ⁇ g of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 ⁇ g of polynucleotides is combined with about 8 nmol liposomes.
  • antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
  • Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993);
  • a therapeutically effective dose refers to that amount of active ingredient which increases or decreases functional activity relative to the functional activity which occurs in the absence of the therapeutically effective dose.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals.
  • the dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD 5 o/ED 5 o.
  • compositions that exhibit large therapeutic indices are preferred.
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
  • the exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation. Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE-. or calcium phosphate-mediated transfection.
  • Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about 50 ⁇ g/kg, about 50 ⁇ g to about.5 mg/kg, about 100 ⁇ g to about 500 ⁇ g/kg of patient body weight, and about 200 to about 250 ⁇ g/kg of patient body weight.
  • effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
  • the reagent is preferably an antisense oligonucleotide or a ribozyme.
  • Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
  • a reagent reduces expression of a human calcium-independent alpha- latrotoxin receptor homolog 3 gene or the activity of a calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
  • the effectiveness of the mechanism chosen to decrease the level of expression of a human calcium-independent alpha-latrotoxin receptor homolog 3 gene or the activity of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to calcium-independent alpha-latrotoxin receptor homolog 3- specific mRNA, quantitative RT-PCR, immunologic detection of a human calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide, or measurement of functional activity.
  • any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
  • Human calcium-independent alpha-latrotoxin receptor homolog 3 also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the protein. For example, differences can be determined between the cDNA or genomic sequence encoding calcium-independent alpha- latrotoxin receptor homolog 3 in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
  • Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method.
  • cloned DNA segments can be employed as probes to detect specific DNA segments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
  • DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g. , Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl.
  • the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.
  • direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
  • Altered levels of calcium-independent alpha-latrotoxin receptor homolog 3 also can be detected in various tissues.
  • Assays used to detect levels of the receptor poly- peptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
  • the polynucleotide of SEQ ID NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4 calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide obtained is transfected into human embryonic kidney 293 cells.
  • the cells are scraped from a culture flask into 5 ml of Tris HCl, 5 mM EDTA, pH 7.5, and lysed by sonication. Cell lysates are centrifuged at 1000 ⁇ m for 5 minutes at 4°C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4°C.
  • the pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO 4 , 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1% BSA, 2 mg/ml aprotinin, 0.5 mg/ml leupeptin, and 10 mg/ml phosphoramidon.
  • Optimal membrane suspension dilutions defined as the protein concentration required to bind less than 10%) of an added radioligand, i.e. alpha-latrotoxin, are added to 96-well polypropylene microtiter plates containing ligand, non-labeled peptides, and binding buffer to a final volume of 250 ml.
  • membrane preparations are incubated in the presence of increasing concentrations (0.1 nM to 4 nM) of 125 I ligand.
  • Binding reaction mixtures are incubated for one hour at 30°C. The reaction is stopped by filtration through GF/B filters treated with 0.5% polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program. Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide. Protein concentration is measured by the Bradford method using Bio-Rad Reagent, with bovine serum albumin as a standard. The calcium-independent alpha-latrotoxin receptor homolog 3 activity of the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 is demonstrated. EXAMPLE 2
  • the Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human calcium-independent alpha- latrotoxin receptor homolog 3 polypeptides in yeast.
  • the calcium-independent alpha- latrotoxin receptor homolog 3 -encoding DNA sequence is derived from SEQ ID NO: 1
  • the DNA sequence Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon. Moreover, at both termini recognition sequences for restriction endonucleases are added and after digestion of the multiple cloning site of pPICZ B with the corresponding restriction enzymes the modified DNA sequence is ligated into pPICZB.
  • This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/md-His6 vector is used to transform the yeast.
  • the yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea.
  • the bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San
  • Purified calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione- derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
  • Human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides comprise the amino acid sequence shown in SEQ LD NO: 2.
  • the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
  • the buffer solution containing the test compounds is washed from the wells.
  • Binding of a test compound to a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide is detected by fluorescence measurements of the contents of the wells.
  • a test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide.
  • test compound is administered to a culture of human cells transfected with a calcium-independent alpha-latrotoxin receptor homolog 3 expression construct and incubated at 37°C for 10 to 45 minutes.
  • a culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
  • RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979).
  • Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P-labeled calcium-independent alpha-latrotoxin receptor homolog 3-specific probe at 65°C in Express-hyb (CLONTECH).
  • the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO: 1.
  • a test compound that decreases the calcium-independent alpha-latrotoxin receptor homolog 3-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of calcium-independent alpha- latrotoxin receptor homolog 3 gene expression.
  • subcutaneous adipose tissue subcutaneous adipose tissue, mesenteric adipose tissue, adrenal gland, bone marrow, brain (cerebellum, spinal cord, cerebral cortex, caudate, medulla, substantia nigra, and putamen), colon, fetal brain, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle small intestine, spleen, stomach, testes, thymus, thyroid trachea, and uterus.
  • tissues subcutaneous adipose tissue, mesenteric adipose tissue, adrenal gland, bone marrow, brain (cerebellum, spinal cord, cerebral cortex, caudate, medulla, substantia nigra, and putamen), colon, fetal brain, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle
  • Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis” firstly described in Higuchi et al, BioTechnology 10, 413-17, 1992, and Higuchi et al, BioTechnology 11, 1026-30, 1993.
  • the principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
  • the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission will increase in direct proportion to the amount of the specific amplified product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. 6, 995-1001, 1996).
  • the amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction.
  • the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used. All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700.
  • RNA extraction and cDNA preparation Total RNA from the tissues listed above are used for expression quantification. RNAs labeled "from autopsy” were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer' s protocol.
  • RNA Fifty ⁇ g of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/ ⁇ l RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/ ⁇ l RNase inhibitor (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; lOmM MgCl 2 ; 50 mM NaCl; and 1 mM DTT.
  • RNA is extracted once with 1 volume of phenokchloroform:- isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M sodium acetate, pH5.2, and 2 volumes of ethanol.
  • RNA from the autoptic tissues Fifty ⁇ g of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectrophoto- metric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manu- facturer's protocol. The final concentration of RNA in the reaction mix is 200 ng/ ⁇ L. Reverse transcription is carried out with 2.5 ⁇ M of random hexamer primers.
  • TaqMan quantitative analysis Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy- tetramethyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
  • FAM 6-carboxy-fluorescein
  • TAMRA 6-carboxy- tetramethyl-rhodamine
  • the assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from
  • Human embryonic kidney 293 cells transfected with a polynucleotide which expresses human calcium-independent alpha-latrotoxin receptor homolog 3 are scraped from a culture flask into 5 ml of Tris HCl, 5 mM EDTA, pH 7.5, and lysed by sonication. Cell lysates are centrifuged at 1000 rpm for 5 minutes at 4°C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4°C. The pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO 4 , 1 mM
  • EDTA 100 mM NaCl, pH 7.5, supplemented with 0.1 % BSA, 2 ⁇ g/ml aprotinin, 0.5 mg/ml leupeptin, and 10 ⁇ g/ml phosphoramidon.
  • Optimal membrane suspension dilutions defined as the protein concentration required to bind less than 10 % of the added radioligand, are added to 96-well polypropylene microtiter plates containing I-labeled ligand or test compound, non-labeled peptides, and binding buffer to a final volume of 250 ⁇ l.
  • Binding reaction mixtures are incubated for one hour at 30°C.
  • the reaction is stopped by filtration through GF/B filters treated with 0.5%> polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program.
  • Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide. Protein concentration is measured by the Bradford method using Bio-Rad Reagent, with bovine serum albumin as a standard.
  • a test compound which increases the radioactivity of membrane protein by at least 15% relative to radioactivity of membrane protein which was not incubated with a test compound is identified as a compound which binds to a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide.
  • Receptor-mediated inhibition of cAMP formation can be assayed in host cells which express human calcium-independent alpha-latrotoxin receptor homolog 3.
  • Cells are plated in 96-well plates and incubated in Dulbecco's phosphate buffered saline (PBS) supplemented with 10 mM HEPES, 5 mM theophylline, 2 ⁇ g/ml aprotinin, 0.5 mg/ml leupeptin, and 10 ⁇ g/ml phosphoramidon for 20 minutes at 37°C in 5%
  • PBS Dulbecco's phosphate buffered saline
  • test compound is added and incubated for an additional 10 minutes at 37°C.
  • the medium is aspirated, and the reaction is stopped by the addition of 100 mM HCl.
  • the plates are stored at 4°C for 15 minutes. cAMP content in the stopping solution is measured by radioimmunoassay.
  • Radioactivity is quantified using a gamma counter equipped with data reduction software.
  • a test compound which decreases radioactivity of the contents of a well relative to radioactivity of the contents of a well in the absence of the test compound is identified as a potential inhibitor of cAMP formation.
  • a test compound which increases radioactivity of the contents of a well relative to radioactivity of the contents of a well in the absence of the test compound is identified as a potential enhancer of cAMP formation.
  • Intracellular free calcium concentration can be measured by microspecfrofluorome try using the fluorescent indicator dye Fura-2/AM (Bush et al, J. Neurochem. 57, 562- 74, 1991).
  • Stably transfected cells are seeded onto a 35 mm culture dish containing a glass coverslip insert. Cells are washed with HBS , incubated with a test compound, and loaded with 100 ⁇ l of Fura-2/AM (10 ⁇ M) for 20-40 minutes. After washing with HBS to remove the Fura-2/AM solution, cells are equilibrated in HBS for 10-20 minutes. Cells are then visualized under the 40X objective of a Leitz Fluovert FS microscope.
  • Fluorescence emission is determined at 510 nM, with excitation wavelengths alternating between 340 nM and 380 nM.
  • Raw fluorescence data are converted to calcium concentrations using standard calcium concentration curves and software analysis techniques.
  • a test compound which increases the fluorescence by at least 15% relative to fluorescence in the absence of a test compound is identified as a compound which mobilizes intracellular calcium.
  • Cells which stably express human calcium-independent alpha-latrotoxin receptor homolog 3 cDNA are plated in 96-well plates and grown to confluence. The day before the assay, the growth medium is changed to 100 ⁇ l of medium containing 1% serum and 0.5 ⁇ Ci 3 H-myinositol. The plates are incubated overnight in a CO 2 incubator (5% CO 2 at 37°C). Immediately before the assay, the medium is removed and replaced by 200 ⁇ l of PBS containing 10 mM LiCl, and the cells are equilibrated with the new medium for 20 minutes.
  • cells also are equilibrated with antagonist, added as a 10 ⁇ l aliquot of a 20-fold concentrated solution in PBS.
  • antagonist added as a 10 ⁇ l aliquot of a 20-fold concentrated solution in PBS.
  • the 3 H-inositol phosphate accumulation from inositol phospholipid metabolism is started by adding 10 ⁇ ml of a solution containing a test compound. To the first well 10 ⁇ l are added to measure basal accumulation. Eleven different concentrations of test compound are assayed in the following 11 wells of each plate row. All assays are performed in duplicate by repeating the same additions in two consecutive plate rows.
  • the plates are incubated in a CO incubator for one hour. The reaction is terminated by adding 15 ⁇ l of 50% v/v trichloroacetic acid (TCA), followed by a 40 minute incubation at 4°C. After neutralizing TCA with 40 ⁇ l of 1 M Tris, the content of the wells is transferred to a Multiscreen HV filter plate (Millipore) containing Dowex AG1-X8 (200-400 mesh, formate form). The filter plates are prepared by adding 200 ⁇ l of Dowex AG1-X8 suspension (50% v/v, wate ⁇ resin) to each well. The filter plates are placed on a vacuum manifold to wash or elute the resin bed. Each well is washed 2 times with 200 ⁇ l of water, followed by 2 x 200 ⁇ l of 5 mM sodium tetraborate/60 mM ammonium formate.
  • TCA 50% v/v trichloroacetic acid
  • the 3 H-IPs are eluted into empty 96-well plates with 200 ⁇ l of 1.2 M ammonium formate/0.1 formic acid.
  • the content of the wells is added to 3 ml of scintillation cocktail, and radioactivity is determined by liquid scintillation counting.
  • Binding assays are carried out in a binding buffer containing 50 mM HEPES, pH 7.4, 0.5% BSA, and 5 mM MgCl 2 .
  • the standard assay for radioligand binding to membrane fragments comprising calcium- independent alpha-latrotoxin receptor homolog 3 polypeptides is carried out as follows in 96 well microtiter plates (e.g., Dynatech Immulon II Removawell plates). Radioligand is diluted in binding buffer+ PMSF/Baci to the desired cpm per 50 ⁇ l, then 50 ⁇ l aliquots are added to the wells. For non-specific binding samples, 5 ⁇ l of 40 ⁇ M cold ligand also is added per well.
  • Binding is initiated by adding 150 ⁇ l per well of membrane diluted to the desired concentration (10-30 ⁇ g membrane protein/well) in binding buffer ⁇ PMSF/Baci. Plates are then covered with Linbro mylar plate sealers (Flow Labs) and placed on a Dynatech Microshaker II. Binding is allowed to proceed at room temperature for 1-2 hours and is stopped by centrifuging the plate for 15 minutes at 2,000 x g. The supernatants are decanted, and the membrane pellets are washed once by addition of 200 ⁇ l of ice cold binding buffer, brief shaking, and recentrifugation. The individual wells are placed in 12 x 75 mm tubes and counted in an LKB Gammamaster counter (78% efficiency). Specific binding by this method is identical to that measured when free ligand is removed by rapid (3-5 seconds) filtration and washing on polyethyleneimine-coated glass fiber filters.
  • membrane pellets are resuspended in 200 ⁇ l per microtiter plate well of ice-cold binding buffer without BSA. Then 5 ⁇ l per well of 4 mM N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOS, Pierce) in DMSO is added and mixed. The samples are held on ice and
  • Radiolabeled proteins are visualized by autoradiography of the dried gels with Kodak XAR film and DuPont image intensifier screens.
  • Membrane solubilization is carried out in buffer containing 25 mM Tris, pH 8, 10% glycerol (w/v) and 0.2 mM CaCl (solubilization buffer).
  • the highly soluble detergents including Triton X- 100, deoxycholate, deoxycholate:lysolecithin, CHAPS, and zwittergent are made up in solubilization buffer at 10% concentrations and stored as frozen aliquots. Lysolecithin is made up fresh because of insolubility upon freeze-thawing and digitonin is made fresh at lower concentrations due to its more limited solubility.
  • washed pellets after the binding step are resuspended free of visible particles by pipetting and vortexing in solubilization buffer at 100,000 x g for 30 minutes. The supernatants are removed and held on ice and the pellets are discarded.
  • the intact R:L complex can be assayed by four different methods. All are carried out on ice or in a cold room at 4-10°C).
  • I-hgand complex 19 ⁇ ⁇ ⁇ • precipitated receptor : I-hgand complex is determined by gamma counting of the filters.
  • CPM of receptor I-ligand complex adsorbed to filters are determined by gamma counting.PAR.4. Charcoal/Dextran (Paul and Said, Peptides 7[Suppl. 77,147-149, 1986). Dextran T70 (0.5 g,
  • Binding of biotinyl-receptor to GH Cl membranes is carried out as described above. Incubations are for 1 hour at room temperature. In the standard purification protocol, the binding incubations contain 10 nM Bio-S29. 125 I ligand is added as a tracer at levels of 5,000-100,000 cpm per mg of membrane protein. Control incubations contain 10 ⁇ M cold ligand to saturate the receptor with non-biotinylated ligand.
  • Solubilization of receptor:ligand complex also is carried out as described above, with
  • Immobilized streptavidin (streptavidin cross-linked to 6% beaded agarose, Pierce Chemical Co.; "SA-agarose”) is washed in solubilization buffer and added to the solubilized membranes as 1/30 of the final volume. This mixture is incubated with constant stirring by end-over-end rotation for 4-5 hours at 4-10°C. Then the mixture is applied to a column and the non-bound material is washed through. Binding of radioligand to SA-agarose is determined by comparing cpm in the 100,000 x g supernatant with that in the column effluent after adsorption to SA-agarose.
  • GTP-gamma-S Sigma+0.15% (wt/vol) deoxycholate:lysolecithin +1/1000 (vol/vol) 100.times.4pase.
  • elution buffer 0.15% (wt/vol) deoxycholate:lysolecithin +1/1000 (vol/vol) 100.times.4pase.
  • Eluates from the streptavidin column are incubated overnight (12-15 hours) with immobilized wheat germ agglutinin (WGA agarose, Vector Labs) to adsorb the receptor via interaction of covalently bound carbohydrate with the WGA lectin.
  • the ratio (vol/vol) of WGA-agarose to streptavidin column eluate is generally 1 :400. A range from 1:1000 to 1:200 also can be used.
  • the resin is pelleted by centrifugation, the supernatant is removed and saved, and the resin is washed 3 times (about 2 minutes each) in buffer containing 50 mM HEPES, pH 8,
  • the resin is extracted three times by repeated mixing (vortex mixer on low speed) over a 15-30 minute period on ice, with 3 resin columns each time, of 10 mM N-N'-N"- triacetylchitotriose in the same HEPES buffer used to wash the resin. After each elution step, the resin is centrifuged down and the supernatant is carefully removed, free of WGA-agarose pellets. The three, pooled eluates contain the final, purified receptor.
  • the material non-bound to WGA contain G protein subunits specifically eluted from the streptavidin column, as well as non-specific contaminants. All these fractions are stored frozen at -90°C.
  • Overnight fasted normal rats or mice have elevated rates of gluconeogenesis as do streptozotocin-induced diabetic rats or mice fed ad libitum.
  • Rats are made diabetic with a single intravenous injection of 40 mg/kg of streptozotocin while C57BL/KsJ mice are given 40- 60 mg/kg i.p. for 5 consecutive days.
  • Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels compared to the vehicle-treated control group.
  • Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hyperinsulinemic and insulin resistant.
  • the animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group.
  • Compounds are administered daily either q.d. or b.i.d. by different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group.
  • Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load.
  • compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice.
  • an intravenous glucose load (0.4 g/kg) is given, blood is collected one minute later.
  • Plasma insulin levels are determined.
  • Compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (1 g/kg), bled again after 15, 30, 60 and 90 minutes and plasma glucose levels determined.
  • Compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
  • test compounds which regulate calcium-independent alpha-latrotoxin receptor homolog 3 are administered by different routes (p.o., i.p., s.c, or i.v.) to overnight fasted normal rats or mice.
  • an intravenous glucose load (0.4 g/kg) is given, blood is collected one minute later.
  • Plasma insulin levels are determined.
  • Test compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose.
  • animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (lg/kg), bled again after 15, 30, 60, and
  • Test compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
  • mice Effects on plasma cholesterol levels including HDL cholesterol are typically assessed in humanized apo-AI transgenic mice. Modulation of human target proteins can be determined in corresponding transgenic mice (e.g., CETP transgenic mice). Triglyceride-lowermg is usually evaluated in ob/ob mice or Zucker rats. Animals are fed with normal diets or modified diets (e.g., enriched by 0.5 % cholesterol 20% coconut oil). Standard protocols consist of oral applications once daily for 7 to 10 days at doses ranging from 0,1 to 100 mg/kg. The compounds are dissolved (e.g., in
  • Solutol/ Ethanol/ saline mixtures and applied by oral gavage or intravenous injection.
  • blood samples are typically drawn by retroorbital punctuation.
  • Plasma cholesterol and triglyceride levels are determined with standardized clinical diagnostic kits (e.g., INFINITYTM cholesterol reagent and INFINITYTM triglyceride reagent; Sigma, St. Louis).
  • HDL cholesterol is determined after phosphotungstic acid precipitation of non-HDL lipoproteins or FPLC gel filtration with post-column derivatization of cholesterol using the reagents mentioned above.
  • Plasma levels of human apolipoprotein-AI in relevant humanized transgenic mice are measured by immunoturbidimetry (Sigma).
  • Female conscious SHR (Moellegaard Denmark, 220 - 290 g) are equipped with implantable radiotelemetry, and a data aquisition system (Data Sciences, St. Paul, MN, USA), comprising a chronically implantable transducer/transmitter unit equipped with a fluid-filled catheter is used.
  • the transmitter is implanted into the peritoneal cavity, and the sensing catheter is inserted into the descending aorta.
  • the animals of control groups only receive the vehicle.
  • mean blood pressure and heart rate of treated and untreated control groups are measured.
  • a tip catheter for recording of left ventricular pressure is inserted into the ventricle via the carotid artery (PC350, Millar Instruments, Houston, TX, USA), a hollow catheter is inserted into the femoral artery and connected to a strain gauge (type 4-327-1, Telos Medical, Upland, CA, USA for recording of arterial blood pressure, two venous catheters are inserted into either femoral vein and one additional catheter into a forearm vein for application of the anaesthetic and drugs, respectively, and an oxymetry catheter for recording of oxygen saturation is inserted into the coronary sinus via the jugular vein (Schwarzer IVH4, M ⁇ nchen, Germany).
  • LCX left coronary artery
  • dP/dt Arterial blood pressure, electrocardiogram (lead II), left ventricular pressure, first derivative of left ventricular pressure (dP/dt), heart rate, coronary blood flow, and oxygen saturation in the coronary sinus are continuously recorded on a pen recorder (Brush, Gould, Cleveland, OH, USA). The maximum of dP/dt is used as measure of left ventricular contractility (dP/dtmax). After completion of the instrumentation, an interval of 60 min is allowed for stabilization before the test compound is intravenously applied as bolus injections. Care is taken that all measured cardiovascular parameters have returned to control level before injection of the next dose. Each dose of the test compound is tested at least three times in different animals. The order of injection of the different doses is randomized in each animal.
  • Acute pain is measured on a hot plate mainly in rats.
  • Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to 56°C) and the latency time is measured until the animals show nocifensive behavior, such as stepping or foot licking.
  • the other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature. Subsequently this surface is slowly but constantly heated until the animals begin to lick a hind paw. The temperature which is reached when hind paw licking begins is a measure for pain threshold.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal
  • Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5%> formalin or 10 to 100 ⁇ g capsaicin is injected into one hind paw of the experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the affected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
  • Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to formalin or capsaicin administration.
  • application routes i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal
  • Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia.
  • the first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve.
  • the second variant is the tight Hgation of about the half of the diameter of the common sciatic nerve.
  • a group of models is used in which tight ligations or transections are made of either the L5 and L6 spinal nerves, or the L% spinal nerve only.
  • the fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured.
  • Control animals are treated with a sham operation. Postoperatively, the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc. -Life Science Instruments, Woodland Hills, SA, USA; Electronic von Frey
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by means of a cold plate of 5 to 10°C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity.
  • a further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb.
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal
  • Inflammatory Pain Inflammatory Pain is induced mainly in rats by injection of 0.75 mg carrageenan or complete Freund's adjuvant into one hind paw. The animals develop an edema with mechanical allodynia as well as thermal hyperalgesia. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc-Life Science Instruments, Woodland Hills, SA,
  • Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy, Paw thermal stimulator, G. Ozaki, University of California, USA).
  • a radiant heat source Plant Test, Ugo Basile, Comerio, Italy, Paw thermal stimulator, G. Ozaki, University of California, USA.
  • the second method comprises differences in paw volume by measuring water displacement in a plethysmometer (Ugo Basile, Comerio, Italy).
  • Compounds are tested against uninflamed as well as vehicle treated control groups.
  • Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to pain testing.
  • Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., ⁇ .t, L v., s.c, intradermal, transdermal) prior to pain testing.
  • application routes i.v., i.p., p.o., ⁇ .t, L v., s.c, intradermal, transdermal
  • 6-Hydroxydopamine (6-OH-DA) Lesion. Degeneration of the dopaminergic ni- grostriatal and striatopallidal pathways is the central pathological event in
  • Parkinson's disease This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
  • MFB medium forebrain bundle
  • mice Male Wistar rats (Harlan Winkelmann, Germany), weighing 200+250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques. Animals are administered pargyline on the day of surgery (Sigma, St.
  • DA nigrostriatal pathway 4 ⁇ l of 0.01% ascorbic acid-saline containing 8 ⁇ g of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 ⁇ l/min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur.
  • Stepping Test Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol.
  • the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface.
  • One paw is touching the table, and is then moved slowly sideways (5 s for 1 m), first in the forehand and then in the backhand direction.
  • the number of adjusting steps is counted for both paws in the backhand and forehand direction of movement.
  • the sequence of testing is right paw forehand and backhand adjusting stepping, followed by left paw forehand and backhand directions.
  • the test is repeated three times on three consecutive days, after an initial training period of three days prior to the first testing.
  • Forehand adjusted stepping reveals no consistent differences between lesioned and healthy control animals. Analysis is therefore restricted to backhand adjusted stepping.
  • Balance Test Balance adjustments following postural challenge are also measured during the stepping test sessions.
  • the rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw touching the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement. When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score 3 is given for no reaction of movement. The test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
  • Staircase Test (Paw Reaching).
  • a modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement.
  • Plexiglass test boxes with a central platform and a removable staircase on each side are used.
  • the apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use.
  • For each test the animals are left in the test boxes for 15 min.
  • the double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side.
  • MPTP neurotoxin l-methyl-4-phenyl-l,2,3,6-tetrahydropyridine
  • DAergic mesencephalic dopaminergic
  • TH tyrosine hydroxylase
  • mice are perfused transcardialfy with 0.01 M PBS (pH 7.4) for 2 min, followed by 4% paraformaldehyde (Merck) in PBS for 15 min.
  • PBS pH 7.4
  • 4% paraformaldehyde Merck
  • the brains are removed and placed in 4% paraformaldehyde for 24 h at 4°C. For dehydration they are then transferred to a
  • TH free-floating tyrosine hydroxylase
  • Sections are mounted on to gelatin-coated slides, left to dry overnight, counter- stained with hematoxylin dehydrated in ascending alcohol concentrations and cleared in butylacetate. Coverslips are mounted on entellan.
  • Columbus, OH comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit.
  • the rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse.
  • the system software allows preprogramming of session protocols with varying rotational speeds (0-80 rpm). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod. The system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time of the fall and all the set-up parameters, are recorded.
  • the system also allows a weak current to be passed through the base grid, to aid training.
  • the object recognition task- has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents.
  • a rat is placed in an open field, in which two identical objects are present.
  • the rats inspects both objects during the first trial of the object recognition task.
  • a second trial after a retention interval of for example 24 hours, one of the two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field.
  • the inspection time at each of the objects is registered.
  • the basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
  • Administration of the putative cognition enhancer prior to the first trial pre- dominantly allows assessment of the effects on acquisition, and eventually on consolidation processes.
  • Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
  • the passive avoidance task assesses memory performance in rats and mice.
  • the inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor of the light compartment.
  • Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours.
  • the rat is allowed to explore the apparatus for 300 sec.
  • the rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
  • the guillotine door between the compartments is lowered as soon as the rat has entered the dark compartment with its four paws, and a scrambled 1 mA footshock is administered for 2 sec.
  • the rat is removed from the apparatus and put back into its home cage.
  • the procedure during the retention session is identical to that of the habituation sessions.
  • the step-through latency that is the first latency of entering the dark compartment (in sec.) during the retention session is an index of the memory performance of the animal; the longer the latency to enter the dark compartment, the better the retention is.
  • Scopolamine impairs the memory performance during the retention session 24 hours later. If the test compound increases the enter latency compared with the . scopola ine-treated controls, is likely to possess cognition enhancing potential.
  • the Morris water escape task measures spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice.
  • the performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank.
  • Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence of the experimenter, and by a radio on a shelf that is playing softly.
  • the animals receive four trials during five daily acquisition sessions.
  • a trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized.
  • the escape platform is always in the same position.
  • a trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds.
  • an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds.
  • the probe trial all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
  • rats or mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits, are used.
  • the T-maze spontaneous alternation task assesses the spatial memory performance in mice.
  • the start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter.
  • a mouse is put into the start arm at the beginning of training.
  • the guillotine door is closed.
  • the 'forced trial' either the left or right goal arm is blocked by lowering the guillotine door.
  • the mouse After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for
  • the percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials
  • Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start of the training session. Scopolamine reduced the per-cent alternations to chance level, or below.
  • a cognition enhancer which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
  • This protocol is to determine the effect of chronic administration of an unknown compound on body weight and food and water consumption in obese Zucker fa/fa rats.
  • Obese Zucker fa/fa rats are frequently used in the determination of compound efficacy in the reduction of body weight.
  • This animal model has been successfully used in the identification and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans 2 ' 3 ' 4 & 5 .
  • Rats are kept in standard animal rooms under controlled temperature and humidity and a 12/12 light dark cycle. Water and food are continuously available. Rats are single housed in large rat shoeboxes containing grid floor. Animals are adapted to the grid floors and sham dosed with study vehicle for at least four days before the recording of two-days baseline measurement of body weight and 24 hr food and water consumption. Rats are assigned to one of 6-8 treatment groups based upon their body weight on baseline. The groups are set up so that the mean and standard error of the mean of body weight were similar.
  • Animals are orally gavaged (2ml/ kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/compound. At this time, body weight, food and water consumption are measured. On the final day, animals are euthanized using CO 2 inhalation.
  • the purpose of this protocol is to determine the effect of chronic administration of an unknown compound on body weight of mice made obese by exposure to a 45% kcal/g high fat diet during more than 10 weeks.
  • the body weight of mice selected for the studies is higher than three standard deviations from the weight of a control group of mice fed standard low fat (5-6% fat) mouse chow.
  • Diet-induced obese (DIO) animals are frequently used in the determination of compound efficacy in the reduction of body weight 1, 2 ' 3 ' 4 .
  • This animal model has been successfully used in the identification and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans ' ' .
  • Animals are orally gavaged (5 ml/kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/ - compound. At this time, body weight, food and water consumption are measured.
  • Diazoxide restores beta-3 adrenergic receptor function in diet-induced obesity and diabetes. Endocrinology, 141 (10), 3630-7.
  • This protocol is to determine the effect of a single dose of an unknown compound on food consumption of lean overnight fasted rats.
  • the fasted-refed rat model is frequently used in the field of obesity to identify compounds with potential for anorectic effects.
  • This animal model has been successfully used in the identification and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans 1, 2 ' 3 & 4 .
  • the efficacy test The rats are fasted overnight during the dark phase (total of approx. 16-18 hrs). The animal is dosed orally with his assigned treatment (2mg.ml). One hour after dosing, pre-weighed food jars are returned to the cage. Food intake is recorded 30, 60, 90, 180, 240 minutes post food return. At each time point, spillage is returned to the food jar and then the food jars are weighed. The amount of food consumed is determined for each time point. Difference between treatment group is determined using appropriate statistical analysis.
  • RNA from each cell or tissue source was first reverse transcribed. Eighty-five ⁇ g of total RNA was reverse transcribed using 1 ⁇ mole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany) and 3000 U RnaseQut (Invitrogen, Groningen, Netherlands) in a final volume of 680 ⁇ l.
  • the first strand synthesis buffer and Omniscript reverse transcriptase (2 u/ ⁇ l) were obtained from (Qiagen, Hilden, Germany). The reaction was incubated at 37°C for 90 minutes and cooled on ice. The volume was adjusted to 6800 ⁇ l with water, yielding a final concentration of 12.5 ng/ ⁇ l of starting RNA.
  • Primerl ggatcctgatgaaccaccac The reverse primer sequence was Primer2 ggataccaccaccaccaatcagg.
  • Probe 1 tccaccaagaccaatgctcagattt, labeled with , FAM (carboxyfluorescein succinimidyl ester) as the reporter dye and TAlvlRA (carboxy- tetramethylrhodamine) as the quencher, was used as a probe.
  • the following reagents were prepared in a total of 25 ⁇ l : lx TaqMan buffer A, 5.5 mM MgCl 2 , 200 nM of dATP, dCTP, dGTP, and dUTP, 0.025 U/ ⁇ l AmpliTaq GoldTM, 0.01 U/ ⁇ l AmpErase, and Probel tccaccaagaccaatgctcagattt, forward and reverse primers each at 200 nM, 200 nM , FAM/TAMRA-labeled probe, and 5 ⁇ 1 of template cDNA.
  • Thermal cycling parameters were 2 min at 50°C, followed by 10 min at 95°C, followed by 40 cycles of melting at 95°C for 15 sec and annealing/extending at 60°C for 1 min. Calculation of corrected CT values
  • the CT (threshold cycle) value is calculated as described in the "Quantitative determination of nucleic acids" section.
  • the CF-value (factor for threshold cycle correction) is calculated as follows:
  • PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
  • CTn KG -values were calculated as described in the "Quantitative determination of nucleic acids" section.
  • CT HKG - n -mean value (CT H ⁇ .G. -value + CT ⁇ G2 -value + ... + CT ⁇ G - n -value) / n
  • CT C DNA-n CT value of the tested gene for the cDNA n
  • CF CD N A -_ correctionion factor for cDNA n
  • CT c o r-cD N A-n corrected CT value for a gene on cDNA n
  • CT cor . cDNA . n ⁇ 40 is defined as CT cor .
  • CDNA [high] Relative Expression 2 (CTcor - cDNA[h,sh] " CTCO .- C DNA - complicat )
  • the following tissues were tested: fetal , heart, heart, pericardium, heart atrium (right), heart atrium (left), heart ventricle (left), heart ventricle (right), heart apex, Purkinje fibers, interventricular septum, fetal aorta, aorta, artery, coronary artery, pulmonary artery, carotid artery, mesenteric artery, vein, pulmonic valve, coronary artery smooth muscle primary cells, HUVEC cells, skin, adrenal gland, thyroid, thyroid tumor, pancreas, pancreas liver cirrhosis, esophagus, esophagus tumor, stomach, stomach tumor, colon, colon tumor, small intestine, ileum, ileum tumor,
  • breast tumor mammary gland
  • prostate prostate BPH
  • bladder ureter
  • penis corpus cavernos urn
  • fetal kidney kidney, kidney tumor, HEK 293 cells.
  • HUVEC cells 27 fetal brain 64634 brain 19349 alzheimer brain 25888 cerebellum 2257 cerebellum (right) 148489 cerebellum (left) 95950 cerebral cortex 69755 alzheimer cerebral cortex 116502 frontal lobe 87682 alzheimer brain frontal lobe 77398 occipital lobe 87682 parietal lobe 96618 temporal lobe 155872 precentral gyrus 123145 postcentral gyrus 1468 tonsilla cerebelli 108701 vermis cerebelli 75281 pons 80684 substantia nigra 282913 cerebral meninges 175 cerebral peduncles 39787 corpus callosum 46663 hippocampus 140479 thalamus 33689 dorsal root ganglia 101 spinal cord 24322 neuroblastoma SK-N-MC cells 2998 neuroblastoma SH-SY5Y cells 28329 neuroblastoma IMR32 cells 31652
  • HeLa cells (cervix tumor) 1 placenta 3373 uterus 4182 uterus tumor 3848 ovary 7132 ovary tumor 43538 breast 9542 breast tumor 739
  • MDA MB 231 cells (breast tumor) 43 mammary gland 1618
  • the expression profile shows that human calcium-independent alpha-latrotoxin receptor homolog 3 is involved in the following diseases and conditions: cardiovascular diseases, central nervous system diseases, diabetis, obesity, dermatological diseases, endocrinological diseases, gastrointestinal diseases, liver diseases, cancer, neurological diseases, respriratory diseases, diseases of the reproductive system, genito-urological diseases.
  • Modulators of the human calcium-independent alpha- latrotoxin receptor homolog 3 can be used to treat cardiovascular diseases, central nervous system diseases, diabetis, obesity, dermatological diseases, endocrinological diseases, gastrointestinal diseases, liver diseases, cancer, neurological diseases, respriratory diseases, diseases of the reproductive system, genito-urological diseases.
  • Regulators of the expression of human calcium-independent alpha-latrotoxin receptor homolog 3 can be used to treat cardiovascular diseases, central nervous system diseases, diabetis, obesity, dermatological diseases, endocrinological diseases, gastrointestinal diseases, liver diseases, cancer, neurological diseases, respriratory diseases, diseases of the reproductive system, genito-urological diseases. .
  • alpha-Latrotoxin receptor CIRL/latrophilin 1 defines an unusual family of ubiquitous G-protein-linked receptors. G-protein coupling not required for triggering exocytosis. JBiol Chem 1998 273(49):32715-24.
  • alpha-Latrotoxin and its receptors neurexins and CIRL/latrophilins Annu Rev Neurosci 2001;24:933-62.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Endocrinology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Reagents that regulate human calcium-independent alpha-latrotoxin receptor homolog 3 and reagents which bind to human calcium-independent alpha-latrotoxin receptor homolog 3 gene products can play a role in preventing, ameliorating, or correcting dysfunctions or diseases including, but not limited to, cardiovascular disorders, CNS disorders, diabetes, and obesity.

Description

REGULATION OF HUMAN CALCIUM-INDEPENDENT ALPHA-LATRQTOXIN RECEPTOR HOMOLOG 3
This application incorporates by reference copending provisional application Serial No. 60/413,156 filed September 25, 2002 and Serial No. 60/460,877 filed April 8, 2003.
FIELD OF THE INVENTION
The invention relates to the regulation of human calcium-independent alpha- latrotoxin receptor homolog 3.
BACKGROUND OF THE INVENTION
Many medically significant biological processes are mediated by signal transduction pathways that involve G proteins (Lefkowitz, Nature 351, 353-54, 1991). The family of G protein-coupled receptors (GPCR) includes receptors for hormones, neurotransmitters, growth factors, and viruses. Specific examples of GPCRs include receptors for such diverse agents as calcitonin, adrenergic hormones, endothelin, cAMP, adenosine, acetylcholine, serotonin, dopamine, histamine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1, rhodopsins, odorants, cytomegalovirus, G proteins themselves, effector proteins such as phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins such as protein kinase A and protein kinase C.
The GPCR protein superfamily now contains over 250 types of paralogues, receptors that represent variants generated by gene duplications (or other processes), as opposed to orthologues, the same receptor from different species. The superfamily can be broken down into five families: Family I, receptors typified by rhodopsin and the β2-adrenergic receptor and currently represented by over 200 unique members (reviewed by Dohlman et al., Ann. Rev. Biochem. 60, 653-88, 1991, and references therein); Family II, the recently characterized parathyroid hormone/calcitonin/- secretin receptor family (Juppner et al., Science 254, 1024-26, 1991; Lin et al., Science 254, 1022-24, 1991); Family III, the metabotropic glutamate receptor family in mammals (Nakanishi, Science 258, 597-603, 1992); Family IN, the cAMP receptor family, important in the chemotaxis and development of D. discoideum (Klein et al, Science 241, 1467-72, 1988; and Family N, the fmgal mating pheromone receptors such as STE2 (reviewed by Kurjan, Ann. Rev. Biochem. 61, 1097-129, 1992).
GPCRs possess seven conserved membrane-spanning domains connecting at least eight divergent hydrophilic loops. GPCRs (also known as 7TM receptors) have been characterized as including these seven conserved hydrophobic stretches of about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops. Most GPCRs have single conserved cysteine residues in each of the first two extracellular loops, which form disulfide bonds that are believed to stabilize functional protein, structure. The seven transmembrane regions are designated as TM1, TM2, TM3, TM4, TM5, TM6, and TM7. TM3 has been implicated in signal transduction.
Phosphorylation and lipidation (palmitylation or farnesylation) of cysteine residues can influence signal transduction of some GPCRs. Most GPCRs contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus. For several GPCRs, phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization.
For some receptors, the ligand binding sites of GPCRs are believed to comprise hydrophilic sockets formed by several GPCR transmembrane domains. The hydrophilic sockets are surrounded by hydrophobic residues of the GPCRs. The hydrophilic side of each GPCR transmembrane helix is postulated to face inward and form a polar ligand binding site. TM3 has been implicated in several GPCRs as having a ligand binding site, such as the TM3 aspartate residue. TM5 serines, a TM6 asparagine, and TM6 or TM7 phenylalanines or tyrosines also are implicated in ligand binding.
GPCRs are coupled inside the cell by heterotrimeric G proteins to various intra- cellular enzymes, ion channels, and transporters (see Johnson et al., Endoc. Rev. 10,
317-31, 1989). Different G protein alpha subunits preferentially stimulate particular effectors to modulate various biological functions in a cell. Phosphorylation of cytoplasmic residues of GPCRs is an important mechanism for the regulation of some GPCRs. For example, in one form of signal transduction, the effect of hormone binding is the activation inside the cell of the enzyme, adenylate cyclase. Enzyme activation by hormones is dependent on the presence of the nucleotide GTP. GTP also influences hormone binding. A G protein connects the hormone receptor to adenylate cyclase. G protein exchanges GTP for bound GDP when activated by a hormone receptor. The GTP-carrying form then binds to activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G protein itself, returns the G protein to its basal, inactive form. Thus, the G protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.
Over the past 15 years, nearly 350 therapeutic agents targeting GPCRs receptors have been successfully introduced onto the market. This indicates that these receptors have an established, proven history as therapeutic targets.
Alpha-Latrotoxin Receptor
Alpha-latrotoxin (ALX), a neurotoxic protein contained in black widow spider venom, stimulates a robust release of neurotransmitters and the subsequent degeneration of the affected nerve terminals. This effect is mediated by ALX binding to a G protein-coupled receptor called latropbilin (Ichtchenko et al, J. Biol. Chem. 274, 5491-98, 1999; Rahman et al, Philos. Trans. R. Soc. Lond. B Biol. Sci.
28, 39-86, 1999). There are two populations of ALX receptors, calcium-dependent and calcium-independent (Capogna et al, J. Neurophysiol. 75, 2017-28, 1996; Krasnoperov et al, J. Biol. Chem. 274, 3590-96, 1999; Ichtchenko et al, J. Biol. Chem. 274, 5491-98, 1999; Krasnoperov et al, Neuron 18, 925-37, 1997; Hlubek et al, Mol. Pharmacol. 57, 519-28, 2000; Henkel et al, Cell Tissue Res. 296, 229-33, 1999; Lelianova et al, J. Biol. Chem. 272, 21504-08, 1997; Sugita et al, J. Biol.
Chem. 273, 32715-24, 1998). Because of the dramatic effect of ALX on exocytosis, there is a need in the art to identify additional members of the ALX GCPR family whose activity can be regulated to provide therapeutic effects.
It is an object of the invention to provide reagents and methods of regulating a human calcium-independent alpha-latrotoxin receptor homolog 3. This and other objects of the invention are provided by one or more of the embodiments described below.
BRIEF DESCRIPTION OF THE FIGURES
Fig. 1 shows the DNA-sequence encoding a calcium-independent alpha- latrotoxin receptor homolog 3 Polypeptide (SEQ ID NO: 1).
Fig. 2 " shows the amino acid sequence deduced from the DNA-sequence of
Fig.l (SEQ ID NO: 2).
DETAILED DESCRIPTION OF THE INVENTION
The invention relates to an isolated polynucleotide from the group consisting of:
a) a polynucleotide encoding a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 95% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
b) a polynucleotide comprising the sequence of SEQ ID NO: 1 ;
c) a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b) and encodes a Calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide;
d) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code and encodes a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide; and
e) a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a Calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide.
A newly identified human calcium-independent alpha-latrotoxin receptor homolog 3 comprises the amino acid sequence shown in SEQ LD NO: 2. A coding sequence for human calcium-independent alpha-latrotoxin receptor homolog 3 is shown in SEQ ID NO: 1. This sequence is located on chromosome 4ql3.1. Related ESTs (BI460679; BF969782; BQ340423; H15996; T10303; H29414; BE938352; H24417; BF933505; N69327) are expressed in testis, adrenal cortex carcinoma, infant brain, and cochlea.
In the protein of the present invention a galactose binding lectin domain, an olfactomedin-like domain, a hormone receptor domain, a lafrophilin/ CL-1-like GPS domain, and a seven transmembrane receptor (secretm family) and latrophilm cytoplasmic C-terminal region were identified. The location of these domains are shown in FIG. 1. Human calcium-independent alpha-latrotoxin receptor homolog 3 of the invention is expected to be useful for the same purposes as previously identified calcium- independent alpha-latrotoxin receptors. Human calcium-independent alpha- latrotoxin receptor homolog 3 is believed to be useful in therapeutic methods to treat disorders such as cardiovascular disorders, CNS disorders, diabetes, and obesity. Human calcium-independent alpha-latrotoxin receptor homolog 3 also can be used to screen for human calcium-independent alpha-latrotoxin receptor homolog 3 activators and inhibitors.
One embodiment of the present invention is an expression vector containing any polynucleotide of the present invention.
Yet another embodiment of the present invention is a host cell containing any expression vector of the present invention.
Still another embodiment of the present invention is a substantially purified Calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide encoded by any polynucleotide of the present invention.
Even another embodiment of the present invention is a method of producing a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide of the present invention, wherein the method comprises the following steps:
a. culturing the host cells of the present invention under conditions suitable for the expression of the Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide; and
b. recovering the Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide from the host cell culture. Yet another embodiment of the present invention is a method for detecting a polynucleotide encoding a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide in a biological sample comprising the following steps:
a. hybridizing any polynucleotide of the present invention to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and
b. detecting said hybridization complex.
Still another embodiment of the present invention is a method for detecting a polynucleotide of the present invention or a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide of the present invention comprising the steps of:
a. contacting a biological sample with a reagent which specifically interacts with the polynucleotide or the Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide and
b. detecting the interaction
Even another embodiment of the present invention is a diagnostic kit for conducting any method of the present invention.
Yet another embodiment of the present invention is a method of screening for agents which decrease the activity of a Calcium-mdependent alpha-latrotoxin receptor homolog 3, comprising the steps of:
a. contacting a test compound with a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide encoded by any polynucleotide of the present invention; b. detecting binding of the test compound to the Calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3.
Still another embodiment of the present invention is a method of screening for agents which regulate the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3, comprising the steps of:
a. contacting a test compound with a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide encoded by any polynucleotide of the present invention; and
b. detecting a Calcium-independent alpha-latrotoxin receptor homolog 3 activity of the polypeptide, wherein a test compound which increases the Calcium- independent alpha-latrotoxin receptor homolog 3 activity is identified as a potential therapeutic agent for increasing the activity of the Calcium- independent alpha-latrotoxin receptor homolog 3, and wherein a test com- pound which decreases the Calcium-independent alpha-latrotoxin receptor homolog 3 activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity of the Calcium-independent alpha-latrotoxin receptor homolog 3.
Even another embodiment of the present invention is a method of screening for agents which decrease the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3, comprising the step of:
contacting a test compound with any polynucleotide of the present invention and detecting binding of the test compound to the polynucleotide, wherein a test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of Calcium-independent alpha-latrotoxin receptor homolog 3.
Yet another embodiment of the present invention is a method of reducing the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3, comprising the step of:
contacting a cell with a reagent which specifically binds to any polynucleotide of the present invention or any Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide of the present invention, whereby the activity of Calcium-independent alpha-latrotoxin receptor homolog 3 is reduced.
Still another embodiment of the present invention is a reagent that modulates the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide or a polynucleotide wherein said reagent is identified by any methods of the present invention.
Even another embodiment of the present invention is a pharmaceutical composition, comprising
an expression vector of the present invention or a reagent of the present invention and a pharmaceutically acceptable carrier.
Yet another embodiment of the present invention is the use of an expression vector of the present invention or a reagent of the present invention for modulating the activity of a Calcium-independent alpha-latrotoxin receptor homolog 3 in a disease, preferably a cardiovascular disorder, a CNS disorder, diabetes or obesity.
The invention thus provides a human calcium-independent alpha-latrotoxin receptor homolog 3 that can be used to identify test compounds that may act, for example, as activators or inhibitors. Human calcium-independent alpha-latrotoxin receptor homolog 3 and fragments thereof also are useful in raising specific antibodies that can block the protein and effectively reduce its activity.
Polypeptides
Human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides according to the invention comprise at least 6, 10, 15, 20, 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, or 1551 contiguous amino acids selected from the amino acid sequence shown in SEQ ID NO: 2 or a biologically active variant thereof, as defined below. A calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide of the invention therefore can be a portion of a calcium-independent alpha-latrotoxin receptor homolog 3 protein, a full-length calcium-independent alpha-latrotoxin receptor homolog 3 protein, or a fusion protein comprising all or a portion of a calcium- independent alpha-latrotoxin receptor homolog 3 protein.
Biologically active variants
Human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide variants that are biologically active, e.g., retain functional activity, also are human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides. Preferably, naturally or non-naturally occurring human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide variants have amino acid sequences which are at least about 95, 96, 97, 98, or 99% identical to the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof.
Percent identity between a putative human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide variant and an amino acid sequence of SEQ ID NO: 2 is determined by conventional methods. See, for example, Altschul et al, Bull. Math. Bio. 48:603 (1986), and Henikoff & Henikoff, Proc. Natl. Acad. Sci.
USA SP:10915 (1992). Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "BLOSUM62" scoring matrix of Henikoff & Henikoff, 1992.Those skilled in the art appreciate that there are many established algorithms available to align two amino acid sequences. The "FASTA" similarity search algorithm of Pearson & Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant. The FASTA algorithm is described by Pearson & Lipman, Proc. Nat'lAcad. Sci. USA 55:2444(1988), and by Pearson, Meth. Enzymol. 183:63 (1990). Briefly, FASTA first characterizes sequence similarity by identifying regions shared by the query sequence (e.g., SEQ ID NO: 2) and a test sequence that have either the highest density of identities (if the ktup variable is 1) or pairs of identities (if ktup=2), without considering conservative amino acid substitutions, insertions, or deletions. The ten regions with the highest density of identities are then rescored by comparing the similarity of all paired amino acids using an amino acid substitution matrix, and the ends of the regions are "trimmed" to include only those residues that contribute to the highest score. If there are several regions with scores greater than the "cutoff value (calculated by a predetermined formula based upon the length of the sequence the ktup value), then the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps. Finally, the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch- Sellers algorithm (Needleman & Wunsch, J Mol. Biol.48:444 (1970); Sellers, SIAM J. Appl. Math.26:181 (1974)), which allows for amino acid insertions and deletions. Preferred parameters for FASTA analysis are: ktup=l, gap opening penalty=10, gap extension penalty=l, and substitution matrix=BLOSUM62. These parameters can be introduced into a
FASTA program by modifying the scoring matrix file ("SMATRIX"), as explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63 (1990).
"% identity" of a first sequence towards a second sequence, within the meaning of the invention, means the % identity which is calculated as follows: First the optimal global alignment between the two sequences is determined with the CLUSTALW algorithm [Thomson JD, Higgins DG, Gibson TJ. 1994. ClustalW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22:
4673-4680], Version 1.8, applying the following command line syntax: . /clustai -infile= . /inf ile . txt -output= -outorder=aligned -pwι. atrix=gonnet
-pwdnaι_atrix=clustalw -pwgapopen=10 . 0 -pwgapext=0 . 1 -matrix=gonnet
-gapopen=10 . 0 -gapext=0 . 05 -gapdist=8 -hgapresidues=GPSNDQERK
-maxdiv=40 . Implementations of the CLUSTAL W algorithm are readily available at numerous sites on the internet, including, e.g., http://www.ebi.ac.uk. Thereafter, the number of matches in the alignment is determined by counting the number of identical nucleotides (or amino acid residues) in aligned positions. Finally, the total number of matches is divided by the number of nucleotides (or amino acid residues) of the longer of the two sequences, and multiplied by 100 to yield the % identity of the first sequence towards the second sequence.
FASTA can also be used to determine the sequence identity of nucleic acid molecules using a ratio as disclosed above. For nucleotide sequence comparisons, the ktup value can range between one to six, preferably from three to six, most preferably three, with other parameters set as default.
Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions. Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
Amino acid insertions or deletions are changes to or within an amino acid sequence.
They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a human calcium-mdependent alpha- latrotoxin receptor homolog 3 polypeptide can be found using computer programs well known in the art, such as DNASTAR software.
The invention additionally, encompasses calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides that are differentially modified during or after translation, e.g., by gly cosy lation, acety lation, phosphorylation, amidation, derivati- zation by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications can be carried out by known techniques including, but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, N8 protease,
ΝaBH4, acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
Additional post-translational modifications encompassed by the invention include, for example, e.g., N-lin ed or O-linked carbohydrate chains, processing of N- terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of prokaryotic host cell expression. The calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
The invention also provides chemically modified derivatives of calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptides that may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Patent No. 4,179,337). The chemical moieties for derivitization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethyl- cellulose, dextran, polyvinyl alcohol, and the like. The polypeptides can be modified at random or predetermined positions within the molecule and can include one, two, three, or more attached chemical moieties.
Whether an amino acid change or a polypeptide modification results in a biologically active calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can readily be determined by assaying for functional activity, as described in the specific examples, below.
Fusion proteins
Fusion proteins are useful for generating antibodies against calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins that interact with portions of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
A human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond. The first polypeptide segment comprises a calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide, such as those described above. The first polypeptide segment also can comprise full-length calcium-independent alpha- latrotoxin receptor homolog 3 protein.
The second polypeptide segment can be a full-length protein or a protein fragment. Proteins commonly used in fusion protein construction include β-galactosidase, β- glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). Addition- ally, epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, NSN-G tags, and thioredoxin (Trx) tags. Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DΝA binding domain (DBD) fusions, GAL4 DΝA binding domain fusions, and herpes simplex virus (HSN) BP16 protein fusions. A fusion protein also can be engineered to contain a cleavage site located between the calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide-encoding sequence and the heterologous protein sequence, so that the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be cleaved and purified away from the heterologous moiety.
A fusion protein can be synthesized chemically, as is known in the art. Preferably, a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology. Recombinant DΝA methods can be used to prepare fusion proteins, for example, by making a DΝA construct which comprises coding sequences selected from SEQ ID NO: 1 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art. Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).
Identification of species homologs
Species homologs of human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be obtained using calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of calcium-inde- pendent alpha-latrotoxin receptor homolog 3 polypeptide, and expressing the cDNAs as is known in the art.
Polynucleotides
A human calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide. A coding sequence for human calcium-independent alpha- latrotoxin receptor homolog 3 is shown in SEQ ID NO: 1.
Degenerate nucleotide sequences encoding human calcium-independent alpha- latrotoxin receptor homolog 3 polypeptides, as well as homologous nucleotide sequences which are at least about 50, 55, 60, 65, 70, preferably about 75, 90, 96, 98, or 99% identical to the nucleotide sequence shown in SEQ ID NO: 1 or its complement also are calcium-mdependent alpha-latrotoxin receptor homolog 3 polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2. Complementary DNA (cDNA) molecules, species homologs, and variants of calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides that encode biologically active calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides also are calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides. Polynucleotide fragments comprising at least 8, 9, 10, 11, 12, 15, 20, or 25 contiguous nucleotides of SEQ ID NO: 1 or its complement also are calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides. These fragments can be used, for example, as hybridization probes or as antisense oligonucleotides. Identification of polynucleotide variants and homologs
Variants and homologs of the calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides described above also are calcium-independent alpha- latrotoxin receptor homolog 3 polynucleotides. Typically, homologous calcium- independent alpha-latrotoxin receptor homolog 3 polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known calcium- independent alpha-latrotoxin receptor homolog 3 polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions-2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50°C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each—homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.
Species homologs of the calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the Tm of a double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et al, J. Mol. Biol. 81, 123 (1973). Variants of human calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides or calcium-mdependent alpha-latrotoxin receptor homolog 3 polynucleotides of other species can therefore be identified by hybridizing a putative homologous calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO: 1 or the complement thereof to form a test hybrid. The melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising poly- nucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.
Nucleotide sequences which hybridize to calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides or their complements following stringent hybridization and/or wash conditions also are calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides. Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
Typically, for stringent hybridization conditions a combination of temperature and salt concentration should be chosen that is approximately 12-20°C below the calculated Tm of the hybrid under study. The Tm of a hybrid between a calcium- independent alpha-latrotoxin receptor homolog 3 polynucleotide having a nucleotide sequence shown in SEQ ID NO: 1 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
Tm = 81.5°C - 16.6(logιo[Na+]) + 0.41(%G + C) - 0.63(%formamide) - 600/1), . where / = the length of the hybrid in basepairs.
Stringent wash conditions include, for example, 4X SSC at 65°C, or 50%o formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C. Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
Preparation of polynucleotides
A human calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids. Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such teclmique for obtaining a polynucleotide can be used to obtain isolated calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments, which comprise calcium-independent alpha-latrotoxin receptor homolog 3 nucleotide sequences. Isolated polynucleotides are in preparations that are free or at least 70, 80, or 90% free of other molecules.
Human calcium-independent alpha-latrotoxin receptor homolog 3 cDNA molecules can be made with standard molecular biology techniques, lϊsing calcium-independent alpha-latrotoxin receptor homolog 3 mRNA as a template. Human calcium- independent alpha-latrotoxin receptor homolog-3 cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.
Alternatively, . synthetic chemistry techniques can be used to synthesize calcium- independent alpha-latrotoxin receptor homolog 3 polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide having, for example, an amino acid sequence shown in SEQ ID NO: 2 or a biologically active variant thereof.
Extending polynucleotides
Various PCR-based methods can be used to extend the nucleic acid sequences disclosed herein to detect upstream sequences such as promoters and regulatory elements. Sarkar, PCR Methods Applic. 2, 318-322, 1993; Triglia et al, Nucleic Acids Res. 16, 8186, 1988; Lagersfrom et al, PCR Methods Applic. 1, 111-119, 1991; Parker et al, Nucleic Acids Res. 19, 3055-3060, 1991). Additionally, PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA (CLONTECH, Palo Alto, Calif). See WO 01/98340.
Obtaining Polynucleotides
Human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides can be obtained, for example, by purification from human cells, by expression of calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides, or by direct chemical synthesis.
Protein purification
Human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides can be purified from any human cell which expresses the receptor, including host cells which have been transfected with calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotides. A purified calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide is separated from other compounds that normally associate with the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chroma- tography, affinity chromatography, and preparative gel electrophoresis.
A preparation of purified calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis. Expression of polynucleotides
To express a human calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide, the polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding calcium- independent alpha-latrotoxin receptor homolog 3 polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y., 1989.
A variety of expression vector/host systems can be utilized to contain and express sequences encoding a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems. See WO 01/98340.
Host cells
A host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding and/or function. Different host cells that have specific cellular machinery and characteristic mechanisms for post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38) are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein. See WO 01/98340.
Detecting expression
Although the presence of marker gene expression suggests that the calcium- independent alpha-latrotoxin receptor homolog 3 polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a human calcium-independent alpha-latrotoxin receptor homolog 3 poly- peptide is inserted within a marker gene sequence, transformed cells containing sequences which encode a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding a calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide.
Alternatively, host cells which contain a human calcium-independent alpha- latrotoxin receptor homolog 3 polynucleotide and which express a human calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide can be identified by a variety of procedures known to those of skill in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RLA), and fluorescence activated cell sorting (FACS). Hampton et al, SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St. Paul, Minn., 1990) and
Maddox et al, J. Exp. Med. 158, 1211-1216, 1983). See also WO 01/98340. A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide. Alternatively, sequences encoding a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromo genie agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
Expression and purification of polypeptides
Host cells transformed with nucleotide sequences encoding a human calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides can be designed to contain signal sequences which direct secretion of soluble calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides through a prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide. See WO 01/98340. - 2A -
Chemical synthesis
Sequences encoding a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Nucl. Acids Res. Symp. Ser. 215-223, 1980; Horn et al. Nucl. Acids Res. Symp. Ser. 225-232, 1980). Alternatively, a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques
(Merrifield, J Am. Chem. Soc. 85, 2149-2154, 1963; Roberge et al, Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Optionally, fragments of calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptides can be separately synthesized and combined using chemical methods to produce a full- length molecule.
Production of altered polypeptides
As will be understood by those of skill in the art, it may be advantageous to produce calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
Antibodies
Any type of antibody known in the art can be generated to bind specifically to an epitope of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide. "Antibody" as used herein includes intact immunogiobulin molecules, as well as fragments thereof, such as Fab, F(ab')2, and Fv, which are capable of binding an epitope of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide. Typically, at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope. However, epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
An antibody which specifically binds to an epitope of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art. Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody that specifically binds to the immunogen.
Typically, an antibody that specifically binds to a human calcium-mdependent alpha- latrotoxin receptor homolog 3 polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay. Preferably, antibodies that specifically bind to calcium- independent alpha-latrotoxin receptor homolog 3 polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a human calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide from solution. See WO 01/98340.
Antisense oligonucleotides
Antisense oligonucleotides are nucleotide sequences that are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, - or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level pf calcium-independent alpha-latrotoxin receptor homolog 3 gene products in the cell.
Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combi- nation of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkyl- phosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.
Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmarm et al, Chem. Rev. 90, 543-583, 1990.
Modifications of calcium-independent alpha-latrotoxin receptor homolog 3 gene expression can be obtained by designing antisense oligonucleotides that will form duplexes to the control, 5', or regulatory regions of the calcium-independent alpha- latrotoxin receptor homolog 3 gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons. Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et al, in Huber & Carr, MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura Publishing Co., Mt. Kisco, N.Y., 1994). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes. See WO 01/98340.
Ribozymes
Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin.
Struct. Biol. 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673). The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage..
Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
The coding sequence of a human calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide can be used to generate ribozymes that will specifically bind to mRNA transcribed from the calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide. Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591,
1988). For example, the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme. The hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201). See WO 01/98340.
Differentially expressed genes
Described herein are methods for the identification of genes whose products interact with human calcium-independent alpha-latrotoxin receptor homolog 3. Such genes may represent genes that are differentially expressed in disorders including, but not limited to, cardiovascular disorders, CNS disorders, diabetes, and obesity. Further, such genes may represent genes that are differentially regulated in response to manipulations relevant to the progression or treatment of such diseases. Additionally, such genes may have a temporally modulated expression, increased or decreased at different stages of tissue or organism development. A differentially expressed gene may also have its expression modulated under control versus experimental conditions. In addition, the human calcium-independent alpha-latrotoxin receptor homolog 3 gene or gene product may itself be tested for differential expression.
The degree to which expression differs in a normal versus a diseased state need only be large enough to be visualized via standard characterization techniques such as differential display techniques. Other such standard characterization techniques by which expression differences may be visualized include but are not limited to, quantitative RT (reverse transcriptase), PCR, and Northern analysis.
To identify differentially expressed genes total RNA or, preferably, mRNA is isolated from tissues of interest. For example, RNA samples are obtained from tissues of experimental subjects and from corresponding tissues of control subjects. Any RNA isolation technique that does not select against the isolation of mRNA may be utilized for the purification of such RNA samples. See, for example, Ausubel et al, ed., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, Inc. New York, 1987-1993. Large numbers of tissue samples may readily be processed using techniques well known to those of skill in the art, such as, for example, the single-step RNA isolation process of Chomczynski, U.S. Patent 4,843,155.
Transcripts within the collected RNA samples that represent RNA produced by differentially expressed genes are identified by methods well known to those of skill in the art. They include, for example, differential screening (Tedder et al, Proc. Natl. Acad. Sci. U.S.A. 85, 208-12, 1988), subfractive hybridization (Hedrick et al, Nature 308, 149-53; Lee et al, Proc. Natl. Acad. Sci. U.S.A. 88, 2825, 1984), and, preferably, differential display (Liang & Pardee, Science 257, 967-71, 1992; U.S.
Patent 5,262,311).
The differential expression information may itself suggest relevant methods for the treatment of disorders involving the human calcium-independent alpha-latrotoxin receptor homolog 3. For example, treatment may include a modulation of expression of the differentially expressed genes and/or the gene encoding the human calcium- independent alpha-latrotoxin receptor homolog 3. The differential expression information may indicate whether the expression or activity of the differentially expressed gene or gene product or the human calcium-independent alpha-latrotoxin receptor homolog 3 gene or gene product are up-regulated or down-regulated.
Screening methods
The invention provides assays for screening test compounds that bind to or modulate the activity of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide or a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polynucleotide. A test compound preferably binds to a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide or polynucleotide. More preferably, a test compound decreases or increases functional activity by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound. Test compounds
Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced re- combinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
Methods for the synthesis of molecular libraries are well known in the art (see, for example, DeWitt et al, Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al, J. Med. Chem. 37, 2678,
1994; Cho et al, Science 261, 1303, 1993; Carell et al, Angew. Chem. Int. Ed. Engl 33, 2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al, J. Med. Chem. 37, 1233, 1994). Libraries of compounds can be presented in solution (see, e.g., Houghten, BioTechniques 13, 412-421, 1992), or on beads (Lam, Nature 354, 82-84, 1991), chips (Fodor, Nature 364, 555-556, 1993), bacteria or spores
(Ladner, U.S. Patent 5,223,409), plasmids (Cull et al, Proc. Natl. Acad. Sci. U.S.A. 89, 1865-1869, 1992), or phage (Scott & Smith, Science 249, 386-390, 1990; Devlin, Science 249, 404-406, 1990); Cwirla et al, Proc. Natl Acad. Sci. 97, 6378-6382, 1990; Felici, J Mol. Biol. 222, 301-310, 1991; and Ladner, U.S. Patent 5,223,409). High throughput screening
Test compounds can be screened for the ability to bind to calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides or polynucleotides or to affect calcium-independent alpha-latrotoxin receptor homolog 3 activity or calcium- independent alpha-latrotoxin receptor homolog 3 gene expression using high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 μl. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
Alternatively, "free format assays," or assays that have no physical barrier between samples, can be used. For example, an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994). The cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells -to change colors.
Another example of a free format assay is described by Chelsky, "Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 7-10, 1995). Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combi- natorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
Yet another example is described by Salmon et al, Molecular Diversity 2, 57-63 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.
Another high throughput screening method is described in Beutel et al, U.S. Patent 5,976,813. In this method, test samples are placed in a porous matrix. One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support. When samples are introduced to the porous matrix they diffuse sufficiently slowly, such that the assays can be performed without the test samples running together.
Binding assays
For binding assays, the test compound is preferably a small molecule that binds to the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide, such that normal biological activity is prevented. Examples of such small molecules include, but are not limited. to, small peptides or peptide-like molecules.
In binding assays, either the test compound or the calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound that is bound to the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product. Alternatively, binding of a test compound to a human calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide can be determined without labeling either of the interactants. For example, a microphysiometer can be used to detect binding of a test compound with a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide. A microphysiometer (e.g., Cytosensor™) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide (McConnell et al, Science 257, 1906-1912, 1992).
Determining the ability of a test compound to bind to a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct.
Biol. 5, 699-705, 1995). BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore™). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
In yet another aspect of the invention, a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046-12054, 1993; Bartel et al, BioTechniques 14, 920-924, 1993; Iwabuchi et al, Oncogene 8, 1693-1696, 1993; and Brent W094/10300), to identify other proteins which bind to or interact with the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide and modulate its activity.
The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. For example, in one construct, polynucleotide encoding a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a • known transcription factor (e.g., GAL-4). In the other construct a DNA sequence that encodes an unidentified protein ("prey" or "sample") can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact in vivo to form an protein- dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein that interacts with the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide.
It may be desirable to immobilize either the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide (or polynucleotide) or the test compound to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, either the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide (or polynucleotide) or the test compound can be bound to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the solid support. Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
In one embodiment, the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide is a fusion protein comprising a domain that allows the calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide to be bound to a solid support. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
Other techniques for immobilizing proteins or polynucleotides on a solid support also can be used in the screening assays of the invention. For example, either a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS(N- hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which specifically bind to a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies which specifically bind to the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide or test compound and SDS gel electrophoresis under non- reducing conditions.
Screening for test compounds which bind to a human calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a calcium-independent alpha-lafrotoxin receptor homolog 3 polypeptide or polynucleotide can be used in a cell-based assay system.. A calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide or polynucleotide is determined as described above.
Functional activity
Test compounds can be tested for the ability to increase or decrease the functional activity of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide. Functional activity can be measured, for example, as described in the specific examples, below.
Functional assays can be carried out after contacting either a purified calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide, a cell membrane preparation, or an intact cell with a test compound. A test compound that decreases functional activity of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for decreasing calcium-mdependent alpha-latrotoxin receptor homolog 3 activity. A test compound that increases functional activity of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential therapeutic agent for increasing human calcium-independent alpha-latrotoxin receptor homolog 3 activity.
Gene expression
In another embodiment, test compounds that increase or decrease calcium-independent alpha-latrotoxin receptor homolog 3 gene expression are identified. A calcium-mdependent alpha-latrotoxin receptor homolog 3 polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide is determined. The level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.
The level of calcium-independent alpha-latrotoxin receptor homolog 3 mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide. Either qualitative or quantitative methods can be used. The presence of polypeptide products of a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a human calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide. Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell that expresses a human calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide can be used in a cell-based assay system. The calcium- independent alpha-latrotoxin receptor homolog 3 polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.
Pharmaceutical compositions
The invention also provides pharmaceutical compositions that can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the invention can comprise, for example, a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide, calcium-independent alpha-latrotoxin receptor homolog 3 polynucleotide, ribozymes or antisense oligonucleotides, antibodies which specifically bind to a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide, or mimetics, activators, or inhibitors of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide activity. The compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
In addition to the active ingredients, these pharmaceutical compositions can contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries that facilitate processing of the active compounds into preparations which can be used pharmaceutically. Pharmaceutical compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, infra-arterial, intramedullary, i ntrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means. Pharmaceutical compositions for, oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i. e. , dosage.
Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
Pharmaceutical formulations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as
Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides,. or liposomes. Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the suspension also can contain suitable stabilizers or agents that increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
The pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. The pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms. In other cases, the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
Therapeutic indications and methods
Human calcium-independent alpha-latrotoxin receptor homolog 3 can be regulated to treat cardiovascular disorders, CNS disorders, diabetes, and obesity.
Cardiovascular disorders
Cardiovascular diseases include the following disorders of the heart and the vascular system: congestive heart failure, myocardial infarction, ischemic diseases of the heart, all kinds of atrial and ventricular arrhythmias, hypertensive vascular diseases, and peripheral vascular diseases.
Heart failure is defined as a pathophysiologic state in which an abnormality of cardiac function is responsible for the failure of the heart to pump blood at a rate commensurate with the requirement of the metabolizing tissue. It includes all forms of pumping failure, such as high-output and low-output, acute and chronic, right- sided or left-sided, systolic or diastolic, independent of the underlying cause.
Myocardial infarction (MI) is generally caused by an abrupt decrease in coronary blood flow that follows a thrombotic occlusion of a coronary artery previously narrowed by arteriosclerosis. MI prophylaxis (primary and secondary prevention) is included, as well as the acute treatment of MI and the prevention of complications.
Ischemic diseases are conditions in which the coronary flow is restricted resulting in a perfusion which inadequate to, meet the myocardial requirement for oxygen. This group of diseases includes stable angina, unstable angina, and asymptomatic ischemia.
Arrhythmias include all forms of atrial and ventricular tachyarrhythmias (atrial tachycardia, atrial flutter, atrial fibrillation, atrio-ventricular reentrant tachycardia, preexcitation syndrome, ventricular tachycardia, ventricular flutter, and ventricular fibrillation), as well as bradycardic forms of arrhythmias.
Vascular diseases include primary as well as all kinds of secondary arterial hyper- tension (renal, endocrine, neurogenic, others). The disclosed gene and its product may be used as drug targets for the treatment of hypertension as well as for the prevention of all complications. Peripheral vascular diseases are defined as vascular diseases in which arterial and/or venous flow is reduced resulting in an imbalance between blood supply and tissue oxygen demand. It includes chronic peripheral arterial occlusive disease (PAOD), acute arterial thrombosis and embolism, inflammatory vascular disorders, Raynaud's phenomenon, and venous disorders.
Nuclear hormone receptors and cardiovascular diseases
Nuclear hormone receptors are involved in biochemical pathways that regulate cholesterol and lipid homeostasis. These receptors are ligand-activated transcription factors, which translate the effects of lipid soluble factors such as hormones, vitamins, fatty acids and various drugs into gene expression.
LXR alpha is a member of the nuclear hormone receptor superfamily. The physiologic ligands for this receptor are likely to be specific intermediates in the cholesterol biosynthetic pathways, such as 24(S),25-epoxycholesterol and 22(R)- hydroxycholesterol. LXR alpha modulates the transcription of genes implicated in lipid and lipoprotein metabolism including ABCA1, ABCG1, Apolipoprotein E, SREBP1, FAS, SCD and LPL. It was demonstrated in animal models that activation of LXR alpha increases HDL and reduces arteriosclerotic lesion size. Thus, LXR alpha activation will protect patients with hypoalphalipoproteinemia from CAD via an increase of reverse cholesterol transport.
It is reasonable, to assume that additional nuclear receptors of this family will be detected which might be functionally involved in the process of atherosclerosis.
Interference with the function of these receptors will have a substantial benefit in patients with CAD, including but not limited to, atherosclerosis, ischemia/- reperfusion, hypertension, restenosis, and arterial inflammation.
CNS disorders
Central and peripheral nervous system disorders also can be treated, such as primary and secondary disorders after brain injury, disorders of mood, anxiety disorders, disorders of thought and volition, disorders of sleep and wakefulness, diseases of the motor unit, such as neurogenic and myopathic disorders, neurodegenerative disorders such as Alzheimer's and Parkinson's disease, and processes of peripheral and chronic pain.
Pain that is associated with CNS disorders also can be treated. Pain which can be treated includes that associated with central nervous system disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation). Non-central neuropathic pain includes that associated with post mastectomy pain, reflex sympathetic dystrophy (RSD), trigeminal neuralgiara- dioculopathy, post-surgical pain, HIV/AIDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy, vasculitic neuropathy secondary to connective tissue disease), paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, trigeminal neuralgia, cranial neuralgias, and post-herpetic neuralgia. Pain associated with cancer and cancer treatment also can be treated, as can headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic and chronic tension-type headache,, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania.
Diabetes
Diabetes mellitus is a common metabolic disorder characterized by an abnormal elevation in blood glucose, alterations in lipids and abnormalities (complications) in the cardiovascular system, eye, kidney and nervous system. Diabetes is divided into two separate diseases: type 1 diabetes (juvenile onset), which results from a loss of cells which make and secrete insulin, and type 2 diabetes (adult onset), which is caused by a defect in insulin secretion and a defect in insulin action.
Type I diabetes is initiated by an autoimmune reaction that attacks the insulin secreting cells (beta cells) in the pancreatic islets. Agents that prevent this reaction from occurring or that stop the reaction before destruction of the beta cells has been accomplished are potential therapies for this disease. Other agents that induce beta cell proliferation and regeneration also are potential therapies.
Type II diabetes is the most common of the two diabetic conditions (6% of the population). The defect in insulin secretion is an important cause of the diabetic condition and results from an inability of the beta cell to properly detect and respond to rises in blood glucose levels with insulin release. Therapies that increase the response by the beta cell to glucose would offer an important new treatment for this disease.
The defect in insulin action in Type II diabetic subjects is another target for therapeutic intervention. Agents that increase the activity of the insulin receptor in muscle, liver, and fat will cause a decrease in blood glucose and a normalization of plasma lipids. The receptor activity can be increased by agents that directly stimulate the receptor or that increase the intracellular signals from the receptor. Other therapies can directly activate the cellular end process, i.e. glucose transport or various enzyme systems, to generate an insulin-like effect and therefore a produce beneficial outcome. Because overweight subjects have a greater susceptibility to Type II diabetes, any agent that reduces body weight is a possible therapy.
Both Type I and Type II diabetes can be freated with agents that mimic insulin action or that treat diabetic complications by reducing blood glucose levels. Likewise, agents that reduces new blood vessel growth can be used to treat the eye complications that develop in both diseases.
Obesity
Obesity and overweight are defined as an excess of body fat relative to lean body mass. An increase in caloric intake or a decrease in energy expenditure or both can bring about this imbalance leading to surplus energy being stored as fat. Obesity is associated with important medical morbidities and an increase in mortality. The causes of obesity are poorly understood and may be due to genetic factors, environmental factors or a combination of the two to cause a positive energy balance. In contrast, anorexia and cachexia are characterized by an imbalance in energy intake versus energy expenditure leading to a negative energy balance and weight loss.
Agents that either increase energy expenditure and/or decrease energy intake,, absorption or storage would be useful for treating obesity, overweight, and associated comorbidities. Agents that either increase energy intake and/or decrease energy expenditure or increase the amount of lean tissue would be useful for treating cachexia, anorexia and wasting disorders.
This gene, translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity, overweight, anorexia, cachexia, wasting disorders, appetite suppression, appetite enhancement, increases or decreases in satiety, modulation of body weight, and/or other eating disorders such as bulimia.
Also this gene, translated proteins and agents which modulate this gene or portions of the gene or its products are useful for treating obesity/overweight-associated comorbidities including hypertension, type 2 diabetes, coronary artery disease, hyper- lipidemia, stroke, gallbladder disease, gout, osteoarthritis, sleep apnea, and respiratory problems, some types of cancer including endometrial, breast, prostate, and colon cancer, thrombolic disease, polycystic ovarian syndrome, reduced fertility, complications of pregnancy, menstrual irregularities, hirsutism, stress incontinence, and depression.
G protein-coupled receptors and obesity treatment
G protein-coupled receptors (GPCRs) are integral membrane proteins characterized by seven transmembrane spanning helical domains that mediate the actions of many extracellular signals. GPCRs interact with hetero trimeric guanine nucleotide binding regulatory proteins (G proteins) that modulate a variety of second messenger systems or ionic conductances to effect physiological responses. In fact, almost 50% of currently marketed drugs elicit their therapeutic effects by interacting with GPCRs (Kirkpatrick, Nat. Rev. Drug Disc. 1, 7, 2002).
A number of peripherally and centrally acting signaling molecules produce a sense of hunger/satiety or produce elevation in lipid mobilization/oxidation through their interactions with GPCRs. There are numerous examples of neurotransmitters and hormones acting on central satiety pathways. Endocannabinoids, melanin concentrating hormone, serotonin, dopamine, ΝPY, α-MSH, GLP-1, ghrelin and orexin serve as few examples of neurotransmitters/ hormones that modulate satiety and/or energy expenditure through GPCRs (Di Marzo et al, Nature 410:822-25, 2001;
Marsh et al, Proc. Natl. Acad. Sci. USA PP:3240-45, 2002; Νonogaki et al, Nat. Med. 4:1152-56, 1998; Gadde et al, Obes. Res. P:544-51, 2001; Danielsa et al, Peptides 22:483-91, 2001; Hinney et al, J. Clin. Endocrin. Metabol. 84: 1483-86, 1999; Meier et al, Eur. J. Pharmacol. 440:269-79, 2002; Νakazato et al, Nature 409: 194-98, 2001; Haynes et al, Regul. Pept. 104: 153-59, 2002). Small molecule agonists or antagonists ligands of these GPCRs would serve as effective anti-obesity therapeutics.
In addition to modulation of central pathways, GPCRs also play a critical role in regulating energy expenditure in the periphery. For example, selective agonist ligands of β3-adrenergic receptors (AR) induce increase in lipolysis and lipid oxidation in rodents resulting in a decrease in body weight (Arch, Eur. J. Pharmacol. 440: 99-107, 2002). A number of β3-AR agonists are currently being evaluated in clinical trials for their anti-obesity and anti-diabetic effects. In summary, GPCRs constitute an attractive drug target for the development of effective anti-obesity agents.
Nuclear receptors and obesity treatment
Small lipophilic molecules such as steroid and thyroid hormones play an important role in the growth, differentiation, metabolism, reproduction, and morphogenesis of higher organisms and humans. Most cellular actions of these molecules are mediated through binding to nuclear receptors that act as ligand-inducible transcription factors by directly interacting as monomers, homodimers, or heterodimers with the retinoid ' X receptor with DNA response elements of target genes, as well as by "cross-talking" to other signaling pathways. Our knowledge of regulation of gene expression by nuclear receptors has grown spectacularly during the last years, mainly due to the realization that not only the interaction of the receptors with DNA was important for transcriptional responses, but also that many coregulators (coactivators and corepressors) were crucial in transmitting the hormonal signal to the transcriptional machinery.
Cloning of receptors for steroid and thyroid hormones demonstrates that these receptors share an extensive homology. This observation led to a search for new proteins with similar structure. During the course of the last decade, the identification and characterization of close to fifty human receptors have led to the discovery of new hormonal responses and to the novel concept of "reverse endocrinology," in which the characterization of the receptor precedes the study of its physiological function. Regulatory ligands for many of these receptors have not yet been identified, and they have been called "orphan receptors."
In the last years ligands have been found for several of these orphan receptors. Some of these ligands are products of lipid metabolism. It is now known that compounds such as fatty acids, leukotrienes, prostaglandin and cholesterol derivatives, bile acids, and pregnanes can regulate gene expression through their binding to nuclear receptors. Therefore, as opposed to classic hormones, other ligands originate intra- cellularly as metabolic products, which may explain why their role as regulators of nuclear receptors was not previously identified by physiological experimentation. Many other orphan receptors may have a still unidentified ligand, but others may act in a constitutive manner or could be activated by other means, i.e., phosphorylation. That orphan receptors also play key roles in development, homeostasis, and disease has been proven by targeted deletion in mice and by their association with different diseases including obesity, cancer, diabetes, or lipid disorders. These findings have opened new strategies for treatment of these diseases, and orphan receptors at this point, together with the search for new agonist and antagonist ligands for classical receptors, constitute important targets for drug discovery. See Physiological Reviews
57, 1269-304, 2001.
This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a human calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide binding molecule) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
A reagent which affects calcium-independent alpha-latrotoxin receptor homolog 3 activity can be administered to a human cell, either in vitro or in vivo, to reduce calcium-independent alpha-latrotoxin receptor homolog 3 activity. The reagent preferably binds to an expression product of a human calcium-independent alpha- latrotoxin receptor homolog 3 gene. If the expression product is a protein, the reagent is preferably an antibody. For treatment of human cells ex vivo, an antibody can be added to a preparation of stem cells that have been removed from the body.
The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
In one embodiment, the reagent is delivered using a liposome. Preferably, the liposome is stable in the animal into which it has been administered for at least about
30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours. A liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human. Preferably, the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.
A liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell. Preferably, the transfection efficiency of a liposome is about
0.5 μg of DNA per 16 nmole of liposome delivered to about 106 cells, more preferably about 1.0 μg of DNA per 16 nmole of liposome delivered to about 106 cells, and even more preferably about 2.0 μg of DNA per 16 nmol of liposome delivered to about 106 cells. Preferably, a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about
200 and 400 nm in diameter. Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid com- position and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol. Optionally, a liposome comprises a compound capable of targeting the liposome to a particular cell type, such as a cell-specific ligand exposed on the outer surface of the liposome.
Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods that are standard in the art (see, for example, U.S. Patent 5,705,151). Preferably, from about 0.1 μg to about 10 μg of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 μg to about 5 μg of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 μg of polynucleotides is combined with about 8 nmol liposomes.
In another embodiment, antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery. Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993);
Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988); Wu et al, J. Biol. Chem. 269, 542-46 (1994); Zenke et al, Proc. Natl. Acad. Sci. U.S.A. 87, 3655-59 (1990); Wu et al, J. Biol. Chem. 266, 338-42 (1991).
Determination of a therapeutically effective dose
The determination of a therapeutically effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient which increases or decreases functional activity relative to the functional activity which occurs in the absence of the therapeutically effective dose. For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
Therapeutic efficacy and toxicity, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD5o/ED5o.
Pharmaceutical compositions that exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors that can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation. Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
If the reagent is a single-chain antibody, polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun," and DEAE-. or calcium phosphate-mediated transfection.
Effective in vivo dosages of an antibody are in the range of about 5 μg to about 50 μg/kg, about 50 μg to about.5 mg/kg, about 100 μg to about 500 μg/kg of patient body weight, and about 200 to about 250 μg/kg of patient body weight. For administration of polynucleotides encoding single-chain antibodies, effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA.
If the expression product is mRNA, the reagent is preferably an antisense oligonucleotide or a ribozyme. Polynucleotides that express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
Preferably, a reagent reduces expression of a human calcium-independent alpha- latrotoxin receptor homolog 3 gene or the activity of a calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent. The effectiveness of the mechanism chosen to decrease the level of expression of a human calcium-independent alpha-latrotoxin receptor homolog 3 gene or the activity of a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to calcium-independent alpha-latrotoxin receptor homolog 3- specific mRNA, quantitative RT-PCR, immunologic detection of a human calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide, or measurement of functional activity.
In any of the embodiments described above, any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents . can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
Any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
Diagnostic methods
Human calcium-independent alpha-latrotoxin receptor homolog 3 also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences that encode the protein. For example, differences can be determined between the cDNA or genomic sequence encoding calcium-independent alpha- latrotoxin receptor homolog 3 in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is likely to be the causative agent of the disease.
Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method. In addition, cloned DNA segments can be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.
Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g. , Myers et al, Science 230, 1242, 1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e.g., Cotton et al, Proc. Natl. Acad. Sci. USA 85, 4397-4401, 1985). Thus, the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA. In addition to direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.
Altered levels of calcium-independent alpha-latrotoxin receptor homolog 3 also can be detected in various tissues. Assays used to detect levels of the receptor poly- peptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.
All patents and patent applications cited in this disclosure are expressly incorporated herein by reference. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples, which are provided for purposes of illustration only and are not intended to limit the scope of the invention.
EXAMPLE 1
Detection of calcium-independent alpha-latrotoxin receptor homolog 3 activity
The polynucleotide of SEQ ID NO: 1 is inserted into the expression vector pCEV4 and the expression vector pCEV4 calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide obtained is transfected into human embryonic kidney 293 cells. The cells are scraped from a culture flask into 5 ml of Tris HCl, 5 mM EDTA, pH 7.5, and lysed by sonication. Cell lysates are centrifuged at 1000 φm for 5 minutes at 4°C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4°C.
The pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO4, 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1% BSA, 2 mg/ml aprotinin, 0.5 mg/ml leupeptin, and 10 mg/ml phosphoramidon. Optimal membrane suspension dilutions, defined as the protein concentration required to bind less than 10%) of an added radioligand, i.e. alpha-latrotoxin, are added to 96-well polypropylene microtiter plates containing ligand, non-labeled peptides, and binding buffer to a final volume of 250 ml.
In equilibrium saturation binding assays, membrane preparations are incubated in the presence of increasing concentrations (0.1 nM to 4 nM) of 125I ligand.
Binding reaction mixtures are incubated for one hour at 30°C. The reaction is stopped by filtration through GF/B filters treated with 0.5% polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program. Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide. Protein concentration is measured by the Bradford method using Bio-Rad Reagent, with bovine serum albumin as a standard. The calcium-independent alpha-latrotoxin receptor homolog 3 activity of the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 is demonstrated. EXAMPLE 2
Expression of recombinant human calcium-independent alpha-latrotoxin receptor homolog 3
The Pichia pastoris expression vector pPICZB (Invitrogen, San Diego, CA) is used to produce large quantities of recombinant human calcium-independent alpha- latrotoxin receptor homolog 3 polypeptides in yeast. The calcium-independent alpha- latrotoxin receptor homolog 3 -encoding DNA sequence is derived from SEQ ID
NO: 1. Before insertion into vector pPICZB, the DNA sequence is modified by well known methods in such a way that it contains at its 5 '-end an initiation codon and at its 3 '-end an enterokinase cleavage site, a His6 reporter tag and a termination codon. Moreover, at both termini recognition sequences for restriction endonucleases are added and after digestion of the multiple cloning site of pPICZ B with the corresponding restriction enzymes the modified DNA sequence is ligated into pPICZB. This expression vector is designed for inducible expression in Pichia pastoris, driven by a yeast promoter. The resulting pPICZ/md-His6 vector is used to transform the yeast.
The yeast is cultivated under usual conditions in 5 liter shake flasks and the recombinantly produced protein isolated from the culture by affinity chromatography (Ni-NTA-Resin) in the presence of 8 M urea. The bound polypeptide is eluted with buffer, pH 3.5, and neutralized. Separation of the polypeptide from the His6 reporter tag is accomplished by site-specific proteolysis using enterokinase (Invitrogen, San
Diego, CA) according to manufacturer's instructions. Purified human calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide is obtained. EXAMPLE 3
Identification of test compounds that bind to calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides
Purified calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione- derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution. Human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptides comprise the amino acid sequence shown in SEQ LD NO: 2. The test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
The buffer solution containing the test compounds is washed from the wells.
Binding of a test compound to a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound that increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide.
EXAMPLE 4
Identification of a test compound which decreases calcium-independent alpha- latrotoxin receptor homolog 3 gene expression
A test compound is administered to a culture of human cells transfected with a calcium-independent alpha-latrotoxin receptor homolog 3 expression construct and incubated at 37°C for 10 to 45 minutes. A culture of the same type of cells that have not been transfected is incubated for the same time without the test compound to provide a negative control.
RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979). Northern blots are prepared using 20 to 30 μg total RNA and hybridized with a 32P-labeled calcium-independent alpha-latrotoxin receptor homolog 3-specific probe at 65°C in Express-hyb (CLONTECH). The probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO: 1. A test compound that decreases the calcium-independent alpha-latrotoxin receptor homolog 3-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of calcium-independent alpha- latrotoxin receptor homolog 3 gene expression.
EXAMPLE 5
Tissue-specific expression of calcium-independent alpha-latrotoxin receptor homolog 3
The qualitative expression pattern of calcium-independent alpha-latrotoxin receptor homolog 3 in various tissues is determined by Reverse Transcription-Polymerase
Chain Reaction (RT-PCR).
Quantitative expression profiling
To demonstrate that calcium-independent alpha-latrotoxin receptor homolog 3 is involved in the disease process of diabetes, the following whole body panel is screened to show predominant or relatively high expression: subcutaneous and mesenteric adipose tissue, adrenal gland, bone marrow, brain, colon, fetal brain, heart, hypothalamus, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle, small intestine, spleen, stomach, testis, thymus, thyroid, trachea, and uterus. Human islet cells and an islet cell library also are tested. As a final step, the expression of calcium-independent alpha-latrotoxin receptor homolog 3 in cells derived from normal individuals with the expression of cells derived from diabetic individuals is compared.
To demonstrate that calcium-independent alpha-latrotoxin receptor homolog 3 is involved in the disease process of obesity, expression is determined in the following tissues: subcutaneous adipose tissue, mesenteric adipose tissue, adrenal gland, bone marrow, brain (cerebellum, spinal cord, cerebral cortex, caudate, medulla, substantia nigra, and putamen), colon, fetal brain, heart, kidney, liver, lung, mammary gland, pancreas, placenta, prostate, salivary gland, skeletal muscle small intestine, spleen, stomach, testes, thymus, thyroid trachea, and uterus. Neuroblastoma cell lines SK- Nr-Be (2), Hr, Sk-N-As, HTB-10, IMR-32, SNSY-5Y, T3, SK-N-D2, D283, DAOY, CHP-2, U87MG, BE(2)C, T986, KANTS, MO59K, CHP234, C6 (rat), SK-N-F1, SK-PU-DW, PFSK-1, BE(2)M17, and MCIXC also are tested for calcium- independent alpha-latrotoxin receptor homolog 3 expression. As a final step, the expression of calcium-independent alpha-latrotoxin receptor homolog 3 in cells derived from normal individuals with the expression of cells derived from obese individuals is compared.
Quantitative expression profiling is performed by the form of quantitative PCR analysis called "kinetic analysis" firstly described in Higuchi et al, BioTechnology 10, 413-17, 1992, and Higuchi et al, BioTechnology 11, 1026-30, 1993. The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies.
If the amplification is performed in the presence of an internally quenched fluorescent oligonucleotide (TaqMan probe) complementary to the target sequence, the probe is cleaved by the 5 '-3' endonuclease activity of Taq DNA polymerase and a fluorescent dye released in the medium (Holland et al, Proc. Natl. Acad. Sci. U.S.A. 88, 7276-80, 1991). Because the fluorescence emission will increase in direct proportion to the amount of the specific amplified product, the exponential growth phase of PCR product can be detected and used to determine the initial template concentration (Heid et al, Genome Res. 6, 986-94, 1996, and Gibson et al, Genome Res. 6, 995-1001, 1996).
The amplification of an endogenous control can be performed to standardize the amount of sample RNA added to a reaction. In this kind of experiment, the control of choice is the 18S ribosomal RNA. Because reporter dyes with differing emission spectra are available, the target and the endogenous control can be independently quantified in the same tube if probes labeled with different dyes are used. All "real time PCR" measurements of fluorescence are made in the ABI Prism 7700.
RNA extraction and cDNA preparation. Total RNA from the tissues listed above are used for expression quantification. RNAs labeled "from autopsy" were extracted from autoptic tissues with the TRIzol reagent (Life Technologies, MD) according to the manufacturer' s protocol.
Fifty μg of each RNA were treated with DNase I for 1 hour at 37°C in the following reaction mix: 0.2 U/μl RNase-free DNase I (Roche Diagnostics, Germany); 0.4 U/μl RNase inhibitor (PE Applied Biosystems, CA); 10 mM Tris-HCl pH 7.9; lOmM MgCl2; 50 mM NaCl; and 1 mM DTT.
After incubation, RNA is extracted once with 1 volume of phenokchloroform:- isoamyl alcohol (24:24:1) and once with chloroform, and precipitated with 1/10 volume of 3 M sodium acetate, pH5.2, and 2 volumes of ethanol.
Fifty μg of each RNA from the autoptic tissues are DNase treated with the DNA-free kit purchased from Ambion (Ambion, TX). After resuspension and spectrophoto- metric quantification, each sample is reverse transcribed with the TaqMan Reverse Transcription Reagents (PE Applied Biosystems, CA) according to the manu- facturer's protocol. The final concentration of RNA in the reaction mix is 200 ng/μL. Reverse transcription is carried out with 2.5μM of random hexamer primers.
TaqMan quantitative analysis. Specific primers and probe are designed according to the recommendations of PE Applied Biosystems; the probe can be labeled at the 5' end FAM (6-carboxy-fluorescein) and at the 3' end with TAMRA (6-carboxy- tetramethyl-rhodamine). Quantification experiments are performed on 10 ng of reverse transcribed RNA from each sample. Each determination is done in triplicate.
Total cDNA content is normalized with the simultaneous quantification (multiplex
PCR) of the 18S ribosomal RNA using the Pre-Developed TaqMan Assay Reagents (PDAR) Control Kit (PE Applied Biosystems, CA).
The assay reaction mix is as follows: IX final TaqMan Universal PCR Master Mix (from 2X stock) (PE Applied Biosystems, CA); IX PDAR control - 18S RNA (from
20X stock); 300 nM forward primer; 900 nM reverse primer; 200 nM probe; 10 ng cDNA; and water to 25 μl.
Each of the following steps are carried out once: pre PCR, 2 minutes at 50°C, and 10 minutes at 95°C. The following steps are carried out 40 times: denaturation, 15 seconds at 95°C, annealing/extension, 1 minute at 60°C.
The experiment is performed on an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, CA). At the end of the run, fluorescence data acquired during PCR are processed as described in the ABI Prism 7700 user's manual in order to achieve better background subtraction as well as signal linearity with the starting target quantity. EXAMPLE 6
Radioligand binding assays
Human embryonic kidney 293 cells transfected with a polynucleotide which expresses human calcium-independent alpha-latrotoxin receptor homolog 3 are scraped from a culture flask into 5 ml of Tris HCl, 5 mM EDTA, pH 7.5, and lysed by sonication. Cell lysates are centrifuged at 1000 rpm for 5 minutes at 4°C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4°C. The pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO4, 1 mM
EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1 % BSA, 2 μg/ml aprotinin, 0.5 mg/ml leupeptin, and 10 μg/ml phosphoramidon. Optimal membrane suspension dilutions, defined as the protein concentration required to bind less than 10 % of the added radioligand, are added to 96-well polypropylene microtiter plates containing I-labeled ligand or test compound, non-labeled peptides, and binding buffer to a final volume of 250 μl.
In equilibrium saturation binding assays, membrane preparations are incubated in the presence of increasing concentrations (0.1 nM to 4 nM) of 125I-labeled ligand or test compound (specific activity 2200 Ci/mmol). The binding affinities of different test compounds are determined in equilibrium competition binding assays, using 0.1 nM
I-peptide in the presence of twelve different concentrations of each test compound.
Binding reaction mixtures are incubated for one hour at 30°C. The reaction is stopped by filtration through GF/B filters treated with 0.5%> polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program.
Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide. Protein concentration is measured by the Bradford method using Bio-Rad Reagent, with bovine serum albumin as a standard. A test compound which increases the radioactivity of membrane protein by at least 15% relative to radioactivity of membrane protein which was not incubated with a test compound is identified as a compound which binds to a human calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide.
EXAMPLE 7
Effect of a test compound on human calcium-independent alpha-latrotoxin receptor homolog 3 -mediated cyclic AMP formation
Receptor-mediated inhibition of cAMP formation can be assayed in host cells which express human calcium-independent alpha-latrotoxin receptor homolog 3. Cells are plated in 96-well plates and incubated in Dulbecco's phosphate buffered saline (PBS) supplemented with 10 mM HEPES, 5 mM theophylline, 2 μg/ml aprotinin, 0.5 mg/ml leupeptin, and 10 μg/ml phosphoramidon for 20 minutes at 37°C in 5%
CO2. A test compound is added and incubated for an additional 10 minutes at 37°C. The medium is aspirated, and the reaction is stopped by the addition of 100 mM HCl. The plates are stored at 4°C for 15 minutes. cAMP content in the stopping solution is measured by radioimmunoassay.
Radioactivity is quantified using a gamma counter equipped with data reduction software. A test compound which decreases radioactivity of the contents of a well relative to radioactivity of the contents of a well in the absence of the test compound is identified as a potential inhibitor of cAMP formation. A test compound which increases radioactivity of the contents of a well relative to radioactivity of the contents of a well in the absence of the test compound is identified as a potential enhancer of cAMP formation. EXAMPLE 8
Effect of a test compound on the mobilization ofintracellular calcium
Intracellular free calcium concentration can be measured by microspecfrofluorome try using the fluorescent indicator dye Fura-2/AM (Bush et al, J. Neurochem. 57, 562- 74, 1991). Stably transfected cells are seeded onto a 35 mm culture dish containing a glass coverslip insert. Cells are washed with HBS , incubated with a test compound, and loaded with 100 μl of Fura-2/AM (10 μM) for 20-40 minutes. After washing with HBS to remove the Fura-2/AM solution, cells are equilibrated in HBS for 10-20 minutes. Cells are then visualized under the 40X objective of a Leitz Fluovert FS microscope.
Fluorescence emission is determined at 510 nM, with excitation wavelengths alternating between 340 nM and 380 nM. Raw fluorescence data are converted to calcium concentrations using standard calcium concentration curves and software analysis techniques. A test compound which increases the fluorescence by at least 15% relative to fluorescence in the absence of a test compound is identified as a compound which mobilizes intracellular calcium.
EXAMPLE 9
Effect of a test compound on phosphoinositide metabolism
Cells which stably express human calcium-independent alpha-latrotoxin receptor homolog 3 cDNA are plated in 96-well plates and grown to confluence. The day before the assay, the growth medium is changed to 100 μl of medium containing 1% serum and 0.5 μCi 3H-myinositol. The plates are incubated overnight in a CO2 incubator (5% CO2 at 37°C). Immediately before the assay, the medium is removed and replaced by 200 μl of PBS containing 10 mM LiCl, and the cells are equilibrated with the new medium for 20 minutes. During this interval, cells also are equilibrated with antagonist, added as a 10 μl aliquot of a 20-fold concentrated solution in PBS. The 3H-inositol phosphate accumulation from inositol phospholipid metabolism is started by adding 10 μml of a solution containing a test compound. To the first well 10 μl are added to measure basal accumulation. Eleven different concentrations of test compound are assayed in the following 11 wells of each plate row. All assays are performed in duplicate by repeating the same additions in two consecutive plate rows.
The plates are incubated in a CO incubator for one hour. The reaction is terminated by adding 15 μl of 50% v/v trichloroacetic acid (TCA), followed by a 40 minute incubation at 4°C. After neutralizing TCA with 40 μl of 1 M Tris, the content of the wells is transferred to a Multiscreen HV filter plate (Millipore) containing Dowex AG1-X8 (200-400 mesh, formate form). The filter plates are prepared by adding 200 μl of Dowex AG1-X8 suspension (50% v/v, wateπresin) to each well. The filter plates are placed on a vacuum manifold to wash or elute the resin bed. Each well is washed 2 times with 200 μl of water, followed by 2 x 200 μl of 5 mM sodium tetraborate/60 mM ammonium formate.
The 3H-IPs are eluted into empty 96-well plates with 200 μl of 1.2 M ammonium formate/0.1 formic acid. The content of the wells is added to 3 ml of scintillation cocktail, and radioactivity is determined by liquid scintillation counting.
EXAMPLE 10
Receptor Binding Methods
Standard Binding Assays. Binding assays are carried out in a binding buffer containing 50 mM HEPES, pH 7.4, 0.5% BSA, and 5 mM MgCl2. The standard assay for radioligand binding to membrane fragments comprising calcium- independent alpha-latrotoxin receptor homolog 3 polypeptides is carried out as follows in 96 well microtiter plates (e.g., Dynatech Immulon II Removawell plates). Radioligand is diluted in binding buffer+ PMSF/Baci to the desired cpm per 50 μl, then 50 μl aliquots are added to the wells. For non-specific binding samples, 5 μl of 40 μM cold ligand also is added per well. Binding is initiated by adding 150 μl per well of membrane diluted to the desired concentration (10-30 μg membrane protein/well) in binding buffer÷ PMSF/Baci. Plates are then covered with Linbro mylar plate sealers (Flow Labs) and placed on a Dynatech Microshaker II. Binding is allowed to proceed at room temperature for 1-2 hours and is stopped by centrifuging the plate for 15 minutes at 2,000 x g. The supernatants are decanted, and the membrane pellets are washed once by addition of 200 μl of ice cold binding buffer, brief shaking, and recentrifugation. The individual wells are placed in 12 x 75 mm tubes and counted in an LKB Gammamaster counter (78% efficiency). Specific binding by this method is identical to that measured when free ligand is removed by rapid (3-5 seconds) filtration and washing on polyethyleneimine-coated glass fiber filters.
Three variations of the standard binding assay are also used.
1. Competitive radioligand binding assays with a concentration range of cold ligand vs. 125 I-labeled ligand are carried out as described above with one modification. All dilutions of ligands being assayed are made in 40X PMSF/Baci to a concentration 40X the final concentration in the assay. Samples of peptide (5 μl each) are then added per microtiter well. Membranes and radioligand are diluted in binding buffer without protease inhibitors. Radioligand is added and mixed with cold ligand, and then binding is initiated by addition of membranes.
2. Chemical cross-linking of radioligand with receptor is done after a binding step identical to the standard assay. However, the wash step is done with binding buffer minus BSA to reduce the possibility of non-specific cross-linking of radioligand with BSA. The cross-linking step is carried out as described below.
3. Larger scale binding assays to obtain membrane pellets for studies on solubilization of receptor:ligand complex and for receptor purification are also carried out. These are identical to the standard assays except that (a) binding is carried out in polypropylene tubes in volumes from 1-250 ml, (b) concentration of membrane protein is always 0.5 mg/ml, and (c) for receptor purification, BSA concentration in the binding buffer is reduced to 0.25%, and the wash step is done with binding buffer without BSA, which reduces
BSA contamination of the purified receptor.
EXAMPLE 11
Chemical Cross-Linking of Radioligand to Receptor
After a radioligand binding step as described above, membrane pellets are resuspended in 200 μl per microtiter plate well of ice-cold binding buffer without BSA. Then 5 μl per well of 4 mM N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOS, Pierce) in DMSO is added and mixed. The samples are held on ice and
UV-irradiated for 10 minutes with a Mineralight R-52G lamp (UVP Inc., San Gabriel, Calif.) at a distance of 5-10 cm. Then the samples are transferred to Eppendorf microfuge tubes, the membranes pelleted by centrifugation, supernatants removed, and membranes solubilized in Laemmli SDS sample buffer for polyacrylamide gel electrophoresis (PAGE). PAGE is carried out as described below.
Radiolabeled proteins are visualized by autoradiography of the dried gels with Kodak XAR film and DuPont image intensifier screens. EXAMPLE 12
Membrane Solubilization
Membrane solubilization is carried out in buffer containing 25 mM Tris, pH 8, 10% glycerol (w/v) and 0.2 mM CaCl (solubilization buffer). The highly soluble detergents including Triton X- 100, deoxycholate, deoxycholate:lysolecithin, CHAPS, and zwittergent are made up in solubilization buffer at 10% concentrations and stored as frozen aliquots. Lysolecithin is made up fresh because of insolubility upon freeze-thawing and digitonin is made fresh at lower concentrations due to its more limited solubility.
To solubilize membranes, washed pellets after the binding step are resuspended free of visible particles by pipetting and vortexing in solubilization buffer at 100,000 x g for 30 minutes. The supernatants are removed and held on ice and the pellets are discarded.
EXAMPLE 13
Assay of Solubilized Receptors
After binding of 125I ligands and solubilization of the membranes with detergent, the intact R:L complex can be assayed by four different methods. All are carried out on ice or in a cold room at 4-10°C).
1. Column chromatography (Knuhtsen et al, Biochem. J. 254, 641-647, 1988). Sephadex G-50 columns (8 x 250 mm) are equilibrated with solubilization buffer containing detergent at the concentration used to solubilize membranes and 1 mg/ml bovine serum albumin. Samples of solubilized membranes (0.2- 0.5 ml) are applied to the columns and eluted at a flow rate of about
0.7 ml/minute. Samples (0.18 ml) are collected. Radioactivity is determined in a gamma counter. Void volumes of the columns are determined by the elution volume of blue dextran. Radioactivity eluting in the void volume is considered bound to protein. Radioactivity eluting later, at the same volume as free 125I ligands, is considered non-bound.
2. Polyethyieneglycol precipitation (Cuatrecasas, Proc. Natl. Acad. Sci. USA 69, 318-322, 1972). For a 100 μl sample of solubilized membranes in a 12 x 75 mm polypropylene tube, 0.5 ml of 1% (w/v) bovine gamma globulin (Sigma) in 0.1 M sodium phosphate buffer is added, followed by 0.5 ml of 25%o (w/v) polyethyieneglycol (Sigma) and mixing. The mixture is held on ice for 15 minutes. Then 3 ml of 0.1 M sodium phosphate, pH 7.4, is added per sample. The samples are rapidly (1-3 seconds) filtered over Whatman GF/B glass fiber filters and washed with 4 ml of the phosphate buffer. PEG-
19 ■ ■ ■ • precipitated receptor : I-hgand complex is determined by gamma counting of the filters.
3. GFB/PEI filter binding (Brans et al, Analytical Biochem. 132, 74-81, 1983). Whatman GF/B glass- fiber filters are soaked in 0.3% polyethyleneimine (PEI, Sigma) for 3 hours. Samples of solubilized membranes (25-100 μl) are replaced in 12 x 75 mm polypropylene tubes. Then 4 ml of solubilization buffer without detergent is added per sample and the samples are immediately filtered through the GFB/PEI filters (1-3 seconds) and washed with 4 ml of
1 solubilization buffer. CPM of receptor : I-ligand complex adsorbed to filters are determined by gamma counting.PAR.4. Charcoal/Dextran (Paul and Said, Peptides 7[Suppl. 77,147-149, 1986). Dextran T70 (0.5 g,
Pharmacia) is dissolved in 1 liter of water, then 5 g of activated charcoal (Norit A, alkaline; Fisher Scientific) is added. The suspension is stirred for 10 minutes at room temperature and then stored at 4°C. until use. To measure R:L complex, 4 parts by volume of charcoal dextran suspension are added to 1 part by volume of solubilized membrane. The samples are mixed and held on ice for 2 minutes and then centrifuged for 2 minutes at 11,000 x g in a Beckman microfuge. Free radioligand is adsorbed charcoal/dextran and is discarded with the pellet. Receptor : 125 I-ligand complexes remain in the supernatant and are determined by gamma counting.
EXAMPLE 14
Receptor Purification
Binding of biotinyl-receptor to GH Cl membranes is carried out as described above. Incubations are for 1 hour at room temperature. In the standard purification protocol, the binding incubations contain 10 nM Bio-S29. 125I ligand is added as a tracer at levels of 5,000-100,000 cpm per mg of membrane protein. Control incubations contain 10 μM cold ligand to saturate the receptor with non-biotinylated ligand.
Solubilization of receptor:ligand complex also is carried out as described above, with
0.15% deoxycholate:lysolecithin in solubilization buffer containing 0.2 mM MgCl2, to obtain 100,000 x g supernatants containing solubilized R:L complex.
Immobilized streptavidin (streptavidin cross-linked to 6% beaded agarose, Pierce Chemical Co.; "SA-agarose") is washed in solubilization buffer and added to the solubilized membranes as 1/30 of the final volume. This mixture is incubated with constant stirring by end-over-end rotation for 4-5 hours at 4-10°C. Then the mixture is applied to a column and the non-bound material is washed through. Binding of radioligand to SA-agarose is determined by comparing cpm in the 100,000 x g supernatant with that in the column effluent after adsorption to SA-agarose. Finally, the column is washed with 12-15 column volumes of solubilization buffer+0.15%) deoxycholate:lysolecithin +1/500 (vol/vol) 100 x 4pase.PAR.The streptavidin column is eluted with solubilization buffer+0.1 mM EDTA+0.1 mM EGTA+04 mM
GTP-gamma-S (Sigma)+0.15% (wt/vol) deoxycholate:lysolecithin +1/1000 (vol/vol) 100.times.4pase. First, one column volume of elution buffer is passed through the column and flow is stopped for 20-30 minutes. Then 3-4 more column volumes of elution buffer are passed through. All the eluates are pooled.
Eluates from the streptavidin column are incubated overnight (12-15 hours) with immobilized wheat germ agglutinin (WGA agarose, Vector Labs) to adsorb the receptor via interaction of covalently bound carbohydrate with the WGA lectin. The ratio (vol/vol) of WGA-agarose to streptavidin column eluate is generally 1 :400. A range from 1:1000 to 1:200 also can be used. After the binding step, the resin is pelleted by centrifugation, the supernatant is removed and saved, and the resin is washed 3 times (about 2 minutes each) in buffer containing 50 mM HEPES, pH 8,
5 mM MgCl > and 0.15% deoxycholate:lysolecithin. To elute the WGA-bound receptor, the resin is extracted three times by repeated mixing (vortex mixer on low speed) over a 15-30 minute period on ice, with 3 resin columns each time, of 10 mM N-N'-N"- triacetylchitotriose in the same HEPES buffer used to wash the resin. After each elution step, the resin is centrifuged down and the supernatant is carefully removed, free of WGA-agarose pellets. The three, pooled eluates contain the final, purified receptor. The material non-bound to WGA contain G protein subunits specifically eluted from the streptavidin column, as well as non-specific contaminants. All these fractions are stored frozen at -90°C.
EXAMPLE 15
Diabetes: In vivo testing of compounds/target validation
Glucose Production
Over-production of glucose by the liver, due to an enhanced rate of gluconeogenesis, is the major cause of fasting hyperglycemia in diabetes. Overnight fasted normal rats or mice have elevated rates of gluconeogenesis as do streptozotocin-induced diabetic rats or mice fed ad libitum. Rats are made diabetic with a single intravenous injection of 40 mg/kg of streptozotocin while C57BL/KsJ mice are given 40- 60 mg/kg i.p. for 5 consecutive days. Blood glucose is measured from tail-tip blood and then compounds are administered via different routes (p.o., i.p., i.v., s.c). Blood is collected at various times thereafter and glucose measured. Alternatively, compounds are administered for several days, then the animals are fasted overnight, blood is collected and plasma glucose measured. Compounds that inhibit glucose production will decrease plasma glucose levels compared to the vehicle-treated control group.
Insulin Sensitivity
Both ob/ob and db/db mice as well as diabetic Zucker rats are hyperglycemic, hyperinsulinemic and insulin resistant. The animals are pre-bled, their glucose levels measured, and then they are grouped so that the mean glucose level is the same for each group. Compounds are administered daily either q.d. or b.i.d. by different routes (p.o., i.p., s.c.) for 7-28 days. Blood is collected at various times and plasma glucose and insulin levels determined. Compounds that improve insulin sensitivity in these models will decrease both plasma glucose and insulin levels when compared to the vehicle-treated control group.
Insulin Secretion
Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load. When measuring insulin levels, compounds are administered by different routes (p.o., i.p., s.c. or i.v.) to overnight fasted normal rats or mice. At the appropriate time an intravenous glucose load (0.4 g/kg) is given, blood is collected one minute later. Plasma insulin levels are determined. Compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose. When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (1 g/kg), bled again after 15, 30, 60 and 90 minutes and plasma glucose levels determined. Compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
Compounds that enhance insulin secretion from the pancreas will increase plasma insulin levels and improve the disappearance of plasma glucose following the administration of a glucose load. When measuring insulin levels, test compounds which regulate calcium-independent alpha-latrotoxin receptor homolog 3 are administered by different routes (p.o., i.p., s.c, or i.v.) to overnight fasted normal rats or mice. At the appropriate time an intravenous glucose load (0.4 g/kg) is given, blood is collected one minute later. Plasma insulin levels are determined. Test compounds that enhance insulin secretion will increase plasma insulin levels compared to animals given only glucose. When measuring glucose disappearance, animals are bled at the appropriate time after compound administration, then given either an oral or intraperitoneal glucose load (lg/kg), bled again after 15, 30, 60, and
90 minutes and plasma glucose levels determined. Test compounds that increase insulin levels will decrease glucose levels and the area-under-the glucose curve when compared to the vehicle-treated group given only glucose.
EXAMPLE 16
In vivo target validation
Effects on plasma cholesterol levels including HDL cholesterol are typically assessed in humanized apo-AI transgenic mice. Modulation of human target proteins can be determined in corresponding transgenic mice (e.g., CETP transgenic mice). Triglyceride-lowermg is usually evaluated in ob/ob mice or Zucker rats. Animals are fed with normal diets or modified diets (e.g., enriched by 0.5 % cholesterol 20% coconut oil). Standard protocols consist of oral applications once daily for 7 to 10 days at doses ranging from 0,1 to 100 mg/kg. The compounds are dissolved (e.g., in
Solutol/ Ethanol/ saline mixtures) and applied by oral gavage or intravenous injection. Before and at the end of the application period, blood samples are typically drawn by retroorbital punctuation. Plasma cholesterol and triglyceride levels are determined with standardized clinical diagnostic kits (e.g., INFINITY™ cholesterol reagent and INFINITY™ triglyceride reagent; Sigma, St. Louis). HDL cholesterol is determined after phosphotungstic acid precipitation of non-HDL lipoproteins or FPLC gel filtration with post-column derivatization of cholesterol using the reagents mentioned above. Plasma levels of human apolipoprotein-AI in relevant humanized transgenic mice are measured by immunoturbidimetry (Sigma).
Long-term anti-atherosclerotic potency of drug candidates are evaluated in Apo E- knockout mice. Therefore, animals are fed a standard chow diet (4.5 % fat) or a Western diet (20 % fat) containing 1 to 100 mg/kg of the respective compounds for 3 to 5 month. Arterial lesions are quantified in serial cryosections of the proximal aorta by staining with Oil Red O and counterstaining with hematoxylin. Lesion area size is determined using a digital imaging system.
EXAMPLE 17
In vivo testing of cardiovascular effects of test compounds
Hemodynamics in anesthetized rats
Male Wistar rats weighing 300-350 g (Harlan Winkelmann, Borchen, Germany) are anesthetized with thiopental "Nycomed" (Ny corned, Munich, Germany) 100 mg kg-1 i.p. A tracheotomy is performed, and catheters are inserted into the femoral artery for blood pressure and heart rate measurements (Gould pressure transducer and recorder, model RS 3400) and into the femoral vein for substance administration. The animals are ventilated with room air and their body temperature is controlled. Test compounds are administered orally or intravenously. Hemodynamics in conscious SHR
Female conscious SHR (Moellegaard Denmark, 220 - 290 g) are equipped with implantable radiotelemetry, and a data aquisition system (Data Sciences, St. Paul, MN, USA), comprising a chronically implantable transducer/transmitter unit equipped with a fluid-filled catheter is used. The transmitter is implanted into the peritoneal cavity, and the sensing catheter is inserted into the descending aorta.
Single administration of test compounds is performed as a solution in Transcutol®/ Cremophor®/ H2O (10/20/70 = v/v/v) given orally by gavage. The animals of control groups only receive the vehicle. Before treatment, mean blood pressure and heart rate of treated and untreated control groups are measured.
Hemodynamics in anesthetized dogs
Studies are performed on anesthetized dogs of either sex (body weight between 20- 30 kg). Anesthesia is initiated by slow intravenous injection of 25 mg kg-1 sodium thiopental (Trapanal®, Byk Gulden, Konstanz, Germany). The anesthesia is continued and maintained throughout the experiment by continuous infusion of 0.04 mg kgT h"l fentanyl (Fentanyl®, Janssen, Neuss, Germany) and
0.25 mg kgT h"l droperidol (DihydrobenzperidolR, Janssen, Neuss, Germany). During this anaesthesia, heart rate is as low as 35-40 bpm due to increased vagal tone. Therefore, a parasympathetic blockade is achieved by intermittent injections of atropine (0.1 mg per animal) (AtropinsulfatR, Eifelfango, Bad Neuenahr, Germany). After intubation the animals are artificially ventilated at constant volume (EngstromR
300, Engstrδm, Sweden) with room air enriched with 30% oxygen to maintain an end-tidal CO2 concentration of about 5% (NormocapR, Datex, Finland).
The following catheters are implanted for measurement of cardiovascular parameters: a tip catheter for recording of left ventricular pressure is inserted into the ventricle via the carotid artery (PC350, Millar Instruments, Houston, TX, USA), a hollow catheter is inserted into the femoral artery and connected to a strain gauge (type 4-327-1, Telos Medical, Upland, CA, USA for recording of arterial blood pressure, two venous catheters are inserted into either femoral vein and one additional catheter into a forearm vein for application of the anaesthetic and drugs, respectively, and an oxymetry catheter for recording of oxygen saturation is inserted into the coronary sinus via the jugular vein (Schwarzer IVH4, Mϋnchen, Germany).
After a left-sided thoracotomy the ramus circumflexus of the left coronary artery (LCX) is freed from connective tissue, and an electromagnetic flow probe (Gould Statham, Oxnard, CA, USA) is applied for measurement of coronary blood flow.
Arterial blood pressure, electrocardiogram (lead II), left ventricular pressure, first derivative of left ventricular pressure (dP/dt), heart rate, coronary blood flow, and oxygen saturation in the coronary sinus are continuously recorded on a pen recorder (Brush, Gould, Cleveland, OH, USA). The maximum of dP/dt is used as measure of left ventricular contractility (dP/dtmax). After completion of the instrumentation, an interval of 60 min is allowed for stabilization before the test compound is intravenously applied as bolus injections. Care is taken that all measured cardiovascular parameters have returned to control level before injection of the next dose. Each dose of the test compound is tested at least three times in different animals. The order of injection of the different doses is randomized in each animal.
EXAMPLE 18
In vivo testing of compounds/target validation
Pain
Acute pain. Acute pain is measured on a hot plate mainly in rats. Two variants of hot plate testing are used: In the classical variant animals are put on a hot surface (52 to 56°C) and the latency time is measured until the animals show nocifensive behavior, such as stepping or foot licking. The other variant is an increasing temperature hot plate where the experimental animals are put on a surface of neutral temperature. Subsequently this surface is slowly but constantly heated until the animals begin to lick a hind paw. The temperature which is reached when hind paw licking begins is a measure for pain threshold.
Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to pain testing.
Persistent pain. Persistent pain is measured with the formalin or capsaicin test, mainly in rats. A solution of 1 to 5%> formalin or 10 to 100 μg capsaicin is injected into one hind paw of the experimental animal. After formalin or capsaicin application the animals show nocifensive reactions like flinching, licking and biting of the affected paw. The number of nocifensive reactions within a time frame of up to 90 minutes is a measure for intensity of pain.
Compounds are tested against a vehicle treated control group. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to formalin or capsaicin administration.
Neuropathic pain. Neuropathic pain is induced by different variants of unilateral sciatic nerve injury mainly in rats. The operation is performed under anesthesia. The first variant of sciatic nerve injury is produced by placing loosely constrictive ligatures around the common sciatic nerve. The second variant is the tight Hgation of about the half of the diameter of the common sciatic nerve. In the next variant, a group of models is used in which tight ligations or transections are made of either the L5 and L6 spinal nerves, or the L% spinal nerve only. The fourth variant involves an axotomy of two of the three terminal branches of the sciatic nerve (tibial and common peroneal nerves) leaving the remaining sural nerve intact whereas the last variant comprises the axotomy of only the tibial branch leaving the sural and common nerves uninjured. Control animals are treated with a sham operation. Postoperatively, the nerve injured animals develop a chronic mechanical allodynia, cold allodynioa, as well as a thermal hyperalgesia. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc. -Life Science Instruments, Woodland Hills, SA, USA; Electronic von Frey
System, Somedic Sales AB, Horby, Sweden). Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy), or by means of a cold plate of 5 to 10°C where the nocifensive reactions of the affected hind paw are counted as a measure of pain intensity. A further test for cold induced pain is the counting of nocifensive reactions, or duration of nocifensive responses after plantar administration of acetone to the affected hind limb. Chronic pain in general is assessed by registering the circadanian rhythms in activity (Surjo and Arndt, Universitat zu Kδln, Cologne, Germany), and by scoring differences in gait (foot print patterns; FOOTPRINTS program, Klapdor et al., 1997. A low cost method to analyze footprint patterns. J. Neurosci. Methods 75, 49-54).
Compounds are tested against sham operated and vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to pain testing.
Inflammatory Pain. Inflammatory pain is induced mainly in rats by injection of 0.75 mg carrageenan or complete Freund's adjuvant into one hind paw. The animals develop an edema with mechanical allodynia as well as thermal hyperalgesia. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc-Life Science Instruments, Woodland Hills, SA,
USA). Thermal hyperalgesia is measured by means of a radiant heat source (Plantar Test, Ugo Basile, Comerio, Italy, Paw thermal stimulator, G. Ozaki, University of California, USA). For edema measurement two methods are being used. In the first method, the animals are sacrificed and the affected hindpaws sectioned and weighed. The second method comprises differences in paw volume by measuring water displacement in a plethysmometer (Ugo Basile, Comerio, Italy). Compounds are tested against uninflamed as well as vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., i.t., Lev., s.c, intradermal, transdermal) prior to pain testing.
Diabetic neuropathic pain. Rats treated with a single intraperitoneal injection of 50 to 80 mg/kg streptozotocin develop a profound hyperglycemia and mechanical allodynia within 1 to 3 weeks. Mechanical allodynia is measured by means of a pressure transducer (electronic von Frey Anesthesiometer, IITC Inc-Life Science Instruments, Woodland Hills, S A, USA).
Compounds are tested against diabetic and non-diabetic vehicle treated control groups. Substance application is performed at different time points via different application routes (i.v., i.p., p.o., ϊ.t, L v., s.c, intradermal, transdermal) prior to pain testing.
Parkinson's disease
6-Hydroxydopamine (6-OH-DA) Lesion. Degeneration of the dopaminergic ni- grostriatal and striatopallidal pathways is the central pathological event in
Parkinson's disease. This disorder has been mimicked experimentally in rats using single/sequential unilateral stereotaxic injections of 6-OH-DA into the medium forebrain bundle (MFB).
Male Wistar rats (Harlan Winkelmann, Germany), weighing 200+250 g at the beginning of the experiment, are used. The rats are maintained in a temperature- and humidity-controlled environment under a 12 h light/dark cycle with free access to food and water when not in experimental sessions. The following in vivo protocols are approved by the governmental authorities. All efforts are made to minimize animal suffering, to reduce the number of animals used, and to utilize alternatives to in vivo techniques. Animals are administered pargyline on the day of surgery (Sigma, St. Louis, MO, USA; 50 mg/kg i.p.) in order to inhibit metabolism of 6-OHDA by monoamine oxidase and desmethylimipramine HCl (Sigma; 25 mg/kg i.p.) in order to prevent uptake of 6-OHDA by noradrenergic terminals. Thirty minutes later the rats are anesthetized with sodium pentobarbital (50 mg/kg) and placed in a stereotaxic frame. In order to lesion the DA nigrostriatal pathway 4 μl of 0.01% ascorbic acid-saline containing 8 μg of 6-OHDA HBr (Sigma) are injected into the left medial fore-brain bundle at a rate of 1 μl/min (2.4 mm anterior, 1.49 mm lateral, -2.7 mm ventral to Bregma and the skull surface). The needle is left in place an additional 5 min to allow diffusion to occur.
Stepping Test. Forelimb akinesia is assessed three weeks following lesion placement using a modified stepping test protocol. In brief, the animals are held by the experimenter with one hand fixing the hindlimbs and slightly raising the hind part above the surface. One paw is touching the table, and is then moved slowly sideways (5 s for 1 m), first in the forehand and then in the backhand direction. The number of adjusting steps is counted for both paws in the backhand and forehand direction of movement. The sequence of testing is right paw forehand and backhand adjusting stepping, followed by left paw forehand and backhand directions. The test is repeated three times on three consecutive days, after an initial training period of three days prior to the first testing. Forehand adjusted stepping reveals no consistent differences between lesioned and healthy control animals. Analysis is therefore restricted to backhand adjusted stepping.
Balance Test. Balance adjustments following postural challenge are also measured during the stepping test sessions. The rats are held in the same position as described in the stepping test and, instead of being moved sideways, tilted by the experimenter towards the side of the paw touching the table. This maneuver results in loss of balance and the ability of the rats to regain balance by forelimb movements is scored on a scale ranging from 0 to 3. Score 0 is given for a normal forelimb placement. When the forelimb movement is delayed but recovery of postural balance detected, score 1 is given. Score 2 represents a clear, yet insufficient, forelimb reaction, as evidenced by muscle contraction, but lack of success in recovering balance, and score 3 is given for no reaction of movement. The test is repeated three times a day on each side for three consecutive days after an initial training period of three days prior to the first testing.
Staircase Test (Paw Reaching). A modified version of the staircase test is used for evaluation of paw reaching behavior three weeks following primary and secondary lesion placement. Plexiglass test boxes with a central platform and a removable staircase on each side are used. The apparatus is designed such that only the paw on the same side at each staircase can be used, thus providing a measure of independent forelimb use. For each test the animals are left in the test boxes for 15 min. The double staircase is filled with 7 x 3 chow pellets (Precision food pellets, formula: P, purified rodent diet, size 45 mg; Sandown Scientific) on each side. After each test the number of pellets eaten (successfully retrieved pellets) and the number of pellets taken (touched but dropped) for each paw and the success rate (pellets eaten/pellets taken) are counted separately. After three days of food deprivation (12 g per animal per day) the animals are tested for 11 days. Full analysis is conducted only for the last five days.
MPTP treatment. The neurotoxin l-methyl-4-phenyl-l,2,3,6-tetrahydropyridine (MPTP) causes degeneration of mesencephalic dopaminergic (DAergic) neurons in rodents, non-human primates, and humans and, in so doing, reproduces many of the symptoms of Parkinson's disease. MPTP'leads to a marked decrease in the levels of dopamine and its metabolites, and in the number of dopaminergic terminals in the striatum as well as severe loss of the tyrosine hydroxylase (TH)-immunoreactive cell bodies in the substantia nigra, pars compacta.
In order to obtain severe and long-lasting lesions, and to reduce mortality, animals receive single injections of MPTP, and are then tested for severity of lesion 7-10 days later. Successive MPTP injections are administered on days 1, 2 and 3. Animals receive application of 4 mg/kg MPTP hydrochloride (Sigma) in saline once daily. All injections are intraperitoneal (i.p.) and the MPTP stock solution is frozen between injections. Animals are decapitated on day 11.
Immunohistology. At the completion of behavioral experiments, all animals are anaesthetized with 3 ml thiopental (1 g/40 ml i.p., Tyrol Pharma). The mice are perfused transcardialfy with 0.01 M PBS (pH 7.4) for 2 min, followed by 4% paraformaldehyde (Merck) in PBS for 15 min. The brains are removed and placed in 4% paraformaldehyde for 24 h at 4°C. For dehydration they are then transferred to a
20% sucrose (Merck) solution in 0.1 M PBS at 4°C until they sink. The brains are frozen in methylbutan at -20°C for 2 min and stored at -70°C. Using a sledge microtome (mod. 3800-Frigocut, Leica), 25 μm sections are taken from the genu of the corpus callosum (AP 1.7 mm) to the hippocampus (AP 21.8 mm) and from AP 24.16 to AP 26.72. Forty-six sections are cut and stored in assorters in 0.25 M Tris buffer (pH 7.4) for immunohistochemistry.
A series of sections is processed for free-floating tyrosine hydroxylase (TH) immunohistochemistry. Following three rinses in 0.1 M PBS, endogenous peroxidase activity is quenched for 10 min in 0.3%> H O2 ±PBS. After rinsing in
PBS, sections are preincubated in 10% normal bovine serum (Sigma) for 5 min as blocking agent and transferred to either primary anti-rat TH rabbit antiserum (dilution 1:2000).
Following overnight incubation at room temperature, sections for TH immuno- reactivity are rinsed in PBS (2 xlO min) and incubated in biotinylated anti-rabbit immunogiobulin G raised in goat (dilution 1:200) (Vector) for 90 min, rinsed repeatedly and transferred to Vectastain ABC (Vector) solution for 1 h. 3,.3' -Diaminobenzidine tetrahydrochloride (DAB; Sigma) in 0.1 M PBS, supplemented with 0.005% H2O2, serves as chromogen in the subsequent visualization reaction.
Sections are mounted on to gelatin-coated slides, left to dry overnight, counter- stained with hematoxylin dehydrated in ascending alcohol concentrations and cleared in butylacetate. Coverslips are mounted on entellan.
Rotarod Test. We use a modification of the procedure described by Rozas and Labandeira-Garcia (1997), with a CR-1 Rotamex system (Columbus Instruments,
Columbus, OH) comprising an IBM-compatible personal computer, a CIO-24 data acquisition card, a control unit, and a four-lane rotarod unit. The rotarod unit consists of a rotating spindle (diameter 7.3 cm) and individual compartments for each mouse. The system software allows preprogramming of session protocols with varying rotational speeds (0-80 rpm). Infrared beams are used to detect when a mouse has fallen onto the base grid beneath the rotarod. The system logs the fall as the end of the experiment for that mouse, and the total time on the rotarod, as well as the time of the fall and all the set-up parameters, are recorded. The system also allows a weak current to be passed through the base grid, to aid training.
Dementia
77?e object recognition task. The object recognition task- has been designed to assess the effects of experimental manipulations on the cognitive performance of rodents. A rat is placed in an open field, in which two identical objects are present. The rats inspects both objects during the first trial of the object recognition task. In a second trial, after a retention interval of for example 24 hours, one of the two objects used in the first trial, the 'familiar' object, and a novel object are placed in the open field. The inspection time at each of the objects is registered. The basic measures in the OR task is the time spent by a rat exploring the two object the second trial. Good retention is reflected by higher exploration times towards the novel than the 'familiar' object.
Administration of the putative cognition enhancer prior to the first trial pre- dominantly allows assessment of the effects on acquisition, and eventually on consolidation processes. Administration of the testing compound after the first trial allows to assess the effects on consolidation processes, whereas administration before the second trial allows to measure effects on retrieval processes.
The passive avoidance task. The passive avoidance task assesses memory performance in rats and mice. The inhibitory avoidance apparatus consists of a two-compartment box with a light compartment and a dark compartment. The two compartments are separated by a guillotine door that can be operated by the experimenter. A threshold of 2 cm separates the two compartments when the guillotine door is raised. When the door is open, the illumination in the dark compartment is about 2 lux. The light intensity is about 500 lux at the center of the floor of the light compartment.
Two habituation sessions, one shock session, and a retention session are given, separated by inter-session intervals of 24 hours. In the habituation sessions and the retention session the rat is allowed to explore the apparatus for 300 sec. The rat is placed in the light compartment, facing the wall opposite to the guillotine door. After an accommodation period of 15 sec. the guillotine door is opened so that all parts of the apparatus can be visited freely. Rats normally avoid brightly lit areas and will enter the dark compartment within a few seconds.
In the shock session the guillotine door between the compartments is lowered as soon as the rat has entered the dark compartment with its four paws, and a scrambled 1 mA footshock is administered for 2 sec. The rat is removed from the apparatus and put back into its home cage. The procedure during the retention session is identical to that of the habituation sessions.
The step-through latency, that is the first latency of entering the dark compartment (in sec.) during the retention session is an index of the memory performance of the animal; the longer the latency to enter the dark compartment, the better the retention is. A testing compound in given half an hour before the shock session, together with
1 mg*kg" scopolamine. Scopolamine impairs the memory performance during the retention session 24 hours later. If the test compound increases the enter latency compared with the . scopola ine-treated controls, is likely to possess cognition enhancing potential.
The Morris water escape task. The Morris water escape task measures spatial orientation learning in rodents. It is a test system that has extensively been used to investigate the effects of putative therapeutic on the cognitive functions of rats and mice. The performance of an animal is assessed in a circular water tank with an escape platform that is submerged about 1 cm below the surface of the water. The escape platform is not visible for an animal swimming in the water tank. Abundant extra-maze cues are provided by the furniture in the room, including desks, computer equipment, a second water tank, the presence of the experimenter, and by a radio on a shelf that is playing softly.
The animals receive four trials during five daily acquisition sessions. A trial is started by placing an animal into the pool, facing the wall of the tank. Each of four starting positions in the quadrants north, east, south, and west is used once in a series of four trials; their order is randomized. The escape platform is always in the same position. A trial is terminated as soon as the animal had climbs onto the escape platform or when 90 seconds have elapsed, whichever event occurs first. The animal is allowed to stay on the platform for 30 seconds. Then it is taken from the platform and the next trial is started. If an animal did not find the platform within 90 seconds it is put on the platform by the experimenter and is allowed to stay there for 30 seconds. After the fourth trial of the fifth daily session, an additional trial is given as a probe trial: the platform is removed, and the time the animal spends in the four quadrants is measured for 30 or 60 seconds. In the probe trial, all animals start from the same start position, opposite to the quadrant where the escape platform had been positioned during acquisition.
Four different measures are taken to evaluate the performance of an animal during acquisition training: escape latency, traveled distance, distance to platform, and swimming speed. The following measures are evaluated for the probe trial: time (s) in quadrants and traveled distance (cm) in the four quadrants. The probe trial provides additional information about how well an animal learned the position of the escape platform. If an animal spends more time and swims a longer distance in the quadrant where the platform had been positioned during the acquisition sessions than in any other quadrant, one concludes that the platform position has been learned well.
In order to assess the effects of putative cognition enhancing compounds, rats or mice with specific brain lesions which impair cognitive functions, or animals treated with compounds such as scopolamine or MK-801, which interfere with normal learning, or aged animals which suffer from cognitive deficits, are used.
The T-maze spontaneous alternation task. The T-maze spontaneous alternation task (TeMCAT) assesses the spatial memory performance in mice. The start arm and the two goal arms of the T-maze are provided with guillotine doors which can be operated manually by the experimenter. A mouse is put into the start arm at the beginning of training. The guillotine door is closed. In the first trial, the 'forced trial', either the left or right goal arm is blocked by lowering the guillotine door. After the mouse has been released from the start arm, it will negotiate the maze, eventually enter the open goal arm, and return to the start position, where it will be confined for
5 seconds, by lowering the guillotine door. Then, the animal can choose freely between the left and right goal arm (all guillotine-doors opened) during 14 'free choice' trials. As soon a the mouse has entered one goal arm, the other one is closed. The mouse eventually returns to the start arm and is free to visit whichever go alarm it wants after having been confined to the start arm for 5 seconds. After completion of 14 free choice trials in one session, the animal is removed from the maze. During training, the animal is never handled.
The percent alternations out of 14 trials is calculated. This percentage and the total time needed to complete the first forced trial and the subsequent 14 free choice trials
(in s) is analyzed. Cognitive deficits are usually induced by an injection of scopolamine, 30 min before the start of the training session. Scopolamine reduced the per-cent alternations to chance level, or below. A cognition enhancer, which is always administered before the training session, will at least partially, antagonize the scopolamine-induced reduction in the spontaneous alternation rate.
EXAMPLE 19
In vivo testing of compounds/target validation
Evaluation of Compound's Efficacy on the Reduction of Body Weight and Food and
Water Consumption in Obese Zucker fa/fa Rats
The purpose of this protocol is to determine the effect of chronic administration of an unknown compound on body weight and food and water consumption in obese Zucker fa/fa rats. Obese Zucker fa/fa rats are frequently used in the determination of compound efficacy in the reduction of body weight. This animal model has been successfully used in the identification and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans 2' 3'4 & 5.
A typical study include 60-80 male Zucker fa/fa, (n=10/ treatment group) with an average body weight of approximately 550g. Rats are kept in standard animal rooms under controlled temperature and humidity and a 12/12 light dark cycle. Water and food are continuously available. Rats are single housed in large rat shoeboxes containing grid floor. Animals are adapted to the grid floors and sham dosed with study vehicle for at least four days before the recording of two-days baseline measurement of body weight and 24 hr food and water consumption. Rats are assigned to one of 6-8 treatment groups based upon their body weight on baseline. The groups are set up so that the mean and standard error of the mean of body weight were similar. Animals are orally gavaged (2ml/ kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/compound. At this time, body weight, food and water consumption are measured. On the final day, animals are euthanized using CO2 inhalation.
1. Al-Barazanji KA, Arch JR, Buckingham RE and Tadayyon, M. (2000).
Central exedin-4 reduces body weight without altering plasma leptin in (fa/fa)
Zucker rats. Obes Res. 8 (4), 317-23.
2. Assimacopoulos-Jearmet F, et al., (1991). Effect of a peroxisome proliferator on b-oxidation and iverall energy balance in obese (fa/fa) rats. Am J Physiol, 260 (2 Pt 2):R278-83.
3. Dryden S, Brown M, King P and Williams G. (1999). Decreased plasma leptin in lean and obese Zucker rats after treatment with the serotonin reuptake inhibitor fluoxetine. Horm Metab Res, 31 (6), 363-6.
4. Edwards S and Stevens R. (1994). Effects of chronic systemic administration of 5-HT on food intake and body weight in rats. Pharmacology Biochem Behav. 47 (4), 865-72.
5. Grinker JA, Drewnowski A, Enns M and Kissuleff H (1980). Effects of d- amphetamine and fenfluramine on feeding patterns and activity of obese and lean Zucker rats. Pharmacol Biochem Behav. 12 (2), 265-75.
Evaluation of Compound's Efficacy on the Reduction of Body Weight in Diet-Induced Obese Mice
The purpose of this protocol is to determine the effect of chronic administration of an unknown compound on body weight of mice made obese by exposure to a 45% kcal/g high fat diet during more than 10 weeks. The body weight of mice selected for the studies is higher than three standard deviations from the weight of a control group of mice fed standard low fat (5-6% fat) mouse chow. Diet-induced obese (DIO) animals are frequently used in the determination of compound efficacy in the reduction of body weight1, 2' 3' 4. This animal model has been successfully used in the identification and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans ' ' .
A typical study include 60-80 male C57bl/J6 mice (n=10/ treatment group) with an average body weight of approximately 45 g. Mice are kept in standard animal rooms under controlled temperature and humidity and a 12/12 light dark cycle. Water and food are continuously available. Mice are single housed in shoeboxes. Animals are sham dosed with study vehicle for at least four days before the recording of two-days baseline measurement of body weight and 24 hr food and water consumption. Mice are assigned to one of 6-8 treatment groups based upon their body weight on baseline. The groups are set up so that the mean and standard error of the mean of body weight were similar.
Animals are orally gavaged (5 ml/kg) daily before the dark phase of the LD/cycle for a pre-determined number of days (typically 8-14 days) with their assigned dose/ - compound. At this time, body weight, food and water consumption are measured.
Data is analyzed using appropriate statistics following the research design. On the final day, animals are euthanized using CO2 inhalation.
1. Brown M, Bing C, King P, Pickavance L, Heal D and Wilding J. (2001). Sibutramine reduces feeding, body fat and improve insulin resistance in dietary-obese Wistar rats independently of hypothalamic neuropeptide Y. British Journal of Pharmacology, 132, 1898-1904.
2. Guerre-Millo m, et al., (2000). Peroxisome Proliferator-activated receptor a activators improve insulin sensitivity and reduce adiposity. The Journal of
Biological Chemistry, 275 (22), 16638-16642. 3. Han LK, Kimura Y and Okuda H. (1999). Reduction in fat storage during chitin-chitosan treatment in mice fed a high-fat diet. Int J Obes Relat Metab Disord, 23 (2) 174-9.
4. Surwit RS, Dixon TM, Petro AE, Daniel KE and Collins S. (2000). Diazoxide restores beta-3 adrenergic receptor function in diet-induced obesity and diabetes. Endocrinology, 141 (10), 3630-7.
Evaluation of Compound's Efficacy on the Reduction of Food Intake in Lean
Overnight Fasted Rats
The purpose of this protocol is to determine the effect of a single dose of an unknown compound on food consumption of lean overnight fasted rats. The fasted-refed rat model is frequently used in the field of obesity to identify compounds with potential for anorectic effects. This animal model has been successfully used in the identification and characterization of the efficacy profile of compounds that are or have been used in the management of body weight in obese humans1, 2' 3 & 4.
A typical study includes 60-80 male rats (n=10/treatment group) with an average body weight of approximately 280 g. Rats are kept in standard animal rooms under controlled temperature and humidity and a 12/12 light dark cycle. Rats are single housed in suspended cages with a mesh floor. Water and food are continuously available unless the animals are being fasted for the study.
The efficacy test: The rats are fasted overnight during the dark phase (total of approx. 16-18 hrs). The animal is dosed orally with his assigned treatment (2mg.ml). One hour after dosing, pre-weighed food jars are returned to the cage. Food intake is recorded 30, 60, 90, 180, 240 minutes post food return. At each time point, spillage is returned to the food jar and then the food jars are weighed. The amount of food consumed is determined for each time point. Difference between treatment group is determined using appropriate statistical analysis.
Blavet N DeFeudis FV and Clostre F (1982). Studies on food intake in fasted rat. Gen Pharmacology, 13(4), 293-7.
Grignaschi G, Fanelli E, Scagnol I, and Samanin R (1999). Studies on the role of serotonin receptors in the effect of sibutramine in various feeding paradigms in rats. Br. J. Pharmacol., 127(5), 1190-1194.
McTavish D and Heel RC. (1992). Dexfenfluramine: A review of its pharmacological properties and therapeutic potential in obesity. Drug. 43 (5), 713-733.
Rowland NE, Antelman SM, Bartness TJ (1985). comparison of the effects of fenfluramine and other anorectic agents in different feeding and drinking paradigms in rats. Life Science, 36, 2295-2300.
Example 20
Expression profiling
Total cellular RNA was isolated from cells by one of two standard methods: 1) guanidine isothiocyanate/cesium chloride density gradient centrifugation [Kellogg et al (1990)]; or with the Tri-Reagent protocol according to the manufacturer's specifications (Molecular Research Center, Inc., Cincinatti, Ohio). Total RNA prepared by the Tri-reagent protocol was treated with DNAse I to remove genomic DNA contamination.
For relative quantitation of the mRNA distribution, total RNA from each cell or tissue source was first reverse transcribed. Eighty-five μg of total RNA was reverse transcribed using 1 μmole random hexamer primers, 0.5 mM each of dATP, dCTP, dGTP and dTTP (Qiagen, Hilden, Germany) and 3000 U RnaseQut (Invitrogen, Groningen, Netherlands) in a final volume of 680 μl. The first strand synthesis buffer and Omniscript reverse transcriptase (2 u/μl) were obtained from (Qiagen, Hilden, Germany). The reaction was incubated at 37°C for 90 minutes and cooled on ice. The volume was adjusted to 6800 μl with water, yielding a final concentration of 12.5 ng/μl of starting RNA.
For relative quantitation of the distribution of mRNA in cells and tissues the Perkin Elmer ABI Prism R™ 7700 Sequence Detection system or Biorad iCycler was used according to the manufacturer's specifications and protocols. PCR reactions were set up to quarititate expression of the test gene and the housekeeping genes HPRT (hypoxanthine phosphoribosyltransferase), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), β -actin, and others. Forward and reverse primers and probes were designed using the Perkin Elmer ABI Primer Express™ software and were synthesized by TibMolBiol (Berlin, Germany). The forward primer sequence was:
Primerl ggatcctgatgaaccaccac The reverse primer sequence was Primer2 ggataccaccaccaatcagg. Probe 1 tccaccaagaccaatgctcagattt, labeled with , FAM (carboxyfluorescein succinimidyl ester) as the reporter dye and TAlvlRA (carboxy- tetramethylrhodamine) as the quencher, was used as a probe. The following reagents were prepared in a total of 25 μl : lx TaqMan buffer A, 5.5 mM MgCl2, 200 nM of dATP, dCTP, dGTP, and dUTP, 0.025 U/μl AmpliTaq Gold™, 0.01 U/ μl AmpErase, and Probel tccaccaagaccaatgctcagattt, forward and reverse primers each at 200 nM, 200 nM , FAM/TAMRA-labeled probe, and 5 μ 1 of template cDNA. Thermal cycling parameters were 2 min at 50°C, followed by 10 min at 95°C, followed by 40 cycles of melting at 95°C for 15 sec and annealing/extending at 60°C for 1 min. Calculation of corrected CT values
The CT (threshold cycle) value is calculated as described in the "Quantitative determination of nucleic acids" section. The CF-value (factor for threshold cycle correction) is calculated as follows:
1. PCR reactions were set up to quantitate the housekeeping genes (HKG) for each cDNA sample.
2. CTnKG-values (threshold cycle for housekeeping gene) were calculated as described in the "Quantitative determination of nucleic acids" section.
3. CTHKG-mean values (CT mean value of all HKG tested on one cDNAs) of all HKG for each cDNA are calculated (n = number of HKG):
CTHKG-n-mean value = (CTHκ.G.-value + CTπκG2-value + ... + CTπ G-n-value) / n
4. CTpannei mean value (CT mean value of all HKG in all tested cDNAs) = (CTHKGi-mean value + CTHKG2-mean value + ...+ CTπKG-y-mean value) / y (y = number of cDNAs).
5. CFCDNA-n (correction factor for cDNA n) = CTpannei-mean value - CTHKG-IΓ mean value.
6. CTCDNA-n (CT value of the tested gene for the cDNA n) + CFCDNA-_ (correction factor for cDNA n) = CT cor-cDNA-n (corrected CT value for a gene on cDNA n).
Calculation of relative expression
Definition : highest CTcor.cDNA.n ≠ 40 is defined as CTcor.CDNA [high] Relative Expression = 2 (CTcor-cDNA[h,sh] " CTCO.-C DNA-„) The following tissues were tested: fetal , heart, heart, pericardium, heart atrium (right), heart atrium (left), heart ventricle (left), heart ventricle (right), heart apex, Purkinje fibers, interventricular septum, fetal aorta, aorta, artery, coronary artery, pulmonary artery, carotid artery, mesenteric artery, vein, pulmonic valve, coronary artery smooth muscle primary cells, HUVEC cells, skin, adrenal gland, thyroid, thyroid tumor, pancreas, pancreas liver cirrhosis, esophagus, esophagus tumor, stomach, stomach tumor, colon, colon tumor, small intestine, ileum, ileum tumor, ileum chronic inflammation, rectum, salivary gland, fetal liver, liver, liver liver cirrhosis, liver tumor, HEP G2 cells, leukocytes (peripheral blood), Jurkat (T-cells), bone marrow, erythrocytes, lymph node, thymus, thrombocytes, bone marrow stromal cells, bone marrow CD71+ cells, bone marrow CD33+ cells, bone marrow CD34+ cells, bone marrow CD 15+ cells, cord blood CD71+ cells, cord blood CD34+ cells, neutrophils cord blood, neutrophils peripheral blood, spleen, spleen liver cirrhosis, skeletal muscle, adipose, fetal brain, brain, Alzheimer brain, cerebellum, cerebellum (right), cerebellum (left), cerebral cortex, Alzheimer cerebral cortex, frontal lobe, Alzheimer brain frontal lobe, occipital lobe, parietal lobe, temporal lobe, precentral gyrus, postcentral gyrus, tonsilla cerebelli, vermis cerebelli, pons, substantia nigra, cerebral meninges, cerebral peduncles, corpus callosum, hippocampus, thalamus, dorsal root ganglia, spinal cord, neuroblastoma SK-N-MC cells, neuroblastoma SH-SY5Y cells, neuroblastoma IMR32 cells, glial tumor H4 cells, glial tumor H4 cells + APP, HEK CNS, HEK CNS + APP, retina, fetal lung, fetal lung fibroblast IMR-90 cells, fetal lung fibroblast MRC-5 cells, lung, lung right upper lobe, lung right mid lobe, lung right lower lobe, lung lupus disease, lung tumor, lung COPD, trachea, cervix, testis, HeLa cells (cervix tumor), placenta, uterus, uterus tumor, ovary, ovary tumor, breast, breast tumor, MDA MB 231 cells
(breast tumor), mammary gland, prostate, prostate BPH, bladder, ureter, penis, corpus cavernos urn, fetal kidney, kidney, kidney tumor, HEK 293 cells.
The results are shown below: TISSUE / relative Expression
fetal heart 2320 heart ' 3541 pericardium 1758 heart atrium (right) 11191 heart atrium (left) 1468 heart ventricle (left) 1144 heart ventricle (right) 80 heart apex 7804
Purkinje fibers 1698 interventricular septum 13034 fetal aorta 560 aorta 260 artery 44 coronary artery 666 pulmonary artery 39 carotid artery 137 mesenteric artery 1121 vein 32 pulmonic valve 744 coronary artery smooth muscle primary cells 2
HUVEC cells 27 fetal brain 64634 brain 19349 alzheimer brain 25888 cerebellum 2257 cerebellum (right) 148489 cerebellum (left) 95950 cerebral cortex 69755 alzheimer cerebral cortex 116502 frontal lobe 87682 alzheimer brain frontal lobe 77398 occipital lobe 87682 parietal lobe 96618 temporal lobe 155872 precentral gyrus 123145 postcentral gyrus 1468 tonsilla cerebelli 108701 vermis cerebelli 75281 pons 80684 substantia nigra 282913 cerebral meninges 175 cerebral peduncles 39787 corpus callosum 46663 hippocampus 140479 thalamus 33689 dorsal root ganglia 101 spinal cord 24322 neuroblastoma SK-N-MC cells 2998 neuroblastoma SH-SY5Y cells 28329 neuroblastoma IMR32 cells 31652 glial tumor H4 cells 84 glial tumor H4 cells + APP 35
HEK CNS 13777 HEK CNS + APP 28133 retina 1652 leukocytes (peripheral blood) 74
Jurkat (T-cells) 5 bone marrow 35 erythrocytes 4 lymphnode 111 thymus 189 thrombocytes 1 bone marrow stromal cells 23 bone marrow CD71+ cells 0 bone marrow CD33+ cells 0 bone marrow CD34+ cells 17 bone marrow CD 15+ cells 0 cord blood CD71+ cells 0 cord blood CD34+ cells 0 neutrophils cord blood 0 neutrophils peripheral blood 0 spleen 228 spleen liver cirrhosis 37 fetal lung 35120 fetal lung fibroblast IMR-90 cells 167 fetal lung fibroblast MRC-5 cells 38 . lung 413 lung right upper lobe 1675 lung right mid lobe 1090 lung right lower lobe 1618 lung lupus disease 365 lung tumor 4513 lung COPD 350 trachea 695 prostata 1418 prostate BPH 399 bladder 2120 ureter 5078 penis 278 corpus cavernosum 501 fetal kidney 39512 kidney 1351 kidney tumor 596
HEK 293 cells 15936 adrenal gland 4905 thyroid 653 thyroid tumor 77 pancreas 64 pancreas liver cirrhosis 137 esophagus 269 esophagus tumor 19083 stomach 6937 stomach tumor 6700 colon 2937 colon tumor 282 small intestine 7591 ileum 6654 ileum tumor 137 ileum chronic inflammation 24 rectum 8659 salivary gland 91 fetal liver 481 liver 910 liver liver cirrhosis 322 liver tumor 1846 HEP G2 cells 25 skeletal muscle 861 adipose 1144 skin 21174 cervix 3591 testis 1226
HeLa cells (cervix tumor) 1 placenta 3373 uterus 4182 uterus tumor 3848 ovary 7132 ovary tumor 43538 breast 9542 breast tumor 739
MDA MB 231 cells (breast tumor) 43 mammary gland 1618
The expression profile shows that human calcium-independent alpha-latrotoxin receptor homolog 3 is involved in the following diseases and conditions: cardiovascular diseases, central nervous system diseases, diabetis, obesity, dermatological diseases, endocrinological diseases, gastrointestinal diseases, liver diseases, cancer, neurological diseases, respriratory diseases, diseases of the reproductive system, genito-urological diseases. Modulators of the human calcium-independent alpha- latrotoxin receptor homolog 3 can be used to treat cardiovascular diseases, central nervous system diseases, diabetis, obesity, dermatological diseases, endocrinological diseases, gastrointestinal diseases, liver diseases, cancer, neurological diseases, respriratory diseases, diseases of the reproductive system, genito-urological diseases.
Regulators of the expression of human calcium-independent alpha-latrotoxin receptor homolog 3 can be used to treat cardiovascular diseases, central nervous system diseases, diabetis, obesity, dermatological diseases, endocrinological diseases, gastrointestinal diseases, liver diseases, cancer, neurological diseases, respriratory diseases, diseases of the reproductive system, genito-urological diseases. . REFERENCES
Structural requirements for alpha-latrotoxin binding and alpha-latrotoxin-stimulated secretion. A study with calcium-independent receptor of alpha-latrotoxin (CIRL) deletion mutants. JBiol Chem 1999 274(6):3590-6.
alpha-Latrotoxin receptor CIRL/latrophilin 1 (CLl) defines an unusual family of ubiquitous G-protein-linked receptors. G-protein coupling not required for triggering exocytosis. JBiol Chem 1998 273(49):32715-24.
A latrophilin/CL-1-like GPS domain in polycystin-1. Curr Biol 1999 9(16):R585-8 Structural requirements for alpha-latrotoxin binding and alpha-latrotoxin-stimulated secretion. A study with calcium-independent receptor of alpha-latrotoxin (CIRL) deletion mutants. JBiol Chem 1999 Feb 5;274(6):3590-6.
Structural requirements for alpha-latrotoxin binding and alpha-latrotoxin-stimulated secretion. A study with calcium-independent receptor of alpha-latrotoxin (CIRL) deletion mutants. JBiol Chem 1999 Feb 5;274(6):3590-6.
Involvement of the calcium-independent receptor for alpha-latrotoxin in brain ischemia. Brain Res Mol Brain Res 2002 Aug 1;104(2):246.
alpha-Latrotoxin and its receptors: neurexins and CIRL/latrophilins Annu Rev Neurosci 2001;24:933-62.

Claims

1. An isolated polynucleotide being selected from the group consisting of:
a. a polynucleotide encoding a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide comprising an amino acid sequence selected form the group consisting of:
i. amino acid sequences which are at least about 95% identical to the amino acid sequence shown in SEQ ID NO: 2; and ii. the amino acid sequence shown in SEQ ID NO: 2.
b. a polynucleotide comprising the sequence of SEQ ID NO: 1 ;
c. a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b) and encodes a calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide;
d. a polynucleotide the sequence of which deviates from the poly- nucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code and encodes a calcium-mdependent alpha-latrotoxin receptor homolog 3 polypeptide; and
e. a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d) and encodes a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide.
2. An expression vector containing any polynucleotide of claim 1.
3. A host cell containing the expression vector of claim 2.
4. A substantially purified calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide encoded by a polynucleotide of claim 1.
5. A method for producing a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide, wherein the method comprises the following steps:
a. culturing the host cell of claim 3 under conditions suitable for the expression of the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide; and
b. recovering the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide from the host cell culture.
6. A method for detection of a polynucleotide encoding a calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide in a biological sample comprising the following steps:
a. hybridizing any polynucleotide of claim 1 to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and
b. detecting said hybridization complex.
7. The method of claim 6, wherein before hybridization, the nucleic acid material of the biological sample is amplified.
8. A method for the detection of a polynucleotide of claim 1 or a calcium- independent alpha-latrotoxin receptor homolog 3 polypeptide of claim 4 comprising the steps of: a. contacting a biological sample with a reagent which specifically interacts with the polynucleotide or the calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide and
b. detecting the interaction
9. A diagnostic kit for conducting the method of any one of claims 6 to 8.
10. A method of screening for agents which decrease the activity of a calcium- independent alpha-lafrotoxin receptor homolog 3, comprising the steps of:
a. contacting a test compound with any calcium-independent alpha- lafrotoxin receptor homolog 3 polypeptide encoded by any polynucleotide of claiml;
b. detecting binding of the test compound to the calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a calcium-independent alpha-latrotoxin receptor homolog 3.
11. A method of screening for agents which regulate the activity of a calcium- independent alpha-latrotoxin receptor homolog 3, comprising the steps of:
a. contacting a test compound with a calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide encoded by any polynucleotide of claim 1; and
b. detecting a calcium-independent alpha-latrotoxin receptor homolog 3 activity of the polypeptide, wherein a test compound which increases the calcium-independent alpha-latrotoxin receptor homolog 3 activity is identified as a potential therapeutic agent for increasing the activity of the calcium-independent alpha-latrotoxin receptor homolog 3, and wherein a test compound which decreases the calcium-independent alpha-latrotoxin receptor homolog 3 activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity of the calcium-independent alpha-latrotoxin receptor homolog 3.
12. A method of screening for agents which decrease the activity of a calcium- independent alpha-latrotoxin receptor homolog 3, comprising the step of:
contacting a test compound with any polynucleotide of claim 1 and detecting binding of the test compound to the polynucleotide, wherein a test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of calcium-independent alpha-latrotoxin receptor homolog 3.
13. A method of reducing the activity of calcium-independent alpha-latrotoxin receptor homolog 3, comprising the step of:
contacting a cell with a reagent which specifically binds to any polynucleotide of claim 1 or any calcium-independent alpha-latrotoxin receptor homolog 3 polypeptide of claim 4, whereby the activity of calcium-independent alpha-latrotoxin receptor homolog 3 is reduced.
14. A reagent that modulates the activity of a calcium-independent alpha- latrotoxin receptor homolog 3 polypeptide or a polynucleotide wherein said reagent is identified by the method of any of the claim 10 to 12.
15. A pharmaceutical composition, comprising: the expression vector of claim 2 or the reagent of claim 14 and a pharmaceutically acceptable carrier.
16. Use of the expression vector of claim 2 or the reagent of claim 14 in the preparation of a medicament for modulating the activity of a calcium- independent alpha-latrotoxin receptor homolog 3 in a disease.
17. Use of claim 16 wherein the disease is a cardiovascular disease, central nervous system disease, diabetis, obesity, dermatological disease, endocrinological disease, gastrointestinal disease, liver disease, cancer, neurological disease, respriratory disease, disease of the reproductive system, or a genito-urological disease.
PCT/EP2003/010665 2002-09-25 2003-09-25 Regulation of human calcium-independent alpha-latrotoxin receptor homolog 3 WO2004029086A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003275986A AU2003275986A1 (en) 2002-09-25 2003-09-25 Regulation of human calcium-independent alpha-latrotoxin receptor homolog 3

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US41315602P 2002-09-25 2002-09-25
US60/413,156 2002-09-25
US46087703P 2003-04-08 2003-04-08
US60/460,877 2003-04-08

Publications (2)

Publication Number Publication Date
WO2004029086A2 true WO2004029086A2 (en) 2004-04-08
WO2004029086A3 WO2004029086A3 (en) 2004-06-10

Family

ID=32045239

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/010665 WO2004029086A2 (en) 2002-09-25 2003-09-25 Regulation of human calcium-independent alpha-latrotoxin receptor homolog 3

Country Status (2)

Country Link
AU (1) AU2003275986A1 (en)
WO (1) WO2004029086A2 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000052039A2 (en) * 1999-03-04 2000-09-08 Icos Corporation Lectomedin materials and methods
WO2002010387A2 (en) * 2000-07-27 2002-02-07 Incyte Genomics, Inc. G-protein coupled receptors
WO2002061087A2 (en) * 2000-12-19 2002-08-08 Lifespan Biosciences, Inc. Antigenic peptides, such as for g protein-coupled receptors (gpcrs), antibodies thereto, and systems for identifying such antigenic peptides
US20030054347A1 (en) * 2001-04-27 2003-03-20 The Regents Of The University Of Michigan Latrophilin Polynucleotides

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000052039A2 (en) * 1999-03-04 2000-09-08 Icos Corporation Lectomedin materials and methods
WO2002010387A2 (en) * 2000-07-27 2002-02-07 Incyte Genomics, Inc. G-protein coupled receptors
WO2002061087A2 (en) * 2000-12-19 2002-08-08 Lifespan Biosciences, Inc. Antigenic peptides, such as for g protein-coupled receptors (gpcrs), antibodies thereto, and systems for identifying such antigenic peptides
US20030054347A1 (en) * 2001-04-27 2003-03-20 The Regents Of The University Of Michigan Latrophilin Polynucleotides

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ICHTCHENKO K ET AL: "A NOVEL UBIQUITOUSLY EXPRESSED ALPHA-LATROTOXIN RECEPTOR IS A MEMBER OF THE CIRL FAMILY OF G-PROTEIN-COUPLED RECEPTORS" JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, BALTIMORE, MD, US, vol. 274, no. 9, 26 February 1999 (1999-02-26), pages 5491-5498, XP000828192 ISSN: 0021-9258 *
MATSUSHITA H ET AL: "THE LATROPHILIN FAMILY: MULTIPLY SPLICED G PROTEIN-COUPLED RECEPTORS WITH DIFFERENTIAL TISSUE DISTRIBUTION" FEBS LETTERS, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 443, 1999, pages 348-352, XP002926615 ISSN: 0014-5793 *

Also Published As

Publication number Publication date
WO2004029086A3 (en) 2004-06-10
AU2003275986A8 (en) 2004-04-19
AU2003275986A1 (en) 2004-04-19

Similar Documents

Publication Publication Date Title
EP1364026B1 (en) Human g protein-coupled receptor
US20040030100A1 (en) Regulation of human extracellular calcium- sensing g protein-coupled receptor
US20030166600A1 (en) Regulation of human isotocin-like g protein-coupled receptor
US20040096847A1 (en) Regulation of human secretin receptor-like gpcr
US20040136981A1 (en) Regulation of human histamine h2-like g protein-coupled receptor
US20050064404A1 (en) Regulation of human serotonin-like g protein-coupled receptor
WO2004029086A2 (en) Regulation of human calcium-independent alpha-latrotoxin receptor homolog 3
WO2004009630A1 (en) Regulation of human serotonin receptor
US20030143590A1 (en) Regulation of human dopamine-like g protein- coupled receptor
US20010041355A1 (en) Regulation of human nerve growth factor-related G protein-coupled receptor
WO2004031234A2 (en) Regulation of human calcium-independent alpha-latrotoxin receptor
WO2004031235A1 (en) Regulation of human calcium-independent alpha-latrotoxin receptor
WO2004000883A1 (en) Regulation of human growth hormone-releasing hormone receptor
US20040058350A1 (en) Regulation of human secretin receptor-like gpcr
WO2003104279A1 (en) Regulation of a human g protein-coupled receptor
EP1290163A2 (en) Regulation of human serotonin-like g protein-coupled receptor
US20030073115A1 (en) Regulation of human galanin receptor-like g protein coupled receptor
US20040143092A1 (en) Regulation of human dorsal root receptor-like g protein-coupled receptor
WO2002099107A2 (en) Regulation of human trace amine receptor ta5
WO2002101043A2 (en) Regulation of human ta4 receptor
US20030114643A1 (en) Regulation of human serotonin-like g protein-coupled receptor
WO2003051925A1 (en) Human secretin-type gpcr (latrophilin)
US20040039170A1 (en) Regulation of human g protein-coupled receptor
WO2004009631A2 (en) Human gnrh (type 2) receptor
EP1268779A1 (en) Regulation of human galanin receptor-like g protein coupled receptor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP