WO2005085440A1 - VERFAHREN ZUR ANREICHERUNG UND/ODER ABTRENNUNG VON PROKARYONTER DNA MITTELS EINES PROTEINS, DAS NICHT-METHYLIERTE CpG-MOTIVE ENTHALTENDE DNA SPEZIFISCH BINDET - Google Patents
VERFAHREN ZUR ANREICHERUNG UND/ODER ABTRENNUNG VON PROKARYONTER DNA MITTELS EINES PROTEINS, DAS NICHT-METHYLIERTE CpG-MOTIVE ENTHALTENDE DNA SPEZIFISCH BINDET Download PDFInfo
- Publication number
- WO2005085440A1 WO2005085440A1 PCT/EP2005/002198 EP2005002198W WO2005085440A1 WO 2005085440 A1 WO2005085440 A1 WO 2005085440A1 EP 2005002198 W EP2005002198 W EP 2005002198W WO 2005085440 A1 WO2005085440 A1 WO 2005085440A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dna
- protein
- prokaryotic
- prokaryotic dna
- separation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
Definitions
- the invention relates to methods for separating and / or enriching prokaryotic DNA or for depleting this DNA from physiological liquids using a protein which specifically binds non-methylated cytidine-phosphate-guanosine dinucleotides (CpG motifs) of a DNA, and a kit to carry out the procedure.
- a protein which specifically binds non-methylated cytidine-phosphate-guanosine dinucleotides (CpG motifs) of a DNA
- CpG motifs non-methylated cytidine-phosphate-guanosine dinucleotides
- Infections caused by bacteria are one of the most common causes of inflammatory diseases.
- the early detection of the bacterial pathogen is of crucial importance.
- the short time requirement is an essential advantage over conventional culture-dependent methods.
- the sensitivity of the detection of prokaryotic DNA directly from body fluids and non-pretreated test material is far too low compared to the culture of the microorganisms.
- a sufficient amount of nucleic acids from bacteria for the direct detection of pathogens from non-pretreated test material is only reached to a limited extent in the area of 16S rRNA analysis, by means of PCR of the 16S region on the bacterial chromosome and the subsequent sequence analysis of the PCR fragment, since mostly multiple copies for the portion encoding the 16S rRNA are located on the chromosome.
- NAT nucleic acid Amplification techniques
- PCR polymerase chain reaction
- LCR ligase chain reaction
- This detection limit is currently not yet reached with PCR methods, not even with those that have their target sequence in the region of the 16S rRNA region on the chromosome. Although several regions coding for the 16S rRNA are located on the bacterial chromosome, mostly 3 to 6, the requirement that at least one molecule of the template DNA is in the PCR reaction mixture remains unfulfilled.
- the pathogen-specific nucleic acid detection without amplification step by direct detection of the prokaryotic DNA is only of diagnostic importance if the number of germs in the test material is sufficiently high.
- the main problem of the detection of prokaryotic DNA for the identification of bacterial pathogens in body fluids, in addition to PCR-inhibiting components in the test material, consists primarily in the low concentration of prokaryotic DNA and the associated excess of eukaryotic versus prokaryotic DNA. This includes in particular competitive processes in DNA analysis as well as the small amount of prokaryotic DNA can be seen as a hindrance to qualitative and quantitative detection of pathogens.
- the usual methods for DNA isolation enrich the total DNA of a body fluid, so that the ratio of host DNA to microbial DNA can be between 1:10 "6 and 1:10 " 8 . From this difference, the difficulty of detecting microbial DNA in body fluids is easy to understand.
- Prokaryotic DNA differs from eukaryotic DNA, for example, by the presence of unmethylated CpG motifs (Hartmann G et al., Manuals ⁇ videblatt, vol. 98/15: A981-A985 (2001).
- CpG motifs are found in the prokaryotic DNA a 16-fold excess compared to eukaryotic DNA, which contains such motifs only temporarily, eg in cancer cells or promoter regions In prokaryotic DNA, these motifs are not methylated, whereas in eukaryotic DNA they are mostly methylated, which further increases the difference.
- Unmethylated CpG motifs are unmethylated deoxycytidylate deoxyguanylate dinucleotides within the prokaryotic genome or within fragments thereof.
- the specific methylation patterns for a disease enable diagnosis at a very early stage on the one hand, and molecular diagnosis on the other
- hCGBP human CpG-binding protein
- EP 02020904 has shown a method which enables the separation and enrichment of prokaryotic DNA from a mixture of prokaryotic and eukaryotic DNA by binding the prokaryotic DNA to a specifically non-methylated DNA-binding protein.
- the present invention is therefore based on the object of providing a method which enables the separation and / or enrichment of prokaryotic DNA from examination samples with a high proportion of eukaryotic DNA, in particular from patients with infections.
- this is achieved by a protein that binds non-methylated CpG motifs, it having a 25% to 35% homology, in particular about 27.6% homology, to the wild-type CPGB protein and compared to this at most up to The length of the binding site is shortened.
- the human CPGB protein (cf. Voo et al., Mol Cell Biol. 2000 Mar; 20 (6): 2108-21.) Is referred to below as the wild-type CPGB protein (or CPGbP656).
- the protein according to the invention is referred to below as CPGbP181.
- the protein described in EP 02020904 which is a shortened variant of the wild-type CPGB protein and was used as the basis for the protein according to the invention, is referred to below as CPGbP241.
- the invention is described below with reference to the figures, wherein
- Figure 1 shows the amino acid sequence of CPGbP181 (shown in bold) compared to the wild-type CPGB protein (CPGbP656) and the CPGbP241 (shown in italics);
- FIG. 2 shows the DNA sequence and translation into the amino acid sequence of the complete CPG-binding protein CPGbP656, the shortened CPG-binding peptides CPGbP241 (bold) and CPGbP181 (italics) being shown;
- Figure 3 depicts a PCR of streptococcal DNA in human blood
- Figure 4 shows a nested PCR with the PCR products from the primary PCR approach of Figure 3 as a template
- Figure 5 illustrates a gel eradication experiment
- FIG. 6 shows another gel retardation experiment
- Figure 7 shows the elution of calf thymus DNA and pUC18emm on rCpG-181 Sepharose
- FIG. 8 shows the determination of the determination of the eluted DNA in the fractions by measuring the absorbance at 254 nm as a function of the NaCl gradient.
- FIG. 10 shows results of the PCR after enrichment of prokaryotic DNA from a DNA mixture of Staphylococcus aureus and human DNA using coupled CpGbP-181 protein on AH-Sepharose.
- the wild-type CPGB protein CPGbP656 binds unmethylated CpG motifs of prokaryotic DNA, thereby forming a protein-DNA complex.
- This can, for example, be or be bound on a carrier, as a result of which the DNA can be separated and / or enriched.
- the present invention is now based on the surprising finding that a protein which is truncated in comparison to the wild-type CPGB protein (CPGbP656 with 656 amino acids) and which has a 25% to 35%, in particular approximately 27.6%, homology to the wild-type CPGB protein has an improved binding property over unmethylated CpG motifs of prokaryotic DNA than the wild-type CPGB protein and variants thereof with 80% or more homology.
- An example of such a truncated protein is CPGbP181 with 181 amino acids.
- Prokaryotic DNA differs from eukaryotic DNA, for example, in the presence of unmethylated CpG motifs (Deutsches ⁇ chtblatt, 98/15: A981-A985 (2001)).
- the invention is based on the knowledge that eukaryotic DNA and prokaryotic DNA differ in their proportion of CpG motifs.
- CpG motifs are in a 20-fold excess compared to eukaryotic DNA, which contains such motifs only temporarily, e.g. in cancer cells or promoter regions ((Deutsches ⁇ videblatt, vol. 98/15: A981-A985 (2001)).
- CpG motifs are unmethylated deoxycytidylate deoxyguanylate dinucleotides within the prokaryotic genome or within fragments thereof.
- the invention is based on the knowledge that the protein according to the invention binds specifically to unmethylated CpG motifs. This specific binding property of the protein according to the invention is used to bind prokaryotic DNA and thereby subsequently from a sample e.g. enrich, separate and isolate with a predominant part of eukaryotic DNA.
- DNA containing non-methylated CpG motifs refers to both eukaryotic and prokaryotic DNA. This can be purified and brought back into solution (for example, non-methylated DNA isolated from tissues) or directly in the source of origin (e.g. B. body fluid, such as blood, serum, tracheal aspirate, urine, bronchalveolar lavage, nasal swab, skin smear, puncture fluid) are present.
- body fluid such as blood, serum, tracheal aspirate, urine, bronchalveolar lavage, nasal swab, skin smear, puncture fluid
- the DNA containing non-methylated CpG motifs is prokaryotic DNA, in particular bacterial DNA.
- the term "homology" in the context of the present invention denotes the degree of agreement between two protein sequences. For example, 60% homology means that 60 out of 100 amino acid positions in the sequences match.
- the term “shortened” as used to characterize the protein of the invention means that the length of the amino acid sequence of the protein of the invention (e.g. CPGbP181) is shorter than the length of the amino acid sequence of the wild-type CPGB protein (CPGbP656). The shortening takes place at the N-terminal and at the C-terminal end of the wild-type protein sequence (FIG. 1). The maximum shortening represents the DNA binding site of the protein.
- the protein used according to the invention can, for. B. have a molecular weight of about 19959 daltons (native) or 21444 daltons (in plasmid pQE60).
- the isoelectric point of the protein according to the invention is approximately 10.09 (native protein) or 10.15 (in the plasmid pQE60).
- a particularly preferred protein used according to the invention has the protein shown in SEQ ID No. 2 and Fig. 1 shown amino acid sequence. This has particularly good binding properties against unmethylated CpG motifs of prokaryotic DNA.
- CPGbP241 described in EP 02020904, which is a shortened variant of the wild-type CPGB protein (CPGbP656) and was used as the basis for the protein used according to the invention (e.g. CPGbP181), has a length of 241 amino acids, a molecular weight of about 33650 daltons (native) and 28138 daltons (in plasmid pQE60) and an isoelectric point of 9.89 (native) and 9.88 (in plasmid pQE60).
- the cDNA and amino acid sequence is shown in Figures 1 and 2.
- the wild-type CGBP protein has a length of 656 amino acids, 135 positively and 94 negatively charged residues, a molecular weight of approximately 75684 daltons and an isoelectric point of 8.15.
- the cDNA and amino acid sequence is shown in Figure 1.
- FIGS. 1 and 2 The sequence comparison of the protein CPGbP181 used according to the invention in accordance with SEQ ID No. 2 with the protein described in EP 02020904 (CPGbP241) is shown in FIGS. 1 and 2.
- the protein used according to the invention is preferably produced by cloning the corresponding cDNA sequence into a plasmid and expression in Escherichia coli.
- An E.co// strain expressing the protein according to the invention was deposited on February 16, 2004 under the number DSM 16229 at the German Collection for Microorganisms and Cell Cultures. Alternatively, other manufacturing processes familiar to those skilled in the art can be used.
- the use of the plasmid pQE9 is an exemplary possibility, but any other suitable plasmid can be used as a vector. Expression in E. coli is also only an example.
- the protein can be produced both on a laboratory scale (eg in an Erlenmeyer flask) and on an industrial scale (eg a fermenter).
- the protein according to the invention can be purified, for example, by binding histidine residues (His-tag) introduced at the beginning or the end of the protein to a suitable nickel-containing matrix, a method which is known to the person skilled in the art.
- Further types of purification can be any kind of fusion proteins that allow purification via suitable matrices (columns, gels, beads, etc.).
- Other forms of tag's can include fusion peptides / proteins, e.g. Streptavidin-Tag, Myc-Tag and others.
- a preferred form of the protein used according to the invention is the native form, but a denatured form is also suitable for binding unmethylated CpG motifs. “Denatured forms” in the sense of the present invention are understood to mean secondary structures other than those occurring in nature.
- the native or denatured form of the protein used according to the invention represents an exemplary embodiment.
- the invention includes that in fro synthesis and all other chemical or enzymatic modification of the protein, such as e.g. Incorporation of disulfide bridges, glycosylations, phosphorylations, acylations, amino acid exchanges and fusion with proteins or other molecules.
- Such modifications can e.g. can be achieved by recombination and / or expression and / or chemical and / or enzymatic modification of individual or more amino acids.
- the protein used according to the invention has a number of advantages. It can bind prokaryotic DNA via unmethylated CpG motifs, better than the wild-type CPGB protein or variants thereof with 80% or more homology. This makes it possible to specifically separate and / or enrich the prokaryotic DNA from a mixture of prokaryotic and eukaryotic DNA. Ultimately, this enables quick and easy detection of pathogens and early diagnosis of infections that can be caused by bacterial pathogens. Vice versa, the invention can also be used for the depletion of microbial DNA in the sense of purification in clinical conditions which are associated with an unphysiological occurrence of bacteria or their fission products, body fluids, in particular blood, from patients.
- the subject of the invention is a method for the separation and / or enrichment of prokaryotic DNA with the steps a) contacting at least one prokaryotic DNA in solution with a specifically prokaryotic DNA-binding protein that has a 25% to 35% homology to the wild-type CG PB protein, whereby a protein-DNA complex is formed, and b) separation of the complex.
- the DNA can be purified and brought back into solution or directly in the source of origin (e.g. body fluid, such as blood, serum, tracheal aspirate, urine, bronchalveolar lavage, nasal swab, skin smear, puncture fluid).
- body fluid such as blood, serum, tracheal aspirate, urine, bronchalveolar lavage, nasal swab, skin smear, puncture fluid.
- the separation can be carried out by means of various methods for the separation, isolation or enrichment of DNA-protein complexes or DNA-polypeptide complexes, which are well known to the person skilled in the art. Methods are preferably used in which the DNA-binding protein is or is immobilized on a carrier in order to separate and / or enrich the DNA from the sample solution.
- the separation is followed by a step for separating the DNA from the protein according to the invention from the complex.
- a step for separating the DNA from the protein according to the invention from the complex can be done for example by conventional methods for DNA purification, which are known to the person skilled in the art.
- the separation is based on the change in the pH or the salt concentration (eg on 1 M NaCl) of the medium / buffer or the addition of chaotropic reagents, etc; So suitable parameters that lead to the dissolution of the protein-DNA complex. Such methods are known to the person skilled in the art.
- the protein according to the invention is bound to a carrier.
- This embodiment represents a particularly simple way of enriching prokaryotic DNA, since the separation from the solution can be carried out particularly easily, for example by physical removal (e.g. centrifugation) of the loaded carrier or carriers from the solution.
- any suitable solvent can be used for the solution for prokaryotic DNA.
- the method is particularly expedient for enriching prokaryotic DNA from solutions which contain different biomolecular species, in particular different types of DNA.
- the invention preferably relates to a method for separation and Enrichment of prokaryotic or viral DNA from a mixture of prokaryotic and eukaryotic DNA.
- the prokaryotic DNA in body fluids is separated from the eukaryotic DNA and enriched by specific binding to the protein according to the invention.
- the prokaryotic DNA enriched in this way facilitates the detection of prokaryotic pathogens with the help of molecular biological methods and can contribute to the diagnosis of diseases caused by pathogenic pathogens.
- the embodiment in which the DNA-binding protein according to the invention is immobilized on the surface of a support is suitable for adsorption of prokaryotic DNA from body fluids, preferably from the blood.
- body fluids e.g. whole blood, serum or cerebrospinal fluid
- the body fluid e.g. whole blood, serum or cerebrospinal fluid
- This principle can therefore be used for the depletion of prokaryotic DNA from physiological liquids in the sense of purification, the special binding properties of the protein according to the invention being used.
- the invention provides a method that increases the binding capacity and efficiency of the protein and thus an improved separation and / or enrichment of unmethylated DNA from a mixture of methylated DNA and unmethylated DNA.
- this is achieved by the indirect coupling of the protein to the matrix. This method is described below with reference to FIGS. 9 and 10.
- the subject of the invention is the indirect binding of the protein to the matrix via a spacer.
- the degree of mobility and the number of free binding sites of the CpGbP-181 protein are increased. This increases the binding capacity and efficiency. Furthermore, the amount of protein used can be reduced.
- spacers are understood to mean short chain-like molecules which have a spatial distance between the matrix and the protein used according to the invention, eg. B. CpGbP-181 protein.
- Such spacers are known to the person skilled in the art, e.g. B. from the Affinity chromatography or protein immobilization.
- Such chain-like molecules are made of C and H atoms and optionally heteroatoms, e.g. B. N, built. These chain-like molecules are made up of individual chain links based on the C atoms, e.g. B. CH 2 and any heteroatoms, e.g. B. NH built.
- the spacer has in particular 4 to 20, preferably 7 to 10, chain links.
- a particularly preferred spacer is derived from diamine hexane (NH 2 - (CH 2 ) 6 -NH 2 ). Antibodies are not to be regarded as spacers in the sense of the present invention.
- matrix is used to refer to substances which act as carriers for spacers and protein.
- Carrier materials can be, for example, Sepharose, pearl cellulose, silica or the like substances known to the person skilled in the art.
- Body fluids in the sense of the invention are understood to mean all fluids originating from the body of a mammal, including humans, in particular those in which pathogens can occur, such as, for. B. blood, urine, cerebrospinal fluid, pleural, pericardial, peritoneal and synovial fluid.
- pathogens such as, for. B. blood, urine, cerebrospinal fluid, pleural, pericardial, peritoneal and synovial fluid.
- the description of the invention relating to human blood is not a limitation but only an exemplary application.
- Bacterial pathogens are preferably understood to be pathogens of sepsis, but also all other bacterial pathogens of infections. They can differ from commensal pathogens, which are considered normal colonization of the organism and are occasionally also found in patient test samples, but have no clinical significance.
- the ratio of host DNA to pathogen DNA can often only be 1:10 ⁇ 6 to 1:10 "8 or even less.
- the method according to the invention enables prokaryotic DNA to be bound to the protein according to the invention is enriched by 1 potency unit and more.
- the protein used according to the invention can be coupled directly or indirectly to the carrier.
- the type of coupling depends on the carrier and the carrier material. Membranes, microparticles and resins or similar materials for affinity matrices are particularly suitable as carriers. Suitable materials for binding the protein according to the invention and - depending on the type of material - the implementation of the binding are well known to the person skilled in the art.
- For indirect coupling for example, specific antibodies against the protein according to the invention or the polypeptide are suitable, which in turn are bound to the carrier by known methods.
- One application of the method according to the invention is the enrichment of prokaryotic DNA.
- Another application is the separation of prokaryotic DNA from a mixture of eukaryotic and prokaryotic DNA by binding the prokaryotic DNA to the protein used according to the invention, which has been immobilized, for example, on a matrix.
- the mixture of the body's own and prokaryotic DNA is connected to the affinity matrix by means of suitable methods, and the prokaryotic DNA is bound to the immobilized protein according to the invention; the eukaryotic DNA, for example, passes through a separation column and can be collected separately.
- Affinity matrices can be, for example, polymeric polysaccharides, such as agaroses, other biopolymers, synthetic polymers, or supports with a silicate backbone, such as porous glasses or other solid or flexible supports, on which the DNA-binding protein used according to the invention is immobilized.
- the affinity matrix is rinsed with a suitable reagent, so that either the binding protein with the coupled prokaryotic DNA is separated from the matrix and / or the prokaryotic DNA is separated from the binding protein and is available in sufficient quantities for further work steps ,
- microparticles which allow immobilization of the DNA-binding protein according to the invention are possible.
- microparticles can consist of latex, plastic (e.g. styrofoam, polymer), metal or ferromagnetic substances.
- Fluorescent microparticles such as those offered by Luminex, for example, can also be used.
- the microparticles are separated from the substance mixture using suitable methods, such as filtration, centrifugation, precipitation, sorting by measuring the fluorescence intensity or magnetic methods. After separation from the microparticles, the prokaryotic DNA is available for further processing.
- Another application of the method according to the invention is to separate and enrich prokaryotic DNA from eukaryotic DNA by binding the prokaryotic DNA to the protein used according to the invention, which is then separated from other constituents of the mixture by electrophoresis.
- Another application of the method according to the invention consists in the separation and enrichment of prokaryotic DNA from eukaryotic DNA by binding the prokaryotic DNA to the protein used according to the invention, the protein according to the invention then being bound to corresponding antibodies.
- the antibodies can be attached to solid or flexible substrates, e.g. B. glass, plastics, silicon, microparticles, membranes, or are in solution.
- the method according to the invention can also be used to purify body fluids from prokaryotic DNA. It is expedient that the separation is carried out extracorporeally under sterile conditions so that the body fluids can be returned to the body, so that the body's immune system is supported in eliminating infections by removing the prokaryotic DNA located in the body fluids.
- the protein used according to the invention can also be used for the detection of prokaryotic DNA. After the enrichment of the prokaryotic DNA, a step for the amplification of the prokaryotic DNA follows, for which all common amplification methods are suitable (PCR, LCR, LM-PCR etc.).
- the method according to the invention in particular with the embodiments described above, has the advantage that specific binding of unmethylated CpG-motif-rich prokaryotic DNA to proteins with specific affinity for such structures enables concentration of prokaryotic DNA from the total DNA of an infected host and so that the detection sensitivity for methods for the detection of pathogen DNA in body fluids is greatly increased.
- prokaryotic DNA from eukaryotic DNA with a specifically binding protein
- the subsequent DNA detection can be carried out via a PCR reaction.
- a nested PCR will not be necessary in most cases, so that considerable time savings in diagnostics will be possible.
- the protein used according to the invention is used to deplete prokaryotic DNA in physiological body fluids. Depletion in the sense of the present invention means that the amount of prokaryotic DNA is reduced. This possibility of reducing the prokaryotic DNA also makes it possible to use the proteins according to the invention in environmental technology, sewage management and air conditioning technology
- the invention also relates to a method for separating and enriching unmethylated genomic DNA from a mixture of unmethylated genomic and methylated genomic DNA.
- the methylated genomic DNA is separated by the binding of the non-methylated genomic DNA to the CpGbP-181 protein coupled to a matrix. This procedure contributes significantly to the simplified investigation of the methylation pattern of methylated genomic DNA and enables the diagnosis of diseases that have a specific methylation pattern.
- the invention also relates to a kit for enriching prokaryotic DNA by means of one of the methods described above, in which at least the protein according to the invention is optionally present together with other suitable reagents for carrying out the method.
- the kit can contain at least one set of primers which are suitable for the amplification of genomic DNA of certain prokaryotes under standard conditions.
- Primers 1 (GGATCCGGTGGAGGGCGCAAGAGGCCTG -fw SEQ ID No. 3) and 2 (AAGCTTAGAGGTAGGTCCTCAT-CTGAG-rv SEQ-ID No. 4), which amplify a shortened DNA fragment, were constructed from the DNA sequence for the complete CPGbP protein encodes a truncated CPG-binding protein, CPGbP181. After cleavage with the restriction enzymes BamHI and Hind III, the DNA fragment was ligated into the vector pQE9 (Qiagen).
- pQE9 an open reading frame is created in which a DNA fragment coding for 6 x His tag is fused to the 5 'end (pQE9 [6HisCPGbP181]).
- the complete amino acid sequence of the coding Fusion protein 6His-CPGbP181 is shown below, the bold section representing the peptide CPGbP181 and the bold sections indicating fused foreign amino acids from plasmid pQE9.
- the plasmid pQE9 [6HisCPGbP181] was described in £. coli expression strain M15 [pREP4] (Qiagen) transformed.
- the clone is hereinafter referred to as M15 [pCPGbP181] and the expressed protein rCPGbP181.
- the expression of the protein rCPGbP181 was carried out according to the following protocol: A colony of the expression strain M15 [pCPGbP181] is grown in 2 ml of Luria medium with 100 ⁇ g / ml ampicillin and 25 ⁇ g / ml kanamycin at 37 ° C. with shaking overnight.
- the preculture is then transferred to 200 ml of prewarmed nutrient medium containing the same antibiotic concentrations. After 3 hours of growth at 37 ° C. with shaking, IPTG is added to induce expression and incubated for a further 5 hours.
- the bacteria are then centrifuged off and the sediment is resuspended in 5 ml of 0.2 M Tris buffer, pH 7.5.
- the bacteria are treated with ultrasound in an ice bath for 5 x 1 min. After centrifugation, the sediment is resuspended in 10 ml 0.2 M Tris, 2M urea, pH 7.5 and shaken for 15 min.
- rCPGbP181 can be obtained in different ways: 1. As a denatured protein dissolved in 6M guanidine hydrochloride or 6 M urea and 2. As a native protein soluble in buffers of physiological concentration. In the second case, the yield is lower.
- the protein rCPGbP181 is eluted from the Ni-NTA agarose with an imidazole gradient of 0-0.5 M M in the buffer 0.2 M Tris, 6M guanidine hydrochloride, 0.001 M dithioeritrite (DTE), 0.02 M imidazole, pH7 .5 as a basis. Thereby rCPGbP181 is detached from the column at 0.2 - 0.3 M imidazole. The protein obtained in this way is dialyzed against 0.2 M Tris, 6M urea, 0.001 M dithioeritrite (DTE), pH7.5 and frozen. In the case of dialysis against physiological buffers, purified rCPGbP181 fails.
- the guanidine hydrochloride concentration of 6 molar on the Ni-NTA agarose with the bound rCPGbP181 is brought to a 0 molar guanidine hydrochloride via a gradient.
- the basis is the buffer 0.2 M Tris, 0.5 M NaCI, 0.001 M dithioeritrite (DTE), 0.02 M imidazole, pH7.5.
- DTE dithioeritrite
- An imidazole gradient of 0 to 0.5 molar was then applied for elution in buffer 0.2 M Tris, 0.5 M NaCl, 0.001 M dithioeritrite (DTE), pH 7.5 as a basis.
- the DNA is isolated by means of absorption on a DNA-binding matrix using commercial kits for isolating total DNA from body fluids in accordance with a modified manufacturer's specification.
- 100 ⁇ l of infected blood in Eppendorf tubes are mixed with 200 ⁇ l of the totalisis buffer, which contains proteinase K and SDS. The mixture is incubated at 37 ° C for 30 minutes and then heated to 95 ° C for 20 minutes.
- mutanolysin After cooling, 20 ⁇ g mutanolysin are added and incubated at 37 ° C. for a further 60 min. After centrifugation, the mixture is applied to the centrifugation columns with a DNA-binding matrix and the DNA is purified according to the manufacturer's instructions. The purified DNA is taken up in a final volume of 100 ⁇ l of 0.01 molar Tris buffer, pH 7.5 or in the same amount of elution buffer from the manufacturer. For the detection of pathogens, primers for the identification of the streptolysin O gene (slo) were constructed. 1. PCR. Amplification of a 465 bp fragment
- Forward primer 1 5'-AGCATACAAGCAAATTTTTTACACCG
- Reverse primer 2 5'- GTTCTGTTATTGACACCCGCAATT primer concentration 1 mg / ml batch: 5 ⁇ l DNA isolate 0.5 ⁇ l primer fw 1 0.5 ⁇ l primer rv 2 14 ⁇ l aqua dest total 25 ⁇ l in ready to go Kit (Amersham Pharmacia) Reaction:
- Cycles 40 (30 sec. 95 ° C, 30 sec 51 ° C, 3 min 72 ° C, 1 x 7 min 72 ° C)
- FIG. 1 shows PCR of streptococcal DNA in human blood (10 ⁇ l of the 25 ⁇ l mixture separated: 1) PCR mixture with 5 ⁇ l template DNA; 2) Mix with 5 ⁇ l template, diluted 1:10. 3) Positive control: 0.2 ⁇ l streptococcal DNA as template without the presence of eukaryotic DNA from blood. ST) molecular weight standard)
- Cycles 40 (30 sec. 95 ° C, 30 sec 54 ° C, 3 min 72 ° C, 1 x 7 min 72 ° C)
- FIG. 4 shows the nested PCR with the PCR products from the primary PCR approach in FIG. 3 as a template. The samples correspond to those from FIG. 3.
- the desired slo-DNA fragment is amplified at a concentration of 100 streptococcal cells per 100 ⁇ l blood (sample 1).
- a concentration of 100 streptococcal cells per 100 ⁇ l blood (sample 1).
- pathogen-specific nucleic acid detections without an amplification step by direct detection of the bacterial DNA are also too insensitive, which is mainly due to the large excess of human DNA compared to bacterial DNA.
- Competitive processes in DNA analysis and the small amount of bacterial DNA can also be seen as a hindrance to qualitative and quantitative analysis.
- the usual methods for DNA isolation accumulate the total DNA of a body fluid, so that the ratio of host DNA to microbial DNA can be between 1:10 "5 and 1:10 " 8 . From this difference, the difficulty of detecting microbial DNA in body fluids is easy to understand.
- E. coli plasmid pUC18 was used as the test DNA with an inserted M protein segment from Streptococcus dysgalactiae supsp. equisimilis (Geyer et. al. FEMS Immunol. Med. Microbiol. 26: 11-24, 1999).
- the plasmid preparation was split and half was methylated with the New England BioLabs CpG methylase kit.
- Lane 1 shows that unmethylated pUCI ⁇ emm interacts with rCPGbp181, but no interaction showed rCPGbP181 with methylated pUCI ⁇ emm (Lanel).
- Lanes 4 and 5 are the plasmids without the addition of rCPGbP181 as controls.
- Example 4 Binding and separation of a mixture of calf thymus DNA and bacterial DNA to immobilized CPGbp1 ⁇ 1.
- Purified CPGbp181 was coupled to aminohexyl-Sepharose (Amersham-Biosciences) using glutaraldehyde according to the instructions of Cambiasso et al. (Cambiasso, C. et al., Immunochemistry 12: 273-278, 1975).
- the immobilized protein concentration was 0.3 mg per milliliter of Sepharose.
- 300 ⁇ l of Sepharose was placed in a spin filter tube with an inner frit material that does not absorb DNA or protein, but does not retain the Sepharose.
- FIG. 7, ⁇ shows that the eukaryotic calf thymus DNA is initially washed between 0 and 0.1 M NaCl from the column, while the prokaryotic DNA (pUCI ⁇ emm) was eluted in the fraction at 0.3 M NaCl. This shows that eukaryotic DNA has a lower affinity for CPGbP181 and thus a clear separation of the two DNA fractions was achieved.
- Example 5 Increase in the binding properties of the CpG-bP-1 ⁇ 1 protein which result from the indirect binding of this protein via a spacer to a matrix.
- prokaryotic DNA from a DNA mixture of Staphylococcus aureus and human DNA was used using the directly coupled CpGbP-181 protein on CNBr-Sepharose or using the CpGbP-181 coupled indirectly via a diaminohexyl spacer (AH).
- AH diaminohexyl spacer
- the AH-Sepharose was first incubated for 15 minutes at room temperature after the addition of glutaraldehyde. The AH-Sepharose was then washed with 0.1 molar Na2HP04. Now 0.24 mg of the CpGbP-181 protein was added to the matrix. The binding of the CpGbP-181 protein to the AH Sepharose was achieved by incubation for 2 hours at room temperature. The excess CpGbP-181 protein was removed.
- the CpGbP-1 ⁇ 1-AH-Sepharose was incubated for 2 hours at room temperature to saturate free binding sites. The CpGbP-1 ⁇ 1-AH-Sepharose was then washed again with 0.1 molar Na 2 HP0 4 . To reduce the Schiff base and stabilize the binding, the CpGbP-1 ⁇ 1-AH-Sepharose was mixed with sodium borohydride and incubated for 1 hour at room temperature.
- the CpGbP-1 ⁇ 1-AH Sepharose was then washed with 0.1 molar Na 2 HP0 4 .
- the shelf life of the CpGbP-1 ⁇ 1-AH-Sepharose at 4 ° C is achieved by adding 20% ethanol.
- the CpGbP-1 ⁇ 1-AH Sepharose was then portioned into columns.
- the columns prepared with the CpGbP-1 ⁇ 1-AH-Sepharose were then washed with TRIS buffer and were available for the separation / enrichment of non-methylated CpG motifs containing DNA.
- the DNA mixture consisted of 330 ng human DNA and 150 ng prokaryotic DNA (Staphylococcus aureus DNA). The DNA mixtures were placed on the columns prepared with CNBr-Sepharose or with AH-Sepharose and incubated for 1 minute at room temperature. The columns were then centrifuged and washed with 100 ⁇ l TRIS buffer (10 ⁇ M, pH 7). The washing and centrifugation step was repeated 5 times.
- FIG. 9 direct binding of the CpG-131 protein to CNBr-Sepharose
- FIG. 10 indirect binding of the CpG-1 ⁇ 1 protein via a spacer (AH) to sepahrose
- AH spacer
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Crystallography & Structural Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ES05715667T ES2384571T3 (es) | 2004-03-05 | 2005-03-02 | Procedimiento para el enriquecimiento y/o la separación de ADN procariota mediante una proteína que se une específicamente a ADN que contiene motivos CpG no metilados |
| EP05715667A EP1723233B1 (de) | 2004-03-05 | 2005-03-02 | Verfahren zur anreicherung und/oder abtrennung von prokaryotischer dna mittels eines proteins, das nicht-methylierte cpg-motive enthaltende dna spezifisch bindet |
| CA2558515A CA2558515C (en) | 2004-03-05 | 2005-03-02 | Method of enriching and/or separating prokaryotic dna by means of a protein which specifically binds dna containing non-methylated cpg motifs |
| DK05715667.1T DK1723233T3 (da) | 2004-03-05 | 2005-03-02 | Fremgangsmåde til berigelse og/eller adskillelse prokaryotisk DNA ved hjælp af et protein, som specifikt binder DNA indeholdende ikke-methylerede CPG-motiver |
| US10/591,633 US8481262B2 (en) | 2004-03-05 | 2005-03-02 | Method for enriching and/or separating prokaryotic DNA using a protein that specifically bonds to unmethylated DNA containing CpG-motifs |
| AT05715667T ATE554167T1 (de) | 2004-03-05 | 2005-03-02 | Verfahren zur anreicherung und/oder abtrennung von prokaryotischer dna mittels eines proteins, das nicht-methylierte cpg-motive enthaltende dna spezifisch bindet |
| JP2007501210A JP4848358B2 (ja) | 2004-03-05 | 2005-03-02 | 非メチル化CpGモチーフを含むDNAに特異的に結合するタンパク質を用いて原核生物DNAの濃縮または分離のうち少なくともいずれか一方を行う方法 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE200410010928 DE102004010928B4 (de) | 2004-03-05 | 2004-03-05 | Protein zur Bindung prokaryonter DNA sowie Verfahren zur Trennung und Anreicherung prokaryonter DNA |
| DE102004010928.1 | 2004-03-05 | ||
| DE102005001889.0 | 2005-01-14 | ||
| DE200510001889 DE102005001889B4 (de) | 2005-01-14 | 2005-01-14 | Verfahren zur Steigerung der Bindungskapazität und -effizienz eines Proteins, das nicht methylierte CPG-Motive enthaltende DNA spezifisch bindet |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2005085440A1 true WO2005085440A1 (de) | 2005-09-15 |
| WO2005085440A8 WO2005085440A8 (de) | 2005-12-15 |
Family
ID=34921210
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2005/002198 Ceased WO2005085440A1 (de) | 2004-03-05 | 2005-03-02 | VERFAHREN ZUR ANREICHERUNG UND/ODER ABTRENNUNG VON PROKARYONTER DNA MITTELS EINES PROTEINS, DAS NICHT-METHYLIERTE CpG-MOTIVE ENTHALTENDE DNA SPEZIFISCH BINDET |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US8481262B2 (https=) |
| EP (1) | EP1723233B1 (https=) |
| JP (1) | JP4848358B2 (https=) |
| AT (1) | ATE554167T1 (https=) |
| CA (1) | CA2558515C (https=) |
| DK (1) | DK1723233T3 (https=) |
| ES (1) | ES2384571T3 (https=) |
| WO (1) | WO2005085440A1 (https=) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006133758A3 (de) * | 2005-06-16 | 2007-03-01 | Sirs Lab Gmbh | Vorrichtung zur anreicherung/abtrennung von nicht-methylierte cpg-motive enthaltender dna |
| DE102007041864A1 (de) | 2007-09-04 | 2009-03-05 | Sirs-Lab Gmbh | Verfahren zum Nachweis von Bakterien und Pilzen |
| WO2011124653A1 (de) * | 2010-04-08 | 2011-10-13 | Greiner Bio - One Gmbh | Verfahren und kit zur trennung viraler und prokaryontischer von eukaryontischen nukleinsäuren |
| JP2014000098A (ja) * | 2007-09-11 | 2014-01-09 | Kaneka Corp | 核酸検出方法、および核酸検出キット |
| DE102012021146A1 (de) | 2012-10-25 | 2014-05-15 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Methode zur spezifischen Isolation von Nukleinsäuren |
| WO2020216966A1 (en) * | 2019-04-26 | 2020-10-29 | Thermo Fisher Scientific Baltics Uab | Isolated nucleic acid binding domains |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK1400589T3 (da) | 2002-09-18 | 2006-11-27 | Sirs Lab Gmbh | Fremgangsmåde til påvisning af prokaryotisk DNA |
| JP5246726B2 (ja) | 2006-10-05 | 2013-07-24 | 株式会社ジャパンディスプレイウェスト | シフトレジスタ回路および表示装置 |
| US20090137024A1 (en) * | 2007-11-28 | 2009-05-28 | Canon U.S. Life Sciences, Inc. | Method of Separating Target DNA from Mixed DNA |
| DE102012219142B4 (de) * | 2012-10-19 | 2016-02-25 | Analytik Jena Ag | Verfahren zum Trennen, Erfassen oder Anreichern von unterschiedlichen DNA-Spezies |
| WO2016034405A1 (en) | 2014-09-03 | 2016-03-10 | Siemens Aktiengesellschaft | A process for separation of prokaryotic dna from eukaryotic dna in a whole blood sample |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1400589A1 (de) * | 2002-09-18 | 2004-03-24 | SIRS-Lab GmbH | Verfahren zur Anreicherung prokaryontischer DNA |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6239116B1 (en) * | 1994-07-15 | 2001-05-29 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
| WO1997005484A1 (en) * | 1995-07-28 | 1997-02-13 | Beth Israel Deaconess Medical Center, Inc. | A method of and test kit for mutagenesis testing |
| EP1248798A2 (en) * | 1999-08-18 | 2002-10-16 | Fraunhofer-Gesellschaft Zur Förderung Der Angewandten Forschung E.V. | Human dna sequences |
| JP2002034565A (ja) * | 2000-07-19 | 2002-02-05 | Japan Science & Technology Corp | 細菌dnaを特異的に認識する受容体タンパク質 |
| SE0201257D0 (sv) * | 2002-04-25 | 2002-04-25 | Medical Invest In Sweden Ab | Improved Separation |
| GB0215228D0 (en) * | 2002-07-01 | 2002-08-14 | Inpharmatica Ltd | Protein |
| GB0423991D0 (en) * | 2004-10-29 | 2004-12-01 | Univ Edinburgh | Applications of nucleic acid fragments |
-
2005
- 2005-03-02 ES ES05715667T patent/ES2384571T3/es not_active Expired - Lifetime
- 2005-03-02 EP EP05715667A patent/EP1723233B1/de not_active Expired - Lifetime
- 2005-03-02 JP JP2007501210A patent/JP4848358B2/ja not_active Expired - Fee Related
- 2005-03-02 WO PCT/EP2005/002198 patent/WO2005085440A1/de not_active Ceased
- 2005-03-02 CA CA2558515A patent/CA2558515C/en not_active Expired - Fee Related
- 2005-03-02 DK DK05715667.1T patent/DK1723233T3/da active
- 2005-03-02 US US10/591,633 patent/US8481262B2/en not_active Expired - Fee Related
- 2005-03-02 AT AT05715667T patent/ATE554167T1/de active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1400589A1 (de) * | 2002-09-18 | 2004-03-24 | SIRS-Lab GmbH | Verfahren zur Anreicherung prokaryontischer DNA |
Non-Patent Citations (3)
| Title |
|---|
| CROSS S H ET AL: "Purification of CpG islands using a methylated DNA binding column", NATURE GENETICS, NEW YORK, NY, US, vol. 6, no. 3, 1 March 1994 (1994-03-01), pages 236 - 244, XP000578157, ISSN: 1061-4036 * |
| SACHSE S ET AL: "Using a DNA-binding protein to enrich prokaryotic DNA from a mixture of both eukaryotic and prokaryotic DNA", 56. DGHM-JAHRESTAGUNG, 26.-29.SEPTEMBER 2004, MÜNSTER, DE, 2004, XP002332325, Retrieved from the Internet <URL:http://www.sirs-lab.de/content/de/pdf/kompetenzen/sachse.pdf> [retrieved on 20050616] * |
| VOO K S ET AL: "Cloning of a mammalian transcriptional activator that binds unmethylated CpG motifs and shares a CXXC domain with DNA methyltransferase, human trithorax, and methyl-CpG binding domain protein 1", MOLECULAR AND CELLULAR BIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, WASHINGTON, US, vol. 20, no. 6, March 2000 (2000-03-01), pages 2108 - 2121, XP002262527, ISSN: 0270-7306 * |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006133758A3 (de) * | 2005-06-16 | 2007-03-01 | Sirs Lab Gmbh | Vorrichtung zur anreicherung/abtrennung von nicht-methylierte cpg-motive enthaltender dna |
| DE102007041864A1 (de) | 2007-09-04 | 2009-03-05 | Sirs-Lab Gmbh | Verfahren zum Nachweis von Bakterien und Pilzen |
| EP2188397A1 (de) * | 2007-09-04 | 2010-05-26 | SIRS-Lab GmbH | Verfahren zum nachweis von bakterien und pilzen |
| JP2010537650A (ja) * | 2007-09-04 | 2010-12-09 | エスアイアールエス‐ラブ ゲーエムベーハー | 細菌及び真菌の検出方法 |
| DE102007041864B4 (de) * | 2007-09-04 | 2012-05-03 | Sirs-Lab Gmbh | Verfahren zum Nachweis von Bakterien und Pilzen |
| JP2014000098A (ja) * | 2007-09-11 | 2014-01-09 | Kaneka Corp | 核酸検出方法、および核酸検出キット |
| US9063130B2 (en) | 2007-09-11 | 2015-06-23 | Kaneka Corporation | Nucleic acid detection method and nucleic acid detection kit |
| WO2011124653A1 (de) * | 2010-04-08 | 2011-10-13 | Greiner Bio - One Gmbh | Verfahren und kit zur trennung viraler und prokaryontischer von eukaryontischen nukleinsäuren |
| US8993306B2 (en) | 2010-04-08 | 2015-03-31 | Greiner Bio-One Gmbh | Method and kit for separating viral and prokaryotic nucleic acids from eukaryotic nucleic acids |
| DE102012021146A1 (de) | 2012-10-25 | 2014-05-15 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Methode zur spezifischen Isolation von Nukleinsäuren |
| WO2020216966A1 (en) * | 2019-04-26 | 2020-10-29 | Thermo Fisher Scientific Baltics Uab | Isolated nucleic acid binding domains |
| US12612615B2 (en) | 2019-04-26 | 2026-04-28 | Thermo Fisher Scientific Baltics, UAB | Isolated nucleic acid binding domains |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2005085440A8 (de) | 2005-12-15 |
| JP4848358B2 (ja) | 2011-12-28 |
| US20080003568A1 (en) | 2008-01-03 |
| CA2558515C (en) | 2013-12-03 |
| JP2007525982A (ja) | 2007-09-13 |
| ATE554167T1 (de) | 2012-05-15 |
| US8481262B2 (en) | 2013-07-09 |
| EP1723233A1 (de) | 2006-11-22 |
| CA2558515A1 (en) | 2005-09-15 |
| ES2384571T3 (es) | 2012-07-09 |
| DK1723233T3 (da) | 2012-07-23 |
| EP1723233B1 (de) | 2012-04-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DE69802191T2 (de) | Festphase nukleinsäure-isolierung | |
| DE3787445T2 (de) | Verfahren zur Isolierung von langkettiger Nukleinsäure. | |
| EP0743949B1 (de) | Verfahren zur herstellung endotoxinfreier oder an endotoxin abgereicherter nucleinsäuren und/oder oligonucleotide für die gentherapie | |
| DE69031237T2 (de) | Verfahren zur Reinigung von Nukleinsäuren | |
| DE3546806C2 (https=) | ||
| DE69936584T2 (de) | Schnelles und einfaches verfahren zur isolierung von zirkulären nukleinsäuren | |
| WO1995034569A1 (de) | Universelles verfahren zur isolierung und reinigung von nukleinsäuren aus extrem geringen mengen sowie sehr stark verunreinigten unterschiedlichsten ausgangsmaterialien | |
| DE19648625A1 (de) | Mikroprojektil für das Einbringen von Substanzen in Zellen durch ballistischen Transfer | |
| US11814618B2 (en) | Methods for co-isolation of nucleic acids and proteins | |
| WO2011061274A1 (de) | Verfahren zur selektiven anreicherung und isolierung mikrobieller und optional zusätzlich viraler nukleinsäuren | |
| EP1723233B1 (de) | Verfahren zur anreicherung und/oder abtrennung von prokaryotischer dna mittels eines proteins, das nicht-methylierte cpg-motive enthaltende dna spezifisch bindet | |
| CN111448315B (zh) | 一种Cas蛋白体系分离DNA的方法 | |
| WO2006084753A1 (de) | Verfahren zur isolierung von nukleinsäuren, wobei die nukleinsäuren bei erhöhter temperatur an einer matrix immobilisiert werden | |
| EP1560926B1 (de) | Neuartige pufferformulierungen zur isolierung, reinigung und rückgewinnung lang- und kurzkettiger nukleinsäuren | |
| EP3198011B1 (de) | Verfahren zum nachweis von nukleinsäuren in proben mit biologischem material | |
| EP1400589B1 (de) | Verfahren zum Nachweis prokaryontischer DNA | |
| EP3228710B1 (de) | Aufreinigung von nukleinsäure aus einer nukleinsäure und endotoxin enthaltenden probe | |
| DE102004010928B4 (de) | Protein zur Bindung prokaryonter DNA sowie Verfahren zur Trennung und Anreicherung prokaryonter DNA | |
| DE69105811T2 (de) | Verfahren zur Extraktion von bestimmten Nukleinsäurefragmenten. | |
| DE10033991A1 (de) | Verfahren zur Isolierung von Nukleinsäuren | |
| WO2006133758A2 (de) | Vorrichtung zur anreicherung/abtrennung von nicht-methylierte cpg-motive enthaltender dna | |
| DE102005001889B4 (de) | Verfahren zur Steigerung der Bindungskapazität und -effizienz eines Proteins, das nicht methylierte CPG-Motive enthaltende DNA spezifisch bindet | |
| DE102006019650A1 (de) | Formulierungen und Verfahren zur Isolierung von Nukleinsäuren aus beliebigen komplexen Ausgangsmaterialien und nachfolgende komplexe Genanalytik | |
| WO2002024904A2 (de) | Verfahren zur herstellung von ribonukleinsäure (rns) | |
| EP2912190A1 (de) | Methode zur spezifischen isolation von nukleinsäuren |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WR | Later publication of a revised version of an international search report | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2005715667 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2558515 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007501210 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005715667 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10591633 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 10591633 Country of ref document: US |