WO2011062935A1

WO2011062935A1 - Compositions and assay systems for intracellular processes

Info

Publication number: WO2011062935A1
Application number: PCT/US2010/056936
Authority: WO
Inventors: Selena Bartlett; Antonello Bonci; Carolina Haass-Koffler; Mohammed Naeemuddin
Original assignee: The Regents Of The University Of California
Priority date: 2009-11-17
Filing date: 2010-11-17
Publication date: 2011-05-26

Abstract

This invention is directed to novel compositions, process methods, research tools, and use of these in the identification and development of novel therapeutic and/or diagnostic products. The compositions of the invention are fusion proteins that in essence recreate and/or potentiate one or more protein complex interactions that occur in vivo in the modulation of biological processes.

Description

UNITED STATES PATENT APPLICATION

COMPOSITIONS AND ASSAY SYSTEMS FOR INTRACELLULAR PROCESSES

SELENA BARTLETT

Berkeley, California A Citizen of Australia ANTONELLO BONCI

Bethesda, Maryland A Citizen of the USA CAROLINA HAASS-KOFFLER

San Francisco, California A Citizen of the United States MOHAMMED NAEEMUDDIN

Fremont, California A Citizen of the United States

Ernest Gallo Clinic and Research Center

Attorney Docket Number: GLLO006PCT/GC055PCT

ATTORNEY DOCKET NUMBER: GLLO006PCT/GC055PCT

COMPOSITIONS AND ASSAY SYSTMS FOR INTRACELLULAR PROCESSES

FIELD OF THE INVENTION

[0001] This invention relates to compositions, research tools, and assay systems of use for of such drug discovery. In particular, the invention relates to fusion proteins used to identify modulators of biological activity mediated through transmembrane proteins.

BACKGROUND OF THE INVENTION

[0002] In the following discussion certain articles and methods will be described for background and introductory purposes. Nothing contained herein is to be construed as an "admission" of prior art. Applicant expressly reserves the right to demonstrate, where appropriate, that the articles and methods referenced herein do not constitute prior art under the applicable statutory provisions.

[0003] Numerous intracellular biological molecules associated with mammalian disease states are difficult to use in drug discovery activities due to the specific properties of these molecules. Mammalian proteins that require post- translational modification, tightly regulated folding, or cellular processing present significant challenges in that their activity is dependent upon their modification or processing. Other proteins that are highly insoluble or which are difficult to isolate present additional challenges, particularly in providing sufficient quantity of protein in a useful form. These properties have hampered the study of these molecules, including their role in normal cellular processes as well as their role in the pathology of the various diseases.

[0004] In a specific example, proteins that are generally insoluble, e.g., amyloid proteins, have been difficult to study, and reproduction of their normal and/or pathological activities in model systems including fibril formation has been a challenge in the study of various forms of amyloidosis. The experimental systems used to study amyloid proteins generally cannot recreate the native conditions under which these fibrils are formed in vivo. For example, some proteins need to partially unfold, or denature, before they can form amyloid fibrils. Unfolding is promoted by certain experimental conditions such as low pH or high temperature. Therefore, experiments that seek to explore the role of protein misfolding in fibril formation often employ conditions not typically found in the body to accelerate the rate of protein fibrillation. The results obtained are thus limited by these necessary conditions, and the ability to identify molecules that promote, decelerate or prevent fibril formation in vivo is hampered by the experimental conditions of fibril formation.

[0005] In another specific example, the study of various proteases is difficult due to the need for appropriate processing for activity. Zymogens are large protease precursor proteins, and the protease activity is activated by removal of an inhibitory segment or protein. In certain cases, activation occurs once the protease is delivered to the extracellular environment to prevent damage to the cell that produces the protease from being damaged by it. The regulation and function of proteases is thus difficult to study, as the processing required cannot be properly recreated in traditional cell models.

[0006] There is thus a need in the art for new research tools for the study of protein activity and identification of molecules that modulate this and other similar processes. The present invention provides compositions, research tools, and assays that address this need.

SUMMARY OF THE INVENTION

[0001] This Summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter. Other features, details, utilities, and advantages of the claimed subject matter will be apparent from the following written Detailed Description, including those aspects illustrated in the accompanying drawings and defined in the appended claims.

[0002] This invention is directed to novel compositions, process methods, assay systems, research tools, and use of these in the identification and development of novel therapeutic and/or diagnostic products. The compositions of the invention are fusion proteins that allow the extracellular presentation of a functional protein or peptide.

[0003] In one aspect, the fusion protein compositions of the invention comprise 1 ) a peptide having an N-terminal extracellular domain from a cell surface protein, a transmembrane region from a cell surface protein, and an intracellular domain and 2) an intracellular peptide or a fragment thereof. The intracellular domain of the first peptide may comprise an intracellular signaling region, an intracellular anchoring region, and the like, and may be from a transmembrane protein or a protein that is associated with the intracellular membrane surface.

[0004] In one specific aspect, the fusion protein compositions of the invention comprise: 1) a peptide having an N-terminal extracellular domain from a G-protein- coupled receptors (GPCR), a transmembrane region from a GPCR, and an intracellular domain and 2) an intracellular peptide or a fragment thereof. The second peptide is fused to an extracellular portion of the first peptide, and preferably to the N-terminal extra cellular domain of the first peptide, and allows extracellular presentation of the second peptide. In certain aspects, the intracellular region of the first peptide is a domain of a GPCR. The fusion protein allows the peptide to adopt the desired conformational configuration, including the native conformation or a conformation associated with a pathological condition. The compositions thus have at least one preserved functional activity in assays for biological processes, including assays in mammalian cells, and are useful in the identification or investigation of intracellular peptide activity.

[0005] In a first aspect of the invention, the intracellular peptide comprises all or an active portion of an amyloid protein. In one specific aspect of the invention, the fusion protein compositions of the invention comprise: 1 ) a peptide having an N- terminal extracellular domain from a GPCR, a transmembrane region from a GPCR, and an intracellular domain and 2) an amyloid protein or a fragment thereof. In certain aspects, the intracellular region of the first peptide is a domain of a GPCR. These compositions allow the study of fibril and/or plaque formation in a controlled, extracellular environment, and can recreate what is believed to be the initial intracellular pathology in these diseases.

[0006] In certain embodiments, the intracellular peptide comprises an enzyme or a proenzyme, e.g., a kinase, a phosphatase, a zymogen, a protease, or a fragment thereof. Thus, in this specific aspect, the fusion protein compositions of the invention comprise: 1) a peptide having an N-terminal extracellular domain from a GPCR, a transmembrane region from a GPCR, and an intracellular domain and 2) an enzyme, proenzyme or a fragment thereof. In certain aspects, the intracellular region of the first peptide is a domain of a GPCR. These compositions provide methods for the study of different processed forms, isoforms and/or domains of an enzyme, and ways to identify binding agents that modulate this enzymatic activity.

[0007] In more specific aspects of the invention, the enzyme used in the fusion composition is an intracellular protein involved with one or more signal transduction pathways, e.g., a kinase or a phosphatase. In another specific aspect of the invention, the enzyme used in the fusion composition is an intracellular protein associated with protease activity.

[0008] In other examples, the intracellular peptide fused to the cell surface protein is an intracellular region of a transmembrane receptor. The use of the intracellular portion of these proteins can help to elucidate the binding partners of these receptors, as well as identify pathways in which these receptors participate in regulation of cytoplasmic and/or nuclear activities. Thus, in this specific aspect, the fusion protein compositions of the invention comprise: 1) a peptide having an N- terminal extracellular domain from a GPCR, a transmembrane region from a GPCR, and an intracellular domain and 2) an intracellular region of a transmembrane protein. In certain aspects, the intracellular region of the first peptide is a domain of a GPCR. These compositions provide methods for the study of different intracellular affinities of these transmembrane proteins, and identify pathways that can be modulated via modulation of the transmembrane proteins.

[0009] In other specific aspects of the invention, the intracellular proteins that are used in the fusion composition are intracellular proteins associated with infectious disease, e.g., peptides produced by the human immunodeficiency virus (HIV), or the Hepatitis C virus (HCV). Thus, in this specific aspect, the fusion protein compositions of the invention comprise: 1) a peptide having an N-terminal extracellular domain from a GPCR, a transmembrane region from a GPCR, and an intracellular domain and 2) a peptide from an infectious organism. In certain aspects, the intracellular region of the first peptide is a signaling domain of a GPCR. These compositions allow the study of typically intracellular components of infectious organisms, and potentially the ability to develop binding agents that will disrupt their function in mammalian cells.

[00010] In some aspects of the invention, the fusion protein compositions comprise a substantially complete amino acid sequence of a particular GPCR, and thus the first peptide comprises an N-terminal extracellular domain, transmembrane region, and an intracellular signaling domain corresponding to a single GPCR.

[00011] Both the first and the second peptide may include amino acid sequence variants that are naturally occurring (e.g., due to genetic polymorphisms within a population), that are added to confer a desirable characteristic to the composition (e.g., mutations introduced to increase stability, to aid in production, and/or to aid in isolation of the composition), or that are added to study the effect of specific mutations and/or polymorphisms of the activity of the composition.

[00012] The compositions of the invention may be created using recombinant technology, or they may be associated following expression of the proteins using synthetic or biological linkers. In a preferred aspect, the composition is produced as a single recombinant protein in a cell.

[00013] One significant use of the composition is as a research tool specifically for the discovery and development of therapeutic products for modulation of a biological process involved in a disease or disorder. The research tool may be useful in various aspects of drug discovery and investigation, including without limitation the initial identification of a drug candidate, the confirmation of activity of a drug candidate; and the identification of activity in an existing pharmaceutical product.

[00014] Another use of the composition is as a research tool specifically used to detect the presence or absence of molecules necessary for the modulation of a biological process involved in a disease or disorder.

[00015] Thus, in one aspect the invention includes research tools and assay systems using such research tools comprising the compositions of the invention, and uses of such research tools and assay systems in identification, investigation and/or confirmation of activity of binding agents that are useful as therapeutic binding agents. The present invention thus encompasses binding agents that are isolated using the method of the invention and uses of such binding agents in either a therapeutic or a diagnostic setting.

[00016] Different classes of cell surface receptors may provide the signaling portion of the fusion peptide. In a specific aspect, GPCRs may be used in the methods of the invention. Each of the different classes of GPCRs are amenable to production of fusion proteins, as described in co-pending PCT Application No. PCT/US2010/29999 and US Application No. 12/754499, which are incorporated herein in their entirety. Another exemplary class of proteins that can be used in the compositions and assay systems of the invention include ion channels, as described in co-pending PCT Application No. PCT/US2010/049149, which is incorporated herein in its entirety. Other cell surface receptors may also be used as described herein.

[00017] In yet another aspect, the present invention provides assay systems that utilize research tools of the invention for identification of a drug candidate for treatment of a biological process. These assay systems utilize the fusion protein compositions of the invention to test one or more binding agents for modulation of the functional activity or changes in conformation of the research tool composition. Once agents are identified using the assay systems of the invention, the binding agents that display the desired change in functional activity or conformation can be isolated for further characterization. The binding agents that display the desired change become drug candidates for the condition associated with that particular biological process.

[00018] The invention thus also provides methods and assay systems for identification of a drug candidate for treatment of a biological process involving an intracellular peptide comprising 1 ) providing a research tool composition comprising a peptide having an N-terminal extracellular domain from a GPCR, a transmembrane region from a GPCR, and an intracellular domain; and a peptide that corresponds an intracellular peptide or a fragment, wherein the second peptide is fused to an extracellular portion of the first peptide; 2) testing one or more binding agents for modulation of functional activity of the second peptide in the research composition, and 3) isolating the binding agents that display the desired change in functional activity of the research tool composition. The binding agents that display the desired change in functional activity of the research tool composition are drug candidates for the biological process involving the intracellular peptide.

[00019] It is a feature of the invention to provide access to proteins that are generally difficult to study due their normal cellular location (e.g., intracellular peptides and peptides located within an organelle membrane), their functional activity, difficulty in purifying reasonable amounts of an active form, degradation of the isolated protein, and the like. The ability to provide such proteins in a tethered format on a cell surface greatly increases the ability to assess activity in a controlled fashion.

[00020] These and other aspects and uses of the invention will be described in more detail in the written description.

BRIEF DESCRIPTION OF THE FIGURES

[00021] FIG. 1 illustrates the structural elements of the construct used to create the apoE3_CRFR fusion protein. [00022] FIG. 2 illustrates the structural elements of the construct used to create the apoE4_CRFR fusion protein.

[00023] FIG. 3 is a 3D software recreation of the anti-FLAG and anti-HA staining in a cell expressing apoE3 _CRFR2 fusion protein.

[00024] FIG. 4 is a 3D software recreation of the anti-FLAG and anti-HA staining in a cell expressing apoE4_CRFR2 fusion protein.

[00025] FIG. 5 is a 3D software recreation of the anti-FLAG and anti-HA staining in a cell expressing CRFR2 alone.

[00026] FIG. 6 is a more detailed 3D software recreation of the anti-FLAG and anti-HA staining in a cell expressing apoE3 _CRFR2 fusion protein.

[00027] FIG. 7 is a more detailed 3D software recreation of the anti-FLAG and anti-HA staining in a cell expressing the intracellular apoE3 protein

[00028] FIG. 8 illustrates the structural elements of the construct used to create the src_CRFR fusion proteins.

[00029] FIG. 9 is a 3D software recreation of the anti-HA and phalloidin staining in a control HEK 293 cell expressing a src_CRFR construct.

[00030] FIG. 10 is a 3D software recreation of the anti-FLAG and phalloidin staining in a control HEK 293 cell expressing an intracellular Src construct.

[00031] FIG. 11 illustrates the structural elements of the construct used to create the A _CRFR fusion proteins.

DETAILED DESCRIPTION OF THE INVENTION

[00032] The practice of the techniques described herein may employ, unless otherwise indicated, conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant techniques), cell biology, and biochemistry, which are within the skill of those who practice in the art. Such conventional techniques include polymer array synthesis, hybridization and ligation of polynucleotides, and detection of hybridization using a label. Specific illustrations of suitable techniques can be had by reference to the examples herein. However, other equivalent conventional procedures can, of course, also be used. Such conventional techniques and descriptions can be found in standard laboratory manuals such as Green, et al., Eds. (1999), Genome Analysis: A Laboratory Manual Series (Vols. I-IV); Weiner, Gabriel, Stephens, Eds. (2007), Genetic Variation: A Laboratory Manual; Dieffenbach, Dveksler, Eds. (2003), PCR Primer: A Laboratory Manual; Bowtell and Sambrook (2003), DNA Microarrays: A Molecular Cloning Manual; Mount (2004), Bioinjormatics: Sequence and Genome Analysis; Sambrook and Russell (2006), Condensed Protocols from Molecular Cloning: A Laboratory Manual; and Sambrook and Russell (2002), Molecular Cloning: A Laboratory Manual (all from Cold Spring Harbor Laboratory Press); Stryer, L. (1995) Biochemistry (4th Ed.) W.H. Freeman, New York N.Y.; Gait, "Oligonucleotide Synthesis: A Practical Approach" 1984, IRL Press, London; Nelson and Cox (2000),

Lehninger, Principles of Biochemistry 3 rd Ed., W. H. Freeman Pub., New York, N.Y.; and Berg et al. (2002) Biochemistry, 5^th Ed., W.H. Freeman Pub., New York, N.Y., all of which are herein incorporated in their entirety by reference for all purposes. Before the present compositions, research tools and methods are described, it is to be understood that this invention is not limited to the particular methods, compositions, targets and uses described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by appended claims.

[00033] It must be noted that as used herein and in the appended claims, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a composition" refers to one or mixtures of such compositions, and reference to "an assay" includes reference to equivalent steps and methods known to those skilled in the art, and so forth.

[00034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing devices, formulations and methodologies which are described in the publication and which might be used in connection with the presently described invention.

[00035] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes both of the limits, ranges excluding either of those included limits are also included in the invention.

[00036] In the following description, numerous specific details are set forth to provide a more thorough understanding of the present invention. However, it will be apparent to one of skill in the art upon reading the specification that the present invention may be practiced without one or more of these specific details. In other instances, well-known features and procedures well known to those skilled in the art have not been described in order to avoid obscuring the invention.

Definitions

[00037] Unless expressly stated, the terms used herein are intended to have the plain and ordinary meaning as understood by those of ordinary skill in the art. The following definitions are intended to aid the reader in understanding the present invention, but are not intended to vary or otherwise limit the meaning of such terms unless specifically indicated.

[00038] The term "amyloid protein" refers to any protein that can misfold to take on an insoluble form associated with a disease state, or a chaperone protein involved in the misfolding process. The term as used herein includes the amyloid precursor protein, a processed form of the protein, an amyloid peptide known to be associated with a disease state, and oligomers thereof. Examples of amyloid proteins are as set forth in Table 1.

[00039] The term "antibody" is intended to include any polypeptide chain- containing molecular structure with a specific shape that fits to and recognizes an epitope, where one or more non-covalent binding interactions stabilize the complex between the molecular structure and the epitope. As antibodies can be modified in a number of ways, the term "antibody" should be construed as covering any specific binding member or substance having a binding domain with the required specificity. Thus, this term covers antibody fragments, derivatives, functional equivalents and homologues of antibodies, including any polypeptide comprising an immunoglobulin binding domain, whether natural or wholly or partially synthetic. Where bispecific antibodies are to be used, these may be conventional bispecific antibodies, which can be manufactured in a variety of ways (Holliger and Winter, 1993), e.g., prepared chemically or from hybrid hybridomas, or may be any of the bispecific antibody fragments mentioned above. It may be preferable to use scFv dimers or diabodies rather than whole antibodies. Diabodies and scFv can be constructed without an Fc region, using only variable domains, potentially reducing the effects of anti-idiotypic reaction. Other forms of bispecific antibodies include the single chain "Janusins" described in Traunecker et al, (1991). Such antibodies also include CRAbs, which are chelating antibodies which provide high affinity binding to an antigen. D. Neri, et al. J. Mol. Biol, 246, 367-373, and dual-variable domain antibodies as described in Wu C et al., Nat Biotechnol. 2007 Nov;25(l l): 1290-7. Epub 2007 Oct 14.

[00040] A "binding agent" is any molecule that is complementary to one or more regions on a fusion protein composition of the invention via association by chemical or physical means. For the purposes of the present invention, the binding agent may be a compound that prevents binding of an intracellular peptide to a target substrate, a compound that facilitates binding of an intracellular peptide with other members of a protein signaling complex, a compound that binds to a peptide and prevents misfolding, a compound that binds to and disrupts misfolding of a peptide, or a compound that interferes with the association of a known binding pair. Examples of binding agents that can be investigated and/or identified using this invention include, but are not restricted to: peptides, proteins (including derivatized or labeled proteins); antibodies or fragments thereof; small molecules; aptamers; carbohydrates and/or other non-protein binding moieties; derivatives and fragments of a naturally-occurring binding agents; peptidomimetics; and pharmacophores.

[00041] The term "biological process" as used herein includes both normal physiological processes, such as enzymatic activity, regeneration, etc. as well as pathological processes, e.g. those involved in diseases and conditions such as amyloidosis, infectious disease, and the like.

[00042] The term "cell surface protein" as used herein refers to any protein or complex of proteins that comprises an extracellular region, and intracellular region, and one or more transmembrane spanning regions. Cell surface proteins include peptides that are members of signaling complexes comprised of multiple assembled transmembrane subunits, such as integral membrane proteins (e.g., ion channels), cell adhesion molecules (CAMs), obligate multimers, including heterodimers, (e.g., integrins, tyrosine kinase receptors), homodimers and the like.

[00043] The term "complementary" refers to the topological compatibility or interactive structure of interacting surfaces of a composition of the invention and a binding agent. Thus, the composition of the invention and its identified binding agents can be described as complementary, and furthermore, the contact surface characteristics are each complementary to each other. Preferred complementary structures have binding affinity for each other and the greater the degree of complementarity the structures have for each other the greater the binding affinity between the structures.

[00044] The term "diagnostic tool" as used herein refers to any composition or assay of the invention used in order to carry out a diagnostic test or assay on a patient sample. As a diagnostic tool, the composition of the invention may be considered an analyte specific reagent, and as such may form part of a diagnostic test regulated by a federal or state agency. The use of the compositions of the invention as a diagnostic tool is not intended to be related to any use of the composition in the development of therapeutic binding agents. [00045] The term "epitope" refers to the portion of the composition of the invention which is delineated by the area of interaction with a binding agent.

[00046] The term "fused" when referring to a fusion protein of the invention refers to any mechanistic, chemical, or recombinant mechanism for attaching a peptide to a GPCR or a fragment thereof. The fusion of the second peptide to the first peptide may be a direct fusion of the sequences, with the second peptide directly adjacent to the first peptide, or it may be an indirect fusion, e.g., with intervening amino acid sequences such as an identifier or epitope tag sequence, a domain, a functional peptide or a larger protein. In certain aspects, the two peptides may be fused following co-expression in the cell, using high affinity binding sequences between the two peptides, such as biotin and avidin or strepavidin. In yet other examples, the two peptides are fused following expression of the GPCR molecule in the cell and synthetic tethering of the second peptide to the N-terminus of the first GPCR peptide.

[00047] The term "intracellular protein" as used herein refers to any peptide for which the primary activity and/or control mechanism of interest occurs within the cell, including within the nucleus, within an organelle, or within a membrane. This term includes proteins that are produced in a cell but which become active upon leaving a cell, e.g., certain proteases such as lactase and amylase. The protein may be a pepide, a propeptide, a prepropeptide, or a cleavage product of any of these.

[00048] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.

[00049] The term "peptidomimetic" as used herein refers to a protein-like chain designed to mimic a peptide. They typically arise from modification of an existing peptide in order to alter the molecule's properties. For example, they may arise from modifications to change a molecule's stability, biological activity, or bioavailability. [00050] The term "pharmacophore" is used herein in an unconventional manner. Although the term conventional means a geometric and/or chemical description of a class or collection of compounds, as used here the term means a compound that has a specific biochemical activity or binding property conferred by the 3-dimensional physical shape of the compound and the electrochemical properties of the atoms making up the compound. Thus, as used here the term "pharmacophore" is a compound and not a description of a collection of compounds which have defined characteristics. Specifically, a "pharmacophore" is a compound with those characteristics.

[00051] The term "protease peptide" includes a protease proenzyme, a zymogen, a processed form of the protease, and/or an active fragment of the protease.

[00052] The term "research tool" as used herein refers to any composition or assay of the invention used for scientific enquiry, academic or commercial in nature, including the development of pharmaceutical and/or biological therapeutics. The research tools of the invention are not intended to be therapeutic or to be subject to regulatory approval; rather, the research tools of the invention are intended to facilitate research and aid in such development activities, including any activities performed with the intention to produce information to support a regulatory submission.

[00053] The term "small molecule" refers to a molecule of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da.

[00054] The term "selectively binds", "selective binding" and the like as used herein, when referring to a binding agent (e.g., protein, nucleic acid, antibody, etc.), refers to a binding reaction which is determinative of the presence composition in heterogeneous population of molecules (e.g., proteins and other biologies). Thus, under designated assay conditions, the binding agent will bind to a composition of the invention at least two times the background and will not substantially bind in a significant amount to other proteins present in the sample. Typically, specific binding will be at least twice background signal or noise and more typically more than 10 to 100 times background. Thus, under designated conditions the binding agent binds to its particular "target" molecule and does not bind in a significant amount to other molecules present in the sample.

[00055] A "target protein" as used herein includes any intracellular component of the fusion compositions of the invention that comprises one or more epitopes to which a binding agent selectively binds.

[00056] As used herein, the terms "treat," "treatment," "treating," and the like, refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse affect attributable to the disease. "Treatment," as used herein, covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, e.g., causing regression of the disease, e.g., to completely or partially remove symptoms of the disease.

The Invention in General

[00057] The present invention is based on the surprising finding that the compositions of the invention allow presentation of normally intracellular components on the extracellular surface of a mammalian cell. Despite the size of the GPCR and in many cases the intracellular peptide, the mammalian cells are able to express and properly insert such molecules into the extracellular membrane. The ability to provide direct access to a molecule that is normally located in the cytoplasm, nucleus or within an organelle allows experimental access to the molecule without the use of harsh culture conditions or cell lysis. Use of the compositions of the invention as research tools provides high-throughput cell-based screening assay systems to identify drug candidates that interact with these molecules and/or modulate their activity.

[00058] Preferably, the compositions of the invention provide extracellular access to intracellular peptides having at least one retained functional activity. In certain cases, the activity is a pathological activity that is associated with a human disease state, as when the composition comprises an amyloid peptide. In other cases, the activity is the native activity associated with normal mammalian cellular processes. Either way, the proteins are produced, folded and processed in a mammalian cellular environment, ensuring that the proteins are folded (or misfolded in the case of a pathological peptide), cleaved, glycosylated, etc. in a manner similar or the same as they would in a true in vivo environment.

[00059] By providing extracellular access to these molecules in a cell-based assay system, it becomes much more straightforward to identify novel substrates for an intracellular peptide, determine specificity of the peptide for different substrates or components of substrates, identify active peptide and/or substrate fragments, identify mutations in the peptides and/or substrates that increase or decrease activity of the peptide of interest and the like. Moreover, by varying the extracellular environment, different aspects of the intracellular environment can be tested for their effect on the peptides.

[00060] Currently, there are not good cell-based models for studying the function of many of these proteins, and cell-based assay systems using the compositions of the invention can facilitate the study of diseases and identification of therapeutic compositions that may be useful in the treatment of such diseases. For example, much of the study of viral progression and peptide activity must be performed in animal models, and certain human infectious disease pathogens (e.g., HIV and HCV) are best studied in primates. In another example, models for disease mechanisms associated with fibril and/or plaque formation have serious limitations due to the nature of the disease progression, and the intracellular pathology of these diseases has not been elucidated. The ability to replicate certain functions in a human cell in an extracellular environment that allows access to these peptides will allow a better understanding of their activity and assist in the development of therapeutics that modulate this function.

[00061] Due to the large size and the conformational constraints of many of the peptides, it was a surprising result that mammalian cells would not only produce such fusion protein compositions, but that the fused composition would be inserted into the extracellular membrane in a manner allowing the normally intracellular peptide to retain functionality. The invention described herein sets forth a more general approach to creating novel compositions and assay systems for testing intracellular components due to the ability of cells to somehow appropriately insert these fusion protein receptors across the extracellular membrane despite the presence of a large peptide at the N-terminus of the receptor.

[00062] The fusion protein compositions of the invention are especially useful as research tools to identify binding agents that modify the activity of the intracellular peptide portion of the fusion composition. The ability to identify binding agents that display a desired change in functional activity and/or confirmation is a great advantage of the invention, and will accelerate the identification and development of drug candidates having the desired changes in such cellular processes. The functional change that is desirable in the treatment of the biological process will depend upon the desired increase or decrease of the intracellular peptide activity or the effect of different conditions on the confirmation of the peptide.

[00063] In specific aspects of the invention, the peptides are indirectly fused to the GPCR, i.e. linked by other, intervening amino acids and/or peptide structures. Such intervening sequences include, but are not limited to, non-functional linker sequences, e.g., sequences that aid in construction of the fusion protein or that serve as epitope tags or other identifiers; smaller functional proteins (e.g., hormones and ligands) that interact with the other components of the fusion protein compositions; domain-based peptides, e.g., sequences based on known protein domains that can be used to provide appropriate spacing between the peptides of the composition, to stabilize the composition, to provide appropriate localization of the compositions, and the like; and larger proteins with desirable traits, such as fibronectin or vitronectin. The intervening peptide sequences can thus vary from an amino acid linker to an epitope tag sequence to a fluorescent identifier to a short functional peptide to a known protein domain, or any combination thereof.

[00064] In specific aspects, the intervening sequence can comprise a single or multiple monomer domains, including monomers with variations of the same domain structures, or combinations of monomer domains that have similar specificity, or variations of different classes of monomer domains selected based on the structure and desired spatial relationships of the other components of the fusion protein compositions. Examples of conserved domains and repeats that can be used as intervening sequences in the present invention include, but are not limited to, those found in the EMBL SMART database, which is described at Letunic I et al., Nucleic Acids Res. 2002 Jan 1;30(1):242- 4.

Amyloid Protein Compositions of the Invention

[00065] Amyloidosis refers to a variety of conditions in which amyloid proteins are abnormally deposited in organs and/or tissues. The transformation of a protein from a soluble form into an insoluble fibrous form occurs through a process known as protein fibrillation. Symptoms of amyloidosis vary widely depending upon the site of amyloid deposition. Amyloid diseases include Type II Diabetes Mellitus, Parkinson's disease, Alzheimer's disease, Huntington's disease and Creutzfeldt- Jakob disease (CJD). A more comprehensive list of amyloid proteins and associated disease states is set forth in Table 1 below.

Table 1 : Amyloid Proteins and Associated Disease States

Prion Spongiform Encephalopathies

Huntingtin Huntington's Disease

Apolipoprotein AI Atherosclerosis

Apolipoprotein E Alzheimer's disease

β2- Microglobulin Dialysis related amyloidosis

Calcitonin Medullary carcinoma of the thyroid

Atrial natriuretic factor Cardiac arrhythmias

Serum amyloid A Rheumatoid arthritis

Medin Aortic medial amyloid

Prolactin Prolactinomas and Depression

Transthyretin Familial amyloid polyneuropathy

Lysozyme Hereditary non-neuropathic systemic amyloidosis

Gelsolin Finnish amyloidosis

Keratoepithelin Lattice corneal dystrophy

Cystatin Cerebral amyloid angiopathy (Icelandic type)

Immunoglobulin light chain AL systemic AL amyloidosis

[00066] The predominant mechanism by which protein fibrillation is believed to occur is referred to as "nucleated growth." Once protein unfolding begins, there is a lag phase during which no protein fibrils are observed followed by rapid production of protein fibrils. During the lag phase many non-fibrous short peptide sequences known as oligomers form and act as seeds for fibril formation. As soon as there is a sufficient population of these oligomers, growth of the fibrils occurs rapidly by addition of proteins to the seeds. Recent evidence suggests that it is the intracellular presence of these protein oligomers, as opposed to the larger and more fibrous aggregates, that are the causative agents of amyloid diseases. [00067] The present invention provides compositions and assays for the study of these amyloid peptides, toxic amyloid peptide oligomers and/or the fibrils produced from them. Compositions comprising an amyloid precursor protein, an amyloid peptide, or an oligomer thereof can be fused to an extracellular region of a transmembrane protein, and preferably to the N-terminus of a GPCR, allowing the study of the normally intracellular mechanisms to be studied in an extracellular environment. These compositions allow extracellular presentation of these proteins, and provide direct access to such peptides in varied culture conditions. Controlling the exposure of the peptides to various conditions and other cellular components may elucidate the causes of the initial oligomer formation and/or the fibrillation process. These compositions also allow identification of drug candidates which bind specifically to the pathogenic forms of the peptides, oligomers and/or fibrils.

[00068] In a specific aspect of the invention, the amyloid fusion compositions can be used in conjunction with one or more enzymes known to process a precursor protein into an amyloid peptide. The enzymes can be provided directly in culture, or they may also be provided in a fusion protein of the invention. For example, a fusion protein composition comprising γ-secretase or β-secretase fused to an extracellular portion of a GPCR can be utilized to study the effects on a composition of the invention comprising β-ΑΡΡ. The different compositions can be co-expressed in a single cell population, or preferably cells expressing individual compositions can be co-cultured. This allows the identification of conditions under which the fibrils form more readily, as well as methods for examining the effects of specific isoforms and/or mutations.

[00069] The pathological role of specific amyloid proteins and their use in the compositions of the invention are discussed below.

β-Amyloid Precursor Protein (β-ΑΡΡ)

[00070] The β-Amyloid Precursor Protein (β-ΑΡΡ) is an amyloid protein associated with neurodegenerative disease, and in particular with Alzheimer's disease (AD) and other forms of neural amyloidosis. β-ΑΡΡ is a membrane-spanning Type 1 glycoprotein that undergoes a variety of proteolytic processing events. (Selkoe, Trends Cell Biol. 8:447-453(1998)). jS-APP has a receptor-like structure with a large ectodomain, a membrane spanning region and a short cytoplasmic tail, expressed and constitutively catabolized in most cells. Major forms of ?-APP are known as APP₆95, APP₇₅₁, and APP₇₇₀, with the subscripts referring to the number of amino acids in each splice variant (Ponte et al., Nature 331:525-527 (1988); Tanzi et al., Nature 331 :528-530 (1988); Kitaguchi et al., Nature 331:530-532 (1988)). The amyloid peptide of ?-APP, the Αβ domain, encompasses parts of both extra-cellular and transmembrane domains of ?-APP. Release of Αβ from ?-APP implies the existence of two distinct proteolytic events to generate the NH₂— and COOH-termini of Αβ.

[00071] Proteolytic processing of β-AW by β-secretase exposes the N- terminus of Αβ, producing COOH terminal fragments (C-terminal fragments or ΟΤΡββ) which contain the whole Αβ domain. After γ-secretase cleavage at the variable C-terminus, Αβ is released. The C-terminus is actually a heterogeneous collection of cleavage sites rather than a single site, since γ-secretase activity occurs over a short stretch of /J- APP amino acids rather than at a single peptide bond. In the amyloidogenic pathway, /J-APP is cleaved by β-secretase to liberate 3ΑΡΡβ and CTFP, which ΟΤΡβ is then cleaved by γ-secretase to release the harmful Αβ peptide.

[00072] While abundant evidence suggests that extracellular accumulation and deposition of Αβ is a central event in the etiology of AD, recent studies have also proposed that increased intracellular accumulation of Αβ or ΟΤΡβ may play a role in the pathophysiology of AD. For example, over-expression of APP harboring mutations which cause familial AD results in the increased intracellular accumulation of ΟΤΡβ in neuronal cultures and Αβ42 in HEK 293 cells. Αβ42 is the 42 amino acid long form of Αβ that is believed to be more efficacious at forming amyloid plaques than shorter forms of Αβ. Moreover, evidence suggests that intra- and extracellular Αβ are formed in distinct cellular pools in hippocampal neurons, and increased intracellular accumulation of Αβ42 is a common feature associated with two types of familial AD mutations in APP ("Swedish" and "London"). Thus, based on these studies and earlier reports implicating extracellular Αβ accumulation in AD pathology, it appears that altered APP catabolism may be involved in disease progression.

[00073] Compositions of the invention may comprise all or part of the β-ΑΡΡ peptide, a cleavage product thereof, or oligomers of these. These compositions may also contain specific mutations, such as the Swedish or the London mutations. These compositions can help elucidate the mechanism of action of the oligomer and/or fibril formation, and identify compositions that are useful in blocking the formation of the amyloid plaques and fibrils.

Apolipoprotein E

[00074] Apolipoprotein E (apoE) plays a key role in lipid metabolism, facilitating cholesterol transport in and out of cells (Poirer J et al., Neuroscience. Jul;55(l):81-90(1993)). The importance of apoE in the central nervous system (CNS) became evident with the association of the E4 allele of apoE with familial and late- onset sporadic Alzheimer's Disease (AD)(Poirer J et al., Lancet 1993 Sep 18;342(8873):697-9.). Studies using the rat brain have shown that in the CNS, apoE is important in the metabolism and redistribution of cholesterol and phospholipids during myelination and membrane remodeling associated with axonal regeneration (Beffert U et al., J Neurochem. Apr;70(4): 1458-66(1998).

[00075] The mature form of apoE in the human plasma and CSF is a single glycosylated 36-37 kDa polypeptide containing 299 amino acids (Ignatius MJ, et.al., Proc Natl Acad Sci U S A. 1986 Feb;83(4): 1125-9 (1986). There are three common isoforms of human apoE gene— E2, E3, and E4— that are expressed from a single apoE genetic locus, giving rise to the three common homozygous phenotypes (E4/4, E3/3, E2/2) and three common heterozygous phenotypes (E4/3, E4/2, E3/2) (Weisgraber, Curr Opin Lipidol. 1994 Apr;5(2): 110-6 (1994)).

[00076] Studies have shown that the E2 isoform of apoE, which has cysteines at positions 112 and 158, has a lower affinity for the LDL receptor (Rubinsztein, et.al., 1994) and is associated with prolonged chylomicron-remnant clearance compared to E3 and E4. The E4 isoform, which has arginine at 112 and cysteine at 158, and the E3 isoform, which has cysteine at 112 and arginine at 158, have similar affinities for their receptors. E4 is associated with larger, less dense lipoproteins more so than E3, and is therefore associated with rapid chylomicron-remnant clearance and increased total cholesterol levels (Permanne et al., Biochem Biophys Res Commun. 1997 Nov 26;240(3):715-20)

[00077] AD patients with the E4 allele were found to have an increased formation of senile plaques compared to AD patients without the e4 allele (Corder EH et al., Neurology. 1995 Jul;45(7): 1323-8 1995). Correlation of senile plaque density in AD patients with varying apoE genotypes showed that patients having one or two E4 alleles demonstrated an increased formation of senile plaques compared to AD patients without the e4 allele. Subjects with two E4 alleles have up to 20 times the risk of developing AD. The apoE4 protein is believed to act as a pathological chaperone promoting conformational change of the normally β-pleated sheet amyloid into amyloid fibers (Castano, Lab Invest. Oct;73(4):457-60 (1995)). The apoE2 isoform, on the other hand, that the apoE2 allele may serve a protective role in AD. Corder EH et al., Nat. Genet. 7 (2): 180-4 (1994).

[00078] Compositions of the invention may comprise any of the apoE isoforms. In specific aspects of the invention, compositions comprising two different isoforms may be expressed within a single cell. In other specific aspects, compositions comprising one or more apoE isoforms may be co-expressed in a cell with compositions comprising APP or a fragment thereof, preferably the Αβ fragment. In another specific aspect, cells expressing one or more apoE isoforms may be co-cultured with cells expressing APP or a fragment thereof, preferably the Αβ fragment. Each of these may offer key insights into the mechanism of action of plaques and/or fibril formation, and help to identify new therapeutics for disrupting this process.

[00079] In particular assay systems, cells expressing compositions comprising one of the apoE isoforms {e.g., apoE4) can be used in direct comparison with cells with a different apoE isoform {e.g., apoE3 or apoE2) to identify agents that have a selective effect or which can transform the phenotype of one isoform into another. The ability of an agent to transform the cellular phenotype of a cell expressing a particular isoform can provide a powerful assay system for determining, e.g., agents that inhibit the deleterious effects or enhance the protective effects of these different isoforms. Such agents may be very good candidates for use ion therapeutic intervention.

Islet amyloid polypeptide

[00080] Islet amyloid polypeptide, (IAPP), also known as amylin, is a peptide coexpressed and cosecreted with insulin by pancreatic beta-cells. IAPP has been implicated to have physiological roles in glucose regulation, hemodynamics, calcium homeostasis, and as an anorectic agent. Prepro-IAPP is synthesized in beta cells as an 89 to 93 amino acid molecule, and mature IAPP appears to be formed by enzymatic processing similar to that involved in the formation of insulin. Glucose- stimulated IAPP secretion generally parallels that of insulin and, on a molar basis, IAPP represents about 1% of the amount of insulin secreted. A significant dissociation of IAPP and insulin secretion (associated with relatively greater upregulation of IAPP secretion) is observed in response to marked hyperglycemia, suggesting that IAPP and insulin expression are differentially regulated.

[00081] In Type II Diabetes Mellitus (DM), the pathology seen in the islet cells is associated with abnormal aggregation of IAPP and a propensity to form amyloid fibrils. In humans, IAPP has an amyloidogenic -promoting region, which resides within amino acids 20 to 29. Johnson, KH et al., N Engl J Med. 1989 Aug 24;321(8):513-8. Henson MS et al., Amyloid. 2006 Dec;13(4):250-9. In vitro fibrillogenesis studies have shown that amino acid substitutions in this region especially affect the amyloid forming ability of IAPP. Abnormalities in IAPP processing and secretion have been proposed as important contributors to the formation of the amyloid peptide IAi₄_i₇. IA can cause β-cell death by occupying extracellular space, thereby impairing nutrients and oxygen uptake. Severe IA (> 50%) has been shown to be associated with increased β-cell apoptosis, decreased relative β-cell volume, a-cell replication and hypertrophy and increased relative a- cell volume. Guardado-Mendoza et al., PNAS August 18, 2009 vol. 106 no. 33 13992-13997.

[00082] Compositions of the invention may comprise all or part of the IAPP peptide, its prepropeptide, a cleavage product thereof (e.g. IA₁₄_₁₇), or oligomers of these. These compositions can help elucidate the mechanism of action of the IA oligomer formation and resulting amyloid formation, and identify compositions that are useful in blocking the formation of the amyloid plaques and fibrils in the pancreas of patients with Type II DM.

Prions

[00083] The endogenous wild-type form of prion protein, PrP , is found in a multitude of normal mammalian tissues. Under pathological conditions in vivo, this normal cellular form of the prion protein (an in particular residues 23-231 ) misfolds into the pathogenic isoform PrP^Sc, a β-rich aggregated pathogenic multimer. Proteinase K digestion of PrP^Sc leads to a proteolytically resistant core, PrP 27-30 (residues 90-231), that can form amyloid fibrils.

[00084] Different strains of prions have unique neurohistological and biochemical features as well as distinct clinical patterns. Such pathological features include but are not limited to the specific incubation time, the neuroanatomic distribution, and the degree of proteinase K resistance. These features, which are stable following serial transmission in a given animal, have been attributed to conformationally distinct multimeric arrangements of PrP^Sc. During the past several years, a considerable body of evidence has accumulated arguing that the properties of prion strains are enciphered in their conformations. Although it seems clear that prion strains are comprised of different conformers of PrP^Sc, glycosylation patterns and specific polymorphisms may add to strain diversity.

[00085] Several lines of kinetic data suggest that the β-oligomer is not on the pathway to amyloid formation. The preferences for forming either a β-oligomer or amyloid can be dictated by experimental conditions, with acidic pH similar to that seen in endocytic vesicles favoring the β-oligomer and neutral pH favoring amyloid. Although both abnormal isoforms have high β-sheet content and bind 1- anilinonaphthalene-8-sulfonate, they are dissimilar structurally. Multiple pathways of misfolding and the formation of distinct β-sheet-rich abnormal isoforms may explain the difficulties in refolding PrP^Sc in vitro, the need for a PrP^Sc template, and the significant variation in disease presentation and neuropathology.

[00086] Compositions of the invention may comprise all or part of the APP peptide, a cleavage product thereof, or oligomers of these. These compositions may correspond to different strains of prion having different known virulence upon infections. These compositions can help elucidate the mechanism of action of the oligomer and/or fibril formation, and identify compositions that are useful in blocking the formation of the prion plaques and fibrils.

Synuclein

[00087] a-synuclein is a synuclein protein of unknown function primarily found in neural tissue, making up to 1 % of all proteins in the cytoplasm (Beyer K et al., Acta Neuropathol. 112 (3): 237-51.(2006)) It is predominantly expressed in the neocortex, hippocampus, substantia nigra, thalamus, and cerebellum. It is predominantly a neuronal protein, but can also be found in glial cells. The postmortem Parkinson's disease (PD), substantia nigra is characterized by sporadic intraneuronal cytoplasmic inclusions known as Lewy bodies (LB), which contain a- synuclein in the fibrous portion. A polymorphism in the a-synuclein promoter is reported to be a susceptibility factor for idiopathic PD, suggesting that its expression level may be critical. This finding is consistent with the premise that a-synuclein oligomerization and/or fibrillization is pathogenic.

[00088] Rare, early-onset forms of PD, which otherwise are indistinguishable from idiopathic PD, are linked to two autosomal dominant point mutations in the gene encoding α-synuclein, A30P and A53T (Li J, Biochemistry. 2001 Sep 25;40(38): 11604-13.). These proteins produce nonfibrillar oligomers that may be assembly intermediates, analogous to that seen for Αβ aggregation. Fibrillization of a-synuclein is clearly accelerated by the A53T mutation but the effect of the A3 OP mutation on fibril formation has not been determined, although A30P increases the rate of actin polymerization and disrupts the cytoskeleton during reassembly of actin filaments. Sousa VL Mol Biol Cell. 2009 Aug;20(16):3725-39. Epub 2009 Jun 24. Furthermore, the behavior of mixtures of the mutant proteins and WT, which are directly relevant to the early-onset PD patients, all of whom are heterozygotes, has not been determined.

[00089] Compositions of the invention may comprise all or part of the a- synuclein protein or oligomers of these. These compositions may also contain specific mutations, such as the A30P or the A53T mutations. These compositions can help elucidate the mechanism of action of the oligomer and/or fibril formation, and identify compositions that are useful in blocking the formation of the amyloid plaques and fibrils.

Enzyme Compositions of the Invention

[00090] The compositions of the invention are particularly suited for identification of enzyme substrate specificity and modulation of particular enzymes. The ability to carefully control the substrates available to an enzyme in a cell-based assay provides a more controlled setting for determining substrate specificity, and identification of binding agents that can block the activity of an enzyme on a particular substrate.

[00091] In certain aspects of the invention, an assay comprises two or more fusion protein compositions, at least one comprising an enzyme or functional fragment thereof and another fusion protein composition comprising a substrate for that particular enzyme. In one aspect, a cell co-expresses the two fusion protein compositions. In another aspect a cell expressing the first fusion protein composition is co-cultured with a cell expressing the second fusion protein. Activity of the first fusion protein can be detected by detection of processing of the fusion protein comprising the substrate on the cell surface. Proteases

[00092] In one aspect of the invention, the intracellular protein of the fusion composition comprises a protease peptide, and preferably a human protease peptide. The protease peptide can comprise any full length proprotease or protease, as well as a fragment of interest such as the active domain or a substrate binding domain. Exemplary proteases for use in the compositions of the invention are as follows.

[00093] The major clans of serine proteases in humans include the chymotrypsin-like, the subtilisin-like, the alpha/beta hydrolase, and signal peptidase clans. Serine proteases are inhibited by a diverse group of inhibitors, including synthetic chemical inhibitors for research or therapeutic purposes, and also natural proteinaceous inhibitors. One family of natural inhibitors called "serpins" (abbreviated from serine protease inhibitors) can form a covalent bond with the serine protease, inhibiting its function. The best-studied serpins are antithrombin and alpha 1 -antitrypsin, studied for their role in coagulation/thrombosis and emphysema/A 1 AT respectively. Artificial irreversible small molecule inhibitors include AEBSF and PMSF.

[00094] The proteasome hydrolases constitute a unique family of threonine proteases. A conserved N-terminal threonine is involved in catalysis at each active site. The three catalytic β subunits are synthesized as pre-proteins. They are activated when the N-terminus is cleaved off, making threonine the N-terminal residue. Catalytic threonines are exposed at the lumenal surface.

[00095] Cysteine proteases have a common catalytic mechanism that involves a nucleophilic cysteine thiol in a catalytic triad. The first step is deprotonation of a thiol in the enzyme's active site by an adjacent amino acid with a basic side chain, usually a histidine residue. The next step is nucleophilic attack by the deprotonated cysteine's anionic sulfur on the substrate carbonyl carbon. In this step, a fragment of the substrate is released with an amine terminus, the histidine residue in the protease is restored to its deprotonated form, and a thioester intermediate linking the new carboxy-terminus of the substrate to the cysteine thiol is formed. The thioester bond is subsequently hydrolyzed to generate a carboxylic acid moiety on the remaining substrate fragment, while regenerating the free enzyme. Examples of cysteine proteases include papain, cathepsins, caspases, and calpains.

[00096] Aspartic proteases are a family of eukaryotic protease enzymes that utilize an aspartate residue for catalysis of their peptide substrates. In general, they have two highly-conserved aspartates in the active site and are optimally active at acidic pH. Nearly all known aspartyl proteases are inhibited by pepstatin.

[00097] Eukaryotic aspartic proteases include pepsins, cathepsins, and renins.

They have a two-domain structure, probably arising from ancestral duplication. Retroviral and retrotransposon proteases are much smaller and appear to be homologous to a single domain of the eukaryotic aspartyl proteases.

[00098] Metalloproteinases are a family of protein-hydrolyzing endopeptidases that contain zinc ions as part of the active structure. There are two subgroups of metalloproteinases: metalloexopeptidases and metalloendopeptidases. Well known metalloendopeptidases include ADAM proteins and matrix metalloproteinases.

[00099] In specific aspects, the activity of a protease can be modulated through modulation - either inhibition or activation of the active site - a zymogen. Zymogens are large, inactive structures, which have the ability to break apart or change into the smaller activated enzymes. The difference between zymogens and the activated enzymes lies in the fact that the active site for catalysis of the zymogens is distorted. As a result, the substrate polypeptide cannot bind effectively, and proteolysis does not occur. Only after activation, during which the conformation and structure of the zymogen change and the active site is opened, can proteolysis occur. Examples of zymogens that can be used in the fusion protein compositions of the invention are as follows:

Table 2: Exemplary Zymogens and their Peptide Products

Angiotensinogen Angiotensin

Pepsinogen. Pepsin

Proelastase Elastase

Procarboxypeptidase Carboxypeptidase

Procollagenase Collagenase

Over 20 proteins and protein fragments make up the

Complement System complement system, including serum proteins, serosal

proteins, and cell membrane receptors

Caspase cascade

Effector (executioner) caspases

(apoptosis initiation)

[000100] Aspartic proteases are a family of eukaryotic protease enzymes that utilize an aspartate residue for catalysis of their peptide substrates. In general, they have two highly-conserved aspartates in the active site and are optimally

Kinases and Phosphatases

[000101] Protein phosphorylation plays a crucial role in biological functions and controls nearly every cellular process, including metabolism, gene transcription and translation, cell-cycle progression, cytoskeletal rearrangement, signal transduction, protein stability, cell motility, and apoptosis. These processes depend on the highly regulated and opposing actions of protein kinases and protein phosphorylases through changes in the phosphorylation of key proteins.

[000102] The compositions of the invention provide key research tools for the study of these proteins and the physiological processes involving them. Exemplary kinases and proteases for use in the compositions of the invention are as follows.

Serine-Threonine Kinases

[000103] In general, protein kinases in mammalian cells are classified by the types of amino acids they phosphorylate. The bulk of phosphorylation found in cells is mediated by serine-threonine protein kinases such as calcium- and phospholipid- dependent protein kinase C, cyclic nucleotide-dependent protein kinases, calmodulin- dependent protein kinases and many others. These kinases are generally cytoplasmic, are Activity of these protein kinases can be regulated by specific events such as DNA damage, as well as by numerous chemical signals, including: cAMP/cGMP, diacylglycerol, and Ca 2+ /calmodulin. Most serine-threonine kinases are inhibited by a pseudosubstrate that binds to the kinase like a real substrate but lacks the amino acid to be phosphorylated. When the pseudosubstrate is removed, the kinase can perform its normal function.

[000104] In systems involving pure proteins, phosphorylation can be studied using purified protein kinases obtained either from commercial sources or by direct purification of the desired kinase. Purified substrates may have differences from the native kinases, however, due to the processes used and the necessary posttranslational modification and processing. The compositions of the invention can provide these cytoplasmic proteins in a more native format for study of substrate specificity, activity, and inhibition.

[000105] One example of as serine-threonine kinase for use in the compositions of the invention is the leucine-rich repeat serine/threonine-protein kinase 2 (LRRK2). LRRK2 is a very large kinase that has been difficult to isolate and study vitro. Mutations in LRRK2 are a leading genetic cause of Parkinson's disease (PD). LRRK2 is predicted to contain both kinase and GTPase enzymatic domains, with recent evidence suggesting that the kinase activity of LRRK2 is central to the pathogenic process associated with this protein in PD. The GTPase domain of LRRK2, however, also plays an important role in the regulation of kinase activity, and familial mutation associated with PD located within the GTPase domain, R1441C, disrupts the GTPase function of LRRK2. Lewis PA et al., Biochem Biophys Res Commun. 2007 June 8; 357(3): 668-671.

[000106] In certain aspects, the compositions of the invention may thus comprise all, and active fragment or a specific domain of LRRK2 fused to the N-terminus of a GPCR in order to better study its function to find binding agents that specifically modulate certain of its activities. The compositions will also be useful to determine the effect of specific mutations, such as the R1441C mutation, on LRRK substrate specificity and its potential effect in PD.

Tyrosine kinases [000107] Tyrosine kinases, the second general class of protein kinases, are predominantly membrane proteins or proteins associated with membrane proteins. In humans, there are 32 cytoplasmic protein tyrosine kinases. Cytoplasmic tyrosine kinases include, but are not limited to, Src, Abl, ZAP70/Syk and Btk/Tec family kinases. Several members of each of these families have been implicated in signal transducton cascades controlling biological processes ranging from lymphocye activation and tissue regeneration to apoptosis. These proteins share numerous homologous domains, including src -homology domain 2 (SH2) and src homology domain 3 (SH3).

[000108] One example of the use of a kinase in the compositions of the invention would be the use of a Src family member fused to the N-terminus of a GPCR to provide extracellular presentation of these molecules that are usually associated with the intracellular side of the cell membrane. The Src family includes nine mammalian members: Src, Yes, Fyn, and Fgr, forming the SrcA subfamily, Lck, Hck, Blk, and Lyn in the SrcB subfamily, and Frk in its own subfamily. Src family kinases interact with cellular cytosolic, nuclear and membrane proteins and modify these proteins by phosphorylation on tyrosine residues. The ability to provide these kinases extracellularly would provide insight into their function in various conditions and with various substrates. Modulation of these enzymes, which are associated with many pathological conditions such as cancer, could offer new therapeutic advances in the treatment of various diseases.

Phosphatases

[000109] Protein phosphatases (PP) act in opposition to kinases and are integral to many signal transduction pathways. Many PPs are highly enriched in, or exclusive to, the nuclear compartment, where they dephosphorylate key substrates to regulate various nuclear processes. PPs from numerous classes may be used in the compositions of the invention.

[000110] Protein Ser/Thr phosphatases can be classified using biochemical assays as either type 1 (PP1) or type 2 (PP2), and can be further subdivided based on metal-ion requirement (PP2A, no metal ion required; PP2B, Ca²⁺ stimulated; PP2C, Mg²⁺ dependent) (Moorhead et al., Nat Rev Mol Cell Biol. Mar;8(3):234-44 (2007)). The protein Ser/Thr phosphatases PPl, PP2A and PP2B of the PPP family, together with PP2C of the PPM family, account for the majority of Ser/Thr PP activity in vivo (Barford et al., Annu Rev Biophys Biomol Struct. 27:133-64. (1998)). In the brain, they are present in different subcellular compartments in neuronal and glial cells, and contribute to different neuronal functions.

[000111] The PPM family, which includes PP2C and pyruvate dehydrogenase phosphatase, are enzymes with Mn 2+ /Mg 2+ metal ions that are resistant to classic inhibitors and toxins of the PPP family. Unlike most PPPs, PP2C exists in only one subunit but, like PTPs, it displays a wide variety of structural domains that confer unique functions. In addition, PP2C does not seem to be evolutionarily related to the major family of Serine/Threonine PPs and has no sequence homology to ancient PPP enzymes. The current assumption is that PPMs evolved separately from PPPs but converged during evolutionary development.

[000112] Class I cysteine-based PTPs constitute the largest family of phosphatases. They contain the well-known non-receptor PTPs \ which are strictly tyrosine-specific, and the DSPs, which target Serine/Threonine as well as Tyrosine and are the most diverse in terms of substrate specificity.

[000113] The Class II cysteine-based class of PTPs is represented by a single gene in humans encoding the 18 kDa low MW phosphatase (LM-PTP/LMW-PTP). Related classes are widely distributed in living organisms and were highly conserved through evolution. The preservation of this class of phosphatases and the involvement of LMPTPs in many common diseases suggest that it is involved in the regulation of many fundamental processes in cellular physiology.

[000114] The third class of PTPs contains three cell cycle regulators, CDC25A, CDC25B and CDC25C, which dephosphorylate CDKs at their N-terminal, a reaction required to drive progression of the cell cycle. They are themselves regulated by phosphorylation and are degraded in response to DNA damage to prevent chromosomal abnormalities.

[000115] The haloacid dehalogenase (HAD) superfamily is a further PP group that uses Asp as a nucleophile and was recently shown to have dual-specificity. These PPs can target both Serine and Tyrosine, but are thought to have greater specificity towards Tyrosine. A further member of this class is the RNA polymerase II C-terminal domain phosphatase. While this family remains poorly understood, it is known to play important roles in development and nuclear morphology.

Intracellular Regions and Domains

Cell adhesion molecules

[000116] Cell Adhesion Molecules (CAMs) are proteins located on the cell surface that bind with proteins on other cells or with the extracellular matrix (ECM) in the process of cell adhesion. These proteins are typically transmembrane receptors and are composed of three domains: an intracellular domain that interacts with the cytoskeleton, a transmembrane domain, and an extracellular domain that interacts either through homophilic binding or heterophilic binding with other CAMs or the extracellular matrix. Most of the CAMs belong to five protein families: the immunoglobulin (Ig) superfamily (IgSF CAMs), the integrins, the cadherins, the selectins and the lymphocyte homing receptors (also known as the "addressins"). The intracellular regions of these molecules can be used in the fusion compositions of the invention to elucidate the role of these molecules and to better direct therapeutics against the CAMs for specific indications based on this information.

[000117] For example, the neural cell adhesion molecules (NCAMs), have been implicated in neurite outgrowth, synaptic plasticity, and learning and memory. NCAMs are homophilic binding glycoprotein expressed on the surface of neurons, glia, skeletal muscle and natural killer cells. There are at least 27 alternatively-spliced NCAM mRNAs produced, giving a wide diversity of NCAM isoforms. The three main isoforms of NCAM vary only in their cytoplasmic domain, and thus the intracellular region of these proteins is critical in differentiating the function of these different isoforms. Fusion of the different cytoplasmic regions of NCAMs to a cell surface protein in the fusion compositions of the invention, and extracellular presentation of these cytoplasmic NCAM regions, allows the identification of different isoforms in different physiological pathways. Therapeutics specific for one or more isoforms can be developed to better target such physiological processes without the risk of serious adverse events from modulation of all NCAMs sharing an extracellular domain. Syndecans

[000118] Syndecans are single transmembrane domain proteins that are thought to act as coreceptors for G protein-coupled receptors. These core proteins carry three to five heparan sulfate and chondroitin sulfate chains which allow for interaction with a large variety of ligands including fibroblast growth factors, vascular endothelial growth factor, transforming growth factor-beta, fibronectin and antithrombin-1. Interactions between fibronectin and some syndecans can be modulated by the extracellular matrix protein tenascin-C. The cytoplasmic domain is essentially composed of two regions of conserved amino acid sequence (CI and C2), separated by a central variable sequence of amino acids that is distinct for each family member. The intracellular regions of these molecules can be fused to cell surface proteins and presented extracellularly in the compositions of the invention. These may be used, e.g., to elucidate the importance of the CI and C2 regions in preserving the intracellular interactions of these molecules with other cytoplasmic signaling molecules, and the effect of the central variable region in protein:protein interactions involving the syndecans and/or their GPCR co repectors.

Receptor Tyrosine Kinases

[000119] Receptor tyrosine kinases are high affinity cell surface receptors for many growth factors, ligands, cytokines and hormones. Of the ninety unique tyrosine kinases are key regulators of normal cellular processes and have a critical role in the development and progression of many disease states, including various types of cancer. Although numerous therapeutics target the extracellular regions of these kinases, identification of therapeutics which modulate the intracellular activity of these molecules has been more challenging. The intracellular region of various tyrosine kinases can also be fused to cell surface proteins in the compositions and methods of the invention to provide extracellular access to regions of these proteins that are found in the cytoplasmic domain. Better understanding of these intracellular regions can help to identify the interaction of these molecules with downstream signal transduction pathways, such as the MAP kinase signaling cascade, and identify new therapeutic targets in terms of pathways involved in numerous pathological states.

Cytoskeletal proteins

[000120] Cytoskeletal proteins provide internal transport pathways, participate in cell division, and perform functional tasks, including motion. The cytoskeleton proteins in eukaryotes include microfilaments, intermediate filaments, and microtubules. A fourth category are the catenins, which are not classically considered cytoskeletal proteins, but they extend out from the cytoskeleton of one cell to the cytoskeleton of an adjacent cell by attaching to other cellular proteins called cadherins, forming cell adhesion molecule complexes. Proteins from each of these classes can be used in the compositions of the invention to provide extracellular access to such proteins in assay systems.

[000121] Microfilaments, also known as actin filaments, are most often present directly under the cell membrane. Microfilaments are approximately 5-9 nanometers in diameter and made of two actin chains which intertwine to form a double helix. The actin filaments are responsible for the shape and membrane projections of the cell, as well as forming the cleavage furrow during replication. Microfilaments are dynamic structures that undergo continual assembly and disassembly within the cell. They interact with myosin, another cellular protein, to contract muscles. The microfilament proteins also play a large role in signal transduction.

[000122] The present invention may include fusion proteins having one or more microfilament protein fused to the N-terminus of a cell surface protein. Such microfilament proteins include, but are not limited to, actin protein Al, A2, B, Gl, and G2; myosins 1A, IB, 1C, MYH1, MYH2, MYH3, MYH4, MYH6, MYH7, MYH7B, MYH8, MYH9, MYH10, MYHl l, MYH13, MYH14, MYH15, and MYH16; tropomodulin 1, 2, 3, and 4; troponins T 1 2 3, C 1 2, and 1 1 2 3; tropomyosin 1, 2, 3, and 4; actinin 1, 2, 3, and 4); Arp2/3 complex*, and actin depolymerizing factors Cofilin (1, 2), Destrin, Gelsolin, and Profilin (1, 2). [000123] The intermediate filaments are tetrameric and composed of two parallel helices. These proteins are stable components of the cytoskeleton that bear tension to maintain the cell's shape along with microfilaments. However, these cytoskeleton proteins also organize the interior of the cell— they anchor organelles, achieve the structure of the nuclear envelope, and participate in cell junctions. The present invention may include fusion proteins having one or more of these intermediate filaments fused to the N-terminus of a cell surface protein. These include, but are not limited to, various proteins in the intermediate filament (IF) classes, including IF type 1 and 2 (Cytokeratin, type I, type II), IF type 3 (Desmin, Peripherin, Vimentin),-IF type 4 (Internexin, Nestin, Neurofilament, Synemin, Syncoilin) and IF (Lamin A, B)

[000124] Microtubules, the third principal component of the cytoskeleton, are rigid hollow rods approximately 25nm in diameter. Like actin filaments, microtubules are dynamic structures that undergo continual assembly and disassembly within the cell. They function both to determine cell shape and in a variety of cell movements, including some forms of cell locomotion, the intracellular transport of organelles, and the separation of chromosomes during mitosis. Tubulins are the primary component of microtubules. Other cytoskeletal proteins that interact with or regulate microtubule assembly include Dyneins, Kinesins, Tau protein, Dynamin, Stathmin, and Tektin.

[000125] The Catenins are the fourth class of cytoskeletal proteins. These include Alpha catenin, Beta catenin, Plakoglobin (gamma catenin), and* Delta catenin. Other cytoskeletal proteins that can be used with the fusion compositions of the invention include, but are not limited to, APC, Dystrophin (Dystroglycan), the-Plakins (Desmoplakin, Plectin), the Spectrins (SPTA1, SPTAN1, SPTB, SPTBN1, SPTBN2, SPTBN4, and SPTBN5), Talin (TLN1), Utrophin and Vinculin.

[000126] Thus, in specific aspects of the invention, the fusion compositions comprise cytoskeletal peptides fused to cell surface proteins, and preferably fused to the N-terminus of the cell surface protein. These compositions and assays comprising these compositions may be used to study intracellular interactions of these dynamic structural components in a controlled extracellular environment.

Infectious Disease Peptides

[000127] A number of infectious agents, including virus such as human immunodeficiency virus (HIV) and hepatitis C virus (HCV), produce intracellular proteins that are critical for initial infection, replication, and/or latency. The compositions of the invention may also comprise one or more if these intracellular viral peptides. The presentation of these peptides in an extracellular environment tethered to a cell membrane allows identification of regulation of these proteins and potentially identification of drug candidates that target this activity.

[000128] For example, with a retrovirus such as HIV, all of the structural proteins of the virion, with few exceptions, are derived from three polyproteins: Gag, Gag-Pro-Pol, and Env. Each of these precursor proteins has special characteristics needed for specific steps in the assembly process, and each undergoes extensive processing. The Env glycoprotein, which is assembled into oligomeric complexes in the rough endoplasmic reticulum (RER), extensively modified, and then cleaved by a cell-encoded protease during transport to the surface of the cell. In some instances, further proteolytic processing of TM occurs after the particle is released. Likewise, the proteins found on the inside the virion (matrix, MA; capsid, CA; nucleocapsid, NC; protease, PR; reverse transcriptase, RT; integrase, IN) are initially linked within the Gag and Gag-Pro-Pol proteins. The Gag protein is sufficient for directing budding at the plasma membrane, and the Pro-Pol polyproteins are incorporated into the resulting particle because they are linked to Gag. Subsequent cleavage of the Gag and Gag-Pro-Pol proteins by the viral protease brings about new shapes and arrangements inside the nascent virion as the immature particle undergoes a metamorphosis into the mature, infectious retrovirus. Even the structure of the viral RNA, packaged into the virion through an interaction with Gag, changes during the budding and maturation process.

[000129] The ability to study these proteins or particular structural elements of these proteins that have undergone processing in the cell, but which are presented on the cell surface membrane, may allow the identification of new binding agents that may be efficacious in thwarting the activity or structural interactions of these proteins. The invention thus includes fusion proteins comprising intracellular viral proteins, preferably fused to the N-terminus of the GPCR.

Intracellular Binding Domains

[000130] In certain aspects of the invention, the N-terminal peptide is a domain or other binding unit that is generally found intracellularly. This includes domains that do not have activity in and of themselves, but which help mediate physiological or pathophysiological processes, e.g., by mediating binding interactions between molecules that have signaling activity.

[000131] Thus, in certain aspects, the N-terminal peptide of the compositions of the invention is a short, linear peptide sequence found in one or more proteins that is recognized by and/or binds to a modular domain in another protein to allow macromolecular recognition between these proteins. Examples of such domains include, but are not limited to Src-homology 2 (SH2) and 3 (SH3) domains, PDZ domains, WW domains and the like. Examples of such domains that can be used in the compositions and assay systems of the invention are disclosed, for example, in the AD AN a database for prediction of protein-protein interaction of modular domains mediated by linear motifs (Encinar JA, Bioinformatics. 2009 Sep 15;25(18):2418-24. Epub 2009 Jul 14), which is incorporated by reference herein.

[000132] The importance of this mode of protein-protein interaction is highlighted by the large number of peptide-binding domains encoded by the human genome. The ability to identify molecules that not only interact in domain-mediated protein-protein interaction networks not just in terms of binding, but also which demonstrate a functional activity, allows identification of physiologically relevant interactions and elucidation of interaction networks mediated by these domains.

Exemplary GPCRsfor Use in the Compositions of the Invention

[000133] G-protein-coupled receptors are a pharmacologically important protein family with approximately 450 genes identified to date. Pathways involving these receptors are the targets of hundreds of drugs, including antihistamines, neuroleptics, antidepressants, and antihypertensives. The GPCRs consist of seven transmembrane domains that are connected through loops. The N terminal of these proteins are located extracellularly and C terminal is extended into the cytoplasmic space. Due to this topology, they are able to transduce the external signal into the cell.

[000134] GPCRs are classified to major five classes, which are further classified to subfamilies, each of which can be used in the creation and use of the compositions of the invention. The GPCR classes found to have activity in mammals includes: Class A, the rhodopsin-like receptors, which is further divided into 19 subgroups (A1-A19); Class B, the secretin receptor family; Class C, the metabotropic glutamate/pheromone receptors; ocular albinism proteins (e.g., GPR143); and Class F, the frizzled/smoothened family, so named because of their initial discovery in Drosophila Melanogaster. A number of GPCRs are still considered "orphan receptors", in that they act as receptors for stimuli that have yet to be identified. Any of these can be used in the creations and use of compositions of the invention.

[000135] The GPCR portion of the fusion protein composition can thus include sequences from: receptors for sensory signal mediators (e.g., light and olfactory stimulatory molecules); adenosine, bombesin, bradykinin, endothelin, γ- aminobutyric acid (GABA), hepatocyte growth factor, melanocortins, neuropeptide Y, opioid peptides, opsins, somatostatin, tachykinins, vasoactive intestinal polypeptide family, and vasopressin; biogenic amines (e.g., dopamine, epinephrine, norepinephrine, histamine, glutamate (metabotropic effect), glucagon, acetylcholine (muscarinic effect), and serotonin); chemokines; lipid mediators of inflammation (e.g., prostaglandins, prostanoids, platelet-activating factor, and leukotrienes); and peptide hormones (e.g., calcitonin, C5a anaphylatoxin, follicle-stimulating hormone (FSH), gonadotropic-releasing hormone (GnRH), neurokinin, thyrotropin-releasing hormone (TRH), and oxytocin).

[000136] In one specific aspect, the GPCR portion of the fusion protein corresponds to receptors involved in signaling in the central nervous system and anterior pituitary, as exemplified by the Class B GPCRs, CRFR1 and CRFR2. These receptors are believed to play a central role in depression, anxiety, and stress disorders. CRFR1 mediates anxiety and depression behaviors and HPA axis stress response, and may be involved in the initiation of escapable and controllable stressors. CRFR2, on the other hand, is known to play a role in such responses, either to reinstate homeostasis to counteract CRFR1 activity or to mediate anxiety and depression responses caused by inescapable stressors. Hauger RL et al., CNS Neurol Disord Drug Targets 2006 August 5:453-479. The ability to identify molecules that selectively modulate signaling of one or both of these receptors could be instrumental in not only understanding these pathways, but also in identification and development of therapeutics useful for control of such neurological responses.

[000137] In another specific aspect, the GPCR portion of the fusion protein composition corresponds to a chemokine receptor. Chemokines and their receptors play a pivotal role in lymphocyte trafficking, recruiting and recirculation. Chemokine receptors are GPCRs belonging to the rhodopsin superfamily. They have an N-terminus outside the cell, three extracellular domains, three intracellular loops and a C-terminus in the cytoplasm wich contains serine and threonine phosphorylation sides. Unusually for GPCRs, nearly all chemokine receptors have multiple high-affinity ligands for a single receptor. CCR5, for example, binds CCL3 and CCL4 as well as CCL5. Binding of a chemokine to its specific receptor on the cell surface activates results in chemotaxis towards the source of the chemokine. Based on their ligand specificity, chemokine receptors can be divided into two major groups, CXCR and CCR, based on the two major classes of chemokines. Thus far six CXC receptors, one CX3C and twelve CC receptors have been identified. The creation of fusion protein compositions may help to tease out the specific interactions necessary for signaling through these receptors, and again aid in identification of binding agents with potential therapeutic effects.

[000138] The GPCR sequences of the compositions of the invention can also be modified for numerous reasons, including enhancement of their use in assays, in vivo stability, to include identifying sequences, such as epitope tags (HA tags, FLAG tags, etc.) or fluorescent indicator proteins; or to provide sequences that aid in isolation of the compositions, etc. Examples of modifications that can be used in the compositions of the invention include: those described in US20080009551, in which a GPCR is modified to produce a ligand upregulatable GPCR; luciferase tagged mutants as described in Ramsay et al., Br J Pharmacol. 2001 133:315-23 and McLean et al., Mol Pharmacol. 1999 56:1182-91; constitutively active receptors, as described in McLean et al., Mol Pharmacol. 2002 62:747-55, Samama et al. J Biol Chem. 1993 268:4625-36, Parnot et al., Trends Endocrinol Metab. 2002 13:336-43, and Teitler et al, Curr Top Med Chem. 2002 2:529-38; sequences to facilitate domain swapping for fusion protein production; modifications to allow interaction and/or use of specific assay components, e.g., sequences to facilitate the use of the PathHunter™ β-Arrestin assays; C-terminal identifiers such as fluorescent proteins {e.g., green fluorescent protein, yellow fluorescent protein, etc.); receptor modifications {e.g., channel rhodopsin modifications) to allow optogenetic applications and detection of light-based activation; and biarsenical labeling reagents such as TC-FlAsH and TC-ReAsH (Invitrogen, Carlsbad, CA) which allow drug- based protein detection (see also Adams SR et al., J Am Chem Soc. 2002 May 29; 124(21 ):6063-76); and the like.

Binding Affinities

[000139] The strength of the interaction of a binding agent with a composition can be characterized by its "binding affinity" to a given binding site or epitope. In the field of immunology, antibodies are characterized by their "binding affinity" to a given binding site or epitope. Every antibody is comprised of a particular 3-dimensional structure of amino acids, which binds to another structure referred to as an epitope or antigen.

[000140] The selective binding of a binding agent to a composition is a simple bimolecular, reversible reaction, not unlike the binding of an antibody to its antigen. For example, if the antibody is represented by Ab and the antigen by Ag, the reaction can be analyzed by standard kinetic theory. Assuming a single binding site the reaction is represented by the equation I as follows: . ;_,<; + Ah Ag - .10

[000141] where Ag-Ab is the bound complex. The forward and reverse binding reactions are represented by rate constants k_\ and fc₂ respectively. The "binding affinity" of the antibody to the antigen is measured by the ratio of complexed to free reactants at equilibrium. The lower the concentration of the reactants at equilibrium, the higher the binding affinity of the antibody for the antigen. In the field of immunology, the binding affinity is represented by an "affinity constant" which is represented by the symbol "K" or sometimes referred to as "K_a". The "K" is defined by the equation II as follows:

„ _{K =} [Ag - Ab] ₌ k

[Ag ][Ab] k ,

[000142] where the brackets denote concentration in moles per liter or liters per mole.

[000143] A typical value for the binding affinity K_a which is also referred to as "K" and is the "affinity constant" which for a typical antibody is in a range of from about 10⁵ to about 10¹¹ liters per mole. The K_a is the concentration of free antigen needed to fill half the binding sites of the antibody present in solution with the antigen. If measured in liters per mole a higher K_a (e.g. 10¹¹) or higher affinity constant indicates a large volume of solvent, a very dilute concentration of free antigen, and as such indicates the antibody has a high binding affinity for the epitope.

[000144] If the K_a is measured in moles per liter a low K_a (e.g. 10^~n) indicates a less concentrated solution of the free antigen needed to occupy half of the antibody binding sites, and as such a high binding affinity.

[000145] Equilibrium is achieved in order to measure the K_a. More specifically, the K_a is measured when the concentration of antibody bound to antigen [Ag-Ab] is equal to the concentration of the antibody [Ab]. Thus, [Ag-Ab] divided by [Ab] is equal to one. Knowing this, the equation II above can be resolved to the equation III as follows: III. K = -

[Ag]

[000146] In equation III the units for K are liters per mole. Typical values in liters per mole are in a range of from about 10⁵ to about 10¹¹ liters per mole.

[000147] The inverse of the above equation is K = [Ag] where the units for K are in moles per liter, and the typical values are in a range of 10^"6 to 10^"12 moles per liter.

[000148] The above shows that typical binding affinities can vary over six orders of magnitude. Thus, what might be considered a useful antibody might have 100,000 times greater binding affinity as compared to the binding affinity of what might be considered a different antibody, which is also considered useful.

[000149] Based on the above it will be understood that binding characteristics of an antibody to an antigen can be defined using terminology and methods well defined in the field of immunology. The binding characteristics of a binding agent to its target intracellular peptide can likewise be defined. The binding affinity or "^Γ' of a binding agent identified using the methods of the invention can thus be precisely determined.

[000150] Those skilled in the art will understand that a high degree of binding affinity does not necessarily translate to a highly effective drug. Thus, when obtaining binding targets that are drug candidates, the candidates showing a wide range of binding affinities may be tested to determine if they obtain the desired biochemical/physiological response. Although binding affinity is important, some drug candidates with high binding affinity are not effective drugs and some drug candidates with low binding affinity are effective drugs. The functional assessment of any binding agents identified or investigated using the compositions of the invention is thus a critical part of any drug design to ensure the drug candidate meets the desired specifications.

Functional Assays [000151] The fusion protein compositions of the invention are useful as either research or diagnostic tools in functional assays, including: assays used to understand physiological processes; assays to identify new binding agents (including drug candidates) that selectively bind to the fusion protein composition, and preferably to the intracellular peptide portion of the composition; and assays to test known compounds (including synthetic, recombinant or naturally-occurring compounds) for their effect on the fusion protein composition, and the like. It is known in the pharmaceutical arts that binding affinity to a target and efficacy do not necessarily correlate, and that identification of functional changes conferred by a binding agent is a much better predictor of efficacy than binding affinity alone. The fusion protein compositions of the invention are especially powerful in identification of binding agents with functional activity rather than just affinity, as the fusion proteins can recreate the activity and/or conformation of the intracellular peptide.

[000152] Functional assays for use with the compositions of the present invention include biochemical assays which can be correlated with in vivo efficacy for a physiological process, ex vivo cell-based assays for measurement of a physiological process, in vivo assays for direct or indirect measurement of a physiological process, etc.

[000153] The functional assays of the invention are any assays that correlate with in vivo modulation of a process. Examples of cell-based assays for use with the present invention include, but are not limited to, high throughput binding screening; assays to measure cell proliferation, death necrosis and/or apoptosis; flow cytometry assays; metabolic assays measuring labeling or turnover; phase and fluorescence microscopy; receptor phosphorylation and/or turnover; cell signaling assays; immunohistochemistry studies; reporter gene assays, and subcellular fractionation and localization. More specific examples of such assays are: FLIPR to detect changes in intracellular calcium concentration; CACO to predict human oral absorption of drug compounds; and cell- based ELISA assays to detect and quantify cellular proteins including post-translational modifications associated with cell activation; [ 35 GTPyS] binding assays, PathHunter™ beta-arrestin technology, SureFire™ MAPkinase assays; PathHunter™ MAP kinase assays; and radioligand binding assays. [000154] Biochemical assays can also be used to correlate binding with functional activity in the methods of the invention. These include, but are not limited to, spectrophotometric assays, fluorometric assays, calorimetric assays, chemiluminescent assays, radiometric assays, chromatographic assays, colorimetric assays, and substrate specificity inhibitor kinase assays. Specific examples are: luciferase assays, in which firefly luciferase protein catalyzes luciferin oxidation and light is generated in the reaction, and which is frequently used as a report gene for measuring promoter activity or transfection efficiency; electrophoresis; gas-liquid chromatography; Forster resonance energy transfer (FRET); and use and detection of activation by RASSLs.

[000155] In a specific aspect, in vivo model assays are utilized to provide a correlation of binding affinity with functional activity in modulating a target peptide. Examples of in vivo functional assays are radiolabelling assays, fluorescent protein expression assays, in vivo capture assays, NMR spectroscopy, or assays specifically designed to identify efficacy in an animal model of a pathological process. For example, in treatment of certain diseases or disorders, such as infectious diseases, therapeutics need to be initially tested in in vivo models due to the complex physiological parameters involved with efficacy.

[000156] For detection of amyloid plaque and/or fibril formation, mass spectrometry can be used (Larson JL et al., Protein Science -2000!, 9:427-431.) Immunohistochemical identification of amyloid fibrils can also be conducted as described in Kebbel A and Rocken C, Am J Surg Pathol. 2006 Jun;30(6):673-683 and Takahashi et al., Amyloid 2000 Dec;7(4):259-65. Other methods include the Thioflavin T (ThT) method. ThT fluoresces only when bound to aggregated fibrils, producing a hypochromic shift in the bound dye (Levine, 1993). The reaction is initiated immediately upon mixing β-amyloid into an aqueous environment and is completed within one minute, aggregation. Quantitative analysis using the ThT method is provided in 20080268549, which is incorporated herein by reference. EXAMPLES

[000157] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent or imply that the experiments below are all of or the only experiments performed. It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

[000158] Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees centigrade, and pressure is at or near atmospheric.

Example 1: Cloning and Production of apoE3_CRFR and apoE4_CRFR Fusion Proteins

[000159] The apoE4 allele of the apoE gene is associated with earlier onset, progression, or severity of traumatic brain injury, CNS ischemic, Parkinson disease, amyotrophic lateral sclerosis, multiple sclerosis, etc. The ApoE3 allele, however, is not associated with a deleterious outcome in many of these same conditions. The ability to differentiate the activities of these proteins in a cell-based setting based on morphology provides a mechanism for screening for agents that have a differential effect on the proteins, or that somehow allow the apoE4 protein to behave more in line with the apoE3 protein in a cell-based assay system. The invention thus provides a mechanism for screening for molecules that convert an apoE4 phenotype into that displayed by apoE3.

[000160] Human apoE3_CRFR and Human apoE4_CRFR fusion proteins were produced by initial cloning of the first GPCR peptide and either an apoE3 peptide or an apoE4 peptide into a pcDNA3.1 ZEO vector. Construction of the plasmids is as described below.

[000161] The apoE3 portion of the fusion construct was obtained from the DNA plasmid RC200395 (Origene, Rockville, Maryland). The apoE4 portion of the fusion construct was obtained by introducing the appropriate nucleotide alterations into the RC200395DNA plasmid. This was prepared using an amplification procedure with the following sense and antisense oligonucleotides comprising the nucleotide changes associated with the apoE4 allelic variant:

[000162] (Sense) TGGAGGACGTGCGCGGCCGCCTG (SEQ ID NO: 1)

[000163] (Antisense) CAGGCGGCCGCGCACGTCCTCCA (SEQ ID NO:2)

[000164] The apoE4 point mutation was introduced into the RC200395 apoE sequence using the following amplification procedure. 1 μΐ (10 ng) of RC200395, 0.5 μΐ 10X PCR buffer, Ιμΐ 2mM dNTPs, 2.5 μ1_50ηιΜ MgCl_2> 3.3 μΐ sense primer (125ng), 3.4 μΐ antisense primer (125ng), 5μ1 Hifidelity Taq (Su/μΐ) and 33.3 μΐ water for a total of 50 μΐ. The amplification conditions included an initial denaturation step at 95°C for 1 minute, followed by 30 cycles at 95°C for 50 seconds, 60°C for 50 seconds, and 68°C for 7 minutes. A final extension was performed at 68°C for 7 minutes.

[000165] Following the amplification, XL10 Gold cells (Invitrogen, Carlsbad,CA) are transformed with the vector containing the apoE4 variant sequence. 2 μΐ apoE4 plasmid DNA treated with Dpnl (NEB, Ipswitch, New York) was added to the XL10 Gold cells and incubated on ice for 30 minutes. NYZ broth [5g NaCl, 2g MgS0₄ 6H₂0, 5g Yeast extract, lOg NZ Amine, and 800 ml dH₂0] was heated to 42°C. The transformed cells were heat pulsed at 42°C for exactly 30 sec. The cells were then placed on ice for 2 minutes, and 500 μΐ of pre- warmed NYZ broth added to the cells and shake at 37°C, 225rpm for 1 hour. 250 μΐ cells were plated on Kan resistant plate and incubated overnight at 37°C.

[000166] The apoE3 and apoE4 plasmids and the ssf_Zeo plasmid (Invitrogen, Carlsbad, CA) were digested with AsiSI and Xhol (NEB, Ipswich, MA). The digestion mixtures each contained 10 μg DNA, 0.5 μΐ BSA, 4.5 μΐ NEB buffer 10X, 2μ1 AsiSI and 2μ1 Xhol and 16 μΐ water for a total volume of 45μ1. The digestions were incubated at 37°C for 3 hours. 1 μΐ of CIP (NEB, Ipswich, MA) was added to the plasmid digestion mixture, and allowed to incubate for an additional hour. The digested apoE3, apoE4 and ssZEO plasmid were each gel purified using a Qiagen gel extraction kit (Valencia, CA) and ligated with T4 ligase. The ligation reactions included 1 μΐ purified ssf_Zeo DNA, 2 μΐ purified apoE3 or apoE4 DNA, 2 μΐ 10X ligase buffer, 1 μΐ T4 DNA ligase (NEB, Ipswich, MA) and 14 μΐ water. The ligation reaction mixtures were incubated at 16°C overnight, followed by incubation at 65°C for 20 minutes and stored at 4°C until further use as described below.

[000167] Chemically competent ToplO E. Coli cells (Invitrogen, Carlsbad, CA) were transformed with the ligated ssf_apoE3 vector or the ligated ssf_apoE4 vector, plated on LB plates, and allowed to incubate overnight at 37°C. The cells were then cultured in 5ml LB, and the vectors isolated via a standard plasmid preparation. The sequence of the plasmids and the desired orientation of the inserts for proper expression of apoE3 or apoE4 was confirmed by restriction endonuclease digestion and sequencing.

[000168] DNA encoding an HA-tagged CRFR2 protein was amplified using human complementary DNA (cDNA) and the following primers:

(HA_XhoI_Forward) ATACTCGAGTATCCTTACGACGTGCCTGA (SEQ ID NO:3) and (Xba_reverse) ATATCTAGATAGAAGGCACAGTCGAGG (SEQ ID NO:4).

An Xbal digestion site in the primers is shown in bold. 0.7 μΐ (approximately 70ng) of human cDNA was used as template DNA in the PCR reaction, and 2.0 μΐ of each primer at a concentration of 5 μΜ. The DNA was amplified using 0.2 μΐ Highfidelity Taq at Su/μΐ in a total volume of 50 μΐ. PCR conditions included an initial denaturation at 95°C for two minutes, followed by 30 cycles of 94°C for 30 seconds, 61°C for 30 seconds and 68°C for 30 seconds, followed by a final extension at 68°C for 5 minutes. The PCR products were stored at 4°C then purified using PCR purification kit from Qiagen (Valencia, CA).

[000169] The purified CRFR2 DNA, the apoE3 pcDNA13_Zeo vector and the apoE4 pcDNA13_Zeo vectors were digested with Xbal (NEB, Ipswich, MA), and the desired fragments gel purified using a Qiagen (Valencia, CA) Gel Extraction Kit. The digested PCR product and vector DNA were ligated using T4 DNA ligase. The ligation reactions included 1 μΐ purified ssf_apoE3 DNA or 1 μΐ purified ssf_apoE4 DNA, 2 μΐ purified CRFR2 DNA, 2 μΐ 10X ligase buffer, 1 μΐ T4 DNA ligase (NEB, Ipswich, MA) and 14 μΐ water. The ligation reaction mixtures were incubated at 16°C overnight, followed by incubation at 65°C for 20 minutes and stored at 4°C until further use as described below.

[000170] Chemically competent E. Coli cells (Invitrogen, Carlsbad, CA) were transformed with the ligated apoE3_CRFR2 vector or the ligated apoE4_CRFR2 vector, plated on LB plates, and allowed to incubate overnight at 37°C. The cells were then cultured in 5ml LB, and the vector isolated via a standard plasmid preparation. The sequence of the plasmids and the desired orientation of the insert for proper expression was confirmed by restriction endonuclease digestion and sequencing.

[000171] The resulting plasmids contain DNA encoding either apoE3 or apoE4 5' to both the HA fragment and the CFRF2. These plasmids are illustrated in FIGs. 1 and 2. The CRFR2 coding region is in-frame with the apoE3 or apoE4 peptide region, so that any protein created using this plasmid will result in a protein having the apoE component at its N-terminus, and the HA and CRFR2 portions in frame and at the carboxy-terminus, as set forth in Figures 1 and 2.

Example 2: Transfection of Human Cells with the ApoE Expression Plasmids

[000172] The plasmid containing the fusion protein was then transfected into HEK 293 cells for expression of the protein, confirmation of the appropriate insertion into the membrane, and ability of the apoE3 and apoE4 fusion proteins to form extracellular fibrils.

[000173] One day prior to transfection, HEK 293 cells were placed in a 12 well plate with DMEM with 10% fetal bovine serum (FBS) in each of the wells. Immediately prior to transfection, each well was examined to confirm approximately 90-95% confluency of the cells in the wells. The DMEM was carefully aspirated from the wells, and replaced with fresh DMEM/10% FBS.

[000174] The final DNA plasmid preparations created in Example 1 were each diluted in ΙΟΟμΙ of Opti-MEM (reduced serum) and gently mixed. Lipofectamine 2000 which had been likewise diluted in ΙΟΟμΙ of Opti-MEM, was incubated at room temperature for 5 minutes, and then combined with the diluted DNA samples. These were mixed gently and incubated at room temperature for 20 minutes.

[000175] Approximately 200μ1 of the Lipofectamine 2000-DNA complexes were added to each well to a total volume of 1.2ml/well. The well contents were mixed gently by rocking the plate back and forth, and incubated at 37°C for 5 hours. After incubation media was replaced with fresh DMEM/10 FBS. The cells were then selected by growing the cells in 10% FBS in DMEM cell media with zeocin (400μg/ml) selection reagent. From these initial experiments, six clones were isolated from both the apoE3 and apoE4 transfections that demonstrated consistent and easily measurable expression of the fusion proteins in the transfected HEK 293 cell lines as determined by Western Blot analysis. The expression of the fusion protein clones in the cell lines was determined using mouse monoclonal antibody against the fusion protein. 50μg of cell lysate was loaded per well on 4-20% Tris-Glycine gel from Invitrogen (Carlsbad, CA).

Example 3: Extracellular Fibril Formation using the apoE3_CRF-R2 and apoE4_CRF-R2 Fusion Proteins

[000176] The mammalian cells expressing the apoE3_CRFR fusion protein or the apoE4_CRFR fusion protein were tested for the extracellular expression of the apoE3 or apoE4, and the ability the respective cells expressing these constructs to create fibrillar structures when introduced to the appropriate culture conditions. Cells were cultured in 10% FBS and passage 2 when the pictures were taken. Cells expressing either CRFR alone or apoE3 alone were also stained with the antibodies to serve as controls in the experiment.

[000177] The HEK 293 cells stably expressing the epitope-tagged CRFR were fed monoclonal anti-HA 11 and stained with Phalloidin. HEK 293 cells stably expressing apoE3 were fed with monoclonal anti-Mi FLAG and stained with Phalloidin. The cells stably expressing the apoE3_CRFR fusion protein or the apoE3_CRFR fusion protein were fed monoclonal anti-HA 11 and with monoclonal anti-Mi FLAG. First, cover slips were flamed and placed into a 6-well plate. 10 ml of PBS was added to a Poly D-Lysine coated vial, and mixed to dissolve the poly-lysine into solution. 5ml of the dissolved polylysine solution (corresponding to approximately 2.5 mg) to 500 ml PBS. 1 ml of the Poly-lysine onto cover slips, and allowed to incubate at room temperature for 20 minutes. Following incubation, the cover slips were rinsed twice with 2ml of PBS, and 2ml of DMEM with 10% FBS media. Cultured HEK 293 cells expressing either the apoE3_CRFR fusion protein or the apoE4_CRFR fusion protein were added to the cover slips via dropper, and allowed to incubate at 37°C.

[000178] The following day, cells were found to be approximately 50-60% confluent. Media were aspirated and 2ml of fixative [2.5 ml PBS; 37% formaldehyde; 20 ml H₂0] was added to each well and incubated at room temperature for 20 minutes. The fixative was aspirated and the cover slip was washed 3 times with TBSC [80 g NaCl; 30g Tris base; 2 g KC1; 1.47 CaCl₂ (2H₂0) in a total volume of 1L, adjusted to pH 7.4]. 50- 60μ1 of Blotto solution [0.3g dry powdered milk; 100 μΐ 10% Triton X-100; 100 μΐ 100 mM CaCl_2; 500 μΐ 1M Tris pH 7.5; and 9.3 ml H₂0] on the top of the cover slip, and incubated at room temperature for 45 minutes. Primary and secondary antibody solutions were then made in blotto solution at concentration 1:1000, the phalloidin concentration was 1 :40.

[000179] 100 μΐ of the primary antibody solution was added to the cover slips, and allowed to incubate at room temperature in the dark for 60 minutes. The primary antibody was aspirated, and the cover slips were washed three times with TBSC. The secondary antibody was added to each cover slip, and the cover slips incubated again at room temperature in the dark for 60 minutes. The secondary antibody was aspirated, and the cover slips were washed three times with TBSC. While still in the final wash solution, the cover slips were carefully removed from the solution, and placed cell side down on a slide with a drop of Vecta shield with DAPI solution. The slides were fixed with nail polish and dried for 15-20 minutes.

[000180] Serial photographs of the cells expressing the apoE3_CRFR fusion protein, the apoE4_CRFR fusion protein, or CRFR alone were taken using a confocal microscope, and assembled to create a 3-dimensional (3D) representation of the cells. The software used for this purpose was Imaris software (Bitplane, Zurich, Switzerland), Imaris is a core software module that delivers functionality for visualization, segmentation and interpretation of 3D microscopy datasets. A Zeiss LSM 510 META Axioplan 2 confocal microscope was used to take serial photos, which were then used to construct a 3D image. Use of the Imaris software allowed accurate information to be obtained about the position of stained proteins, receptors and cellular components of the cells expressing the fusion protein and control cells.

[000181] As seen in Figure 3, the cells expressing the apoE3_CRFR2 fusion protein displayed extracellular fibrils consistent with the oligomerization and nucleation required for fibril formation of apoE3 on the cell membrane surface. This is direct contrast to the cells expressing the apoE4_CRFR2 fusion protein, which showed a much different morphology that did not include such fibril formation, as seen in Figure 4. The cells expressing CRFR alone (Figure 5) also did not display the fibril formation, and looked very similar in morphology to the cells expressing the apoE4_CRFR2 fusion protein.

[000182] In a more detailed image reconstruction, the apoE3_ CRFR2 fusion protein expressing cells (Figure 6) are shown with the fibril extension in comparison with the cells expressing apoE3 alone (Figure 7). The cells expressing apoE3 without the chimera presentation did not display extracellular fibril production, demonstrating it is due to the apoE3 presentation at the cell surface from expression of the apoE3_CRFR2 fusion protein.

Example 4: Cloning and Production of a Src_CRFR2 Fusion protein

[000183] A human Src_CRFR2 fusion protein was produced by initial cloning of the first GPCR peptide and second signaling complex peptide into a pcDNA3.1 ZEO vector. The map of the vector produced for the expression of the Src_CRF-R2 fusion protein is shown in Figure 8. Construction of this plasmid is as described below.

[000184] The Src portion of the fusion construct was obtained by digesting the DNA plasmid RC208622 (Origene, Rockville, Maryland) and the ssf_Zeo plasmid (Invitrogen, Carlsbad, CA). Both were digested with AsiSI and Xhol (NEB, Ipswich, MA). The digestion mixtures each contained 10 μg DNA, 0.5 μΐ BSA, 4.5 μΐ NEB buffer 10X, 2μ1 AsiSI and 2μ1 Xhol and 16 μΐ water for a total volume of 45μ1. The digestions were incubated at 37°C for 3 hours. 1 μΐ of CIP (NEB, Ipswich, MA) was added to the plasmid digestion mixture, and allowed to incubate for an additional hour. The digested Src and plasmid fragments were gel purified using a Qiagen gel extraction kit (Valencia, CA) and ligated with T4 ligase. The ligation reaction included 1 μΐ purified ssf_Zeo DNA, 2 μΐ purified Src DNA, 2 μΐ 10X ligase buffer, 1 μΐ T4 DNA ligase (NEB, Ipswich, MA) and 14 μΐ water. The ligation reaction mixture was incubated at 16°C overnight, followed by incubation at 65°C for 20 minutes. The ligation mixture was stored at 4°C until further use as described below.

[000185] Chemically competent ToplO E. Coli cells (Invitrogen, Carlsbad, CA) were transformed with the ligated ssf_Src vector, plated on LB plates, and allowed to incubate overnight at 37°C. The cells were then cultured in 5ml LB, and the vector isolated via a standard plasmid preparation. The sequence of the plasmids and the desired orientation of the insert for proper expression was confirmed by restriction endonuclease digestion and sequencing.

[000186] DNA encoding an HA-tagged CRFR2 protein was amplified using human complementary DNA (cDNA) and the following primers:

[000187] An Xbal digestion site in the primers is shown in bold. 0.7 μΐ (approximately 70ng) of human cDNA was used as template DNA in the PCR reaction, and 2.0 μΐ of each primer at a concentration of 5 μΜ. The DNA was amplified using 0.2 μΐ Highfidelity Taq at Su/μΐ in a total volume of 50 μΐ. PCR conditions included an initial denaturation at 95°C for two minutes, followed by 30 cycles of 94°C for 30 seconds, 61°C for 30 seconds and 68°C for 30 seconds, followed by a final extension at 68°C for 5 minutes. The PCR products were stored at 4°C then purified using PCR purification kit from Qiagen (Valencia, CA).

[000188] The purified CRFR2 DNA and the ssf_Src vector were both digested with Xbal (NEB, Ipswich, MA), and the desired fragments gel purified using a Qiagen (Valencia, CA) Gel Extraction Kit. The digested PCR product and vector DNA were ligated using T4 DNA ligase. The ligation reaction included 1 μΐ purified ssf_Src DNA, 2 μΐ purified CRFR2 DNA, 2 μΐ 10X ligase buffer, 1 μΐ T4 DNA ligase (NEB, Ipswich, MA) and 14 μΐ water. The ligation reaction mixture was incubated at 16°C overnight, followed by incubation at 65°C for 20 minutes. It was stored at 4°C until further use as described below.

[000189] Chemically competent E. Coli cells (Invitrogen, Carlsbad, CA) were transformed with the ligated Src_CRFR2 vector, plated on LB plates, and allowed to incubate overnight at 37°C. The cells were then cultured in 5ml LB, and the vector isolated via a standard plasmid preparation. The sequence of the plasmids and the desired orientation of the insert for proper expression was confirmed by restriction endonuclease digestion and sequencing. The resulting plasmid contains DNA encoding Src 5' to both the HA fragment and CRFR2. The CRFR2 coding region is in-frame with the Src, so that any protein created using this plasmid will result in a protein having the Src component at its N-terminus, and the HA and CRFR2 portions in frame and at the carboxy-terminus, as set forth in Figure 8. Chemically competent ToplO E. Coli cells (Invitrogen, Carlsbad, CA) were transformed with the ligated Src_CRFR2 vector, plated on LB plates, and allowed to incubate overnight at 37°C. The cells were then cultured in 5ml LB, and the vector isolated via a standard plasmid preparation using a Qiagen (Ventura, CA) mini prep kit. The sequence of the plasmids and the desire orientation for expression was confirmed by restriction endonuclease digestion and sequencing.

Example 5: Transfection of Human Cells with the Src Expression Plasmid and Detection of Expression

[000190] The plasmid containing the Src fusion protein was then transfected into HEK 293 cells for expression of the protein, confirmation of the appropriate insertion into the membrane.

[000191] One day prior to transfection, HEK 293 cells were placed in a 12 well plate with DMEM with 10% fetal bovine serum (FBS) in each of the wells. Immediately prior to transfection, each well was examined to confirm approximately 90-95% confluency of the cells in the wells. The DMEM was carefully aspirated from the wells, and replaced with fresh DMEM/10% FBS. The final DNA plasmid preparation created in Example 4 was then diluted in ΙΟΟμΙ of Opti-MEM (reduced serum) and gently mixed. Lipofectamine 2000, which had been likewise diluted in ΙΟΟμΙ of Opti-MEM, was incubated at room temperature for 5 minutes, and then combined with the diluted DNA. This was mixed gently and incubated at room temperature for 20 minutes.

[000192] Approximately 200μ1 of the Lipofectamine 2000-DNA complexes were added to each well to a total volume of 1.2ml/well. The well contents were mixed gently by rocking the plate back and forth, and incubated at 37°C for 5 hours. After incubation media was replaced with fresh DMEM/10 FBS. The cells were then selected by growing the cells in 10% FBS in DMEM cell media with zeocin (400μg/ml) selection reagent. From these initial experiments, six clones were isolated that demonstrated consistent and easily measurable expression of the fusion proteins in the transfected HEK 293 cell lines as determined by Western Blot analysis. The expression of the fusion protein clones in the cell lines was determined using mouse monoclonal antibody against the fusion protein. 50μg of cell lysate was loaded per well on 4-20% Tris-Glycine gel from Invitrogen (Carlsbad, CA).

[000193] The following day, cells were found to be approximately 50-60% confluent. Media were aspirated and 2ml of fixative [2.5 ml PBS; 37% formaldehyde; 20 ml H₂0] was added to each well and incubated at room temperature for 20 minutes. The fixative was aspirated and the cover slip was washed 3 times with TBSC [80 g NaCl; 30g Tris base; 2 g KC1; 1.47 CaCl₂ (2H₂0) in a total volume of 1L, adjusted to pH 7.4]. 50- 60μ1 of Blotto solution [0.3g dry powdered milk; 100 μΐ 10% Triton X-100; 100 μΐ 100 mM CaCl_2; 500 μΐ 1M Tris pH 7.5; and 9.3 ml H₂0] on the top of the cover slip, and incubated at room temperature for 45 minutes. Primary and secondary antibody solutions were then made in blotto solution at concentration 1:1000, the phalloidin concentration was 1 :40.

[000194] 100 μΐ of the primary antibody solution was added to the cover slips, and allowed to incubate at room temperature in the dark for 60 minutes. The primary antibody was aspirated, and the cover slip was washed three times with TBSC. The secondary antibody was added, and the cover slips incubated again at room temperature in the dark for 60 minutes. The secondary antibody was aspirated, and the cover slip was washed three times with TBSC. While still in the final wash solution, the cover slip was carefully removed from the solution, and placed cell side down on a slide with a drop of Vecta shield with DAPI solution. The slide was fixed with nail polish and dried for 15- 20 minutes.

[000195] Serial photographs of the cells expressing the Src_CRFR fusion protein as well as control cells expressing just human Src were taken using a confocal microscope, and assembled to create a 3-dimensional (3D) representation of the cells. The software used for this purpose was Imaris software (Bitplane, Zurich, Switzerland), Imaris is a core software module that delivers functionality for visualization, segmentation and interpretation of 3D microscopy datasets. A Zeiss LSM 510 META Axioplan 2 confocal microscope was used to take serial photos, which were then used to construct a 3D image. Use of the Imaris software allowed accurate information to be obtained about the position of stained proteins, receptors and cellular components of the cells expressing the fusion protein and control cells.

[000196] As seen in Figures 9 and 10, the HEK cells expressing the fusion protein (Figure 9) displayed extracellular expression (901) of the typically intracellular kinase. The expression of the construct comprising Src alone (Figure 10) displayed the intracellular expression (1001) that is typical for the Src protein.

Example 6 Cloning and Production of A0_CRF-R2 Fusion Proteins

[000197] Human fusion proteins comprising A ₄₀_CRFR2 and A ₄₂_CRFR2 were produced by initial cloning of a GPCR peptide and the amyloid peptides into a pcDNA3.1 ZEO vector. The maps of the vector produced for the expression of the A _CRFR2 fusion proteins are shown in Figure 11. Construction of these plasmids is described below.

[000198] The Αβ₄ο and Αβ₄₂ portions of the fusion construct were obtained by PCR amplification. Amyloid beta peptide fragments were amplified from human cDNA using forward primers: (BamHI_For) ATAGGATCCGGATGCAGAATTCCGACATGACT (SEQ ID NO:5) and either (Abi_42_XhoI_Rev) ATACTCGAGGACGATCACTGTCGCTATGACAA (SEQ ID N0:6) or (Ab₁.4o_XhoI_Rev) ATACTCGAGCACTGTCGCTATGACAA (SEQ ID NO:7).

The restriction sites are shown in bold. 0.7 μΐ (70ng) template DNA was used with 5μ1 10 PCR buffer, 5μ1 2mM dNTPs, 2.5 μ1_50ηιΜ MgCl_2, 2.0 μΐ each primer (5μΜ), 0.2 5μ1 Hifidelity Taq (Su/μΐ) and 32.6 μΐ water for a total of 50 μΐ. The amplification conditions included an initial denaturation step at 95°C for 2 minutes, followed by 30 cycles at 94°C for 30 seconds, 61°C for 30 seconds, and 68°C for 30 seconds. A final extension was performed at 68°C for 5 minutes.

[000199] The PCR products were digested with Bamffl and Xhol. The ssf_Zeo plasmid (Invitrogen, Carlsbad, CA) was also digested with BamHI and Xhol (NEB, Ipswich, MA). The digestion mixtures each contained 10 μg DNA, 0.5 μΐ BSA, 4.5 μΐ NEB buffer 10X, 2μ1 BamHI and 2μ1 Xhol and 16 μΐ water for a total volume of 45μ1. The digestions were incubated at 37°C for 3 hours. 1 μΐ of CIP (NEB, Ipswich, MA) was added to the plasmid digestion mixture, and allowed to incubate for an additional hour. The amplified amyloid peptide and plasmid fragments were gel purified using a Qiagen gel extraction kit (Valencia, CA) and ligated with T4 ligase. The ligation reaction included 1 μΐ purified ssf_Zeo DNA, 2 μΐ purified apoE3 DNA, 2 μΐ 10X ligase buffer, 1 μΐ T4 DNA ligase (NEB, Ipswich, MA) and 14 μΐ water. The ligation reaction mixture was incubated at 16°C overnight, followed by incubation at 65°C for 20 minutes. It was stored at 4°C until further use as described below.

[000200] Chemically competent Top 10 E. Coli cells (Invitrogen, Carlsbad, CA) were transformed with the ligated ssf_A ₄o and ssf_A ₄₂ vectors, plated on TB plates, and allowed to incubate overnight at 37°C. The cells were then cultured in 5ml LB, and the vector isolated via a standard plasmid preparation. The sequence of the plasmids and the desired orientation of the insert for proper expression was confirmed by restriction endonuclease digestion and sequencing.

[000201] DNA encoding an HA-tagged CRFR2 protein was amplified using human complementary DNA (cDNA) and the following primers:

(HA_XhoI_Forward) ATACTCGAGTATCCTTACGACGTGCCTGA (SEQ ID NO:3) and (Xba_reverse) ATATCTAGATAGAAGGCACAGTCGAGG (SEQ ID NO:4) [000202] An Xbal digestion site in the primers is shown in bold. 0.7 μΐ (approximately 70ng) of human cDNA was used as template DNA in the PCR reaction, and 2.0 μΐ of each primer at a concentration of 5 μΜ. The DNA was amplified using 0.2 μΐ Highfidelity Taq at Su/μΐ in a total volume of 50 μΐ. PCR conditions included an initial denaturation at 95°C for two minutes, followed by 30 cycles of 94°C for 30 seconds, 61°C for 30 seconds and 68°C for 30 seconds, followed by a final extension at 68°C for 5 minutes. The PCR products were stored at 4°C then purified using PCR purification kit from Qiagen (Valencia, CA).

[000203] The purified CRFR2 DNA and the ssf_A ₄₀ and ssf_A ₄₂ vectors were digested with Xbal (NEB, Ipswich, MA), and the desired fragments gel purified using a Qiagen (Valencia, CA) Gel Extraction Kit. The digested PCR product and vector DNA were ligated using T4 DNA ligase. The ligation reaction included 1 μΐ purified ssf_A ₄o and ssf_A ₄₂ DNA, 2 μΐ purified CRFR2 DNA, 2 μΐ 10X ligase buffer, 1 μΐ T4 DNA ligase (NEB, Ipswich, MA) and 14 μΐ water. The ligation reaction mixture was incubated at 16°C overnight, followed by incubation at 65°C for 20 minutes. It was stored at 4°C until further use as described below.

[000204] Chemically competent E. Coli cells (Invitrogen, Carlsbad, CA) were transformed with the ligated A _CRFR2 vectors, plated on LB plates, and allowed to incubate overnight at 37°C. The cells were then cultured in 5ml LB, and the vector isolated via a standard plasmid preparation. The sequence of the plasmids and the desired orientation of the insert for proper expression was confirmed by restriction endonuclease digestion and sequencing.

[000205] The resulting plasmid contains DNA encoding Αβ₄ο or Αβ₄₂ 5' to both the HA fragment and CRFR2. The CRFR2 coding region is in-frame with the Αβ portion of the fusion constructs, so that any protein created using this plasmid will result in a protein having the apoE3 component at its N-terminus, and the HA component and CRFR2 portions in frame and at the carboxy-terminus. Chemically competent ToplO E. Coli cells (Invitrogen, Carlsbad, CA) were transformed with the ligated CRFR2 vector, plated on LB plates, and allowed to incubate overnight at 37°C. The cells were then cultured in 5ml LB, and the vector isolated via a standard plasmid preparation using a Qiagen (Ventura, CA) mini prep kit. The sequence of the plasmids and the desire orientation for expression was confirmed by restriction endonuclease digestion and sequencing.

Example 7: Transfection of Human Cells with the Αβ Expression Plasmid

[000206] The plasmid containing the fusion protein was then transfected into HEK 293 cells for expression of the protein, confirmation of the appropriate insertion into the membrane, and functionality of the fusion protein in mammalian cells. One day prior to transfection, HEK 293 cells were placed in a 12 well plate with DMEM with 10% fetal bovine serum (FBS) in each of the wells. Immediately prior to transfection, each well was examined to confirm approximately 90-95% confluency of the cells in the wells. The DMEM was carefully aspirated from the wells, and replaced with fresh DMEM/10% FBS. The final DNA plasmid preparation created in Example 6 was then diluted in ΙΟΟμΙ of Opti-MEM (reduced serum) and gently mixed. Lipofectamine 2000 which had been likewise diluted in ΙΟΟμΙ of Opti-MEM. The Lipofectamine was incubated at room temperature for 5 minutes, and then combined with the diluted DNA. This was mixed gently and incubated at room temperature for 20 minutes.

[000207] Approximately 200μ1 of the Lipofectamine 2000-DNA complexes were added to each well to a total volume of 1.2ml/well. The well contents were mixed gently by rocking the plate back and forth, and incubated at 37°C for 5 hours. After incubation media was replaced with fresh DMEM/10% FBS. The cells were then selected by growing the cells in 10% FBS in DMEM cell media with zeocin (400μg/ml) selection reagent. From these initial experiments, six clones were isolated that demonstrated consistent and easily measurable expression of the fusion proteins in the transfected HEK 293 cell lines as determined by Western Blot analysis. The expression of the fusion protein clones in the cell lines was determined using mouse monoclonal antibody. 50μg of cell lysate was loaded per well on 4-20% Tris-Glycine gel from Invitrogen (Carlsbad, CA).

[000208] Following expression of the fusion proteins in the cells, the cells displayed different morphological characteristics and protein localization patterns of the expressed fusion proteins. The Αβ₄₂ CRFR construct displays more intracellular expression than the Αβ₄ο CRFR construct. The cells expressing the Αβ₄₂ _CRFR appear rounder, less healthy and displayed more toxic deposits than the cells expressing the Αβ₄ο CRFR construct (data not shown).

[000209] The preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of present invention is embodied by the appended claims. In the claims that follow, unless the term "means" is used, none of the features or elements recited therein should be construed as means-plus-function limitations pursuant to 35 U.S.C. §112, 6.

Claims

Representative Provisional Claims

1. A composition comprising:

a first peptide having an N-terminal extracellular domain from a cell surface protein, a transmembrane region from a cell surface protein, and an intracellular domain; and

a second peptide that corresponds an intracellular peptide or a fragment thereof;

wherein the second peptide is fused to an extracellular portion of the first peptide.

2. The composition of Claim 1, wherein the second peptide is fused to the N-terminal extracellular domain of the first peptide.

3. The composition of Claim 1, wherein the first peptide cell surface protein is a G-protein coupled receptor (GPCR).

4. The composition of Claim 1, wherein the second peptide comprises all or an active portion of an amyloid protein.

5. The composition of Claim 1, wherein the second peptide comprises an enzyme, a proenzyme or an active fragment thereof.

6. The composition of Claim 5, wherein the enzyme is a protease, a preproprotease, or an active fragment thereof.

7. The composition of Claim 5, wherein the enzyme is a kinase or an active fragment thereof.

8. The composition of Claim 5, wherein the enzyme is a phosphatase or an active fragment thereof.

9. The composition of Claim 1, wherein the wherein the second peptide is an intracellular region of a transmembrane protein.

10. The composition of Claim 1, wherein the wherein the second peptide is associated with infectious disease.

11. A research tool, comprising the composition of Claim 1.

12. Use of the research tool of Claim 11 in the discovery of a therapeutic binding agent.

13. Use of the research tool of Claim 11 as a diagnostic binding agent.

14. A binding agent to the composition of Claim 1 identified using the research tool of claim 9.

15. Use of the binding agent of Claim 14 in a therapeutic setting.

16. A method for identification of a drug candidate for treatment of a biological process involving for treatment of a biological process involving an intracellular peptide, said method comprising:

providing a research tool composition comprising:

a first peptide having an N-terminal extracellular domain from a GPCR, a transmembrane region from a GPCR, and an intracellular domain from a GPCR; and

wherein the second peptide is fused to an extracellular portion of the first peptide;

testing one or more binding agents for modulation of functional activity of the second peptide in the research composition, and

isolating the binding agents that display the desired change in functional activity of the research tool composition;

wherein the binding agents that display the desired change in functional activity of the research tool composition are drug candidates for the biological process involving the second peptide.

17. The method of Claim 16, wherein second peptide is fused to the N- terminal extracellular domain of the first peptide.

18. The method of Claim 16, wherein the second peptide comprises all or an active portion of an amyloid protein.

19. The method of Claim 16, wherein the second peptide comprises an enzyme, a proenzyme or an active fragment thereof.

20. The method of Claim 19, wherein the enzyme is a protease, a preproprotease, or an active fragment thereof.

21. The method of Claim 19, wherein the enzyme is a kinase or an active fragment thereof.

22. The method of Claim 19, wherein the enzyme is a phosphatase or an active fragment thereof.

23. The method of Claim 16, wherein the second peptide is an intracellular region of a transmembrane protein.

24. The method of Claim 16, wherein the second peptide is associated with infectious disease.