WO2005081714A2 - Use of interfering rna in the production of transgenic animals - Google Patents

Use of interfering rna in the production of transgenic animals Download PDF

Info

Publication number
WO2005081714A2
WO2005081714A2 PCT/US2004/039191 US2004039191W WO2005081714A2 WO 2005081714 A2 WO2005081714 A2 WO 2005081714A2 US 2004039191 W US2004039191 W US 2004039191W WO 2005081714 A2 WO2005081714 A2 WO 2005081714A2
Authority
WO
WIPO (PCT)
Prior art keywords
gene
cell
sequence
irna
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2004/039191
Other languages
English (en)
French (fr)
Other versions
WO2005081714A3 (en
Inventor
Kevin Wells
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Revivicor Inc
Original Assignee
Revivicor Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Revivicor Inc filed Critical Revivicor Inc
Priority to AU2004316293A priority Critical patent/AU2004316293A1/en
Priority to NZ547388A priority patent/NZ547388A/en
Priority to JP2006541617A priority patent/JP2007512027A/ja
Priority to EP04821501A priority patent/EP1734811A4/en
Priority to CA2546853A priority patent/CA2546853C/en
Publication of WO2005081714A2 publication Critical patent/WO2005081714A2/en
Anticipated expiration legal-status Critical
Publication of WO2005081714A3 publication Critical patent/WO2005081714A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • A01K2217/054Animals comprising random inserted nucleic acids (transgenic) inducing loss of function
    • A01K2217/058Animals comprising random inserted nucleic acids (transgenic) inducing loss of function due to expression of inhibitory nucleic acid, e.g. siRNA, antisense
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/108Swine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/02Animal zootechnically ameliorated
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/02Animal zootechnically ameliorated
    • A01K2267/025Animal producing cells or organs for transplantation
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/12Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/60Vectors containing traps for, e.g. exons, promoters
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00Vectors comprising a special translation-regulating system
    • C12N2840/44Vectors comprising a special translation-regulating system being a specific part of the splice mechanism, e.g. donor, acceptor

Definitions

  • the invention provides cells and animals, as well as methods of producing cells and animals, that express at least one interfering RNA molecule to regulate the expression of a specific gene or family of genes.
  • the invention further provides novel iRNA molecules, as well as DNA templates for producing iRNA molecules.
  • Cells in which the genes of interest are disrupted can be confirmed using, for example, a selection marker inserted into the genome, or by functionally testing for the gene of interest.
  • a heterozygous animal can be produced by cloning via somatic cell nuclear transfer or production of offspring from embryonic stem cells. The heterozygous animal can then sometimes be bred to produce homozygous animals in which the desired gene disruption is present in each allele so that the full gene complement is rendered non-functional.
  • the heterozygous animal can also be subject to further genetic targeting or mutagenesis. (Shastry et al. Mol. Cellul Biochem. 136:171-182 (1994) and Galli- Taliadoros et al. (1995) J.
  • RNA interference was originally described in the model organism C. elegans (Fire et al., Nature 391:806-811 (1998); U.S. Patent No. 6,506,559 to Fire et al). Genetic and biochemical data, primarily arising from studies in lower eukaryotes, indicate possible mechanisms for RNA interference.
  • RNA molecules mediate a posttranscriptional gene-silencing mechanism that regulates the expression of developmental genes by inhibiting the translation of target mRNAs.
  • This mechanism is common to plants, fungi, and animals, and the generation of these microRNAs (miRNAs, also known as small inhibitory RNAs or siRNAs) involves a series of sequential steps, where primary RNA transcripts (pri-miRNAs) are cleaved in the nucleus to smaller pre-miRNAs.
  • RNase III such as Drosha, is a nuclease that executes the initiation step of miRNA processing in the nucleus (Lee et al (25 September 2003) Nature 425, 415-419).
  • Drosha cleaves pri-miRNA to release pre-miRNA. These are transported to the cytosol where Dicer, a member of the RNAse III nuclease family, further processes them to yield mature miRNAs from the pre-miRNAs.
  • MiRNAs associate with multicomponent ribonucleoprotein complexes, or RISCs, which effect the silencing of the target mRNA molecules (Holding, C. "Modeling miRNA mechanisms", The Scientist, September 25, 2003).
  • RISC binds to only one strand of the double stranded miRNA molecule. The other strand is degraded by the cell.
  • RNA interference is the only practical method of generating targeted knockout (KO) genotypes.
  • RNA interference technology did not appear to be applicable to mammalian systems.
  • dsRNA activates dsRNA-activated protein kinase (PKR), resulting in an apoptotic cascade and cell death (Der et al (1997) Proc Natl Acad Sci U S A. Apr l;94(7):3279-83.).
  • PSR protein kinase
  • RNA interference appeared to be limited to genetic modulation of lower eukaryotes.
  • Elbashir and colleagues in 2001 discovered that PKR activation requires dsRNA longer than about 30 base pairs.
  • RNA sequences can be introduced into a mammalian cell without initiating an apoptotic cascade.
  • siRNA sequences of 21-23 base pairs were known to be effective in limiting gene expression. Therefore, by providing these sequences in isolation, it became possible to target reduced gene expression while circumventing the cell's natural defense mechanism (Elbashir et al., (2001) Nature 411:494-498).
  • Elbashir et al. (2001) Nature 411:494-498.
  • a range of siRNA molecules all less than 30 base pairs long, had been demonstrated to effectively reduce gene expression in mammalian cells (Caplen et al. (2001) Proc Natl Acad Sci 98(17): 9742-9747).
  • RNA is a double-stranded molecule with a first strand consisting essentially of a ribonucleotide sequence which corresponds to a nucleotide sequence of the target gene and a second strand consisting essentially of a ribonucleotide sequence which is complementary to the nucleotide sequence of the target gene, wherein the first and the second ribonucleotide strands are separate complementary strands that hybridize to each other to form said double-stranded molecule, and the double-stranded molecule inhibits expression of the target gene.
  • PCT Publication No. WO 03/012052 by Caplen et al. discloses small synthetic double stranded RNA molecules, fifteen to forty nucleotides in length, with a 3' or 5' overhang of about 0-5 nucleotides on each strand, wherein the sequence of the double stranded RNA is substantially identical to a portion of mRNA or transcript of the target gene.
  • This publication also discloses arrays of siRNA that can be used to test the effects of gene 'silencing' on cell function.
  • U.S. Publication No. 2003/0166282 by Brown et al. discloses high potency siRNA molecules.
  • This publication describes methods of synthesis, such as enzymatic, of siRNA molecules, as well as the use of modified nucleotide analogs in the siRNA molecule.
  • the delivery of small, double stranded RNA molecules into cells is not amenable to in vivo use, in part due to inefficiency and uncertainty of the delivery of the molecules and also because it results in only transient expression of the iRNA.
  • the next advance in iRNA technology was the production of iRNA molecules inside the cell from DNA templates to obtain stable expression of the iRNA molecule in a cell.
  • the structural gene sequence is described as a nucleotide sequence which is substantially identical to at least a region of the target gene, and wherein at least two copies of the structural gene sequence are placed operably under the control of a single promoter sequence such that at least one copy of the structural gene sequence is placed operably in the sense orientation under the control of the promoter sequence.
  • Brummelkamp et al. (Science (2002) 296: 550-553) reported a stable vector system for expressing siRNA in mammalian cells.
  • the vector contained an RNA polymerase III HI promoter, followed by a siRNA sequence and a poly-T tail (pSUPER).
  • the siRNA contained a sense strand, a loop sequence of five, seven or nine nucleotides and an antisense sequence.
  • Brummerlkamp et al (Cancer Cell (published online August 22, 2002) reported the use of a retroviral to express siRNA (pRETRO-SUPER).
  • PCT Publication WO 03/006477 by the University of Massachusetts discloses RNA hairpins structures that provide increased stability to the dsRNA.
  • the hairpins made of a stem complementary to a target and a second stem complementary to it and a loop portion connecting the two, are putatively cleaved inside the cell to provide a duplexed mRNA.
  • dsRNA molecules are substrates for the Dicer enzyme, as described above.
  • the publication also discloses expression constructs containing DNA encoding such siRNA molecules under the control of exogenous promoters, such as Pol II or PolIII.
  • U.S. Publication No. 2003/0108923 by Tuschl et al describes isolated RNA from about 21 to about 23 nucleotides in length that mediates RNA interference of an mRNA- to which it corresponds, as well as isolated DNA encoding the same.
  • WO 03/023015 by the California Institute of Technology discloses a method of expressing an siRNA in a cell using a retroviral vector system. Further, this publication indicates that siRNA expression may be useful for the treatment or prevention of infection by inhibiting aspects of the life cycle of a pathogen through interference with a target nucleic acid in a viral genome or a host cell gene that is necessary for viral replication. This publication is drawn specifically to the treatment of human viral infections.
  • the constructs disclosed include at least one RNA Pol III promoter, a RNA sense region, a RNA antisense region and a loop region separating the sense and antisense regions in different orientations.
  • the promoter used was the HI promoter and the siRNA region contained sense sequence, a connecting sequence and an antisense sequence to eGFP.
  • This construct allowed for the random integration of the DNA into the animals genome, which was expressed ubiquitously.
  • Carmell et al (Nature Structural Biology 10(2) 91-92) reported the germline transmission of RNAi in mice via the random insertion of a transgene containing an exogenous promoter and siRNA sequence.
  • Kunath et al (Nature Biotechnology May 2003 21: 559-561) reported the generation of knockdown murine embryonic stem(ES) cell lines with transgenic short-hairpin RNA (shRNA) via random integration.
  • a linearized transgene containing the HI RNA polymerase promoter, followed by shRNA sequence (sense and antisense sequence separated by a seven base pair spacer), followed by five thymidines to terminate transcription was introduced via electroporation into the ES cells to achieve random integration of the construct, resulting in a genetic null phenotype for the target gene.
  • Kunath et al. discuss the benefit of assaying gene function in vivo without gene targeting through siRNA technology.
  • PCT Publication No. WO 03/059923 by Tranzyme, Inc. and Ozgene Pty., Ltd. describes the production of genetically modified animals using lentiviral vectors.
  • the vectors described include selectable markers driven off of an exogenous promoter sequence for random integration.
  • the publication describes the nucleotide sequence of interest contained in the gene transfer vector that includes a polynucleotide sequence, which expresses an RNA molecule capable of mediating RNA interference.
  • WO 03/056022 by Oxford Biomedica, Ltd. describes methods of producing transgenic cells using lentiviral vectors for random insertion into the genome.
  • the nucleotides that can be used include an siRNA and an exogenous promoter, such as a RNA polymerase promoter.
  • 2004/0045043 by Finney and Lofquist entitled, "Compositions and Methods for Generating Conditional Knockouts” discloses methods to identify disease-associated genes, produce animal models of disease and identify drug candidates tlirough conditional knockout strategies.
  • the publication discloses the use of homologous recombination to engineer siRNA targets (not siRNA molecules) into endogenous genes. While these initial strategies for providing animals with heritable transgenes have been developed, additional improvements are desired to further control protein expression and minimize adverse effects on the host cell or organism. It is therefore an object of the present invention to provide improved methods to repress the expression of proteins in cells and animals.
  • the invention provides new methods and materials for the repression of expression of a protein that include the use of targeted insertion vectors which have a minimal effect on the homeostasis of the cell or animal.
  • DNA templates that encode an iRNA to repress a target protein are provided that (i) use the endogenous regulatory elements of the cell, such as the endogenous promoter, (ii) are targeted into an intronic sequence of a gene, and/or (iii) do not disrupt the homeostasis of the cell.
  • new iRNA molecules and DNA sequences encoding them are provided, as well as methods to produce the same.
  • an iRNA molecule in which both strands are complementary to a target mRNA (referred to herein as "cTarget") of a protein to be repressed, which can be in the form of a hairpin.
  • a target mRNA referred to herein as "cTarget”
  • iRNA molecules that regulate the expression of specific genes or family of genes that share a common, homologous sequence, such that the expression of the genes can be functionally eliminated are provided.
  • methods are provided to produce transgenic cells and animals that express iRNA molecules at a predetermined location, as well as the cells and animals produced thereby.
  • DNA templates or constructs, which produce iRNA molecules, that contain sequence that targets a particular location in the genome can be introduced into cells, such that the DNA templates are under the control of endogenous regulatory elements of the cell, such as the promoter and/or other regulatory elements of the gene.
  • the DNA templates can be targeted such that expression of the iRNA molecule can be achieved without disrupting the endogenous gene function.
  • the DNA templates can be in the form of vectors. The vectors can be introduced into the cells directly, or linearized prior to introduction into the cell.
  • the DNA templates can be synthesized as oligonucleotides and introduced into cells.
  • the DNA templates can integrate into the genome of the cell via targeted integration.
  • the targeted integration can be via homologous recombination.
  • the DNA templates can contain 5' and 3' targeting sequences that are homologous to the target gene to allow for targeted insertion.
  • the DNA templates can be inserted via homologous recombination into, for example, a housekeeping gene such that the expression of the iRNA molecule is under the control of the associated promoter of the housekeeping gene.
  • the DNA templates can be inserted via homologous recombination into a gene that is only expressed in particular cells or organs such that the expression of the iRNA molecule is under the control of the associated promoter of the cell or organ specific gene.
  • Such templates can be introduced into mammalian cells, such as human, porcine, ovine or bovine cells, bacterial cells, such as E.
  • the DNA templates/constructs used to produce the iRNA molecules can be designed to integrate into exons of the target gene.
  • the DNA templates used to produce the iRNA molecules can be designed to integrate into infrons of the target gene, such as, for example, into a non-esssential location of an endogenous infron.
  • the DNA templates can be targeted such that the endogenous promoter of the target gene directs transcription of the exogenous DNA template.
  • the DNA templates used to produce the iRNA molecules can be embedded in engineered introns for integration into infrons or exons of target genes. These engineered infrons can be derived from any endogenous infron.
  • the endogenous infron can be reduced to its minimal functional components.
  • restriction sites can be added into the engineered infron.
  • the restriction enzyme sites allow for placement of the DNA template into the engineered infron.
  • the synthetic infrons can be inserted into endogenous exons or introns without disrupting the function of the endogenous gene.
  • methods are provided to produce cells and animals in which interfering RNA molecules are expressed to regulate the expression of target genes.
  • Methods according to this aspect of the invention can include: (i) identifying at least one iRNA sequence that is complementary to the target mRNA; (ii) manufacturing a DNA construct encoding the iRNA sequence; (iii) identifying a target endogenous nucleic acid sequences in a cell; (iv) introducing the DNA construct into the cell wherein the DNA construct further contains flanking sequence homologous to the endogenous target gene; and/or (v) expressing the DNA construct in the cell under conditions such that the iRNA molecule binds to the target mRNA sequence, thereby regulating expression of one or more target mRNAs.
  • the present invention provides methods of producing non-human transgenic animals that heritably express iRNA molecules that regulate the expression of one or more target genes.
  • the animals can be produced via somatic cell nuclear transfer.
  • the somatic cell can be engineered to express the iRNA molecule by any of the techniques described herein.
  • ds iRNA molecules are provided in which both sfrands are complementary to the mRNA target sequence (referred to herein as "cTarget"). Due to the intracellular processing of double stranded iRNA (ds iRNA) molecules, only one of the two sfrands of the molecule actually functions to inhibit the target mRNA.
  • the present invention provides novel ds iRNA molecules in which both sfrands can be functional, i.e. can bind to the target RNA sequence.
  • the design of iRNA molecules was such that only one strand of the iRNA molecule was functional (i.e. typically one strand was substantially identical to the target sequence, or the "sense" sequence, and the other strand was the functional strand that was complementary to the target sequence, or the "antisense” sequence), and thus if the nonfunctional strand was processed in vivo, no inhibitory effect was generated.
  • the ds iRNA molecules can contain a first cTarget strand of nucleotides, which hybridizes to a second cTarget strand sequence.
  • the cTarget sfrands can contain at least fifteen, sixteen, seventeen, eighteen, nineteen, twenty, twenty- one, twenty-two, twenty-three, twenty-four or twenty-five nucleotides.
  • segments of cTarget sequence must be evaluated to determine the portions which will hybridize to form a ds iRNA molecule.
  • segments of cTarget sequence at least 100, 200 or 300 nucleotides in length can be analyzed to determine areas of self-hybridization.
  • these sequences can be entered into a computer program which detects areas of self-hybridization, such as, in one specific embodiment, the MFold software, as described in M.
  • the cTarget sequences can be complementary to the same target sequence, h another embodiment, the cTarget sequences can be complementary to different target sequences.
  • the ds iRNA molecule can be palindromic cTarget sequences, in wliich both strands are identical or functionally identical.
  • a cTarget sequence can be analyzed to identify palindromic sequences, for example, through the use of a computer program, such as DNA Sfrider.
  • DNA templates are provided, which produce ds iRNA molecules that are two sfrands of cTarget sequence.
  • DNA templates are provided that produce iRNA precursors.
  • a spacer nucleotide sequence can separate the two cTarget sequences.
  • a nucleotide sequence is provided that contains a first strand complementary to a target and a second strand complementary to a target, which substantially hybridizes to the first strand and a spacer sequence connecting the two sfrands.
  • the spacer can form a loop or hair- pin structure. Such hairpins can be cleaved inside the cell to provide a duplexed mRNA containing the two stems.
  • the spacer nucleotide sequence can be at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or 15 nucleotides in length.
  • the spacer sequence can contain nucleotides that form a loop structure, such as a mir30 loop structure, such as disclosed in Seq ID No 4 or any of the sequences described herein.
  • the loop structure can contain a first nucleotide sequence, such as at least two, three, four or five nucleotides, followed by a second nucleotide sequence, such as at least two, three, four or five nucleotides, followed by a third nucleotide sequence that substantially hybridizes to the first sequence of nucleotides, followed by a fourth string of nucleotides, such as two, three, four or five nucleotides, thereby forming a two loop structure.
  • this two loop structure can serve as a subsfrate for a nuclease, such as Drosha.
  • an additional nucleotide sequence can flank the two cTarget strand sequences.
  • the additional nucleotide sequence can be at least three, four, five, ten or fifteen nucleotides 5' and 3' to the cTarget sfrands.
  • a stem sequence can be 5' and 3' to the cTarget strand sequences.
  • the stem sequence can contain at least four, five, six or seven nucleotides.
  • the 5' stem sequence can contain a first, second and third nucleotide sequence upstream of the first cTarget strand.
  • the 3' stem sequence can contain a fourth, fifth and sixth nucleotide sequence, wherein the fifth nucleotide sequence substantially hybridizes to the second nucleotide sequence of the 5' stem and the fourth and sixth nucleotide sequences do not hybridize to the first and third sequence of the 5' stem.
  • the stem sequence can be a mir30 stem sequence, such disclosed any of the sequences described herein..
  • the additional nucleotide sequence can be a cloning site 5' and or 3' to the cTarget sequence.
  • the cloning site can be 5' and/or 3' of the stem sequence.
  • the cloning site can contain engineered restriction enzyme sites to allow for cloning and splicing of nucleotide sequences within larger sequences.
  • the DNA template can produce an RNA molecule with at least two of the following components wherein the Target complement A and Target complement B will be processed by the cell to form a ds iRNA molecule.
  • ds iRNA molecule One nonlimiting illousfrative embodiment is depicted below:
  • inhibitory RNAs can be constructed by addition of individual inhibitory RNAs into an array or cluster, h one embodiment, a cluster of individual hairpin iRNAs joined in tandem with or without linker sequence is provided. In one embodiment, this structure can have radial symmetry (see, for example, Figure 2). These radial iRNA molecules can exhibit radial symmetry in stracture without having radial symmetry in sequence, h an alternative embodiment, duplex RNAs can be joined with a variety of spacer sequences to produce a stracture that is nearly linear or curved (see, for example, Figure 3).
  • These structures can be produced by linking a series of oligonucleotides with or without spacer sequence and then adding the complement sequence of these oligonucleotides in the reverse order, again with or without linker sequence.
  • these stractural strategies can be combined to produce complex stractures.
  • radial iRNAs and linear clustered iRNAs can mediate targeted inhibition of mRNA via small interfering RNAs.
  • methods are provided to optimize the hybridization of the two cTarget strands, or any sequences in which hybridization is desirable. Cytosine resides in putative sequences can be replaced with uracil residues, since non- Watson-Crick base pairing is possible in RNA molecules.
  • iRNA molecules that regulate the expression of specific genes or family of genes are provided, such that the expression of the genes can be functionally eliminated.
  • at least two iRNA molecules are provided that target the same region of a gene.
  • at least two iRNA molecules are provided that target at least two different regions of the same gene.
  • at least two iRNA molecules are provided that target at least two different genes.
  • Additonal embodiments of the invention provide combinations of the above strategies for gene targeting.
  • the iRNA molecules can be the same sequence.
  • the iRNA molecules can be different sequences.
  • the iRNA molecules can be integrated into either the same or different vectors or DNA templates.
  • the iRNA molecules within the vector or DNA template are operably linked to a promoter sequence, such as, for example, a ubiquitously expressed promoter or cell-type specific promoter.
  • the iRNA molecules within the vector or DNA template are not under the confrol of a promoter sequence.
  • these vectors or DNA templates can be introduced into a cell.
  • the vector or DNA template can integrate into the genome of the cell. The integration into the cell can either be via random integration or targeted integration. The targeted integration can be via homologous recombination.
  • At least two iRNA molecules are provided wherein the families of one or more genes can be regulated by expression of the iRNA molecules
  • at least three, four or five iRNA molecules are provided wherein the families of one or more genes can be regulated by expression of the iRNA molecules.
  • the iRNA molecule can be homologous to a conserved sequence within one or more genes.
  • the family of genes regulated using such methods of the invention can be endogenous to a cell, a family of related viral genes, a family of genes that are conserved within a viral genus, a family of related eukaryotic parasite genes, or more particularly a family of genes from a porcine endogenous retrovirus.
  • At least two iRNA molecules can target the at least two different genes, which are members of the same family of genes.
  • the iRNA molecules can target homologous regions within a family of genes and thus one iRNA molecule can target the same region of multiple genes.
  • the iRNA molecule can be selected from, but are not limited to the following types of iRNA: antisense oligonucleotides, ribozymes, small interfering RNAs (siRNAs), double stranded RNAs (dsRNAs), inverted repeats, short hairpin RNAs (shRNAs), small temporally regulated RNAs, and clustered inhibitory RNAs (ciRNAs), including radial clustered inhibitory RNA, asymmetric clustered inhibitory RNA, linear clustered inhibitory RNA, and complex or compound clustered inhibitory RNA.
  • siRNAs small interfering RNAs
  • dsRNAs double stranded RNAs
  • shRNAs short hairpin RNAs
  • ciRNAs clustered inhibitory RNAs
  • expression of iRNA molecules for regulating target genes in mammalian cell lines or fransgenic animals is provided such that expression of the target gene is functionally eliminated or below detectable levels, i.e. the expression of the target gene is decreased by at least about 70%, 75%, 80%, 85%, 90%, 95%, 97% or 99%.
  • methods are provided to produce cells and animals in which interfering RNA molecules are expressed to regulate the expression of target genes.
  • Methods according to this aspect of the invention can comprise, for example: identifying one or more target nucleic acid sequences in a cell; obtaining at least two iRNA molecules that bind to the target nucleic acid sequence(s); introducing the iRNA molecules, optionally packaged in an expression vector, into the cell; and expressing the iRNAs in the cell under conditions such that the iRNAs bind to the target nucleic acid sequences, thereby regulating expression of one or more target genes.
  • the present invention provides methods of producing non-human transgenic animals that heritably express at least two iRNA molecules that regulate the expression of one or more target genes.
  • the animals can be produced via somatic cell nuclear fransfer.
  • the somatic cell can be engineered to express the iRNA molecule by any of the techniques described herein.
  • the present invention also provides methods for the expression of at least two iRNA molecules in a cell or a fransgenic animal, where the iRNA targets a common location within a family of genes.
  • Such methods can include, for example: identifying one or more target nucleic acid sequences in the cell that are homologous regions within a family of genes; preparing at least two iRNA molecules that bind to the target nucleic acid sequence(s); introducing the iRNA molecules, optionally packaged in an expression vector, into the cell; and expressing iRNAs in the cell or animal under conditions such that the iRNA molecules bind to the homologous region within the gene family.
  • the present invention also provides fransgenic non-human animals produced by the methods of the invention.
  • the methods of the invention are useful for example for the production of transgenic non-human mammals (e.g. mice, rats, ungulates, sheep, goats, cows, porcine animals, rabbits, dogs, horses, mules, deer, cats, monkeys and other non-human primates), birds (particularly chickens, ducks, and geese), fish, reptiles, amphibians, worms (e. g. C. elegans), and insects (including but not limited to, Mosquitos, Drosophila, Trichoplusa, and Spodoptera).
  • transgenic non-human mammals e.g. mice, rats, ungulates, sheep, goats, cows, porcine animals, rabbits, dogs, horses, mules, deer, cats, monkeys and other non-human primates
  • birds particularly chickens, ducks, and geese
  • fish reptiles
  • amphibians worms
  • non-human animals are transgenic ungulates, including pigs.
  • the present invention also provides cells, tissues and organs isolated from such non-human fransgenic animals.
  • endogenous genes that can be regulated by the expression of at least two iRNA molecules include, but are not limited to, genes required for cell survival or cell replication, genes required for viral replication, genes that encode an immunoglobulin locus, for example, Kappa light chain, and genes that encode a cell surface protein, for example, Vascular Cell Adhesion Molecule (VCAM) and other genes important to the stracture and/or function of cells, tissues, organs and animals.
  • VCAM Vascular Cell Adhesion Molecule
  • the methods of the invention can also be used to regulate the expression of one or more non-coding RNA sequences in a transgenic cell or a transgenic animal by heritable fransgene expression of interfering RNA.
  • These non-coding RNA sequences can be sequences of an RNA virus genome, an endogenous gene, a eukaryotic parasite gene, or other non-coding RNA sequences that are known in the art and that will be familiar to the ordinarily skilled artisan.
  • porcine endogenous retrovirus (PERV) genes can be regulated by the expression of at least two iRNA molecules such that the expression of the PERV virus is functionally eliminated or below detection levels.
  • PERV refers to a family of retrovirus of which three main classes have been identified to date: PERV-A (Genbank Accession No. AF038601), PERV-B (EMBL Accession No. PERY17013) and PERV-C (Genbank Accession No. AF038600) (Patience et al 1997, Akiyoshi et al 1998).
  • the gag an ⁇ pol genes of PERV-A, B, and C are highly homologous, it is the env gene that differs significantly between the different types of PERV (eg., PERV-A, PERV-B, PERV-C).
  • PERV-D has also recently been identified (see, for example, U.S.
  • iRNA directed to the PERV virus can decrease the expression of PERV by at least about 70%, 75%,80%, 85%, 90%, 95%, 97% or 99%, or alternatively, below detectable levels.
  • the present invention provides at least two iRNA molecules that target the same sequence within the g ⁇ g,pol or env region of the PERV genome. Further, at least two iRNA molecules are provided that target different sequences within the gag, pol or env regions of the PERV genome. Still further, at least two iRNA molecules are provided that each target different regions (i.e. either gag, pol or env) of the PERV genome.
  • RNA interference molecules directed to the gag region of PERV; at least two RNA interference molecules directed to the pol region of PERV; and at least two RNA interference molecules directed to the env region of PERV are provided to target the PERV gene.
  • the present invention also provides ungulate, and particularly, porcine animals, as well as cells, tissues and organs isolated from non-human fransgenic animals in which the expression of PERV is functionally eliminated via the expression of at least two iRNA molecules.
  • transgenic pigs that express one or more interfering RNAs that interfere with the porcine endogenous retrovirus gene, a family member of the porcine endogenous retrovirus gene or a member of a subset of the porcine endogenous retrovirus gene family.
  • Figure 1 illustrates an example of a mechanisms by which an interfering RNA can mediate targeted destruction of cellular RNA.
  • an expression vector includes nucleic acid sequence encoding an RNA sense sfrand (black box) and antisense sfrand (gray box) in an inverted sequence are operably linked to a single promoter (white box).
  • the sense sfrand binds to its complimentary antisense sfrand, resulting in a double stranded, 'hairpin' RNA molecule (dsRNA).
  • the dsRNA is subsequently processed by an enzyme (Dicer, also known as RNAse III) to produce a small interfering RNA (siRNA).
  • Dier also known as RNAse III
  • FIG. 2 illustrates an example of a mechanism by which clustered inhibitory RNA (ciRNA) can mediate the destruction of cellular RNA.
  • ciRNA clustered inhibitory RNA
  • an expression vector includes a pattern of nucleic acid sequences encoding multiple complimentary RNA sense strands (black boxes) and inverted antisense sfrands (gray boxes). This pattern can be operably linked to a single promoter (white box).
  • the ciRNA transcript can autonomously fold so that each sense sfrand can bind to a complimentary antisense strand. This folding can result in a radially arrayed, double sfranded RNA complex with a hairpin structure at each outer axis.
  • This complex can be processed by an enzyme (Dicer, also known as RNAse III), producing multiple small interfering RNA (siRNA) molecules.
  • the resultant siRNA molecules can associate with an RNA-induced silencing complex (RISC) and with multiple target mRNA sequences. The binding of the cellular mRNA to the RISC induces cleavage of the mRNA sequence(s), thereby eliminating the functional expression of one or more specified gene product(s).
  • RISC RNA-induced silencing complex
  • Figure 3 illustrates another potential mechanism by which clustered inhibitory RNA (ciRNA) could mediate the targeted destruction of cellular RNA.
  • an expression vector includes nucleic acid sequences encoding multiple complimentary RNA sense sfrands (black box) and inverted antisense strands (gray box), operably linked to a single promoter (white box).
  • the ciRNA transcript autonomously folds so that each sense sfrand can bind to a complimentary antisense strand.
  • the resulting structure can be a linear, double sfranded RNA complex, containing at least one hairpin turn.
  • the linear, double sfranded ciRNA complex can then be processed by an enzyme (Dicer, also known as RNAse III), producing multiple small interfering RNA (siRNA) molecules.
  • the resultant siRNA molecules can associate with an RNA-induced silencing complex (RISC) and with multiple target mRNA sequences.
  • RISC RNA-induced silencing complex
  • the binding of the cellular mRNA to the RISC induces cleavage of the mRNA sequence(s), thereby eliminating the functional expression of one or more specified gene product(s).
  • Figure 4 is a representation of molecules of the present invention.
  • the molecules of the invention contain one or more "sets" of iRNA sequences.
  • FIG. 1 is a graphical depiction of a representative vector promoter driven vector (top) and a graphical representation of a representative promoterless vector which can be used in the practice of the invention.
  • Figure 6 is a representation of the process of "promoter trap" (top panel) and "gene frap” (bottom panel) technologies described in the text.
  • the iRNA vector includes one or more iRNA sequences (black boxes) and a 5' and 3' sequence homologous to one or more exon sequences of a desired gene (diagonally striped boxes). The figure shows the homologous sequences recombining to provide a final gene with an iRNA insert.
  • the gene trap vector is shown containing one or more RNA sequences, sequences homologous to an infron region in a gene (striped boxes), and a splice acceptor (SA) site immediately upstream of the promoterless iRNA sequence insert.
  • SA splice acceptor
  • Region 1 is shown to have three alleles. Gene 2, 3, and 4 are shown to have four alleles each. Boxes with the same pattern, within a region, represent sequences that are identical. Boxes with different patterns within a region represent different sequences within that region. Region 1 differs in sequence between all genes and alleles except for Gene 1, allele A and B. Region 2 is conserved among all family members. Only two sequences are found in region 3. Likewise, only two sequences are found in region 4. Seven sequences are found in region 5. Region 6 is not conserved among any family members. Effective targeting of region 2 provides suppression of all family members. Effective targeting of one of the two sequences found in region three specifies a subset of genes.
  • FIG. 8 shows an analysis of a portion of PERV env genes.
  • the region spanning bases 6364 to 6384 is homologous between all family members shown. Two polymorphisms are shown for the dinucleotide at bases 6400 and 6401. Two transgenes are required to effectively repress the shown genes when targeting regions that include this dinucleotide.
  • the region spanning bases 6408 to 6431 represent three polymorphisms.
  • regions that include base 6385 represent three polymorphisms. Single transgenes that target one of the three polymorphism in tripolymorphic regions differentiate a subset of the shown sequences.
  • FIG. 9 illustrates representative inhibitory RNA targets.
  • An 86 base consensus for a semi-conserved region of PERV is shown on the first line.
  • Sixty-eight potential 19 base targets for inhibitory RNA within this sequence are shown on subsequent lines.
  • Targets can be between 17 and 35 bases in length. This process can be reiterated for targets of 17-35 bases and can be applied to any region, protein coding or non-coding, included within any complete or partial PERV genome. All PERV sequences are potential targets. Line 1, PERV sequence; Lines 2-69, potential targets.
  • Figure 10 illustrates the identification of potential targets that share significant homology with non-targeted genes.
  • RNA sequence of target genes are screened for homology to non-targeted RNAs.
  • a 19 base region of an unknown porcine expressed sequence (Genbank entry BI305054) is significantly homologous to a region of semi- conserved PERV sequence (shown in black face bold type).
  • potential target regions with significant homology to non-targeted RNAs can prove useful, such target regions are excluded in initial target screens to reduce the risk of severely down-regulating unintended gene products.
  • Line 1 PERV sequence
  • Lines 2-69 potential targets
  • Line 70 unknown expressed porcine sequence
  • Lines 36-56 excluded targets.
  • Figure 11 represents the configuration of an inhibitory RNA designed for the potential target sequence of Figure 9 that is listed first (Line 2, Figure 3).
  • N refers to any nucleotide and "Y” refers to any integer greater than or equal to zero.
  • Each portion of non-specified sequence, (Ny) can be homopolymeric or can be composed of non-identical bases.
  • any continuous stretch of non-specified sequence, (N Y ) can provide additional functions such as but not limited to encoding protein, providing signals for stability or increased half-life, increasing the length of palindromic sequence, providing signals and functions for splicing, or folding into particular structures.
  • Figure 12 represents the illustrative sequence for radial clustered inhibitory RNA, asymmetric bubble ciRNA, linear ciRNA, and complex ciRNA to a targeted PERV gag consensus sequence.
  • Figure 13 represents a representation of a cloning strategy to insert portions of a gene into a vector.
  • the invention provides new methods and materials for the repression of expression of a protein that include the use of targeted insertion vectors which have a minimal effect on the homeostasis of the cell.
  • DNA templates that encode an iRNA to repress a target protein are provided that (i) use the endogenous regulatory elements of the cell, such as the endogenous promoter, (ii) are targeted into an infronic sequence of a gene, and or (iii) do not disrupt the homeostasis of the cell, h a second embodiment, new iRNA molecules and DNA sequences encoding them are provided, as well as methods to produce the same.
  • a iRNA molecule in which both sfrands are complementary to a target mRNA (cTarget) of a protein to be repressed, which can be is in the form of a hairpin.
  • iRNA molecules that regulate the expression of specific genes or family of genes that share a common, homologous sequence, such that the expression of the genes can be functionally eliminated are provided.
  • RNA interference is a genetically dominant phenomenon, i.e., the fransgene does not need to be rendered homozygous.
  • RNA interference can be directed against genes that may or may not reside in the genome.
  • DNA templates which produce iRNA molecules, that contain sequence that targets a particular location in the genome can be introduced into cells, such that the DNA templates are under confrol of the endogenous regulatory elements of the cell, such as the promoter and/or other regulatory elements of the gene.
  • the DNA templates can be targeted such that expression of the iRNA molecule can be achieved without disrupting the endogenous gene function, hi one embodiment, the DNA templates can be in the form of vectors. The vectors can be introduced into the cells directly, or linearized prior to introduction into the cell.
  • the DNA templates can be synthesized as oligonucleotides and introduced into cells, one embodiment, the DNA templates can integrate into the genome of the cell via targeted integration.
  • the targeted integration can be via homologous recombination.
  • the DNA templates can contain 5' and 3' targeting sequence that is homologous to the target gene to allow for targeted insertion.
  • the DNA templates can be inserted via homologous recombination into, for example, a housekeeping gene such that the expression of the iRNA molecule is under the confrol of the associated promoter of the housekeeping gene.
  • the DNA templates can be inserted via homologous recombination into a gene that is only expressed in particular cells or organs such that the expression of the iRNA molecule is under the confrol of the associated promoter of the cell or organ specific gene.
  • Such templates can be introduced into mammalian cells, such as human, porcine, ovine or bovine cells, bacterial cells, such as E. Coli, and/or yeast cells.
  • ds iRNA molecules are provided in which both sfrands are complementary to the mRNA target sequence (cTarget).
  • ds iRNA double sfranded iRNA
  • the present invention provides novel ds iRNA molecules in which both strands can be functional, i.e. can bind to the target RNA sequence.
  • the design of iRNA molecules was such that only one strand of the iRNA molecule was functional (i.e.
  • iRNA molecules that regulate the expression of specific genes or family of genes are provided, such that the expression of the genes can be functionally eliminated.
  • at least two iRNA molecules are provided that target the same region of a gene, hi another embodiment, at least two iRNA molecules are provided that target at least two different regions of the same gene. In a further embodiment, at least two iRNA molecules are provided that target at least two different genes.
  • porcine endogenous retrovirus (PERV) genes can be regulated by the expression of at least two iRNA molecules such that the expression of the PERV virus is functionally eliminated or below detection levels.
  • PERV refers to a family of retrovirus of which three main classes have been identified to date: PERV-A (Genbank Accession No. AF038601), PERV-B (EMBL Accession No. PERY17013) and PERV-C (Genbank Accession No. AF038600) (Patience et al 1997, Akiyoshi et al 1998).
  • gag and pol genes of PERV-A, B, and C are highly homologous, it is the env gene that differs between the different types of PERV (eg., PERV-A, PERV-B, PERV-C).
  • PERV-D has also recently been identified (see, for example, U.S. Patent No 6,261,806).
  • animal is meant to include any animal, including but not limited to non-human mammals (including, but not limited to, pigs, sheep, goats, cows (bovine), deer, mules, horses, monkeys and other non-human primates, dogs, cats, rats, mice, rabbits), birds (including, but not limited to chickens, turkeys, ducks, geese) reptiles, fish, amphibians, worms (e.g. C. elegans), insects (including but not limited to, Drosophila, Trichoplusa, and Spodoptera).
  • a “transgenic animal” is any animal containing one or more cells bearing genetic information received, directly or indirectly, by deliberate genetic manipulation at the subcellular level.
  • a “transgenic cell” is any cell bearing genetic information received, directly or indirectly, by deliberate genetic manipulation at the subcellular level.
  • the term “ungulate” refers to hoofed mammals. Artiodactyls are even-toed (cloven- hooved) ungulates, including antelopes, camels, cows, deer, goats, pigs, and sheep.
  • Perissodactyls are odd toes ungulates, which include horses, zebras, rhinoceroses, and tapirs.
  • the terms "porcine”, “porcine animal”, “pig” and “swine” are generic terms referring to the same type of animal without regard to gender, size, or breed.
  • “heritable gene,” “heritable trait,” “heritable characteristic,” “heritable iRNA”, means that the unit, e.g. the gene, trait, characteristic, iRNA, etc., are capable of being inherited or of passing by inheritance.
  • the term “regulation of gene expression” refers to the act of confrolling the ability, timing, level, manner or cell-type of franscription of a gene.
  • Regulation can result in increased expression of a gene, decreased expression of a gene or maintenance of expression of a gene, as described herein.
  • ds iRNA molecules are provided in which both sfrands are complementary to the target sequence (cTarget). Due to the intracellular processing of double stranded iRNA (ds iRNA) molecules, only one of the two strands of the molecule actually functions to inhibit the target mRNA.
  • the present invention provides novel ds iRNA molecules in which both sfrands can be functional, i.e. can bind to the target RNA sequence. Prior to this discovery, the design of iRNA molecules was such that only one sfrand of the iRNA molecule was functional (i.e.
  • Micro-RNAs are small endogenous RNAs involved in post-transcriptional regulation of genes.
  • miRNAs One such miRNA (mir30) is transcribed as a large transcript (primir30) that processed via Drosha into a smaller hairpin structure (pre-mir30) that is exported from the nucleus. In the cytoplasm, pre-mir30 is further processed by Dicer to yield mature mir30.
  • the nucleotide sequence of the above sequence is UGUAAACAUCCUCGACUGGAA GCUGUGAAGCC ACAGAUGGGCUUUCAGUCGGAUGUUUGCAGC (Seq ID No 1).
  • a minimal pri-mir30 Drosha substrate has been described for in vitro cleavage (Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Radmark O, Kim S, Kim NN.
  • the nuclear RNase III Drosha initiates microRNA processing. Nature. 2003 Sep25;425(6956):415-9)
  • the putative predicted structure of this subsfrate follows:
  • GG (Seq ID No 2).
  • a minimal pri-mir30 Drosha subsfrate has also been described for in vivo cleavage in the context of an irrelevant mRNA (Zeng Y, Wagner EJ, Cullen BR. Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells.
  • GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAG UCGGAUGUUUGCAGCUGC (Seq ID No 3). Additionally, it has been shown that the active portions of miRNAs can be replaced to generate novel hairpins with siRNA activity (Zeng Y, Wagner EJ, Cullen BR. Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells. Mol Cell. 2002 Jun;9(6):1327-33;; Boden D, Pusch O, Silbermann R, Lee F, Tucker L, Ramratnarn B. Enhanced gene silencing of HIN-1 specific siR ⁇ A using microRNA designed hairpins. Nucleic Acids Res.
  • the ds iRNA molecules can contain a first cTarget sfrand of nucleotides, which hybridizes to a second cTarget sfrand sequence.
  • the cTarget sfrands can contain at least fifteen, sixteen, seventeen, eighteen, nineteen, twenty, twenty- one, twenty- two, twenty-three, twenty-four, twenty-five, twenty-six, twenty-seven, twenty-eight, twenty- nine, thirty, thirty-one, thirty-two, thirty-three, thrirty-four, thirty-five, thirty-six, thirty-seven, thirty-eight, thirty-nine, forty, forty-one, forty-two, forty-three, forty-four, forty-five, forty- six, forty-seven, forty-eight, forty-nine, or fifty nucleotides, in particular, nineteen to thrity- two nucleotides, or twenty-one to thewnt-three nucleotides in length.
  • Methods are also provided to obtain iRNA molecules that are a first cTarget sfrand of nucleotides, which hybridizes to a second cTarget strand sequence.
  • a complementary sequence to the target sequence (cTarget) is first determined and then segments of cTarget sequence can be evaluated to determine the portions of which will hybridize together to form a ds iRNA molecule.
  • segments of cTarget sequence at least 25, 50, 100, 200 300, 400 or 500 nucleotides in length can be analyzed to determine areas of self- hybridization.
  • these sequences can be enetered into a computer program which detects areas of self-hybridization, such as, in one specific embodiment, the MFold software, as described in M. Zuker Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31 (13) 3406-15, (2003), [htrp://www.bioinfo. i.edu/applications/n folcl/old/rna/forml .cgi] .
  • DNA templates are provided, which produce ds iRNA molecules that are two sfrands of cTarget sequence.
  • DNA templates are provided that produce iRNA precursors.
  • a spacer nucleotide sequence can separate the two cTarget sequences.
  • a nucleotide sequence is provided that contains a first sfrand complementary to a target and a second strand complementary to a target, which substantially hybridizes to the first sfrand and a spacer sequence connecting the two sfrands.
  • the spacer can form a loop or hairpin structure. Such hairpins can be cleaved inside the cell to provide a duplexed mRNA containing the two stems.
  • the spacer nucleotide sequence can be at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40 or 50 nucleotides in length.
  • the spacer sequence can contain nucleotides that form a loop structure, such as a mir30 loop structure.
  • the mir30 loop structure can contain at least the following sequence: GUGAAGCCACAGAUG (Seq ID No 4), or as indicated in any of the sequences listed herein, one embodiment the loop structure can contain a first nucleotide sequence, such as at least two, three, four or five nucleotides, followed by a second nucleotide sequence, such as at least two, three, four or five nucleotides, followed by a third nucleotide sequence that substantially hybridizes to the first sequence of nucleotides, followed by a fourth string of nucleotides, such as two, three, four or five nucleotides, thereby forming a two loop structure, hi one embodiment, this two loop structure can serve as a subsfrate for a nuclease, such as Drosha.
  • additional nucleotide sequence can flank the two cTarget strand sequences.
  • the additional nucleotide sequence can be at least three, four, five, ten or fifteen nucleotides 5' and 3' to the cTarget sfrands.
  • a stem sequence can be 5' and 3' to the cTarget strand sequences.
  • the stem sequence can contain at least four, five, six or seven nucleotides.
  • the 5' stem sequence can contain a first, second and third nucleotide sequence upstream of the first cTarget sfrand.
  • the 3' stem sequence can contain a fourth, fifth and sixth nucleotide sequence, wherein the fifth nucleotide sequence substantially hybridizes to the second nucleotide sequence of the 5' stem and the fourth and sixth nucleotide sequences do not hybridize to the first and third sequence of the 5' stem.
  • the stem sequence can be a mir30 stem sequence, such as illustrated in any of the sequences listed herein, such as Seq ID No 5.
  • the additional nucleotide sequence can be a cloning site 5' and/or 3' to the cTarget sequence.
  • the cloning site can be 5' and/or 3' of the stem sequence.
  • the cloning site can contain engineered restriction enzyme sites to allow for cloning and splicing of nucleotide sequences within larger sequences.
  • the DNA template can produce an RNA molecule with at least two of the following components, as illusfrated below, wherein the Target complement A and Target complement B will be processed by the cell to form a ds iRNA molecule:
  • the DNA template can produce a Drosha subsfrate that is processed into a functional iRNA molecule.
  • the cTarget sequences can be complementary to the same target sequence.
  • the cTarget sequences can be complementary to different target sequences.
  • the ds iRNA molecule can be palindromic cTarget sequences, in which both strands are identical or functionally identical.
  • a cTarget sequence can be analyzed to identify palindromic sequences, for example, through the use of a computer program, such as DNA Strider.
  • methods are provided to optimize the hybridization of the two cTarget strands, or any sequences in which hybridization is desirable.
  • Cytosine resides in putative sequences can be replaced with uracil residues, since non-Watson-Crick base pairing is possible in RNA molecules. These uracil residues can bind to either guanine or adenosine, thereby potentially increasing the degree of hybridization between the sfrands.
  • the cTarget sequences can be complementary to the same target sequence.
  • iRNA molecules such as hairpins, in which both strands of the stem are complementary to the target mRNA.
  • hairpins can serve as a Drosha subsfrate and the resulting stracture can be cleaved to produce two strands, each of which is capable of exerting an inhibitory effct on the target mRNA.
  • the complementary sequence to the target sequence (cTarget) is first determined and then segments of cTarget sequence can be evaluated to determine the portions of which will hybridize together to form a ds iRNA molecule.
  • segments of cTarget sequence at least 25, 50, 100, 200 300, 400 or 500 nucleotides in length can be analyzed to determine areas of self-hybridization.
  • these sequences can be entered into a computer program which detects areas of self-hybridization, such as, in one specific embodiment, the MFold software, as described in M. Zuker Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31 (13) 3406-15, (2003), [http://ww w.bioinfo. i.edu applications/mfold/ol ⁇ Vmayforml.cgi]. Areas of self- hybridization can then be identified and tested for its effct in the cell.
  • each of the target sequences can first be determined and then segments of each cTarget sequence can be spliced together. For example, at least 25, 50, 100, 200 300, 400 or 500 nucleotides of cTarget to a first target (cTarget 1) can be joined with at least 25, 50, 100, 200 300, 400 or 500 nucleotides of cTarget to a second target (cTarget 2).
  • This sequence of nucleotides can be evaluated to determine the portions of which will hybridize together to form a ds iRNA molecule.
  • these sequences can be entered into a computer program which detects areas of self-hybridization, such as, in one specific embodiment, the MFold software, as described in M. Zuker Mfold web server for nucleic acid folding and hybridization prediction.
  • Areas of hybridization between cTarget 1 and cTarget 2 can then be identified and tested for its effect on repression of the target mRNAs in a cell.
  • the ds iRNA molecule can be palindromic cTarget sequences, in which both sfrands are identical or functionally identical.
  • a cTarget sequence can be analyzed to identify palindromic sequences, for example, through the use of a computer program, such as DNA Strider.
  • a method to ifentify palindromic sequences is provided in which, complementary sequence to a target mRNA is first determined.
  • This sequence can then be analyzed for the presense of a palindromic sequence that is at least fifteen, sixteen, seventeen, eighteen, nineteen, twenty, twenty- one, twenty-two, twenty-three, twenty-four, twenty-five, twenty-sic, twenty-seven, twenty-eight, twenty-nine, thirty, thirty-one, t rty-two, thirty-three, thrirty-four, thirty-five, thirty-six, thirty-seven, thirty-eight, thirty-nine, forty, forty-one, forty-two, forty-three, forty- four, forty-five, forty-six, forty-seven, forty-eight, forty-nine, or fifty nucleotides, in particular, nineteen to thrity-two nucleotides, or twenty-one to twenty-three nucleotides in length.
  • sequences can be evaluated using a computer program, such as the DNA Strider software.
  • a computer program such as the DNA Strider software.
  • Such palindromic iRNA molecules essentially eliminates the effects of endogeous strand selection in iRNA processing. Hairpin formation can be optimized.
  • methods are provided to optimize the hybridization of the two cTarget sfrands, or any sequences in which hybridization is desirable. Cytosine resides in putative sequences can be replaced with uracil residues, since non- Watson-Crick base pairing is possible in RNA molecules. These uracil residues can bind to either guanine or adenosine, thereby potentially increasing the degree of hybridization between the strands.
  • Drosha substrates can be modified without significant alteration in RNAi targeting by using this strategy.
  • Clustered Inhibitory RNAs Radial and Linear Additionally, inhibitory RNAs can be constructed by addition of individual inhibitory RNAs into an anay or cluster. A variety of stractural motifs can be used. One such motif is a cluster of individual hairpin RNAs joined in tandom with or without linker sequence. Such structures can have radial symmetry in stracture (see, for example, Figure 2), without having radial symmetry in sequence, i.e. radial iRNA molecules.
  • duplex RNAs can be joined with a variety of spacer sequences to produce a structure that is nearly linear or curved (see, for example, Figure 3).
  • These stractures can be produced by linking a series of oligonucleotides with or without spacer sequence and then adding the complement sequence of these oligonucleotides in the reverse order, again with or without linker sequence, h addition, the various stractural strategies can be combined to produce complex structures.
  • Both radially and clustered inhibitory RNA and linear clustered inhibitory RNA stractures can mediate targeted destruction of cellular RNA via small interfering RNAs.
  • Clustered inhibitory RNA can be manufactured so that a single expression vector or DNA template contains from at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 50, 75, or 100 siRNA molecules capable of targeting a single region on an mRNA sequence (see, for example, Figure 4(a)). Additionally, clustered inhibitory RNA can be manufactured so that a single expression vector or DNA template contains at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 50, 75, or 100 siRNAs capable of targeting multiple regions on a single mRNA target sequence (see for example, figure 4(b)).
  • clustered inhibitory RNA can be manufactured so that a single expression vector contains more than one siRNA molecule capable of targeting multiple regions on multiple mRNA targets (see, for example, Figure 4(c)).
  • clustered inhibitory RNA can be manufactured so that a single expression vector contains from at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 50, 75, or 100 siRNA molecules capable of targeting a homologous region on multiple mRNA target sequences.
  • antisense oligonucleotides comprise one or more nucleotide sequences sufficient in identity, number and size to effect specific hybridization with a pre-selected nucleic acid sequence.
  • Antisense oligonucleotides used in accordance with the present invention typically have sequences that are selected to be sufficiently complementary to the target nucleic acid sequences (suitably mRNA in a target cell or organism) so that the antisense oligonucleotide forms a stable hybrid with the mRNA and inhibits the translation of the mRNA sequence, preferably under physiological conditions.
  • the antisense oligonucleotide can be 100% complementary to a portion of the target gene sequence.
  • the antisense oligonucleotides can also be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementary to the target nucleic acid sequence.
  • Antisense oligonucleotides that can be used in accordance with the present invention can be synthesized and used according to procedures that are well known in the art and that will be familiar to the ordinarily skilled artisan. Representative teachings regarding the synthesis, design, selection and use of antisense oligonucleotides include without limitation, for example, U.S.
  • Ribozymes Nucleic acid molecules that can be used in the present invention also include ribozymes.
  • ribozymes are RNA molecules having enzymatic activities usually associated with cleavage, splicing or ligation of nucleic acid sequences to which the ribozyme binds.
  • Typical subsfrates for ribozymes include RNA molecules, although ribozymes can also catalyze reactions in which DNA molecules serve as substrates.
  • Ribozymes which are active infracellularly work in cis, catalyzing only a single turnover reaction, and are usually self- modified during the reaction.
  • ribozymes can be engineered to act in trans, in a truly catalytic manner, with a turnover greater than one and without being self-modified.
  • Ribozymes that can be used in accordance with the present invention can be synthesized and used according to procedures that are well known in the art and that will be familiar to the ordinarily skilled artisan. Representative teachings regarding the synthesis, design, selection and use of ribozymes include without limitation, for example, U.S. Patent
  • RNA interference is mediated by double sfranded RNA (dsRNA) molecules that have sequence-specific homology to their "target" nucleic acid sequences (Caplen, N.J., et al., Proc. Natl. Acad. Sci. USA 98:9742-9747 (2001)).
  • dsRNA double sfranded RNA
  • Biochemical studies in Drosophila cell- free lysates indicate that, in certain embodiments of the present invention, the mediators of RNA-dependent gene silencing are 21-25 nucleotide "small interfering" RNA duplexes (siRNAs).
  • siRNA molecules are suitably used in methods of the present invention.
  • the siRNAs are derived from the processing of dsRNA by an RNase enzyme known as Dicer (Bernstein, E., et al., Nature 409:363-366 (2001)).
  • siRNA duplex products are recruited into a multi-protein siRNA complex termed RISC (RNA Induced Silencing Complex).
  • a RISC is then believed to be guided to a target nucleic acid (suitably mRNA), where the siRNA duplex interacts in a sequence-specific way to mediate cleavage in a catalytic fashion (Bernstein, E., et al., Nature 409:363-366 (2001); Boutla, A, et al., Curr. Biol. 11:1776-1780 (2001)).
  • target nucleic acid suitably mRNA
  • siRNA duplex interacts in a sequence-specific way to mediate cleavage in a catalytic fashion
  • Small interfering RNAs that can be used in accordance with the present invention can be synthesized and used according to procedures that are well known in the art and that will be familiar to the ordinarily skilled artisan.
  • Small interfering RNAs for use in the methods of the present invention suitably comprise between about 0 to about 50 nucleotides (nt).
  • siRNAs can comprise about 5 to about 40 nt, about 5 to about 30 nt, about 10 to about 30 nt, about 15 to about 25 nt, or about 20-25 nucleotides.
  • Inverted Repeats comprise single sfranded nucleic acid molecules that contain two regions that are at least partially complementary to each other, oriented such that one region is inverted relative to the other. This orientation allows the two complementary sequences to base pair with each other, thereby forming a hairpin stracture. The two copies of the inverted repeat need not be contiguous.
  • n can be at least 1, 5, 10, 25, 50, or 100 nucleotide, or more, and can be any number of nucleotides falling within these discrete values.
  • Inverted repeats that can be used in accordance with the present invention can be synthesized and used according to procedures that are well known in the art and that will be familiar to the ordinarily skilled artisan. The production and use of inverted repeats for RNA interference can be found in, without limitation, for example, Kirby, K. et al. Proc. Natl. Acad. Sci. U S A 99:16162-16167 (2002), Adelman, Z. N.
  • RNA molecules folded into hairpins are also advantageously used in the methods of the present invention.
  • shRNA short hairpin RNA
  • stem lengths can be at least fifteen, sixteen, seventeen, eighteen, nineteen, twenty, twenty- one, twenty-two, twenty-three, twenty-four, twenty-five, twenty-six, twenty- seven, twenty-eight, twenty-nine, thirty, thirty-one, thirty-two, thirty-three, thrirty-four, thirty-five, thirty-six, thirty-seven, thirty-eight, thirty-nine, forty, forty-one, forty-two, forty- three, forty-four, forty-five, forty-six, forty-seven, forty-eight, forty-nine, or fifty nucleotides and loop size can be at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40 or 50 nucleotides.
  • shRNAs resemble the dsRNA products of the Dicer RNase and, in any event, have the same capacity for inhibiting expression of a specific gene.
  • Hairpin RNA structures can mediate targeted destruction of cellular RNA via small interfering RNAs (see, for example, Figure 1). Transcription of shRNAs can be initiated at a polymerase III (pol III) promoter and is believed to be terminated at position 2 of a 4-5-thymine franscription termination site. Upon expression, shRNAs are thought to fold into a stem-loop structure with 3' UU-overhangs.
  • Short hairpin RNAs that can be used in accordance with the present invention can be synthesized and used according to procedures that are well known in the art and that will be familiar to the ordinarily skilled artisan.
  • the production and use of inverted repeats for RNA interference can be found in, without limitation, Paddison, P.J., et al., Genes & Dev. 16:948- 958 (2002), Yu, J-Y., et al. Proc. Natl. Acad. Sci. USA 99:6047-6052 (2002), and Paul, C. P. et al. Nature Biotechnol.
  • stRNAs Small Temporally Regulated RNAs
  • stRNAs small temporally regulated RNAs
  • stRNAs comprise from about 20 to about 30 nt (Banerjee and Slack, Bioessays 24:119-129 (2002)), although stRNAs of any size can also be used in accordance with the invention.
  • stRNAs downregulate expression of a target mRNA after the initiation of translation without degrading the mRNA.
  • A. Construct Design The present invention provides novel constructs and DNA templates to express iRNA molecules, as well as methods to make such constructs.
  • methods are provided to produce transgenic cells and animals that express iRNA molecules at a predetermined location, as well as the cells and animals produced thereby.
  • DNA templates, which produce iRNA molecules, that contain sequence that targets a particular location in the genome can be introduced into cells.
  • the DNA templates can be targeted such that expression of the iRNA molecule can be achieved without disrupting the endogenous gene function.
  • the DNA templates can be in the form of vectors. The vectors can be introduced into the cells directly, or linearized prior to introduction into the cell.
  • the DNA templates can be synthesized as oligonucleotides and introduced into cells.
  • the DNA templates can integrate into the genome of the cell via targeted integration.
  • the targeted integration can be via homologous recombination.
  • the DNA templates can be inserted via homologous recombination into, for example, a housekeeping gene such that the expression of the iRNA molecule is under the confrol of the associated promoter of the housekeeping gene.
  • the DNA templates can be inserted via homolgous recombination into a gene that is only expressed in particular cells or organs such that the expression of the iRNA molecule is under the control of the associated promoter of the cell or organ specific gene.
  • the DNA templates used to produce the iRNA molecules can integrate into exons of the target gene
  • the DNA templates used to produce the iRNA molecules can integrate into infrons of the target gene, such as into a non- esssential location of an endogenous infron.
  • the DNA templates can be targeted such that the endogenous promoter of the target gene directs franscription of the exogenous DNA template.
  • the DNA templates used to produce the iRNA molecules can be embedded in engineered (or synthetic) infrons for integration into infrons or exons of target genes.
  • the engineered introns can be derived from any endogenous infron.
  • the endogenous infron can be reduced to its minimal functional components
  • restriction sites can be engineered into the synthetic intron.
  • the restriction enzyme sites allow for placement of the DNA template into the synthetic intron.
  • the synthetic introns can be inserted into endogenous exons or infrons without disrupting the function of the endogenous gene.
  • methods are provided to produce cells and animals in which interfering RNA molecules are expressed to regulate the expression of target genes.
  • Methods according to this aspect of the invention can include, for example: identifying one or more target nucleic acid sequences in a cell; introducing DNA templates that produce iRNA molecules that bind to the target sequence and also contain flanking sequence for homologous recombination into the cell; and expressing the DNA templates in the cell under conditions such that the iRNAs bind to the target nucleic acid sequences, thereby regulating expression of one or more target genes.
  • the present invention provides methods of producing non-human fransgenic animals that heritably express iRNA molecules that regulate the expression of one or more target genes.
  • the animals can be produced via somatic cell nuclear fransfer.
  • the somatic cell can be engineered to express the iRNA molecule by any of the techniques described herein.
  • the DNA templates used to produce the iRNA molecules can be embedded in engineered (or synthetic) infrons for integration into introns or exons of target genes.
  • the engineered infrons can be derived from any endogenous intron.
  • the endogenous intron can be reduced to its minimal functional components, hi another embodiment, restriction sites can be engineered into the synthetic intron.
  • the restriction enzyme sites allow for placement of the DNA template into the synthetic infron.
  • the synthetic introns can be inserted into endogenous exons or infrons without disrupting the function of the endogenous gene.
  • an endogenous gene To obtain the expression pattern, level, and timing of an endogenous gene, one can use homologous recombination to frap all regulatory elements of the endogenous gene. However for many applications, disruption of an endogenous gene would not be acceptable.
  • the exogenous infron can be naturally occuring or designed (Kriegler M. Assembly of enhancers, promoters, and splice signals to confrol expression of fransfened genes. Methods Enzymol.
  • the known infron has been well characterized in the art and thus the DNA template that produces the iRNA molecule can be inserted into a site within the infron that is known to not effect the function of the intron.
  • restriction enzyme sites can be engineered into the infron and the DNA template can then be inserted into the infron at a location, which is non- essential for intron function.
  • restriction enzyme sites can be added to the sequence 5' and 3' of the infron to allow for targeted insertion of the synthetic infron into a target exon or intron.
  • the synthetic infron can contain at least a restriction enzyme site at the 5' end, an infronic splice donor site, a DNA template that can produce at least one iRNA molecule, an infronic branch site, an infronic splice acceptor site and a restriction enzyme site at the 3' end, see, for example, the schematic below:
  • an engineered intron can be created from any known gene, for example, a cell or tissue-specific gene.
  • the following non-limiting methodology can identify an appropriate insertion point for the DNA template, which will not effect infron function. First, sequence the intron. Then, set up a reporter assay, for example, by linking the gene to a reporter gene to test for functioning of the infron. Next, engineer restriction enzyme sites into a location of the intron and then clone into the intron the DNA template sequence. Finally, test the synthetic construct in the reporter assay to determine whether insertion of the DNA template interfered with the functioning of the gene. This process can be completed until a non-essential location of the intron is identified for insertion of the DNA template. Further, this process can also include sequential deletion of infronic sequence until a minimal functional infron is identified. B. Cloning Strategies
  • DNA can be spliced together to form specific nucleotide sequences.
  • DNA templates are provided that contain at least a 5' targeting arm for homologous recombination, a first nucleotide sequence, optionally, a linker sequence, a second nucleotide sequence that substantially hybridizes to the first nucleotide sequence and a 3' targeting arm for homologous recombination.
  • these DNA template can also be cloned into a synthetic infron.
  • oligonucleotide sequences can be synthesized for each component of the DNA template and/or synthetic infron and cloned together using restriction enzymes.
  • each component can be engineered in an expression venctor.
  • the vector can be introduced into the cell to achieve genetic modification of ther cell.
  • the vector can be linearized and then inserted into the cell.
  • at least two iRNA molecules can be expressed in a cell.
  • clustered iRNA molecules are expressed in a cell.
  • to clone a series of iRNA oligonucleotides into an expression vector the following strategy can be employed. First, a vector can be obtained with two non- compatible, unique restriction sites and then the first oligonucleotide can be directionally clone into those sites.
  • the first oligonucleotide can be designed to destroy the one of the restriction sites upon cloning and supply a functional restriction site on the opposite end. With this strategy, cleavage sites for the two original restriction enzymes are present in the new construct and the next oligonucleotide can be cloned into those sites. The cycle can be repeated until the desired number of oligonucleotides are cloned and the fransgene is assemble.
  • restriction sites for Bell (tgatca) and Mlul (acgcgt) the following composition can be used:
  • oligonucleotides for example, for clustered interference RNA
  • Linker sequences can be used to prevent unintentional structures from forming.
  • Non-compatible restriction sites can be used, for example, Bel I or Mlu I sites. These sites can be cloned directionally and upsfream sites can be destroyed and also re-supplied to the new vector in the downstream region in preparation for the next hairpin oligonucleotide.
  • the DNA constracts, templates and/or vectors disclosed herein can be inserted in either an exon or an intron of an endogenous gene. In a particular embodiment, the insertion does not alter the function of the target infron or exon.
  • the targeting strategy serves to maintain the functional integrity of the targeted gene while exploiting its endogenous regulatory capabilities to express the iRNA molecules in the cell.
  • Gene, including infronic and exonic, function can be assayed using functional assays to determine whether gene function has been compromised by the insertion.
  • iRNA molecules can be cloned into a vector.
  • the vector containing the iRNA molecules can further be introduced or inserted into a prokaryotic or eukaryotic cell, preferably resulting in expression of the iRNA molecules, one embodiment, the iRNA molecules can be operably linked to a promoter in the vector.
  • the promoter can be an exogenous or endogenous promoter, i an alternative embodiment, the iRNA molecules are cloned into a promoterless vector, and inserted into the genome of a eukaryotic cell, wherein the promoterless vector is under the confrol of a promoter and/or other regiulatory elements associated with an endogenous gene. In a particular embodiment, such promoeterless vectors do not disrupt cell homeostasis or the functioning of the endogenous gene.
  • “Expression vectors” include vectors that are capable of enhancing the expression of one or more iRNA molecules that have been inserted or cloned into the vector, upon transformation of the vector into a cell.
  • vector and “plasmid” are used interchangeably herein.
  • examples of vectors include, phages, autonomously replicating sequences (ARS), centromeres, and other sequences which are able to replicate or be replicated in vitro or in a cell, or to convey a desired nucleic acid segment to a desired location within a cell of an animal.
  • Expression vectors useful in the present invention include chromosomal-, episomal- and virus-derived vectors, e.g., vectors derived from bacterial plasmids or bacteriophages, and vectors derived from combinations thereof, such as cosmids and phagemids.
  • a vector can have one or more restriction endonuclease recognition sites at which the sequences can be cut in a determinable fashion without loss of an essential biological function of the vector, and into which a nucleic acid fragment can be spliced in order to bring about its replication and cloning.
  • Vectors can further provide primer sites, e.g., for PCR, transcriptional and or franslational initiation and or regulation sites, recombinational signals, replicons, selectable markers, etc.
  • primer sites e.g., for PCR, transcriptional and or franslational initiation and or regulation sites, recombinational signals, replicons, selectable markers, etc.
  • methods of inserting a desired nucleic acid fragment wliich do not require the use of homologous recombination, transpositions or restriction enzymes (such as, but not limited to, UDG cloning of PCR fragments (U.S. Pat. No. 5,334,575), TA Cloning® brand PCR cloning (Invitrogen Corp., Carlsbad, Calif.)) can also be applied to clone a nucleic acid into a vector to be used according to the present invention.
  • the vector can further contain one or more selectable markers to identify cells fransformed with the vector, such as the selectable markers and reporter genes described herein.
  • the iRNA containing expression vector is assembled to include a cloning region and a poly(U)-dependent PolIII franscription terminator.
  • any vector can be used to construct the iRNA containing expression vectors of the invention.
  • vectors known in the art and those commercially available (and variants or derivatives thereof) can, in accordance with the invention, be engineered to include one or more recombination sites for use in the methods of the invention.
  • vectors can be obtained from, for example, Vector Laboratories Inc., Invitrogen, Promega, Novagen, NEB, Clontech, Boehringer Mannheim, Pharmacia, EpiCenter, OriGenes Technologies Inc., Stratagene, PerkinElmer, Pharmingen, and Research Genetics.
  • General classes of vectors of particular interest include prokaryotic and/or eukaryotic cloning vectors, expression vectors, fusion vectors, two-hybrid or reverse two- hybrid vectors, shuttle vectors for use in different hosts, mutagenesis vectors, franscription vectors, vectors for receiving large inserts.
  • vectors of interest include viral origin vectors (Ml 3 vectors, bacterial phage ⁇ vectors, adenoviras vectors, and refroviras vectors), high, low and adjustable copy number vectors, vectors which have compatible replicons for use in combination in a single host (pACYC184 andpBR322) and eukaryotic episomal replication vectors (pCDM8).
  • viral origin vectors Ml 3 vectors, bacterial phage ⁇ vectors, adenoviras vectors, and refroviras vectors
  • high, low and adjustable copy number vectors vectors which have compatible replicons for use in combination in a single host
  • pCDM8 eukaryotic episomal replication vectors
  • Vectors of interest include prokaryotic expression vectors such as pcDNA II, pSL301, pSE280, pSE380, pSE420, pTrcHisA, B, and C, pRSET A, B, and C (Invitrogen, Corp.), pGEMEX-1, and pGEMEX-2 (Promega, Inc.), the pET vectors (Novagen, Inc.), pTrc99A, pKK223-3, the pGEX vectors, pEZZ18, pRIT2T, and pMC1871 (Pharmacia, Inc.), pKK233- 2 and pKK388-l (Clontech, e), and pProEx-HT (Invitrogen, Corp.) and variants and derivatives thereof.
  • prokaryotic expression vectors such as pcDNA II, pSL301, pSE280, pSE380, pSE420, pTrcHisA, B,
  • vectors of interest include eukaryotic expression vectors such as pFastBac, pFastBacHT, pFastBacDUAL, pSFV, and pTet-Splice (Invitrogen), pEUK-Cl, pPUR, pMAM, pMAMneo, pBHOl, pBI121, pDR2, pCMVEBNA, and pYACneo (Clontech), pSVK3, pSVL, pMSG, pCHHO, and pKK232-8 (Pharmacia, Inc.), p3'SS, pXTl, pSG5, pPbac, pMbac, pMClneo, and pOG44 (Stratagene, Inc.), and pYES2, pAC360, pBlueBacHis A, B, and C, pVL1392, pBlueBacIII,
  • vectors that can be used include pUC18, pUC19, pBlueScript, pSPORT, cosmids, phagemids, YAC's (yeast artificial chromosomes), BAC's (bacterial artificial chromosomes), PI (Escherichia coli phage), pQE70, pQE60, pQE9 (quagan), pBS vectors, PhageScript vectors, BlueScript vectors, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene), pcDNA3 (Invitrogen), pGEX, pTrsfus, pTrc99A, pET-5, pET-9, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pSPORTl, pSPORT2, pCMVSPORT2.0 and pSV-SPORTl (Invitrogen) and variants or derivatives
  • Viral vectors can also be used, such as lentiviral vectors (see, for example, WO 03/059923; Tiscornia et al. PNAS 100:1844-1848 (2003)). Additional vectors of interest include pTrxFus, pThioHis, pLEX, pTrcHis, pTrcHis2, pRSET, pBlueBacHis2, pcDNA3.1/His, pcDNA3.1(-)/Myc-His, pSecTag, pEBVHis, pPIC9K, pPIC3.5K, pAO815, pPICZ, pPICZ ⁇ , pGAPZ, pGAPZ ⁇ , pBlueBac4.5, pBlueBacHis2, pMelBac, pSinRep5, pSinHis, pIND, pIND(SPl), pVgRXR, pc
  • Two-hybrid and reverse two-hybrid vectors of interest include pPC86, pDBLeu, pDBTrp, pPC97, p2.5, pGADl-3, pGADIO, pACt, pACT2, pGADGL, pGADGH, pAS2-l, pGAD424, pGBT8, pGBT9, pGAD-GAL4, pLexA, pBD-GAL4, pHISi, pHISi-1, placZi, pB42AD, pDG202, pJK202, ⁇ JG4-5, pNLexA, pYESTrp and variants or derivatives thereof.
  • Promoters and enhancers consist of short anays of DNA sequences that interact specifically with cellular proteins involved in transcription (Maniatis et al., Science 236:1237 [1987]). Promoter and enhancer elements have been isolated from a variety of eukaryotic sources including genes in yeast, insect and mammalian cells, and viruses (analogous control elements, i.e., promoters, are also found in prokaryotes). The selection of a particular promoter and enhancer depends on what cell type is to be used to express the protein of interest.
  • eukaryotic promoters and enhancers have a broad host range while others are functional in a limited subset of cell types (for review see, Voss et al., Trends Biochem. Sci., 11 :287 [1986]; and Maniatis et al., supra).
  • the SV40 early gene enhancer is very active in a wide variety of cell types from many mammalian species and has been widely used for the expression of proteins in mammalian cells (Dijkema et al., EMBO J. 4:761 [1985]).
  • promoter/enhancer elements active in a broad range of mammalian cell types are those from the human elongation factor l ⁇ gene (Uetsuki et al., J. Biol. Chem., 264:5791 [1989]; Kim et al., Gene 91:217 [1990]; and Mizushima and Nagata, Nuc. Acids. Res., 18:5322 [1990]) and the long terminal repeats of the Rous sarcoma virus (Gorman et al., Proc. Natl. Acad. Sci.
  • promoter denotes a segment of DNA which contains sequences capable of providing promoter functions (i.e., the functions provided by a promoter element).
  • promoter elements i.e., the functions provided by a promoter element.
  • the promoter may be "endogenous” or “exogenous” or “heterologous.”
  • An "endogenous” promoter is one which is associated with a given gene in the genome.
  • an “exogenous” or “heterologous” promoter is one which is placed in juxtaposition to a gene by means of genetic manipulation (i.e., molecular biological techniques such as cloning and recombination) such that franscription of that gene is directed by the linked promoter. Promoters can also contain enhancer activities.
  • a. Endogenous promoters the operably linked promoter of the iRNA molecule containing vector is an endogenous promoter.
  • the endogenous promoter can be any unregulated promoter that allows for the continual franscription of its associated gene.
  • the promoter can be a constitutively active promoter. More preferably, the endogenous promoter is associated with a housekeeping gene.
  • Non limiting examples of housekeeping genes whose promoter can be operably linked to the iRNA include the conserved cross species analogs of the following human housekeeping genes; mitochondrial 16S rRNA, ribosomal protein L29 (RPL29), H3 histone, family 3B (H3.3B) (H3F3B), poly(A)-binding protein, cytoplasmic 1 (PABPCl), HLA-B associated franscript-1 (D6S81E), surfeit 1 (SURF1), ribosomal protein L8 (RPL8), ribosomal protein L38 (RPL38), catechol-O-methylfransferase (COMT), ribosomal protein S7 (RPS7), heat shock 27kD protein 1 (HSPB1), eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) (EEF1D), vimentin (VIM), ribosomal protein L41 (RPL41), carboxylesterase 2 (intestine, liver)
  • coli homolog 1 (colon cancer, nonpolyposis type 2) (MLH1), chromosome lq subtelomeric sequence D1S553./U06155, fibromodulin (FMOD), amino-terminal enhancer of split (AES), Rho GTPase activating protein 1 (ARHGAP1), non-POU-domain-containing, octamer-binding (NONO), v-raf murine sarcoma 3611 viral oncogene homolog 1 (ARAFl), heterogeneous nuclear ribonucleoprotein Al (HNRPAl), beta 2-microglobulin (B2M), ribosomal protein S27a (RPS27A), bromodomain-containing 2 (BRD2), azoospermia factor 1 (AZF1), upregulated by 1,25 dihydroxyvitamin D-3 (VDUP1), serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6 (SERPINB6), destt
  • the endogenous promoter can be a promoter associated with the expression of tissue specific or physiologically specific genes, such as heat shock genes. In this way, expression of the iRNA molecules can be tightly regulated.
  • the promoter can be an exogenous promoter, such as a ubiquitiously expressed promoeter, such a RNa polymerase promoeters, such as HI or U6; or constitutively active viral promoter.
  • a ubiquitiously expressed promoeter such as a RNa polymerase promoeters, such as HI or U6
  • constitutively active viral promoter include the RSN LTR, the SN40 early promoter, the CMV IE promoter, the adenoviras major late promoter, Sr ⁇ -promoter (a very strong hybrid promoter composed of the SV40 early promoter fused to the R/U5 sequences from the HTLV-I LTR), and the Hepatitis B promoter.
  • primers are designed and used to amplify coding regions of the target genes. Initially, the most highly expressed coding region from each gene is used to build a model control gene, although any coding or non coding region can be used. Each control gene is assembled by inserting each coding region between a reporter coding region and its poly(A) signal. These plasmids produce an mR ⁇ A with a reporter gene in the upstream portion of the gene and a potential iR ⁇ A target in the 3 ' non-coding region. The effectiveness of individual iR ⁇ As is assayed by suppression of the reporter gene.
  • Reporter genes useful in the methods of the present invention include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase (GUS), chloramphenicol acetylfransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase ( ⁇ OS), octopine synthase (OCS), and derivatives thereof.
  • AHAS acetohydroxyacid synthase
  • AP alkaline phosphatase
  • LacZ beta galactosidase
  • GUS beta glucoronidase
  • CAT chloramphenicol acetylfransferase
  • GFP green fluorescent protein
  • RFP red fluorescent protein
  • YFP yellow fluorescent protein
  • Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methofrexate, phosphinothricin, puromycin, and tetracycline.
  • Methods to detemiine suppression of a reporter gene are well known in the art, and include, but are not limited to, fluorometric methods (e.g. fluorescence specfroscopy, Fluorescence Activated Cell Sorting (FACS), fluorescence microscopy), antibiotic resistance determination.
  • iR ⁇ A containing vector is transfected into appropriate cell lines which express that target nucleic acid.
  • Each selected iR ⁇ A construct is tested for its ability to reduce steady-state mR ⁇ A of the target nucleic acid.
  • any target mRNAs that "survive" the first round of testing are amplified by reverse franscriptase-PCR and sequenced (see, for example, Sambrook, J. et al.
  • Transient expression of iRNA in one embodiment of the present invention, expression of the iRNA in a cell is transient.
  • Transient expression can be from an expression vector that does not insert into the genome of the cell.
  • transient expression can be from the direct insertion of iRNA molecules into the cell.
  • Any of the types of nucleic acids that mediate RNA interference can be synthesized in vifro using a variety of methods well known in the art and inserted directly into a cell.
  • dsRNA and other molecules that mediate RNA interference are available from commercial vendors, such as Ribopharma AG (Kulmach, Germany), Eurogentec (Seraing, Belgium), Sequitur (Natick, MA) and Invitrogen (Carlsbad, CA).
  • dsRNA that has been labeled with fluorophores (e.g., HEX/TET; 5 '-Fluorescein, 6-FAM; 3'- Fluorescein, 6-FAM; Fluorescein dT internal; 5' TAMRA, Rhodamine; 3' TAMRA, Rhodamine), which can also be used in the invention.
  • fluorophores e.g., HEX/TET; 5 '-Fluorescein, 6-FAM; 3'- Fluorescein, 6-FAM; Fluorescein dT internal; 5' TAMRA, Rhodamine; 3' TAMRA, Rhodamine
  • iRNA molecules can be made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Other methods for such synthesis that are known in the art can additionally or alternatively be employed.
  • oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • Lyer RP et al., Cun. Opin. Mol Ther. 1 :344-358 (1999); and Verma S, and Eckstein F., Annual Rev. Biochem. 67:99-134 (1998).
  • iRNA directly inserted into a cell can include modifications to either the phosphate- sugar backbone or the nucleoside.
  • the phosphodiester linkages of natural RNA can be modified to include at least one of a nitrogen or sulfur heteroatom.
  • the interfering RNA can be produced enzymatically or by partial/total organic synthesis.
  • the constructs can be synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (e.g., T3, T7, SP6). If synthesized chemically or by in vitro enzymatic synthesis, the RNA can be purified prior to introduction into a cell or animal. For example, RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography or a combination thereof as known in the art. Alternatively, the interfering RNA construct can be used without, or with a minimum of purification to avoid losses due to sample processing.
  • the iRNA construct can be dried for storage or dissolved in an aqueous solution.
  • the solution can contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.
  • buffers or salts that can be used in the present invention include, but are not limited to, saline, PBS, N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES®), 3-(N-Morpholino)propanesulfonic acid (MOPS), 2-bis(2-
  • Hydroxyethylene)amino-2-(hydroxymethyl)-l ,3-propanediol bis-TRIS®
  • potassium phosphate KP
  • sodium phosphate NaP
  • dibasic sodium phosphate Na2HPO4
  • monobasic sodium phosphate NaH2PO4
  • monobasic sodium potassium phosphate NaKHPO4
  • magnesium phosphate Mg3(PO4)2-4H2O
  • potassium acetate CH3COOH
  • D(+)- ⁇ -sodium glycerophosphate HOCH2CH(OH)CH2OPO3Na2 and other physiologic buffers known to those skilled in the art.
  • Additional buffers for use in the invention include, a salt M-X dissolved in aqueous solution, association, or dissociation products thereof, where M is an alkali metal (e.g., Li+, Na+, K+, Rb+), suitably sodium or potassium, and where X is an anion selected from the group consisting of phosphate, acetate, bicarbonate, sulfate, pyruvate, and an organic monophosphate ester, glucose 6-phosphate or DL- ⁇ -glycerol phosphate.
  • M is an alkali metal (e.g., Li+, Na+, K+, Rb+)
  • X is an anion selected from the group consisting of phosphate, acetate, bicarbonate, sulfate, pyruvate, and an organic monophosphate ester, glucose 6-phosphate or DL- ⁇ -glycerol phosphate.
  • Random Insertion Genomic Insertion of the iRNA containing vector can be accomplished using any known methods of the art.
  • the vector is inserted into a genome randomly using a viral based vector. Insertion of the virally based vector occurs at random sites consistent with viral behavior (see, for example, Daley et al. (1990) Science 247:824-830; Guild et al. (1988) J Virol 62:3795-3801; Miller (1992) Cun Topics MicroBiol Immunol 158:1-24; Samarut et al. (1995) Methods Enzymol 254:206-228).
  • Non limiting examples of viral based vectors include Moloney murine leukemia refroviras, the murine stem cell virus, vaccinia viral vectors, Sindbis virus, Semliki Forest alphavirus, EBV, ONYX- 15, adenoviras, or lentivirus based vectors (see, for example, Hemann MT et al. (2003) Nature Genet. 33:396-400; Paddison & Harmon (2002) Cancer Cell 2:17-23; Brummelkamp TR et al. (2002) Cancer Cell 2:243-247; Stewart SA et al. (2003) RNA 9:493-501 ; Rubinson DA et al. (2003) Nature Genen. 33:401-406; Qin X et al.
  • the fransgene is either cleaved from the vector or is maintained without a vector.
  • Vector removal can be important for certain transgene configurations previously described in the art (Kjer-Nielsen L, Holmberg K, Perera JD, McClus ey J. Impaired expression of chimaeric major histocompatibility complex transgenes associated with plasmid sequences. Transgenic Res. 1992 Jul; 1(4): 182-7.)
  • the "vectorless" fransgene is inserted into a genome randomly using any known method of the art. 2.
  • Targeted insertion In another embodiment, the insertion is targeted to a specific gene locus through homologous recombination.
  • Homologous recombination provides a precise mechanism for targeting defined modifications to genomes in living cells (see, for example, Vasquez KM et al. (2001) PNAS USA 98(15):8403-8410).
  • a primary step in homologous recombination is DNA strand exchange, which involves a pairing of a DNA duplex with at least one DNA strand containing a complementary sequence to form an intermediate recombination structure containing heteroduplex DNA (see, for example, Radding, C. M. (1982) Arm. Rev. Genet. 16: 405; U.S. Pat. No. 4,888,274).
  • the heteroduplex DNA can take several forms, including a three DNA strand containing triplex form wherein a single complementary sfrand invades the DNA duplex (see, for example,. Hsieh et al. (1990) Genes and Development 4: 1951; Rao et al., (1991) PNAS 88:2984)) and, when two complementary DNA sfrands pair with a DNA duplex, a classical Holliday recombination joint or chi structure (Holliday, R. (1964) Genet. Res. 5: 282) can form, or a double-D loop ("Diagnostic Applications of Double-D Loop Formation" U.S.Patent No. 5,273,881).
  • a heteroduplex structure can be resolved by sfrand breakage and exchange, so that all or a portion of an invading DNA sfrand is spliced into a recipient DNA duplex, adding or replacing a segment of the recipient DNA duplex.
  • a heteroduplex stracture can result in gene conversion, wherein a sequence of an invading sfrand is fransfened to a recipient DNA duplex by repair of mismatched bases using the invading sfrand as a template (see, for example, Genes, 3rd Ed. (1987) Lewin, B., John Wiley, New York, N.Y.; Lopez et al. (1987) Nucleic Acids Res. 15: 5643).
  • Cells useful for homologous recombination include, by way of example, epithelial cells, neural cells, epidermal cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, lymphocytes (B and T lymphocytes), erythrocytes, macrophages, monocytes, mononuclear cells, fibroblasts, cardiac muscle cells, and other muscle cells, etc.
  • the vector construct containing the iRNA template may comprise a full or partial sequence of one or more exons and/or infrons of the gene targeted for insertion, a full or partial promoter sequence of the gene targeted for insertion, or combinations thereof.
  • the nucleic acid sequence of the iRNA containing construct comprises a first nucleic acid sequence region homologous to a first nucleic acid sequence region of the gene targeted for insertion, and a second nucleic acid sequence region homologous to a second nucleic acid sequence region of the gene targeted for insertion.
  • the orientation of the vector construct should be such that the first nucleic acid sequence is upsfream of the second nucleic acid sequence and the iRNA template should be therebetween.
  • a nucleic acid sequence region(s) can be selected so that there is homology between the iRNA template containing vector construct sequence(s) and the gene of interest.
  • the construct sequences are isogenic sequences with respect to the target sequences.
  • the nucleic acid sequence region of the construct may conelate to any region of the gene provided that it is homologous to the gene.
  • a nucleic acid sequence is considered to be "homologous” if it is at least about 90% identical, preferably at least about 95% identical, or most preferably, about 98 % identical to the nucleic acid sequence.
  • the 5' and 3' nucleic acid sequences flanking the selectable marker should be sufficiently large to provide complementary sequence for hybridization when the construct is introduced into the genomic DNA of the target cell.
  • homologous nucleic acid sequences flanking the selectable marker gene should be at least about 500 bp, preferably, at least about 1 kilobase (kb), more preferably about 2-4 kb, and most preferably about 3-4 kb in length.
  • both of the homologous nucleic acid sequences flanking the selectable marker gene of the construct should be should be at least about 500 bp, preferably, at least about 1 kb, more preferably about 2-4 kb, and most preferably about 3-4 kb in length.
  • Another type of DNA sequence can be a cDNA sequence provided the cDNA is sufficiently large.
  • each of the flanking nucleic acid sequences used to make the construct is preferably homologous to one or more exon and/or infron regions, and/or a promoter region. Each of these sequences is different from the other, but may be homologous to regions within the same exon and/or infron. Alternatively, these sequences may be homologous to regions within different exons and or infrons of the gene.
  • the two flanking nucleic acid sequences of the construct are homologous to two sequence regions of the same or different introns of the gene of interest.
  • isogenic DNA can be used to make the construct of the present invention.
  • the nucleic acid sequences obtained to make the construct are preferably obtained from the same cell line as that being used as the target cell.
  • a targeting construct can be used in which a single region of homology is present.
  • a single homologous cross-over event produces an insertion within the homolgous regions.
  • This construct can either be supplied circular or is linear and spontaineously circularized within the cell via natural processes (Hasty P, Rivera-Perez J, Chang C, Bradley A. Target frequency and integration pattern for insertion and replacement vectors in embryonic stem cells. Mol Cell Biol. 1991 Sep;l 1(9):4509-17).
  • homologous recombination is used to insert an iRNA containing expression vector operably linked to a promoter into the genome of a cell, such as a fibroblast.
  • the DNA can comprise at least a portion of the gene at the particular locus with introduction of the expression vector into preferably at least one, optionally both copies, of the targeted gene.
  • an iRNA containing expression vector lacking a promoter can be inserted into an endogenous gene.
  • the insertion allows expression of the promoterless vector to be driven by the endogenous gene's associated promoter.
  • the vector is inserted into the 3' non-coding region of a gene.
  • the vector is inserted into a tissue specific or physiologically specific gene. For example, hepatocyte specific expression is provided by targeting an endogenous gene that is expressed in every hepatocyte at the desired level and temporal pattern.
  • a targeting vector is assembled such that the iRNA vector is inserted into a single allele of a housekeeping gene.
  • targeted housekeeping genes include the conserved cross species analogs of the following human housekeeping genes; mitochondrial 16S rRNA, ribosomal protein L29 (RPL29), H3 histone, family 3B (H3.3B) (H3F3B), poly(A)-binding protein, cytoplasmic 1 (PABPCl), HLA-B associated transcri ⁇ t-1 (D6S81E), surfeit 1 (SURF1), ribosomal protein L8 (RPL8), ribosomal protein L38 (RPL38), catechol-O-methyltransferase (COMT), ribosomal protein S7 (RPS7), heat shock 27kD protein 1 (HSPB1), eukaryotic franslation elongation factor 1 delta (guanine nucleotide exchange protein) (EEF1D), vimentin (VIM), ribo
  • coli homolog 1 (colon cancer, nonpolyposis type 2) (MLH1), chromosome lq subtelomeric sequence D1S553./U06155, fibromodulin (FMOD), amino-terrninal enhancer of split (AES), Rho GTPase activating protein 1 (ARHGAP1), non-POU-domain-containing, octamer-binding ( ⁇ O ⁇ O), v-raf murine sarcoma 3611 viral oncogene homolog 1 (ARAFl), heterogeneous nuclear ribonucleoprotein Al (HNRPAl), beta 2-microglobulin (B2M), ribosomal protein S27a (RPS27A), bromodomain-containing 2 (BRD2), azoospermia factor 1 (AZF1), upregulated by 1,25 dihydroxyvitamin D-3 (VDUPl), serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6 (SERPINB6)
  • SEZ23A actin, beta
  • ACTB presenilin 1 (Alzheimer disease 3)
  • PSEN1 interleukin-1 receptor-associated kinase 1
  • IRAKI interleukin-1 receptor-associated kinase 1
  • ZNF162 zinc finger protein 162
  • RPL34 ribosomal protein L34
  • BECN1 beclin 1 (coiled-coil, myosin-like BCL2- interacting protein)
  • BECN1 phosphatidylinositol 4-kinase, catalytic, alpha polypeptide (PIK4CA), IQ motif containing GTPase activating protein 1 (IQGAPl), signal transducer and activator of franscription 3 (acute-phase response factor) (STAT3), heterogeneous nuclear ribonucleoprotein F (HNRPF), putative translation initiation factor (SUIl), protein franslocation complex beta (SEC61B), ras homolog gene family, member A (AR
  • RER1 cerevisiae RER1 (RER1), hyaluronoglucosaminidase 2 (HYAL2), uroplakin 1A (UPK1A), nuclear pore complex interacting protein (NPIP), karyopherin alpha 4 (importin alpha 3) (KPNA4), ant the gene with multiple splice variants near HD locus on 4pl6.3 (RES4-22).
  • RER1 hyaluronoglucosaminidase 2
  • UPK1A uroplakin 1A
  • NPIP nuclear pore complex interacting protein
  • KPNA4 karyopherin alpha 4
  • an iRNA template containing vector is inserted into a targeted housekeeping gene within an infron of the target housekeeping gene.
  • the target housekeeping gene is prevented from being translated by insertion of a promoterless engineered iRNA template that contains multiple stop codons in the 3 ' end of the construct within an intron of the target gene.
  • the iRNA construct is spliced into the chromosome, potentially in frame with the upsfream of the exon comprising the target gene. This results in the expression of the iRNA template prior to the targeted housekeeping gene.
  • the iRNA template expression concomitantly inhibits expression of the housekeeping gene due to the presence of multiple stop codons downstream of the iRNA template.
  • a housekeeping gene targeting construct which contains a sequence with homology to an infron sequence of the target housekeeping gene, a downstream intron splice acceptor signal sequence comprising the AG dinucleotide splice acceptor site, a promoterless iRNA template engineered to contain multiple stop codons 3' of the iRNA tempalte, the infron splice donor signal sequence comprising the GT dinucleotide splice donor site for splicing the engineered iRNA template to the immediate downstream exon, and additional sequence with homology to the intron sequence of the target gene to aid with annealing to the target gene.
  • the 'promoter trap' sfrategy is used to insert the iRNA template containing vector in the target housekeeping gene by replacing an endogenous housekeeping exon with an in-frame, promoterless iRNA template containing vector.
  • the iRNA template containing vector is spliced into the chromosome and results in the expression of the iRNA template and concomitant inhibited expression of the full-length target housekeeping gene. Further, the iRNA template is under the control of the housekeeping gene's associated promoter.
  • This 'promoter trap' gene targeting construct may be designed to contain a sequence with homology to the target housekeeping gene 3' infron sequence upstream of the start codon, the upsfream infron splice acceptor sequence comprising the AG dinucleotide splice acceptor site, a Kozak consensus sequence, a promoterless iRNA template containing vector containing e.g., a polyA termination sequence, a splice donor sequence comprising the GT dinucleotide splice donor site from a infron region downstream of the start codon, and a sequence with 5' sequence homology to the downstream intron. It will be appreciated that the method may be used to target any exon within the targeted housekeeping gene.
  • the DNA is randomly inserted into the chromosome and is designed to signal its presence via the activation of a reporter gene, which both mimics the expression of the endogenous gene and potentially mutates the locus.
  • a reporter gene which both mimics the expression of the endogenous gene and potentially mutates the locus.
  • the iRNA involves the fransgene expression of a vector containing iRNA operably linked to a promoter through the use of an Epstein-Ban Virus (EBV) mini-chromosome vector.
  • EBV Epstein-Ban Virus
  • the siRNA template is embedded within a self-contaiained, sequence that is capable of functional as an intron.
  • the siRNA-containing infron is then inserted into an exon of an endogenous gene such that the resulting recombination allows siRNA expression under the confrol of the endogenous gene regulatory elements and does not prevent expression and franslation of the same endogenous gene.
  • the targeting construct can be inserted into a gene and render the gene inactivated, "knock-out" the gene.
  • the targeting conatructs produced according to the methods described herein can knockout xenoantigenic genes, such as alpha-l,3-galactosylfransferase (such as described in Phelps, et al, Science, 299: pp. 411-414 (2003) or WO 2004/028243).
  • xenoantigenic genes such as alpha-l,3-galactosylfransferase (such as described in Phelps, et al, Science, 299: pp. 411-414 (2003) or WO 2004/028243).
  • Additional genes that are considered potential barriers to xenofransplanataion and thus can be targeted include: the porcine iGb3 synthase gene (see, for example, USSN 60/517,524), the CMP-Neu5Ac hydroxylase gene (see, for example, USSN 10/863,116), and/or the Forssman synthase gene (see, for example, U.S. Patent Application 60/568,922).
  • the targeting constructs described herein can contain 5' and 3' targeting arms that are homologous to gene sequence encoding one or more of these xenoantigens.
  • heterozygous and/or homozygous knockouts can be produced, hi a particular embodiment, the targeting conatructs produced according to the methods described herein can produce iRNA molecules that repress the expression of PERV I porcine cells and knockout at least one xenoantigen.
  • the vectors or synthetic oligoncleotide contracts encoding the iRNA molecules can also include a selectable marker gene. The selectable marker gene can fused in reading frame with the upsfream sequence of the target gene.
  • the cells can be assayed functionally to determine whether successful targeting has occurred.
  • the cells can be analyzed bu restriction analysis, electrophoresis, Southern analysis, polymerase chain reaction, sequencing or another technique known in the art to determine whether appropriate integration of the DNA encoding the iRNA molecules has occurred.
  • Suitable selectable marker genes include, but are not limited to: genes conferring the ability to grow on certain media subsfrates, such as the tk gene (thymidine kinase) or the hprt gene (hypoxanthine phosphoribosylfransferase) which confer the ability to grow on HAT medium (hypoxanthine, aminopterin and thymidine); the bacterial gpt gene (guanine/xanthine phosphoribosylfransferase) which allows growth on MAX medium (mycophenolic acid, adenine, and xanthine).
  • selectable markers include: genes conferring resistance to compounds such as antibiotics, genes conferring the ability to grow on selected subsfrates, genes encoding proteins that produce detectable signals such as luminescence, such as green fluorescent protein, enhanced green fluorescent protein (eGFP).
  • genes conferring resistance to compounds such as antibiotics
  • genes conferring the ability to grow on selected subsfrates genes encoding proteins that produce detectable signals such as luminescence, such as green fluorescent protein, enhanced green fluorescent protein (eGFP).
  • eGFP enhanced green fluorescent protein
  • a wide variety of such markers are known and available, including, for example, antibiotic resistance genes such as the neomycin resistance gene (neo), Southern, P., and P. Berg, J. Mol. Appl. Genet.
  • selectable marker genes include: acetohydroxy acid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase (GUS), chloramphenicol acetylfransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof.
  • AHAS acetohydroxy acid synthase
  • AP alkaline phosphatase
  • LacZ beta galactosidase
  • GUS beta glucoronidase
  • CAT chloramphenicol acetylfransferase
  • GFP green fluorescent protein
  • RFP red fluorescent protein
  • YFP yellow fluorescent protein
  • CFP cyan fluorescent protein
  • Combinations of selectable markers can also be used.
  • Cells that have been homologously recombined to introduce DNA encoding iRNA molecules into the genome can then be grown in appropriately-selected medium to identify cells providing the appropriate integration. Those cells which show the desired phenotype can then be further analyzed by restriction analysis, electrophoresis, Southern analysis, polymerase chain reaction, or another technique known in the art. By identifying fragments which show the appropriate insertion at the target gene site, cells can be identified in which homologous recombination has occurred.
  • Cells which show the desired phenotype based on expression of iRNA molecules can then be further analyzed by restriction analysis, electrophoresis, Southern analysis, polymerase chain reaction, etc to analyze the DNA in order to establish whether homologous or non-homologous recombination occuned. This can be determined by employing probes for the insert and then sequencing the 5' and 3' regions flanking the insert for the presence of the DNA template encoding the iRNA molecule extending beyond the flanking regions of the construct. Primers can also be used which are complementary to a sequence within the construct and complementary to a sequence outside the construct and at the target locus.
  • One approach is to grow up a number of cells in which one copy has been modified and then to subject these cells to another round of targeting using a different selectable marker.
  • homozygotes can be obtained by breeding animals heterozygous for the modified allele, according to traditional Mendelian genetics.
  • iRNA molecules that regulate the expression of specific genes or family of genes are provided, such that the expression of the genes can be functionally eliminated.
  • at least two iRNA molecules are provided that target the same region of a gene, h another embodiment, at least two iRNA molecules are provided that target at least two different regions of the same gene. In a further embodiment, at least two iRNA molecules are provided that target at least two different genes. Additonal embodiments of the invention provide combinations of the above strategies for gene targeting.
  • the iRNA molecules can be the same sequence. In an alternate embodiment, the iRNA molecules can be different sequences. In another embodiment, the iRNA molecules can be integrated into either the same or different vectors or DNA templates.
  • the iRNA molecules within the vector or DNA template are operably linked to a promoter sequence, such as, for example, a ubiquitously expressed promoter or cell-type specific promoter.
  • the iRNA molecules within the vector or DNA template are not under the confrol of a promoter sequence.
  • these vectors or DNA templates can be introduced into a cell, hi one embodiment, the vector or DNA template can integrate into the genome of the cell.
  • the integration into the cell can either be via random integration or targeted integration.
  • the targeted integration can be via homologous recombination.
  • at least two iRNA molecules are provided wherein the families of one or more genes can be regulated by expression of the iRNA molecules.
  • At least three, four or five iRNA molecules are provided wherein the families of one or more genes can be regulated by expression of the iRNA molecules.
  • the iRNA molecule can be homologous to a conserved sequence within one or more genes.
  • the family of genes regulated using such methods of the invention can be endogenous to a cell, a family of related viral genes, a family of genes that are conserved within a viral genus, a family of related eukaryotic parasite genes, or more particularly a family of genes from a porcine endogenous retrovirus.
  • at least two iRNA molecules can target the at least two different genes, which are members of the same family of genes.
  • the iRNA molecules can target homologous regions within a family of genes and thus one iRNA molecule can target the same region of multiple genes.
  • the iRNA molecule can be selected from, but not limited to the following types of iRNA: antisense oligonucleotides, ribozymes, small interfering RNAs (siRNAs), double sfranded RNAs (dsRNAs), inverted repeats, short hairpin RNAs (shRNAs), small temporally regulated RNAs, and clustered inhibitory RNAs (ciRNAs), including radial clustered inhibitory RNA, asymmetric clustered inhibitory RNA, linear clustered inhibitory RNA, and complex or compound clustered inhibitory RNA.
  • expression of iRNA molecules for regulating target genes in mammalian cell lines or fransgenic animals is provided such that expression of the target gene is functionally eliminated or below detectable levels, i.e. the expression of the target gene is decreased by at least about 70%, 75%, 80%, 85%, 90%, 95%, 97% or 99%.
  • methods are provided to produce cells and animals in which interfering RNA molecules are expressed to regulate the expression of target genes.
  • Methods according to this aspect of the invention can comprise, for example: identifying one or more target nucleic acid sequences in a cell; obtaining at least two iRNA molecules that bind to the target nucleic acid sequence(s); introducing the iRNA molecules, optionally packaged in an expression vector, into the cell; and expressing the iRNAs in the cell under conditions such that the iRNAs bind to the target nucleic acid sequences, thereby regulating expression of one or more target genes.
  • the present invention provides methods of producing non-human fransgenic animals that heritably express at least two iRNA molecules that regulate the expression of one or more target genes.
  • the animals can be produced via somatic cell nuclear fransfer.
  • the somatic cell can be engineered to express the iRNA molecule by any of the techniques described herein.
  • the present invention also provides methods for the expression of at least two iRNA molecules in a cell or a transgenic animal, where the iRNA targets a common location within a family of genes.
  • Such methods can include, for example: identifying one or more target nucleic acid sequences in the cell that are homologous regions within a family of genes; preparing at least two iRNA molecules that bind to the target nucleic acid sequence(s); introducing the iRNA molecules, optionally packaged in an expression vector, into the cell; and expressing iRNAs in the cell or animal under conditions such that the iRNA molecules bind to the homologous region within the gene family.
  • the present invention also provides fransgenic non-human animals produced by the methods of the invention.
  • the methods of the invention are useful for the production of fransgenic non-human mammals (e.g. mice, rats, sheep, goats, cows, pigs, rabbits, dogs, horses, mules, deer, cats, monkeys and other non-human primates), birds (particularly chickens, ducks, and geese), fish, reptiles, amphibians, worms (e. g. C. elegans), and insects (including but not limited to, Mosquitos, Drosophila, Trichoplusa, and Spodoptera). While any species of non-human animal can be produced, in one embodiment the non-human animals are transgenic pigs.
  • the present invention also provides cells, tissues and organs isolated from such non-human fransgenic animals.
  • endogenous genes that can be regulated by the expression of at least two iRNA molecules include, but are not limited to, genes required for cell survival or cell replication, genes required for viral replication, genes that encode an immxmoglobulin locus, for example, Kappa light chain, and genes that encode a cell surface protein, for example, Vascular Cell Adhesion Molecule (VCAM) and other genes important to the structure and or function of cells, tissues, organs and animals.
  • VCAM Vascular Cell Adhesion Molecule
  • the methods of the invention can also be used to regulate the expression of one or more non-coding RNA sequences in a fransgenic cell or a fransgenic animal by heritable fransgene expression of interfering RNA.
  • These non-coding RNA sequences can be sequences of an RNA virus genome, an endogenous gene, a eukaryotic parasite gene, or other non-coding RNA sequences that are known in the art and that will be familiar to the ordinarily skilled artisan.
  • iRNA molecules that are expressed in cells or animals according to the aspects of the present invention can decrease, increase or maintain expression of one or more target genes.
  • a representative sample of sequences for each target gene can be obtained. Sequences can be compared to find similar and dissimilar regions. This analysis can determine regions of identity between all family members and within subsets (i.e. groups within the gene family) of family members. In addition, this analysis can determines region of identity between alleles of each family member.
  • target regions can be identified that specify the entire family, subsets of family members, individual family members, subsets of alleles of individual family members, or individual alleles of family members.
  • Regulation of expression can decrease expression of one or more target genes. Decreased expression results in post-franscriptional down-regulation of the target gene and ultimately the final product protein of the target gene.
  • the target nucleic acid sequences are identified such that binding of the iRNA to the sequence will decrease expression of the target gene.
  • Decreased expression of a gene refers to the absence of, or observable or detectable decrease in, the level of protein and/or mRNA product from a target gene relative to that without the introduction of the iRNA.
  • Complete suppression/inhibition as well as partial suppressed expression of the target gene are possible with the methods of the present invention.
  • partial suppressed expression it is meant that the target gene is suppressed (i.e. the expression of the target gene is reduced) from about 10% to about 99%, with 100% being complete suppression/inhibition of the target gene. For example, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or about 99% of gene expression of the one or more genes can be suppressed.
  • expression is suppressed or inhibited below detectable threshold limits.
  • regulation of expression can increase expression of one or more genes. Increased expression can result when the interfering RNA targets a nucleic acid sequence that acts as a suppressor of one or more genes of interest.
  • the target nucleic acid and the gene of interest can be separate sequences.
  • Increased expression of a gene refers to the presence, or observable increase, in the level of protein and/or mRNA product from one or more target genes relative to that without the introduction of the iRNA.
  • increased expression of a gene it is meant that the measurable amount of the target gene that is expressed is increased any amount relative to that without the introduction of the iRNA.
  • the level of expression of the gene can be increased about two-fold, about five-fold, about 10-fold, about 50-fold, about 100-fold, about 500-fold, about 1000-fold, or about 2000-fold, above that which occurs in the absence of the interfering RNA.
  • regulation of expression can maintain expression of one or more genes, when the one or more genes are placed under environmental conditions that generally lead to increased or decreased expression of the one or more genes.
  • Expression of one or more genes can be maintained under environmental conditions that would normally increase or decrease gene expression results in a steady-state level (i.e. no increase or decrease in expression with time) of gene expression relative to expression prior to the presence of environmental conditions that would otherwise increase or decrease expression.
  • Examples of environmental conditions that can increase gene expression include, but are not limited to, the presence of growth factors, increased glucose production, hyperthermia and cell cycle changes.
  • Examples of environmental conditions that can decrease gene expression include, but are not limited to, hypoxia, hypothermia, lack of growth factors and glucose depletion. Quantitation of gene expression can allow one to determine the degree of inhibition (or enhancement) of gene expression in a cell or animal that contain one or more iRNA molecules. Lower doses of injected material and longer times after administration or integration of the iRNA can result in inhibition or enhancement in a smaller fraction of cells or animals (e.g., at least 10%, 20%, 50%, 75%, 90%, or 95% of targeted cells or animals).
  • Quantitation of gene expression in a cell or animal can show similar amounts of inhibition or enhancement at the level of accumulation of target mRNA or translation of target protein.
  • the efficiency of inhibition or enhancement can be determined by assessing the amount of gene product in the cell or animal using any method known in the art.
  • mRNA can be detected with a hybridization probe having a nucleotide sequence outside the region used for the interfering RNA, or translated polypeptide can be detected with an antibody raised against the polypeptide sequence of that region.
  • the present invention also relates to the regulation of expression of a family of genes.
  • family of genes refers to one or more genes that have a similar function, sequence, or phenotype.
  • a family of genes can contain a conserved sequence, i.e. a nucleotide sequence that is the same or highly homologous among all members of the gene family.
  • the iRNA sequence can hybridize to this conserved region of a gene family, and thus one iRNA sequence can target more than one member of a gene family.
  • the target gene or family of genes are genes of an endogeous viras, for example, porcine endogenous retrovirus.
  • the target genes or gene family are genes of an exogenous virus.
  • exogenous viruses include, but are not limited to, zoonotic viruses (such as West Nile Virus, Hantavirus, Herpesviras, Parvovirus, Enterovirus, Rabies, Filoviruses, Human Immunodeficiency Viras, Influenza, and Napah Viras), livestock virases (such as Rinde ⁇ est virus, foot and mouth disease viras, and Marek's disease viras), synthetic viruses and endemic viruses.
  • zoonotic viruses such as West Nile Virus, Hantavirus, Herpesviras, Parvovirus, Enterovirus, Rabies, Filoviruses, Human Immunodeficiency Viras, Influenza, and Napah Viras
  • livestock virases such as Rinde ⁇ est virus, foot and mouth disease viras, and Marek's disease viras
  • synthetic viruses and endemic viruses any viral gene that is not heritable as an integral element of the genome (chromosomal or ex
  • the family of one or more genes of an exogenous viras that are regulated can be a family of related viral genes.
  • related viral genes include, but are not limited to, gag genes, env genes and pol genes, which are related as a family of retroviral genes.
  • the methods of the present invention can also be used to regulate expression of genes within an evolutionarily related family of genes.
  • Evolutionarily related genes are genes that have diverged from a common progenitor genetic sequence, which can or can not have itself been a sequence encoding for one or more mRNAs. Within this evolutionarily related family can exist a subset of genes, and within this subset, a conserved nucleotide sequence can exist.
  • the present invention also provides methods by which to regulate expression of this subset of genes by targeting the iRNA molecules to this conserved nucleotide sequence.
  • Evolutionarily related genes that can be regulated by the methods of the present invention can be endogenous or exogenous to a cell or an animal and can be members of a viral family of genes.
  • the family of viral genes that can be regulated by the methods of the present invention can have family members that are endogenous to the cell or animal.
  • the methods of the invention can be used to regulate the life-cycle of a virus. In one such aspect of the invention, this regulation can result in the truncation, or shortening, of the life-cycle of a virus.
  • truncation or shortening of the life-cycle it is meant that the viras survives for a shorter period of time than an identical virus that has not been regulated.
  • a shorter period of time encompasses any amount of time that is less than the life-cycle of an identical viras that has not been regulated.
  • the virus can survive for an amount of time that is about 1%, about 5%, about 10%, about 33%, about 50%, about 67%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% shorter than an identical viras that has not been regulated.
  • a virus that is said to have its life-cycle truncated 100% represents a virus that does not survive for any amount of time after treatment of the virus, or a host cell harboring the viras, with an iRNA.
  • the iRNA induced regulation can result in the expansion, or lengthening of the life cycle of a virus.
  • expansion or lengthening of the life-cycle it is meant that the virus survives for a longer period of time than an identical virus that has not been regulated.
  • a longer period of time encompasses any amount of time that is greater than the life-cycle of an identical viras that has not been regulated.
  • the virus can survive for an amount of time that is about two-fold, about five-fold, about 10-fold, about fold, about 50-fold, about 70-fold, about 100-fold, about 500-fold, about 1000-fold, about 2000-times, etc., longer than an identical virus that has not been regulated.
  • regulation of expression can maintain the life cycle of a virus, when the viras is placed under environmental conditions that generally lead to expansion or truncation of its life-cycle.
  • a life-cycle of a viras that is maintained under environmental conditions that would normally expand or truncate this life-cycle results in a steady-state (i.e.
  • the interfering RNA can also target a viral gene or family of viral genes, thereby regulating the life-cycle of the virus .
  • the methods of the present invention can be used to regulate expression of genes, or family of genes, that are endogenous to a cell or animal.
  • An endogenous gene is any gene that is heritable as an integral element of the genome of the animal species. Regulation of endogenous genes by methods of the invention can provide a method by which to suppress or enhance a phenotype or biological state of a cell or an animal.
  • phenotypes or biological states that can be regulated include, but are not limited to, shedding or transmission of a viras, feed efficiency, growth rate, palatability, prolificacy, secondary sex characteristics, carcass yield, carcass fat content, wool quality, wool yield, disease resistance, post-partum survival and fertility.
  • Additional endogenous genes that can also be regulated by the methods of the invention include, but are not limited to, endogenous genes that are required for cell survival, endogenous genes that are required for cell replication, endogenous genes that are required for viral replication, endogenous genes that encode an immunoglobulin locus, and endogenous genes that encode a cell surface protein. Further examples of endogenous genes include developmental genes (e.
  • adhesion molecules e.g., adhesion molecules, cyclin kinase inhibitors, Writ family members, Pax family members, Winged helix family members, Hox family members, cytokines/lymphokines and their receptors, growth/differentiation factors and their receptors, neurotransmitters and their receptors), tumor suppressor genes (e.g., APC, BRCAl, BRCA2, MADH4, MCC, NF 1, NF2, RB 1, TP53, and WTI) and enzymes (e.g., ACC synthases and oxidases, ACP desaturases and hydroxylases, ADP-glucose pyrophorylases, ATPases, alcohol dehydrogenases, amylases, amyloglucosidases, catalases, cellulases, chalcone synthases, chitinases, cyclooxygenases, decarboxylases, dextrinases, DNA and RNA polymera
  • the regulated genes, or family of genes are genes of an integrated endogenous viras.
  • integrated endogenous virus genes include, but are not limited to: porcine endogenous retrovirus (PERN) genes, oncogenes (e.
  • ABLI BCLI
  • BCL2 BCL6, CBFA2
  • CBL CSFIR
  • ERBA ERBB
  • ETSI ETS1, ETN6, FGR, FOS, FY ⁇ , HCR, HRAS, JU ⁇ , KRAS, LCK, LY ⁇ , MDM2, MLL, MYB, MYC, MYCLI, MYC ⁇ , ⁇ RAS, PIM 1, PML, RET, SRC, TALI, TCL3, and YES), growth factor receptor genes, B virus genes, and Simian T Lymphofrophic virus genes.
  • any viral gene that is inherited as an element of the genome of a species can be considered an endogenous viral gene and can be regulated by the methods of the invention.
  • the family of one or more genes that is regulated can be a family of related viral genes.
  • the methods of the present invention can also be used to regulate the expression of a specific allele. Alleles are polymorphic variants of a gene that occupy the same chromosomal locus. The methods of the present invention allow for regulation of one or more specific alleles of a gene or a family of genes.
  • the sequence of the iR ⁇ A can be prepared such that one or more particular alleles of a gene or a family of genes are regulated, while other additional alleles of the same gene or family of genes are not regulated.
  • the regulated gene or family of genes is a gene of a eukaryotic parasite. Examples of eukaryotic parasites include, but are not limited to, helminths, protozoa and arthropods.
  • the methods of the present invention allow for the regulation of expression of non-coding R ⁇ A sequences.
  • ⁇ on-coding R ⁇ A sequences are sequences that do not transcribe active proteins.
  • non-coding R ⁇ A sequences can be sequences of an endogenous or exogenous viral genome, they can be endogenous to the cell or animal, or they can also be sequences of a eukaryotic parasite.
  • the methods of the present invention allow for enrichment of homologous recombination events. If the siRNA fransgene is located "outside" of the homologous targeting arms, then the siRNA fransgene is not retained in the genome of the cell in which recombination has occurred. However, if the targeting vector integrates at a random location and therefore does not represent a homologous recombination event, the siRNA fransgene will be present in the genome of such cells.
  • siRNA transgene targets either a required gene, a gene that produces a selectable phenotype, or the selectable marker contained in the original targeting vector, then random integrations can be differentiated from targeting events. In this case, one can enrich for targeting events in relation to non-targeting integration events.
  • the regulated genes, or family of genes are genes of an integrated endogenous viras.
  • a prototype of an endogenous viras is PERV (porcine endogenous retrovirus).
  • porcine endogenous retrovirus (PERV) genes can be regulated by the expression of at least two iRNA molecules such that the expression of the PERV virus is functionally eliminated or below detection levels.
  • PERV refers to a family of retrovirus of which three main classes have been identified to date: PERV-A (Genbank Accession No. AF038601), PERV-B (EMBL Accession No. PERY17013) and PERV-C (Genbank Accession No.
  • iRNA directed to the PERV viras can decrease the expression of PERV by at least about 70%, 75%,80%, 85%, 90%, 95%, 97% or 99%, or alternatively, below detectable levels.
  • the present invention provides at least two iRNA molecules that target the same sequence within the gag, pol or env region of the PERV genome. Further, at least two iRNA molecules are provided that target different sequences within the gag, pol or env regions of the PERV genome. Still further, at least two iRNA molecules are provided that each target different regions (i.e. either gag, pol or env) of the PERV genome.
  • RNA interference molecules directed to the gag region of PERV; at least two RNA interference molecules directed to the pol region of PERV; and at least two RNA interference molecules directed to the env region of PERV are provided to target the PERV gene.
  • the present invention also provides porcine animals, as well as cells, tissues and organs isolated from non-human fransgenic animals in which the expression of PERV is decreased or functionally elkninated via the expression of at least two iRNA molecules.
  • transgenic pigs that express one or more interfering RNAs that interfere with the porcine endogenous retrovirus gene, a family member of the porcine endogenous retrovirus gene or a member of a subset of the porcine endogenous retrovirus gene family.
  • interfering RNAs that interfere with the porcine endogenous retrovirus gene, a family member of the porcine endogenous retrovirus gene or a member of a subset of the porcine endogenous retrovirus gene family.
  • PERVs porcine endogenous retroviruses
  • PERVs porcine endogenous retroviruses
  • PERVs are type-C family retrovirus, ubiquitously found in all pig cells, tissues or organs.
  • PERVs are an integral part of the pig genome with as many as 50 copies of PERV provirases per cell (Le Tissier et al, 1997). Most of the provirases are defective, and only very few of them are replication-competent (Herring et al, 2001).
  • PERV-A, -B and -C At least three distinct PERV sequences have been identified (PERV-A, -B and -C), which are classed according to relative homologies within three different env gene subfamilies (Takeuchi Y et al, 1998; Blusch 2002).
  • Perv-A and PERV-B show 92% amino-acid identity to one another and 63- 66% identity to gibbon ape leukemia virus, feline leukemia viras and Friend murine leukemia virus.
  • PERV-A and PERV-B have been detected from PK-15 (porcine kidney-derived) cells, activated peripheral blood mononuclear cells (PBMCs), pig pancreatic islets and porcine aortic endothelial cells (Martin et al, 1998; Takeuchi et al, 1998; Wilson et al, 1998). Both PERV-A and PERV-B are able to infect human and porcine cells, while PERV-C, an ecofropic retrovirus, has not been shown to be able to infect normal human cells. Infection and pseudotyping experiments have demonstrated that PERV -A, -B and -C use different cell receptors.
  • PERV numbers and integration sites are stable, hi addition, an artificial comfort is created because such pigs would have been selected for few functional or human-tropic PERVs.
  • most human-transmissible PERVs that have been characterized result from novel mRNA recombinations to generate new PERVs that were not in the original genome (Oldmixon et al, 2002).
  • a family of PERV genes can be regulated.
  • Related PERV viruses include, for example PERV A, PERV B, PERV C , and PERV D.
  • related PERV genes include, but are not limited to, gag genes, env genes and pol genes.
  • gag sequences can be found with the following Genbank accession numbers: AF038599, AF038600, AF147808, AF163266, AF417210, AF417211, AF417212, AF417213, AF417214, AF417215, AF417216, AF417217, AF417218, AF417219, AF417220, AF417221, AF435967, AW231947, AW308385 , AW358862, AY056035, AY099323, AY099324, AY265811, BF441465, BF441466, BF441468, BF441469 ; BF443400, BI181099, BI183356, BI186129, BI398794, BI399234, CB468878, CB46892 CB479915 or EMBL; AJ133816, AJ133817, AJ133818
  • pol sequences can be found with the following Genbank accession numbers: AF000572, AF033259, AF033260, AF038599, AF038600 AF147808, AF163265, AF163268, AF274705, AF402661, AF402662, AF402663 AF435966 , AF435967 , AF511088, AF511089, AF511090, AF511091, AF511092 AF511093, AF511094, AF511095, AF511096, AF511097, AF511098, AF511099 AW416859, AW435835, AW447645, AY056035, AY099323, AY099324, BE013835 BF709087, BF709087 , BIl 19493, BI183551, BI183551 , BI304652, BI336152, CB287225 CF178916, CF
  • AF318389 AF417222, AF417223, AF417224, AF417225, AF417226, AF417230,
  • erav-B sequences can be found with the following Genbank accession numbers: AF014162, AF426916, AF426932, AF426933, AF426935, AF426936, AF426937, AF426938, AF426939, AF426940, AF426946, AW657531, AY056024, AY056025, AY056026, AY056027, AY056028, AY056029, AY056030, AY056031, AY056032, AY056033, AY056034, BIl 18348, BI244560, CF180296, CF181717 or EMBL; AJ288586, AJ288587, AJ288588, AJ288589, AJ288590, AJ288591, AJ288592, Y12239.
  • Representative e «v-C sequences can be found with the following Genbank accession numbers: AF318383, AF318384, AF318385, AF318388, AF402660, AF417227, AF417228, AF417229, BI336316, BM190587.
  • Representative env-O sequences can be found with the following Genbank accesssion numbers: AF402661, AF402662, AF402663 or in US patent number 6,261,806.
  • the PERV-A, PERV-B, and PERV-C family of genes can be targeted simultaneously by at least two iRNA molecules, hi another embodiment, the virus is a subset of a porcine endogenous retrovirus family.
  • the cells, tissues and organs of pigs that contain iRNA molecules that regulate PERV can be used for xenofransplantation.
  • the constracts, templates and vectors described herein can be introduced into host cells via any technique known in the art, including but not limited to microinj ection, transfection, transformation, and/or electroporation.
  • the host cell can be any mammalian, plant, yeast or bacterial cell.
  • the host cell is a prokaryote, such as a bacterial cell including, but not limited to an Escherichia or a Pseudomonas species.
  • the host cell is a eukaryotic cell, for example an insect cell, including but not limited to a cell from a Spodoptera, Trichoplusia, Drosophila or an Estigmene species, or a mammalian cell, including but not limited to a human cell, murine cell, a porcine cell, a bovine cell, an ovine cell, a rodent cell, a hamster cell, a monkey, a primate or a human cell.
  • an insect cell including but not limited to a cell from a Spodoptera, Trichoplusia, Drosophila or an Estigmene species
  • a mammalian cell including but not limited to a human cell, murine cell, a porcine cell, a bovine cell, an ovine cell, a rodent cell, a hamster cell, a monkey, a primate or a human cell.
  • the mammalian cell can be a cell obtained from a variety of different organs and tissues such as, but not limited to, skin, mesenchyme, lung, pancreas, heart, intestine, stomach, bladder, blood vessels, kidney, urethra, reproductive organs, and a disaggregated preparation of a whole or part of an embryo, fetus or adult animal; or epithelial cells, fibroblast cells, neural cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, lymphocytes (B and T), macrophages, monocytes, mononuclear cells, cadiac muscle cells, other muscle cells, granulose cells, cumulus cells, epidermal cells or endothelial cells.
  • organs and tissues such as, but not limited to, skin, mesenchyme, lung, pancreas, heart, intestine, stomach, bladder, blood vessels, kidney, urethra, reproductive organs, and
  • the host cells can be HEK cells, COS cells, or other cell commonly used in cell culture.
  • the host cell is a plant cell, including, but not limited to, a tobacco cell, com, a cell from an Arabidopsis species, potato or rice cell.
  • the present invention also includes methods of producing non-human fransgenic animals which heritably express one or more interfering RNAs.
  • Any non-human transgenic animal can be produced by any one of the methods of the present invention including, but not limited to, non-human mammals (including, but not limited to, pigs, sheep, goats, cows (bovine), deer, mules, horses, monkeys and other non-human primates, dogs, cats, rats, mice, rabbits), birds (including, but not limited to chickens, turkeys, ducks, geese and the like) reptiles, fish, amphibians, worms (e.g. C. elegans), insects (including but not limited to, Drosophila, Trichoplusa, and Spodoptera).
  • non-human mammals including, but not limited to, pigs, sheep, goats, cows (bovine), deer, mules, horses, monkeys and other non-human primates, dogs, cats, rats, mice, rabbits
  • birds including, but
  • the present invention also provides a non-human fransgenic animal that has at least two iRNA sequences inserted in its genome.
  • the animal is capable of expressing the iRNA molecule -within the majority of its cells.
  • the animal is capable of expressing the iRNA molecule in virtually all of its cells. Since the sequence is incorporated into the genome of the animal, the iRNA molecules will be inherited by subsequent generations, thus allowing these generations to also produce the iRNA within their cells.
  • non-human fransgenic animals are produced via the process of nuclear fransfer.
  • the present invention provides methods of producing a non-human fransgenic animal through the genetic modification of totipotent embryonic cells.
  • non-human fransgenic animals are produced via the process of nuclear fransfer.
  • the nuclear donor cells can be genetically modified by the targeting constracts described herein to produce iRNA molecules.
  • Production of non-human fransgenic animals which express one or more interfering RNAs via nuclear transfer comprises: (a) identifying one or more target nucleic acid sequences in an animal; b) preparing one or more interfering RNAs, wherein the interfering RNAs bind to the target nucleic acid sequences; (c) preparing one or more expression vectors containing the one or more interfering RNAs; (d) inserting the one or more interfering RNA expression vectors into the genome of a nuclear donor cell; (e) transferring the genetic material of the nuclear donor cell to an acceptor cell; (f) transferring the acceptor cell to a recipient female animal; and (g) allowing the fransfened acceptor cell to develop to term in the female animal.
  • Any animal can be produced by nuclear transfer, including, but not limited to: porcine, bovine, ovine, equine, and rodents, including mice and rats, rabbits.
  • Nuclear fransfer techniques or nuclear transplantation techniques are known in the art (Campbell et al, Theriogenology, 43:181 (1995); Collas, et al, Mol. Report Dev., 38:264-267 (1994); Keefer et al, Biol. Reprod., 50:935-939 (1994); Sims, et al, Proc. Natl. Acad. Sci., USA, 90:6143-6147 (1993); WO 94/26884; WO 94/24274, and WO 90/03432, U.S. Pat.
  • the donor cell can be as described in Wilmut, et al, Nature 385 810 (1997); Campbell, et al., Nature 380 64-66 (1996); or Cibelli, et al, Science 280 1256-1258 (1998). All cells of normal karyotype, including embryonic, fetal and adult somatic cells which can be used successfully in nuclear fransfer can in principle be employed. Fetal fibroblasts are a particularly useful class of donor cells. Generally suitable methods of nuclear fransfer are described in Campbell, et al., Theriogenology 43 181 (1995), Collas, et al, Mol. Reprod. Dev. 38 264-267 (1994), Keefer, et al, Biol. Reprod.
  • Donor cells can also be, but do not have to be, in culture and can be quiescent.
  • Nuclear donor cells which are quiescent are cells which can be induced to enter quiescence or exist in a quiescent state in vivo.
  • Somatic nuclear donor cells may be obtained from a variety of different organs and tissues such as, but not limited to, skin, mesenchyme, lung, pancreas, heart, intestine, stomach, bladder, blood vessels, kidney, urethra, reproductive organs, and a disaggregated preparation of a whole or part of an embryo, fetus or adult animal.
  • nuclear donor cells are selected from the group consisting of epithelial cells, fibroblast cells, neural cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, lymphocytes (B and T), macrophages, monocytes, mononuclear cells, cadiac muscle cells, other muscle cells, granulose cells, cumulus cells, epidermal cells or endothelial cells.
  • the nuclear cell is an embryonic stem cell.
  • fibroblast cells can be used as donor cells.
  • the nuclear donor cells of the invention are germ cells of an animal.
  • nuclear donor cell Any germ cell of an animal species in the embryonic, fetal, or adult stage may be used as a nuclear donor cell.
  • the nuclear donor cell is an embryonic germ cell.
  • Nuclear donor cells may be anested in any phase of the cell cycle (GO, GI, G2, S, M).
  • Methods to confrol the cell cycle phase include, but are not lirnited to, GO quiescence induced by contact inhibition of cultured cells, GO quiescence induced by removal of serum or other essential nutrient, GO quiescence induced by senescence, GO quiescence induced by addition of a specific growth factor; GO or GI quiescence induced by physical or chemical means such as heat shock, hyperbaric pressure or other freatment with a chemical, hormone, growth factor or other substance; S-phase control via treatment with a chemical agent which interferes with any.
  • oocytes can be isolated from the ovaries or reproductive tract of an animal. A readily available source of animal oocytes is slaughterhouse materials.
  • oocytes For the combination of techniques such as genetic engineering, nuclear fransfer and cloning, oocytes must generally be matured in vifro before these cells can be used as recipient cells for nuclear fransfer, and before they can be fertilized by the sperm cell to develop into an embryo.
  • This process generally requires collecting immature (prophase I) oocytes from mammalian ovaries, e.g., bovine ovaries obtained at a slaughterhouse, and maturing the oocytes in a maturation medium prior to fertilization or enucleation until the oocyte attains the metaphase II stage, which in the case of bovine oocytes generally occurs about 18-24 hours post-aspiration. This period of time is known as the "maturation period".
  • a metaphase II stage oocyte can be the recipient oocyte, at this stage it is believed that the oocyte can be or is sufficiently "activated” to treat the introduced nucleus as it does a fertilizing sperm.
  • Metaphase II stage oocytes which have been matured in vivo have been successfully used in nuclear transfer techniques. Essentially, mature metaphase II oocytes can be collected surgically from either non-superovulated or superovulated porcine 35 to 48, or 39-41, hours past the onset of estras or past the injection of human chorionic gonadofropin (hCG) or similar hormone.
  • hCG human chorionic gonadofropin
  • the oocytes can be enucleated. Prior to enucleation the oocytes can be removed and placed in appropriate medium, such as HECM containing 1 milligram per milliliter of hyaluronidase prior to removal of cumulus cells. The stripped oocytes can then be screened for polar bodies, and the selected metaphase II oocytes, as determined by the presence of polar bodies, are then used for nuclear transfer. Enucleation follows. Enucleation can be performed by known methods, such as described in U.S. Pat. No. 4,994,384.
  • metaphase II oocytes can be placed in either HECM, optionally containing 7.5 micrograms per milliliter cytochalasin B, for immediate enucleation, or can be placed in a suitable medium, for example an embryo culture medium such as CRlaa, plus 10%) estras cow serum, and then enucleated later, preferably not more than 24 hours later, and more preferably 16-18 hours later. Enucleation can be accomplished microsurgically using a micropipette to remove the polar body and the adjacent cytoplasm. The oocytes can then be screened to identify those of which have been successfully enucleated.
  • a suitable medium for example an embryo culture medium such as CRlaa, plus 10%
  • One way to screen the oocytes is to stain the oocytes with 1 microgram per milliliter 33342 Hoechst dye in HECM, and then view the oocytes under ultraviolet irradiation for less than 10 seconds.
  • the oocytes that have been successfully enucleated can then be placed in a suitable culture medium, for example, CRlaa plus 10% serum.
  • a single mammalian cell of the same species as the enucleated oocyte can then be fransfened into the perivitelline space of the enucleated oocyte used to produce the NT unit.
  • the mammalian cell and the enucleated oocyte can be used to produce NT units according to methods known in the art.
  • the cells can be fused by elecfrofusion.
  • Elecfrofusion is accomplished by providing a pulse of electricity that is sufficient to cause a transient breakdown of the plasma membrane. This breakdown of the plasma membrane is very short because the membrane reforms rapidly. Thus, if two adjacent membranes are induced to breakdown and upon reformation the lipid bilayers intermingle, small channels can open between the two cells. Due to the thermodynamic instability of such a small opening, it enlarges until the two cells become one. See, for example, U.S. Pat. No. 4,997,384 by Prather et al. A variety of elecfrofusion media can be used including, for example, sucrose, mannitol, sorbitol and phosphate buffered solution.
  • Fusion can also be accomplished using Sendai virus as a fusogenic agent (Graham, Wister Inot. Symp. Monogr., 9, 19, 1969).
  • the nucleus can be injected directly into the oocyte rather than using electroporation fusion. See, for example, Collas and Barnes, Mol. Reprod. Dev., 38:264-267 (1994).
  • the resultant fused NT units are then placed in a suitable medium until activation, for example, CRlaa medium. Typically activation can be effected shortly thereafter, for example less than 24 hours later, or about 4-9 hours later.
  • the NT unit can be activated by any method that accomplishes the desired result.
  • Such methods include, for example, culturing the NT unit at sub-physiological temperature, in essence by applying a cold, or actually cool temperature shock to the NT unit. This can be most conveniently done by culturing the NT unit at room temperature, which is cold relative to the physiological temperature conditions to which embryos are normally exposed.
  • activation can be achieved by application of known activation agents. For example, penetration of oocytes by sperm during fertilization has been shown to activate prefusion oocytes to yield greater numbers of viable pregnancies and multiple genetically identical animals, such as pigs, after nuclear transfer. Also, treatments such as electrical and chemical shock can be used to activate NT embryos after fusion. See, for example, U.S. Pat. No.
  • activation can be effected by simultaneously or sequentially by increasing levels of divalent cations in the oocyte, and reducing phosphorylation of cellular proteins in the oocyte. This can generally be effected by introducing divalent cations into the oocyte cytoplasm, e.g., magnesium, strontium, barium or calcium, e.g., in the form of an ionophore.
  • divalent cations include the use of electric shock, treatment with ethanol and treatment with caged chelators.
  • Phosphorylation can be reduced by known methods, for example, by the addition of kinase inhibitors, e.g., serine-threonine kinase inhibitors, such as 6-dimethyl-aminopurine, staurosporine, 2-aminopurine, and sphingosine.
  • kinase inhibitors e.g., serine-threonine kinase inhibitors, such as 6-dimethyl-aminopurine, staurosporine, 2-aminopurine, and sphingosine.
  • phosphorylation of cellular proteins can be inhibited by introduction of a phosphatase into the oocyte, e.g., phosphatase 2A and phosphatase 2B.
  • the activated NT units can then be cultured in a suitable in vifro culture medium until the generation of cell colonies. Culture media suitable for culturing and maturation of embryos are well known in the art.
  • Examples of known media which can be used for embryo culture and maintenance, include Ham's F- 10+10% fetal calf serum (FCS), Tissue Culture Medium-199 (TCM-199)+10% fetal calf serum, Tyrodes-Albumin-Lactate-Pyruvate (TALP), Dulbecco's Phosphate Buffered Saline (PBS), Eagle's and Whitten's media.
  • FCS fetal calf serum
  • TCM-199 +10% fetal calf serum
  • TCM-199 Tissue Culture Medium-199
  • TCM-199 +10% fetal calf serum
  • TCM-199 Tyrodes-Albumin-Lactate-Pyruvate
  • PBS Dulbecco's Phosphate Buffered Saline
  • Eagle's and Whitten's media Eagle's and Whitten's media.
  • Suitable feeder layers include, by way of example, fibroblasts and epithelial cells.
  • the NT units are cultured on the feeder layer until the NT units reach a size suitable for transferring to a recipient female, or for obtaining cells which can be used to produce cell colonies.
  • these NT units can be cultured until at least about 2 to 400 cells, more preferably about 4 to 128 cells, and most preferably at least about 50 cells.
  • Activated NT units can then be fransfened (embryo fransfers) to the oviduct of an female animals.
  • the female animals can be an estrus-synchronized recipient gilt.
  • Crossbred gilts large white/Duroc/Landrace) (280-400 lbs) can be used.
  • the gilts can be synchronized as recipient animals by oral administration of 18-20 mg ReguMate (Alfrenogest, Hoechst, Wanen, NJ) mixed into the feed. Regu-Mate can be fed for 14 consecutive days. One thousand units of Human Chorionic Gonadofropin (hCG, hitervet America, Millsboro, DE) can then be administered i.m. about 105 h after the last Regu-Mate freatment. Embryo fransfers of the can then be performed about 22-26 h after the hCG injection.
  • the pregnancy can be brought to term and result in the birth of live offspring. In another embodiment, the pregnancy can be 5 terminated early and embryonic cells can be harvested.
  • the methods for embryo fransfer and recipient animal management in the present invention are standard procedures used in the embryo fransfer industry. Synchronous fransfers are important for success of the present invention, i.e., the stage of the NT embryo is in synchrony with the estras cycle of the recipient female. See, for example, Siedel, G. E., Jr. "Critical review of embryo fransfer procedures with cattle” in Fertilization and Embryonic Development in Vitro (1981) L. Masfroianni, Jr. and J. D. Biggers, ed., Plenum Press, New York, N.Y., page 323.
  • transgenic animals can be produced by any means known in the art, including, but not limited to the following: microinj ection of DNA into oocytes, zygotes or pre-implantation blastomeres (such as 2 cell, 4 cell or 8 cell blastomers), transfection of embryonic stem cells, sperm-mediated deliver of DNA and fransfecting embryons in vivo via the blood steam.
  • the present invention provides methods of producing a non- human fransgenic animal that express at least two interfering RNAs through the genetic modification of totipotent embryonic cells.
  • the animals can be produced by: (a) identifying one or more target nucleic acid sequences in an animal; (b) preparing one or more interfering RNAs, wherein the interfering RNAs bind to the target nucleic acid sequences; (c) preparing one or more expression vectors containing the one or more interfering RNAs; (d) inserting the one or more interfering RNA expression vectors into the genomes of a plurality of totipotent cells of the animal species, thereby producing a plurality of fransgenic totipotent cells; (e) obtaining a tefraploid blastocyst of the animal species; (f) inserting the plurality of totipotent cells into the tefraploid blastocyst, thereby producing a fransgenic embryo; (g) transferring the embryo to a recipient female animal; and (h) allowing the embryo to develop to term in the female animal.
  • the totipotent cells can be embryonic stem (ES) cells.
  • ES embryonic stem
  • the isolation of ES cells from blastocysts, the establishing of ES cell lines and their subsequent cultivation are carried out by conventional methods as described, for example, by Doetchmann et al., J. Embryol. Exp. Mo ⁇ h. 87:27-45 (1985); Li et al., Cell 69:915-926 (1992); Robertson, E. J. "Tefracarcinomas and Embryonic Stem Cells: A Practical Approach," ed. E. J.
  • the totipotent cells can be embryonic germ (EG) cells.
  • Embryonic Germ cells are undifferentiated cells functionally equivalent to ES cells, that is they can be cultured and transfected in vifro, then contribute to somatic and germ cell lineages of a chimera (Stewart et al., Dev. Biol. 161:626-628 (1994)).
  • EG cells are derived by culture of primordial germ cells, the progenitors of the gametes, with a combination of growth factors: leukemia inhibitory factor, steel factor and basic fibroblast growth factor (Matsui et al., Cell 70:841-847 (1992); Resnick et al., Nature 359:550-551 (1992)).
  • Tetraploid blastocysts for use in the invention can be obtained by natural zygote production and development, or by known methods by elecfrofusion of two-cell embryos and subsequently cultured as described, for example, by James et al., Genet. Res. Camb. 60:185- 194 (1992); Nagy and Rossant, "Gene Targeting: A Practical Approach,” ed. A. L. Joyner, IRL Press, Oxford, England (1993); or by Kubiak and Tarkowski, Exp.
  • a "plurality" of totipotent cells can encompass any number of cells greater than one.
  • the number of totipotent cells for use in the present invention can be about 2 to about 30 cells, about 5 to about 20 cells, or about 5 to about 10 cells.
  • about 5-10 ES cells taken from a single cell suspension are injected into a blastocyst immobilized by a holding pipette in a micromanipulation apparatus.
  • the embryos are incubated for at least 3 hours, possibly overnight, prior to introduction into a female recipient animal via methods known in the art (see for example Robertson, E. J. "Teratocarcinomas and Embryonic Stem Cells: A Practical Approach” IRL Press, Oxford, England (1987)) .
  • the embryo can then be allowed to develop to term in the female animal.
  • the methods of producing transgenic animals whether utilizing nuclear fransfer, embryo generation, or other methods known in the art, result in a fransgenic animal comprising a genome that does not contain significant fragments of the expression vector used to fransfer the iRNA molecules.
  • significant fragment of the expression vector denotes an amount of the expression vector that comprises about 10% to about 100% of the total original nucleic acid sequence of the expression vector. This excludes the iRNA insert portion that was fransfened to the genome of the transgenic animal. Therefore, for example, the genome of a transgenic animal that does NOT contain significant fragments of the expression vector used to fransfer the iRNA, can contain no fragment of the expression vector, outside of the sequence that contains the iRNA.
  • the genome of a transgenic animal that does not contain significant fragments of the expression vector used to transfer the iRNA can contain about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, or about 10% of the expression vector, outside of the sequence that contains the iRNA. Any method which allows transfer of the iRNA sequence to the genome while also limiting the amount of the expression vector that is also fransfened to a fragment that is not significant can be used in the methods of the present invention.
  • One embodiment of the invention which allows fransfer of the iRNA sequence to the genome while also limiting the amount of the expression vector that is also transferred to a fragment that is not significant, is the method of recombinational cloning, see, for example, U.S. Patent Nos. 5,888,732 and 6,277,608.
  • Recombinational cloning (see, for example, U.S. Patent Nos. 5,888,732 and 6,277,608) describes methods for moving or exchanging nucleic acid segments using at least one recombination site and at least one recombination protein to provide chimeric DNA molecules.
  • One method of producing these chimeric molecules which is useful in the methods of the present invention to produce the iRNA expression vectors comprises: combining in vifro or in vivo, (a) one or more nucleic acid molecules comprising the one or more iRNA sequences of the invention flanked by a first recombination site and a second recombination site, wherein the first and second recombination sites do not substantially recombine with each other; (b) one or more expression vector molecules comprising a third recombination site and a fourth recombination site, wherein the third and fourth recombination sites do not substantially recombine with each other; and (c) one or more site specific recombination proteins capable of recombining the first and third recombinational sites and/or the second and fourth recombinational sites, thereby allowing recombination to occur, so as to produce at least one cointegrate nucleic acid molecule which comprises the one or more iRNA sequences.
  • Recombination sites and recombination proteins for use in the methods of the present invention include, but are not limited to those described in U.S. Patent Nos. 5,888,732 and 6,277,608, such as, Cre/loxP, Integrase ( ⁇ lnt, Xis, IHF and FIS)/att sites (attB, attP, attL and attR), and FLP/FRT.
  • Cre/loxP Integrase ( ⁇ lnt, Xis, IHF and FIS)/att sites
  • attB, attP, attL and attR the resolvase family
  • the resolvase family e.g., gd, Tn3 resolvase, Hin, Gin, and Cin are also known and can be used in the methods of the present invetion.
  • cell extracts can be used or the enzymes can be partially purified using procedures described for Cre and Int.
  • the family of enzymes, the fransposases have also been used to fransfer genetic information between replicons and can be used in the methods of the present invention to fransfer iRNAs.
  • Transposons are structurally variable, being described as simple or compound, but typically encode the recombinase gene flanked by DNA sequences organized in inverted orientations. Integration of transposons can be random or highly specific. Representatives such as Tn7, which are highly site-specific, have been applied to the in vivo movement of DNA segments between replicons (Lucklow et al., J. Virol.
  • Devine and Boeke disclose the construction of artificial transposons for the insertion of DNA segments, in vifro, into recipient DNA molecules.
  • the system makes use of the integrase of yeast TY1 virus-like particles.
  • the nucleic segment of interest is cloned, using standard methods, between the ends of the fransposon-like element TY1.
  • the resulting element integrates randomly into a second target DNA molecule. Additional recombination sites and recombination proteins, as well as mutants, variants and derivatives thereof, for example, as described in U.S. Patent Nos.
  • 5,888,732, 6,277,608 and 6,143,557 can also be used in the methods of the present invention.
  • the iRNA nucleic acid sequences can be fransfened to the genome of a target cell via recombinational cloning.
  • the recombination proteins flanking the iRNA are capable of recombining with one or more recombination proteins in the genome of the target cell, h combination with one or more site specific recombination proteins capable of recombining the recombination sites, the iRNA sequence is fransfened to the genome of the target cell without transferring a significant amount of the remaining expression vector to the genome of the target cell.
  • the recombination sites in the genome of the target cell can occur naturally or the recombination sites can be introduced into the genome by any method known in the art.
  • the recombination sites flanking the one or more iRNA sequences in the expression vector must be complementary to the recombination sites in the genome of the target cell to allow for recombinational cloning.
  • Another embodiment of the invention relates to methods to produce a non-human fransgenic or chimeric animal comprising crossing a male and female non-human fransgenic animal produced by any one of the methods of the invention to produce additional fransgenic or chimeric animal offspring.
  • the progeny produced by this cross also contain the iRNA sequences in their genome. This crossing pattern can be repeated as many times as desired.
  • a male or female non-human fransgenic animal produced by the methods of the invention can be crossed with a female or male animal respectively, wherein the second female or male animal involved in the cross is not a non-human transgenic animal produced by the methods of the invention. Since iRNA is dominant in nature, the progeny from these crosses can also express the iRNA sequences in this genomes. Crosses where at least one animal is a non-human transgenic animal of the present invention can result in progeny that possess the iRNA sequences in their genomes.
  • semen from a male non-human fransgenic animal produced by the methods of the invention can be used to impregnate female animals and produce progeny that contain the iRNA sequences in their genome.
  • the non-human fransgenic animals of the present invention can also be used as sources for therapeutic proteins expressed from fransgenes.
  • the methods of the present invention can be used to reduce the amount of one or more endogenous proteins expressed by an animal.
  • the fransgene expression can be targeted to specific tissues or cells types to provide compartmentalized isolation of such proteins.
  • a protein can be concentrated in milk of a fransgenic animal by driving expression of the protein from a mammary specific promoter.
  • a transgene can be selectively expressed in a specific cell type to allow for specific processing.
  • a human immunoglobulin locus can be used to direct recombination, expression, and processing of human polyclonal antibodies in livestock B- cells.
  • proteins endogenous to the animal can contaminate the material collected (i.e. peptides, proteins and nucleic acids) for purification and ultimate use in a therapeutic setting. While contaminating proteins can be evolutionarily unrelated, they can co-purify with the desired product. Alternatively, the contaminating protein can be the endogenous counte ⁇ art of the fransgene product. In either case, a reduction in expression of the endogenous gene or genes is beneficial from both an economic and therapeutic standpoint.
  • One embodiment of the methods of the invention is the reduction of endogenous immunoglobulin genes to allow production of non-chimeric, non-contaminated human polyclonal antibodies in transgenic animals.
  • the present invention provides iRNA-mediated gene regulation in non-human fransgenic animals via knockout/inhibition of the entire repertoire of endogenous immunoglobulin (Ig) gene loci, and replacement of the animal Ig genes with their human equivalents.
  • Ig immunoglobulin
  • non-human fransgenic animals producing human polyclonal antibodies have important applications in biowarfare countermeasxxres, whereby the animals are immunized with any of the known infectious disease pathogens, or their products, and produce specific human antibodies (preferably IgG), for use as a therapeutic, or for passive immunization of Armed Forces personnel.
  • human polyclonal antibodies derived from animals is broad-spectrum, and not limited to one or a few pathogenic organisms. Any immunogen could be used to immunize these animals, to induce the production of antibodies for prophylaxsis from a variety of pathogenic organisms including, but not limited to, anthrax, staphylococcus, gram negative bacteria, Ebola virus, and Hanta virus.
  • Additional immunogen include, but are not limited to, venoms, and bacterial toxins.
  • the production of human antibodies in animals has the advantage of scale, given that depending on whether they were isolated from blood or milk, one could obtain 2-5 kilograms of specific antibody per animal (especially when considering the use of porcine, ovine or bovine) per year, such that a small number of animals could easily supply the needs of thousands of patients.
  • Antibodies to many of these organisms are currently unavailable in any significant quantity due to their rarity in the general developed population, and because they cannot be used as immunogens in any form in humans due to their viralence/toxicity. Also, because these antibodies are fully human, they are far superior in specificity, avidity, and potency to anti- serums cunently being produced in horses and goats.
  • mice Precedence for this application has been achieved in mice, using mouse ES cell technology.
  • Mendez et.al. (Nature Genet. 15:146-156, (1997)) demonstrated functional fransplantation of megabase human immunoglobulin loci into Ig-deficient knockout mice, and observed human antibody production in these mice that closely resembled that seen in humans.
  • the methods of the present invention provides for production of human polyclonal antibodies in transgenic cattle, sheep and pigs. Cattle can be produced that expressed human immunoglobxilins, these bovine however have limited utility because of antibody chimerism and contamination of endogenous antibodies. A method to render the bovine genes inactive is highly desirable from the point of view of both production and purification.
  • RNA interference via the methods of the present invention allows one to inactivate/suppress the highly repetitive livestock Ig genes with relatively few inhibitory RNAs, and without the requirement of having to clone out large pieces of uncharacterized genomic DNA.
  • Cloned animals that expressed human Ig genes in the absence of livestock Igs, produce human polyclonal antibodies that are then easily purified without the issues of contamination from the endogenous animal Igs.
  • Methods to purify antibodies isolated from the non-human fransgenic animals of the present invention are known in the art (see for example Sambrook, J. et al. "Molecular Cloning: A Laboratory Manual", 2nd addition, Cold Spring Harbor Laboratory Press, Plainview, New York (1989)).
  • the invention provides organs, tissues and/or purified or substantially pure cells or cell lines obtained from animals that express iRNA molecules.
  • organs any organ can be used, including, but not limited to: brain, heart, lungs, glands, brain, eye, stomach, spleen, pancreas, kidneys, liver, intestines, uterus, bladder, skin, hair, nails, ears, nose, mouth, lips, gums, teeth, tongue, salivary glands, tonsils, pharynx, esophagus, large intestine, small intestine, rectum, anus, pylorus, thyroid gland, thymus gland, suprarenal capsule, bones, cartilage, tendons, ligaments, skeletal muscles, smooth muscles, blood vessels, blood, spinal cord, frachea, ureters, urethra, hypothalamus, pituitary, adrenal glands, ovaries, oviducts, uterus, vagina, mammary glands, test
  • the invention provides tissues. Any tissue can be used, including, but not limited to: epithelium, connective tissue, blood, bone, cartilage, muscle, nerve, adenoid, adipose, areolar, bone, brown adipose, cancellous, muscle, cartaginous, cavernous, chondroid, chromaffin, dartoic, elastic, epithelial, fatty, fibrohyaline, fibrous, Gamgee, gelatinous, granulation, gut-associated lymphoid, Haller's vascular, hard hemopoietic, indifferent, interstitial, investing, islet, lymphatic, lymphoid, mesenchymal, mesonephric, mucous connective, multilocular adipose, myeloid, nasion soft, nephrogenic, nodal, osseous, osteogenic, osteoid, periapical, reticular, retiform, rubber, skeletal muscle, smooth muscle, and sub
  • the invention provides cells and cell lines from animals that express iRNA molecules, hi one embodiment, these cells or cell lines can be used for xenofransplantation.
  • Cells from any tissue or organ can be used, including, but not limited to: epithelial cells, fibroblast cells, neural cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, lymphocytes (B and T), macrophages, monocytes, mononuclear cells, cardiac muscle cells, other muscle cells, granulosa cells, cumulus cells, epidermal cells, endothelial cells, Islets of Langerhans cells, pancreatic insulin secreting cells, pancreatic alpha-2 cells, pancreatic beta cells, pancreatic alpha-1 cells, blood cells, blood precursor cells, bone cells, bone precursor cells, neuronal stem cells, primordial stem cells., hepatocytes, keratinocytes, umbilical vein endothelial cells, aortic
  • pancreatic cells including, but not limited to, Islets of Langerhans cells, insulin secreting cells, alpha-2 cells, beta cells, alpha-1 cells from pigs that lack expression of functional alpha-1, 3-GT are provided.
  • Nonviable derivatives include tisssues stripped of viable cells by enzymatic or chemical freatment these tissue derivatives can be further processed via crosslinking or other chemical treatments prior to use in transplantation.
  • the derivatives include exfracelluar matrix derived from a variety of tissues, including skin, urinary, bladder or organ submucosal tissues.
  • tendons, joints and bones stripped of viable tissue to include heart valves and other nonviable tissues as medical devices are provided.
  • the cells can be administered into a host in order in a wide variety of ways.
  • Modes of administration are parenteral, infraperitoneal, intravenous, infradermal, epidural, infraspinal, infrasternal, infra-articular, infra-synovial, inttathecal, intra-arterial, infracardiac, intramuscular, infranasal, subcutaneous, infraorbital, infracapsular, topical, fransdermal patch, via rectal, vaginal or urethral administration including via suppository, percutaneous, nasal spray, surgical implant, internal surgical paint, infusion pump, or via catheter.
  • the agent and carrier are administered in a slow release formulation such as a direct tissue injection or bolus, implant, microparticle, microsphere, nanoparticle or nanosphere.
  • disorders that can be treated by infusion of the disclosed cells include, but are not limited to, diseases resulting from a failure of a dysfunction of normal blood cell production and maturation (i.e., aplastic anemia and hypoproliferative stem cell disorders); neoplastic, malignant diseases in the hematopoietic organs (e.g., leukemia and lymphomas); broad spectrum malignant solid tumors of non-hematopoietic origin; autoimmune conditions; and genetic disorders.
  • Such disorders include, but are not limited to diseases resulting from a failure or dysfunction of normal blood cell production and maturation hype ⁇ roliferative stem cell disorders, including aplastic anemia, pancytopenia, agranulocytosis, thrombocytopenia, red cell aplasia, Blackfan-Diamond syndrome, due to drugs, radiation, or infection, idiopathic; hematopoietic malignancies including acute lymphoblastic (lymphocytic) leukemia, chronic lymphocytic leukemia, acute myelogenous leukemia, chronic myelogenous leukemia, acute malignant myelosclerosis, multiple myeloma, polycythemia vera, agnogenic myelometaplasia, Waldenstrom's macroglobulinemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma; immunosuppression in patients with malignant, solid tumors including malignant melanoma, carcinoma of the stomach, ovarian carcinoma,
  • Neurodegenerative diseases include neurodegenerative diseases, hepatodegenerative diseases, nephrodegenerative disease, spinal cord injury, head trauma or surgery, viral infections that result in tissue, organ, or gland degeneration.
  • Such neurodegenerative diseases include but are not limited to, AIDS dementia complex; demyeliriating diseases, such as multiple sclerosis and acute fransferase myelitis; exfrapyramidal and cerebellar disorders, such as lesions of the ecorticospinal system; disorders of the basal ganglia or cerebellar disorders; hyperkinetic movement disorders, such as Huntington's Chorea and senile chorea; drug- induced movement disorders, such as those induced by drugs that block CNS dopamine receptors; hypokinetic movement disorders, such as Parkinson's disease; progressive supra-nucleo palsy; structural lesions of the cerebellum; spinocerebellar degenerations, such as spinal ataxia, Friedreich's ataxia, cerebellar cortical degenerations,
  • the non-human fransgenic animals of the present invention can be used to screen any type of compound, for example, antibiotics, antifungals, antivirals, chemotherapeuti.es, cardiovascular drugs, and hormones.
  • Compounds that can be screened by using the animals of the present invention can be small molecules or biologies (e.g. proteins, peptides, nucleic acids).
  • Compounds to be tested can be introduced to the animals of the invention via any delivery route known in the art, such as, but not limited to, intravenous injection, intramuscular injection, infraperitoneal injection, orally, sublingually, subcutaneously, via inhalation, intranasally, infrathecally, ocularly, rectally, and fransdermally.
  • the activity of the one or more compounds can be determined by measuring one or more biological or physiological responses of the cells of the animal. For example, cells or animals contacted with the one or more compounds to be screened (i.e. "treated") are compared to "control" cells or animals that have been contacted with one or more inactive compounds (i.e.
  • the confrol cells are not contacted with a compound.
  • the response(s) of the cells or animals to the one or more compounds are then measured and comparisons between confrol and freated samples are made to determine the therapeutic effectiveness of the one or more compounds.
  • the activity of the one or more compounds can be assessed by measuring the amount of target mRNA or protein produced in a cell. Analyzing "freated" and "control" cell samples allows for a quantitative comparison to determine the therapeutic effectiveness of the one or more compounds screened above that of the confrol sample.
  • the amount of compound associated with both target and non-target proteins, cells, tissues or organs can be measured and compared to determine to pharmacokinetic profile of the one or more compounds of both confrol and freated cells or animals.
  • Assays for determining the amount of mRNA and protein in a cell are well known in the art (see for example Sambrook, J. et al. "Molecular Cloning: A Laboratory Manual,” 2nd addition, Cold Spring Harbor Laboratory Press, Plainview, New York (1989)).
  • physiological responses of a cell or animal that can be measured to determine the therapeutic effectiveness of one or more compounds include, but are not limited to, temperature changes, pH changes, oxygen concentration, glucose concentration, blood flow, electro-physiologic properties.
  • Biological and physiological responses are determined by methods well known in the art, including but not limited to, specfroscopic analysis, microscopic or other visualization utilizing marker dyes and probes known in the art, instrumental monitoring (i.e. temperature, pH, blood pressure, blood flow, electrical measurements).
  • therapeutically effective indicates that the compound or composition has an activity that impacts a cell or an animal suffering from a disease or disorder in a positive sense and/or impacts a pathogen or parasite in a negative sense.
  • a therapeutically effective compound can cause or promote a biological or biochemical activity within an animal that is detrimental to the growth and/or maintenance of a pathogen or parasites, or [within] cells, tissues or organs of an animal that have abnormal growth or biochemical characteristics such as cancer cells.
  • a therapeutically effective compound can impact a cell or an animal in a positive sense by causing or promoting a biological or biochemical activity within the cell or animal that is beneficial to the growth and/or maintenance of the cell or animal.
  • Whether (or the extent to which) a therapeutically effective compound impacts a cell or animal in a positive way can be determined by examining the level of a given biological or biochemical characteristic or function observed in the treated cell or animal and comparing that level to the level of the same biological or biochemical characteristic or function observed in an untreated control cell or animal, using art-known assays of a variety of biological or biochemical characteristics or functions.
  • Any compound or composition that induces a change in the examined biological or biochemical characteristic or function in the treated cell or animal by an amount that is quantitatively discemable from that observed in a confrol cell or animal is said to be "therapeutically effective.”
  • a quantitatively discemable amount is any amount that is above the standard experimental enor associated with the method or measurement used to determine therapeutic effectiveness.
  • a quantitatively discemable amount that can indicate that a tested compound or composition is therapeutically effective is a difference in the assayed characteristic or function in the freated cell or animal of about 1%, about 5%, about 10%, about 33%, about 50%, about 67%, about 75%, about 90%, about 95%o, or about 100% relative to the level of the assayed characteristic or function in a confrol cell or animal.
  • the fransgenic cell to be contacted with one or more compounds to be tested can be removed from the fransgenic animal and maintained and assayed in culture.
  • This embodiment of the invention allows for a high throughput screening approach to assess the therapeutic effectiveness of a compound, where multiple, different compounds could be tested on individual cells of the same biologic type or animal species. Similarly, a single compound could be tested on many different cell types (e.g. muscle, bone, skin, neurologic) from a single animal species, or on cells from multiple species.
  • Methods for maintaining cells in culture are well known in the art (see for example Sambrook, J. et al. "Molecular Cloning: A Laboratory Manual", 2nd addition, Cold Spring Harbor Laboratory Press, Plainview, New York (1989) and Freshney, R. I,. "Culture of Animal Cells: A Manual of Basic Technique," Alan R. Liss, e, New York (1983)).
  • Another embodiment of the invention is a method of screening one or more compounds for a therapeutic effect on a human tumor that has been implanted into a non- human fransgenic animal of the invention, comprising: (a) implanting a human tumor or a human tumor cell into a transgenic animal; (b) contacting the human tumor with one or more compounds to be tested; (c) measuring one or more biological or physiological responses of the tumor to the one or more compounds; and (d) determining the therapeutic effectiveness of one or more compounds on the human tumor.
  • Any non-human animal produced by any one of the methods of the present invention can be used as a tumor recipient, including but not limited to, non-human mammals (including, but not limited to, pigs, sheep, goats, cows (bovine), deer, mules, horses, monkeys and other non-human primates, dogs, cats, rats, mice, rabbits and the like), birds (including, but not limited to chickens, turkeys, ducks, geese and the like) reptiles, fish, amphibians and the like.
  • Any human tumor or tumor cell line can be implanted into the animal for screening pu ⁇ oses.
  • Tumors include, but are not limited to, a breast cancer tumor, a uterine cancer tumor, an ovarian cancer tumor, a prostate cancer tumor, a testicular cancer tumor, a lung cancer tumor, a leukemic tumor, a lymphatic tumor, a colon cancer tumor, a gasfrointestinal cancer tumor, a pancreatic cancer tumor, a bladder cancer tumor, a kidney cancer tumor, a bone cancer tumor, a neurological cancer tumor, a head and neck cancer tumor, a skin cancer tumor, a sarcoma, an adenoma and a myeloma.
  • the tumor implanted into the animal can be in the form of a solid tumor mass, a single tumor cell, or multiple (i.e.
  • tumor cells 2, 10, 50, 100, 1000 tumor cells.
  • the tumor can be implanted in any tissue or organ of the animal, or can be delivered systemically. Any method known in the art by which to implant tumors and tumor cells into animals can be used in the present invention.
  • Human tumors or tumor cells can come from any source, including but not limited to, established tumor cell lines, excised primary tumor tissue and commercial/government/academic sources including tissue banks and the like.
  • the non-human transgenic animal of the invention with the implanted human tumor can be used to screen small molecules or biologies (e.g. proteins, peptides, nucleic acids).
  • Compounds to be tested can be introduced to the animals of the invention via any delivery route known in the art, such as, but not limited to, intravenous injection, intramuscular injection, infraperitoneal injection, orally, sublingually, subcutaneously, via inhalation, intranasally, infrathecally, ocularly, rectally, and fransdermally.
  • the activity of the one or more compounds can be determined by measuring one or more biological or physiological responses of the human tumor implanted into the animal. For example, the activity of the compounds can be assessed by measuring the amount of target mRNA or protein produced in a cell. Alternatively, the amount of compound associated with both target and non-target proteins, cells, tissues or organs can be measured and compared.
  • Assays for determining the amount of mRNA and protein in a cell are well known in the art.
  • biological responses of an implanted human tumor that can be measured to determine the therapeutic effectiveness of one or more compounds include, but are not limited to, inflammation, generation of active oxygen species, cell lysis, immunological response (i.e. antibody production), protein production, and the like.
  • physiological responses of an implanted human tumor that can be measured to determine the therapeutic effectiveness of one or more compounds include, but are not limited to, temperature changes, pH changes, oxygen concentration, tumor growth, glucose concentration, blood flow, and the like. h this context, the term "therapeutically effective" indicates that the compound has an activity that impacts the implanted human tumor in a negative sense.
  • a therapeutically effective compound can cause or promote a biological or biochemical activity within an animal that is detrimental to the growth and/or maintenance of the tumor.
  • the present invention also provides therapeutically effective compounds identified using any one of the screening methods of the present invention. These compounds can be small molecules or biologies, hi such an embodiment, the compounds can contain one or more pharmaceutically acceptable carrier or excipient.
  • the compounds provided by the screening methods of the present invention can produce any level of therapeutic effectiveness that is discemable relative to confrol.
  • Example 1 Targeting families of genes For specific targeting of a family of genes, a desired subset of genes, or specific alleles of a gene or gene family, a representative sample of sequences is obtained. These sequences are compared to identify areas of similarity.
  • the comparison determines areas of similarity and identity between given gene families, as well as within subsets of sequences within a family.
  • this analysis determines areas of similarity and identity between alleles of family members.
  • regions are identified that can be used to target either the entire family, subsets of family members, individual family members, subsets of alleles of individual family members, or individual alleles of family members.
  • Figure 8 The results of a typical analysis are shown in Figure 8.
  • Region 2 can target all members of the given 4-gene family.
  • the sequence of Region 3 differentiates Gene 1 and 2 from Gene 3 and 4
  • Region 4 can be used to differentiate Gene 1 and 4 from Gene 2 and 3.
  • Region 5 can be used to differentiate Gene 1, Allele A and B from all other family members, while Region 1 or Region 6 can specify individual alleles of any gene in the family.
  • a "reporter" construct vector that includes, but need not be limited to, one or more potential target regions is constructed.
  • the expression of the reporter construct is measurable, either by measuring the output of the target gene or by measuring output of an additional gene, such as a fluorescent reporter (readout).
  • the reporter construct is introduced to a cell or a cell population, i addition to the reporter construct, iRNA constracts are assembled that encode potential iRNA molecules.
  • the iRNA constructs can be assembled by, for example, combining DNA fragments that include sequences that serve as a promoter of transcription and sequences that represent an iRNA molecule to be tested (see Figure 5).
  • the test constructs are also introduced into the above cultured cells. Measurement of the reporter construct readout indicate efficacy of the iRNA molecule(s), such that if the fransgene encodes an effective iRNA molecule, the readout of the reporter molecule is altered.
  • Test constructs that successfully provide down regulation of the reporter gene provide iRNA sequences that are used alone or in combination to produce transgenic animals. Methods of introducing the iRNA molecules into cells to produce fransgenic animals include homologous recombination using endogenous or exogenous promoters.
  • subsets of genes or alleles may not contain unique targeting regions that are present in every member of the subset.
  • multiple constructs are used so that each iRNA molecule specifies at least one member of the desired target gene subset but none of the members of the excluded targets. Therefore, the group of iRNA molecules specify a unique subset of targets even though no single molecule in the group of iRNA transcripts is capable of targeting all members of the desired subset.
  • constructs are developed that provide collections of iRNA molecules or sets of molecules that target specific genes, families of genes, or alleles within a family. These grouped constracts are developed by combining multiple test construct sequences, or by assembly of a new construct that encodes multiple copies of iRNA or groups of iRNA targeting molecules.
  • a combination of test constructs that are effective against the vertical stripped sequence, horizontal stripped sequence, and bricked sequence in Region 5 down-regulate all alleles of Gene 1 and Gene 3.
  • omission of a construct specifying the horizontal stripped sequence in Region 5 results in targeting Gene 1, Allele A and B, and all alleles of Gene 3.
  • RNA interference is used to heritably suppress expression of a family of related sequences encoding different yet homologous retroviruses found in pigs.
  • a transgene is constructed that results in production of an iRNA molecule with sense and inverted antisense sequences, homologous to a region of the porcine endogenous retrovirus genome that is conserved between PERV variants, at least three of which are known (PERV- A, -B and -C).
  • the fransgene is added to the genome of a pig to produce a genetic line that heritably expresses an RNA molecule that can self hybridize to form dsRNA.
  • RNA induces interference of expressed porcine endogenous retrovirus in each cell that expresses the fransgene. Not only is total PERV production severely down regulated, but recombination between targeted variants may not produce a novel untargeted variant. Cells, tissues, or organs from such animals can be used for xenofransplantation with reduced risk of PERV transmission.
  • Step 1 Assays are developed to quantify the effectiveness of individual iRNA molecules.
  • a reporter vector is constructed to allow streamlined screening of iRNAs and an iRNA expression vector assembled to allow efficient insertion of individual potential iRNA- encoding sequences. Potential targets are identified by sequence analysis of the family of target PERVs.
  • Model-gene control plasmids Based on sequence conservation, primers are designed and used to amplify gag, pol, and env coding regions from both the cell line PK-15, a cell line known to shed infective PERVs (Le Tissier et al., 1997), and in fetal fibroblasts (including ⁇ l,3-GT knockout fibroblasts). The most highly expressed coding region from each gene is used to build a model reporter construct. Each reporter construct is assembled by inserting a PERV coding region (gag, pol, or env) between a reporter molecule coding region and its poly(A) signal. The plasmids thus produce an mRNA with a reporter gene (i.e.
  • ⁇ -Gal, GFP upsfream of a potential iRNA target (in the 3' non-coding region).
  • the effectiveness of individual iRNA molecules is assayed by analyzing suppression of the reporter gene expression.
  • the protocol can also be modified to analyze non-coding PERV sequence in lieu of, or addition to, the coding sequences.
  • /RN4 expression plasmids Several RNA polymerase III (Pol III) dependent promoters are amplified, cloned, and tested for ubiquitous expression in transgenic animals. Pol III promoters can drive expression of iRNAs without addition of terminal sequence (i.e. a poly(A) tail).
  • the Pol III promoters may include the promoters from H1RNA, snRNAU6, 7SK, MRP RNA, or 7SL. Pol III promoters can be screened to choose a promoter with ubiquitous expression.
  • An iRNA test vector is assembled, including a cloning region and a poly(U)-dependent Pol III franscription terminator. Protein coding regions may also be provided within the gene for the interfering RNA.
  • PERV assays Specific probes against PERV-A, -B and -C are developed to detect conesponding proviral PERV DNA sequences.
  • PCR assays for proviral PERV DNA utilize primers specific to gag, pol and env regions, as well as to an internal confrol gene such as the ⁇ -globulin gene.
  • Real-time PCR with primers specific to porcine mitochondrial DNA (mtDNA) or cenfromeric sequences is used to quantify porcine cell contamination (chimerism) in fransmissibility assays.
  • PCR primers specific to gag and pol regions of PERN are also developed to detect PERN R ⁇ A in target samples.
  • An ideal target for iR ⁇ A is a region of the PERN mR ⁇ A that is conserved across most PERVs. Such sequences are identified for initial constructs. Analysis of all known
  • PERV sequences and additional PERV sequences that arise from this effort provide information for logical design of iR ⁇ A vectors. All iR ⁇ A vectors are tested for function in cell assays before use in transgenic animal production. Bioinformatics: Analysis of all available PERV env mRNA sequences is shown in Figxxre 9. This analysis is performed to determine both regions of conservation and consensus sequences. An effective iR ⁇ A targeted to the region between 6364bp and 6384bp will target all PERV env genes shown in this example. Alternatively, a pair of effective iR ⁇ A molecules targeted to the two sequences in the region between 6386bp and 6407bp would also target all PERV env genes shown in this example.
  • targeted genes may share homology with non-targeted genes, h this case, potential targets that share significant homology with non-targeted genes are eliminated from the screening process.
  • RNA sequence of target genes are screened for homology to non-targeted RNAs.
  • a 19 base region of an unknown porcine expressed sequence (Genbank entry BI305054) is significantly homologous to a region of semi-conserved PERV sequence (shown in black face bold type and underlined).
  • Potential target regions with significant homology to non-targeted RNAs can prove useful, such target regions are excluded in initial target screens to reduce the risk of severely down-regulating unintended gene products.
  • Line 1 of Figure 11 represents PERV sequence.
  • Lines 2-69 represent targeted PERV sequence identified by bioinformatics.
  • Line 70 represents an unknown expressed porcine sequence.
  • Lines 36-56 represent the result of the sequence analysis, illusfrating the excluded targets.
  • Figure 12 illustrates an example of a proposed three dimensional configuration of an expressed iRNA.
  • the iRNA is designed for the target sequence 5'AAT TGG AAA ACT AAC CAT C 3 ( Figure 10, Line 2).
  • An exemplary iRNA sequence is 5'(N Y ) AAU UGG AAA ACU AAC CAU C(N Y )G AUG GUU AGU UUU CCA AUU (N ⁇ ) 3' (wherein “N” refers to any nucleotide and "Y” refers to any integer greater than or equal to zero).
  • Each portion of non-specified sequence, (N ⁇ ), can be homopolymeric.
  • the nonidentical sequence can also be composed of non-identical bases.
  • any continuous stretch of non- specified sequence, (N ⁇ ) can provide additional functions such as but not limited to encoding protein, providing signals for stability or increased half-life, increasing the length of palindromic sequence, providing signals and functions for splicing, or folding into particular stractures.
  • Step 3 Tissue culture confirmation: Based on the sequences and plasmids identified in Steps 1 and 2, multiple individual iRNA expressing plasmids are designed, constructed and tested for function in tissue culture using the protocol described in Step 1.
  • Each iRNA plasmid is tested for stable expression and effectiveness against the a reporter plasmid containing the appropriate target sequence. Interference activity against native PERV mRNAs is established experimentally. In addition, reduction in PERV mRNA is conelated with a decrease in viral particle production. Each selected iRNA construct is transfected into PK-15 cells, which are known to shed human-transmissible PERVs. Each selected iRNA construct is tested for ability to reduce steady-state mRNA, reduce the number of viral particles shed, and reduce the transmissibility of PERVs to human cells. In addition, any PERV mRNAs that are found after the first round of testing, are amplified by RT-PCR and sequenced.
  • sequences are analyzed to determine individual polymo ⁇ hisms that allow mRNA to escape iRNA. This information is used to further modify iRNA constructs to target rare polymo ⁇ hisms. After identification of individual iRNA constracts, groups of constructs are developed that will effectively eliminate expression of PERV in selected cells. The specific sequences included in the groupings are identified using the methods described in the previous steps.
  • Step 4 Creation ofPERV-free cells: An alpha-GT knock out line or a line of pigs that express complement inhibiting proteins is used, however a PERV-free genetic background can be achieved using any line of swine.
  • Fibroblasts are engineered with iRNA constracts to allow a degree of functional testing prior to generating animals. These cells are also screened for integration sites to analyze functional effects. The use of fibroblasts is advantageous over other methods of producing fransgenic animals, where normally one can only assay integration-site-specific transgene expression after the animals are bom.
  • Primary alpha-1, 3-GT knockout fetal fibroblasts are engineered to express functionally-screened, optimized iRNA designed in Steps 1 to 3.
  • Step 5 Somatic cell nuclear fransfer allows for an efficient, relatively inexpensive and relatively fast production of fransgenic pigs.
  • Cells that have been developed and screened in Step 4 (alpha- 1,3 GT knockout fibroblasts engineered to contain optimized, functional, PERV-suppressing iRNAs) are used as nucleus donors in somatic cell nuclear transfer.
  • the technique of somatic cell nuclear fransfer includes removing the nucleus from an oocyte of a pig, then fusing or inserting the nucleus from the fibroblast into the enucleated oocyte. The cells are then grown to the blastocyte stage and then frozen and implanted in a sow.
  • tissue culture experiments with PK-15 cells and fetal fibroblasts will prove very useful, to date no in vitro assay exists to perfectly model in vivo fransgene function.
  • tissue specific variation may exist in both iRNA ftmction and PERV mRNA expression.
  • Analysis of fetal tissues of transgenic pigs allows more extensive analysis of iRNA utility. Mid-gestation fetuses are collected. Tissues are harvested and analyzed for iRNA expression and PERV mRNA suppression. Integration sites that provide effective PERV suppression are selected. Somatic cell nuclear transfer allows for the generation of fransgenic pigs that have identical integration events as the screened fetuses.
  • Cloning allows cells that are being propagated, recovered from storage, or cells collected from the mid-gestation fetuses, to be used to make transgenic animals.
  • Cells that have been screened and wherein PERV has been effectively eliminated are used as nucleus donors in somatic cell nuclear fransfer.
  • Reconstracted embryos are fransfened to recipient females and allowed to develop to term.
  • the full elimination of PERV is confirmed in live animals.
  • Piglets are sacrificed at various stages of maturity and analyzed for fransgene expression and suppression of PERV mRNA. In addition, multiple tissues are tested to ensure that PERV is eliminated in therapeutically useful organs.
  • PERV Targets The specific gag, pol and env sequences of PERV that were used to identify potential siRNA targets are listed below. Each sequence is a subset of the full length gene. The subset represents the portion of each gene that we used to assemble the model genes. Regions that are to be excluded from consideration have been replaced with a homopolymer (ttttt...t, or
  • siRNA expression plasmids were screened for effectiveness with the appropriate model gene (anti gag siRNA with a gag model, anti-pol siRNA with a pol model, ect.) in mammalian cells. Most of the siRNA expression plasmids displayed some level of effectiveness. The most potent anti-gag expression plasmid (g49) and the most potent anti-pol expression plasmid (pi 06) were confirmed effective against PERV mRNA in fransfections of PK-15 cells. This effect was assayed by both detection of PERN-produced reverse franscriptase activity and direct measurement of PERV mR ⁇ A.
  • iR ⁇ A expression plasmids Portions of gag, pol, envA, envB, and envC were amplifed and cloned into pCR- XLTOPO (Invifrogen, Carlsbad, CA). Each insert was independently sublconed as an Xbal/Spel fragment into a house vector pPL732.8 at an Xbal site located between the coding region of a reporter gene and its poly(A) signal.
  • Figure 13 A graphic representation of the strategy in Figure 13. For each iR ⁇ A, oligos were cloned into psiR ⁇ A-Hlneo (InvivoGen, San Diego, CA) according to the manufacturers recommendations.
  • the oligos were annealed and cloned into the Bbsl sites in place of the LacZ alpha peptide for blue/white screening.
  • iR ⁇ A integrity was confirmed by sequencing.
  • the appropriate model gene and a single iR ⁇ A test vector were co-fransfected into CHO or PK-15 cells using GenePORTER (Gene Therapy Systems, Inc. (GTS), San Diego, CA ) according to the manufacturers suggestions.
  • GTS Gene Therapy Systems, Inc.
  • cells were also co-fransfected with the reporter gene and an anti-GFP iR ⁇ A vector or with the reporter and a non-functional, negative control iR ⁇ A consruct.
  • iR ⁇ A function Suppression of the either the total level of reporter expression per transfected cell (as measured by FACS) or the proportion of cells that expressed the reporter gene (visual appraisal or FACS) was considered indicative of iR ⁇ A function.
  • the apparently most potent iR ⁇ A for both gag and pol were independently transfected into PK-15 cells without the reporter model gene.
  • reverse franscriptase was measured in the medium of these cells using a commercially available kit (Cavidi Tech, Uppsala, Sweden). Additionally, stable colonies were isolated for each iRNA and the level of steady-state mRNA was measured via quantitative RTPCR. These colonies were also assessed for RT activity and their ability to suppress transiently transfected model gene.
  • CTGTGTAGGGCTTCGT (Seq ID No 10)
  • bases 118-248 form a significant hairpin structure.
  • Bases 147-166 CTCGTACCTTCTAGCAGTC (Seq ID No 11)
  • bases 199-218 ACTGGAGAGGGTCACTGGGG (Seq ID No 12)
  • the MFold predicted structure of that subsfrate is:
  • nucleotide sequence of the above sequence is GAUCUGCGGCCUUCGUACCUUCUAGCAGUCGUGAAGCCACAGAUGGACUG GAGAGGGUCACUGGGGUGCUGAUC (Seq ID No 13).
  • bases 192-214 (GTCATCCCAGTACTGGAGAGGGT (Seq ID Nol4))and bases 155-178 (CTTCTAGCAGTCCTGTTGGTGGCT (Seq ID Nol5)) were used to design a Drosha subsfrate with a mir-30 loop and base.
  • the MFold predicted structure of that substrate is:
  • the nucleotide sequence of the above sequence is GAUCUGCGCGUCAUCCCAGUACUGGAGAGGGUGUGAAGCCACAGAUGCCU UCUAGCAGUCCUGUUGGUGGCUUGCUGAUC (Seq ID Nol6).
  • bases 118-139 GCCTAGGTCAGACAATTCAGTA (Seq ID Nol7)
  • bases 230-251 ATcCTGAAGTTGGCCAGGTCCC(Seq ID Nol8)
  • nucleotide sequence of the above sequence is GAUCUGCGAGGGCCUAGGUCAGACAAUUCAGUAUGUGAAGCCAC GAUGA UACUGAAGUUGGCCAGGUCCCUGCUGAUC (Seq ID No 19).
  • Fragment C is shown below and is the complement of the sequence shown in italics above in Fragment A.
  • Fragment C gctgcccggttcttcccgtacctggatctctccattcgaaggcaaaagc ggttggctagtggggtgtaatctcaggcagaagaaggcatcttttaagtc caatactgtgtaccagttccgttcaggcgggagggcgctcaagaggttat aagggttcgggaccgttgggtgtatgtcctgcacccttttattgacctct etc (Seq ID No 20)
  • bases 142-200 form a significant hairpin structure.
  • Bases 141-163 (AAGAGGTTATAAGGGTTCGGGAC (Seq ID No 21)) and bases 176-201 (GTCCTGCACCCTTTTATTGACCTCTC (Seq ID No 22)) were used to design a Drosha subsfrate with a mir-30 loop and base.
  • the MFold predicted structure of that substrate is:
  • nucleotide sequence of the above sequence is GAUCUGCGAAGAGGUUAUAAGGGUUCGGGACGUGAAGCCACAGAUGGUCC UGCACCCUUUUAUUGACCUCUCUGCUGAUC (Seq ID No 23).
  • Fragment D is shown below and is the complement of the sequence shown in bold in Fragment A.
  • bases 35-171 form a significant hairpin structure.
  • Bases 36-61 AACCCATCCCTGCGGTTTCTGCCCAG (Seq ID No 25)
  • bases 150-171 GGGTCAACACAGTGATGGGTTT (Seq ID No 26)
  • the mir-29 loop was chosen because of complementation between the base 36-61 fragment and the mir-30 loop.
  • the MFold predicted structure of that subsfrate is:
  • nucleotide sequence of the above sequence is GAUCUGCGCAACCCAUCCCUGCGGUUTJCUGCCCAGUCAAUAUAAUIJCUGGG UCAACACAGUGAUGGGUUUUGCUGAUC (Seq ID No 27).
  • bases 86-107 GACTGTATATCTTGATCAGGCT (Seq ID No 28)
  • bases 111-130 CTGGGGAGAATATAGTCGA (Seq ID No 29) were used to design a Drosha substrate with a mir-30 loop and base.
  • the MFold predicted structure of that substrate is:
  • the nucleotide sequence of the above sequence is GAUCUGCGCUGACUGUAUAUCUUGAUCAGGCUGUGAAGCCACAGAUGAGC UUGGGGAGAAUAUAGUCGAUGCUGAUC (Seq ID No 30).
  • bases 100- 123 (agatcacgtaactcagcctcctgt (Seq ID No 33)) and bases 10-34
  • nucleotide sequence pf the above sequence is GAUCUGCGAGAUCACGUAACUCAGCCUCCUGUGUGAAGCCACAGAUGGCA GCUGGUAGAGUGAACGUGAUCCUGCUGAUC (Seq ID No 32).
  • both sfrands of the hairpin can be designed to be identical or functionally identical.
  • the complement of pol Frament A
  • D ⁇ A Strider was analyzed using D ⁇ A Strider to identify potential palindromes.
  • stringency 11 the following sequence was identified: TGGGCCTTTTAGCTGAGGCTCG (Seq ID No 36). This sequence was used to design a Drosha substrate with mir-30 base and loop and has the following MFold predicted structure:
  • nucleotide sequence of the above sequence is GAUCUGCGCAUGGGCCUUUUAGCUGAGGCUCGUAGUGAAGCCACAGAUGU AUGGGCCUUUUAGCUGAGGCUCGUAUGCUGAUC (Seq ID No 37).
  • CTTCTGGTGCTCAGGAGCCCAGGAG (Seq ID No 38), used to design a Drosha subsfrate with mir-30 base and loop, and has the following MFold predicted structure:
  • nucleotide sequence pf the above sequence is GAUCUGCGAUUCUGGUGCUCAGGAGCCCAGGAGGUGAAGCCACAGAUGCU UCUGGUGCUCAGGAGCCCAGGAGUGCUGAUC (Seq ID No 39).
  • CATCGGTCTGGGGGCTGCCGGACGATG (Seq ID No 40), used to design a Drosha subsfrate with mir-30 base and loop, and has the following MFold predicted structure:
  • the nucleotide sequence of the above sequence is GAUCUGCGAAUCGGUCUGGGGGCUGCCGGACGAUGGUGAAGCCACAGAUG CAUCGGUCUGGGGGCUGCCGGACGAUGUGCUGAUC (Seq ID No 41). Additional PERN Targeting Strategies: Optimization of Hairpin formation
  • Imperfect hairpins can result from using the above strategies.
  • the Drosha subsfrates can be modified without significant alteration in R ⁇ Ai targeting.
  • Several "bubbles" are present in the stem portion of the hairpin.
  • nucleotide sequence pf the above sequence is GAUCUGCGAGAAACCACCCUUGAGUAGUUUCCGUGAAGCCACAGAUGGGA AACCACCCUUGAGUAGUUUCCUGCUGAUC (Seq ID No 42).
  • the "C” at position 15 was changed to “U”.
  • the "U” can still base-pair with the "G” foxmd in the target as the complement of "C”.
  • the "U” can also base-pair with the "A” a position 65 in the hairpin.
  • the "C” at position 18 was also changed to a “U” to base-pair with the "A” at position 62.
  • the resulting predicted structure has an improved stem and is shown below.
  • nucleotide sequence pf the above sequence is GAUCUGCGAGAAACUACUCUUGAGUAGUUUCCGUGAAGCCACAGAUGGGA AACUACUCUUGAGUAGUUUCCUGCUGAUC (Seq ID No 43). See also, Zeng Y, Cullen BR. Structural requirements for pre-microRNA binding and nuclear export by Exportin 5. Nucleic Acids Res. 2004 Sep 08;32(16):4776-85; Zeng Y, Cullen BR. Sequence requirements for micro RNA processing and function in human cells. RNA. 2003 Jan;9(l):l 12-23; Zeng Y, Wagner EJ, Cullen BR.
  • Example 3 Sequential Cloning of Hairpin Oligonucleotides To assemble oligos for clustered interference RNA, linker sequences must the considered to prevent unintentional structures from forming. If the same restriction sites are used sequentially, homologies at the base of the hairpin can cause unintentional base pairing.
  • a sequence can be cloned directionally into those two sites, hi the process, the upsfream site can be destroyed and also re-supplied to the new vector in the downstream region in preparation for the next hairpin.
  • the oligonucleotide-supplied Bel I site can be used for the next cloning step and new oligonucleotides can continue to be added to each successive vector provided that none of the infroduced stem sequences supply additional sites for either Bel
  • any number of additional Drosha subsfrates can be added without alteration of their individual predicted structures.
  • An intron was designed, based loosely on the infron found in the murine eosinophil-associated, ribonuclease A family genes (EarX) and a commercially available vector pCpG (hivivoGen, San Diego, CA).
  • the design of this infron included creation of restriction sites that allow of for placement of the inton into any Sbfl site within exon sequence. Upon splicing of primary transcripts containing this intron, the resulting mRNA is unaltered in comparison to its non-engineered, endogenous counterpart.
  • a small series of cloning sites were included within the infron to allow subsequent cloning of iRNA molecules/Drosha substrates. This sequence was cloned into an Sbfl site found naturally within the coding region of a dsRED expression vector
  • Example 5 Use of iRNA to reduce expression of contaminating proteins.
  • expression of an endogenous protein is reduced to prevent or reduce contamination of a product of a fransgene.
  • Transgenic animals are beginning to be used as sources for therapeutic proteins. These proteins are expressed from fransgenes.
  • the fransgene expression can be targeted to specific tissues or cells types to provide compartmentalized harvesting of such proteins.
  • a protein can be concentrated in milk of fransgenic animals by driving expression of said protein from a mammary specific promoter.
  • a transgene may be selectively expressed in a specific cell type to allow for specific processing.
  • a human immxmoglobulin locus can be used to direct recombination, expression, and processing of human polyclonal antibodies in livestock B-cells. h either of these cases, endogenous proteins can contaminate the material collected for purification. This protein may be evolutionarily unrelated but co-purifies with the desired product. Alternatively, the contaminating protein may be the endogenous counterpart of the fransgene product.
  • immunoglobulin genes Step l.
  • Example 2 The technique as described in Example 1, is used wherein the gag, pol and env genes described in Example 1 are replaced with genes for variable domains of porcine immxmoglobulin (Ig), either variable or constant, i addition, Ig heavy-chain, Ig light chain kappa, and Ig light chain lambda are included as potential targets in the sfrategy.
  • Ig porcine immxmoglobulin
  • Step 2 The technique as described in Example 1 is used wherein the analysis of PERV targets is replaced by an analysis of Ig targets to determine the specificity of the iRNA constructs to the given target, hi addition to the test of porcine Ig targets, potential targets that share homology with the human Ig fransgene expressed in the animals are excluded.
  • Step 3 Each selected iRNA construct is introduced into a porcine B-cell cell line. Down- regulation of Ig gene products is assayed by the methods described in Example 1. Specifically, mRNA is assessed by RT-PCR, and surface Ig is measured via labeled antibodies. Steps 4 and 5: Fetal fibroblasts are contacted with the iRNA constructs identified in preceding steps. However, as fetal fibroblasts do not express Ig gene products, their utility in screening in this assay is limited, i this case, late gestation fetuses are used to confirm iRNA effectiveness by RT-PCR and immunoassays.
  • fetal fibroblasts are engineered to expressed porcine Ig transgenes corresponding to the identified targets and iRNA constructs are tested for efficacy. Unintended targeting of human Ig is also assayed. Only iRNA constructs that do not target human Ig fransgenes are used to produce fetuses. Total mRNA is harvested from thymus, spleen, and blood of late gestation fetuses. This RNA is used to screen for endogenous Ig down-regulation by RT-PCR using primers specific to each Ig locus. Each assay includes additional confrol sequences to ensure that no errors are infroduced.
  • Cells that contain human Ig transgenes are used to reconstruct embryos via nuclear fransfer. These cells can be derived from screened fetuses, frozen and stored cell colonies, or cells used to produce the screened fetuses. Reconstructed embryos are used to produce transgenic offspring with the desired traits. Confirmation of both down-regulation of endogenous porcine Ig gene products and expression of transgenic gene products (i.e. human Ig) is confirmed. Animals are bled at various stages of matxirity and analyzed for iRNA fransgene expression, Ig transgene expression, and endogenous Ig gene suppression. The procedure is also repeated under conditions eliciting various immunological states.
  • Example 6 Use of interfering RNA to produce virus resistant animals.
  • RNA interference technology is applied to produce animals that are resistant to a virus and/or have reduced capacity to shed or propagate a virus.
  • a transgene is constructed that results in expression of interfering RNA that targets one or more essential regions of Marek's disease virus.
  • the fransgene construct is then added to the genome of chickens to produce a genetic line that heritably expresses iRNA.
  • the genetic line heritably expresses two RNAs that hybridize to produce a dsRNA molecule, targeted to the essential regions of Marek's disease vims, i a non- disease state the dsRNA is functionally inert, however, when a cell becomes infected with Marek's disease virus, the dsRNA interferes with a viral gene, thus disrupting the viral life-cycle.
  • Such chickens are therefore resistant to Marek's disease.
  • Example 1 The technique as described in Example 1 is used wherein PERV is replaced by Marek's disease virus, hi addition, a cell that sheds Marek's disease is used instead of PK-15 cells. Furthermore, methods for the production of fransgenic poultry, varying slightly from those described but known in the art, can be implemented. Embryonic chicks are used to confirm effectiveness. The appropriate integration site for the iRNA is identified by screening for iRNA expression in transgenic animals after they have reproduced. To this end, fransgenic offspring are available for further propagation of appropriate lines.
  • Example 7 Use of interfering RNA to reduce rejection of xenotransplanted organs.
  • a fransgene is constructed for expression of dsRNA that targets VCAM to suppress inflammation in xenotransplanted organs.
  • Example 1 The methods described in Examples 1 serve as a model for screening iRNA targets.
  • porcine VCAM is the target.
  • a porcine cell line that expresses VCAM is used in place of PK-15 cells.
  • a similar sfrategy as disclosed in Example 1, Step 2 and Figure 11 is employed to remove iRNA targets that are active against VCAM family members.
  • Example 8 Use of interfering RNA to reduce expression of an endogenous gene.
  • RNA interference is used to suppress expression of an endogenous gene in a tissue specific manner.
  • a fransgene is assembled for expression of dsRNA which targets myostatin (GDF-8).
  • GDF-8 myostatin
  • the suppression of the target is intended to be incomplete.
  • Mutations of myostatin provide increased muscle mass in livestock and mice, indicating that an economically beneficial phenotype could accompany a loss of function in myostatin.
  • complete elimination of myostatin produces a phenotype that is not economically viable for meat production (Yang J, et al. (2001) Mol. Reprod. Dev. 60(3):351-61).
  • Interfering RNA technology is used to produce animals suppressed expression of myostatin.
  • Tissue specific expression of an iRNA molecule that provides less than complete suppression is provided by a tissue specific manner on a pol III promoter.
  • Method The methods described in Example 1 serve as a model for screening iRNA targets.
  • porcine GDF-8 is the target rather than PERN.
  • a porcine cell line that expressed GDF-8 is used instead of PK-15 cells.
  • the iR ⁇ A molecules identified, first by virtual sequence alignment and thereafter by in vitro screening are subject to elimination if they are not effective within the parameters identified. Therefore, unlike the previous examples, complete abolition of myostatin eliminates an iR ⁇ A molecule from consideration.
  • Example 9 Use of interfering R ⁇ A to provide resistance to viruses.
  • R ⁇ A interference technology is applied to produce pigs that are resistant to viruses that are dangerous to patients undergoing xenofransplantation.
  • one virus that poses a risk to a patient undergoing a xenotransplant is an influenza virus. Therefore, a fransgene is constructed that results in the expression of interfering R ⁇ A that targets one or more essential regions of viruses that present risks to a patient receiving a xenotransplanted organ.
  • the methods as described in Example 1 serve as a model for screening iR ⁇ A targets, h this case, the influenza virus and its homologous provide the targets, instead of PERN.
  • a cell that sheds influenza virus is used for screening.
  • the iR ⁇ A constructs are screened for their capacity to fully inhibit influenza viral mR ⁇ A as well as viral particle production.
  • useful iR ⁇ A sequences are identified, they are linked within a vector to provide a fransgenic construct that can completely eliminate the expression of the viral gene products. Further rounds of screening ensure that the most effective combination is identified.
  • the constructs are infroduced into fibroblasts to be used in nuclear fransfer procedures, thus providing a fransgenic cell line resistant to influenza virus.
  • Example 10 Use of interfering R ⁇ A to provide genetic selection
  • Selectable markers are limiting in mammalian cells in that most marker genes provide antibiotic resistance and a finite number have been characterized. Therefore, siRNA fransgenes that provide a selectable phenotype can serve as selectable marker genes.
  • the methods described in Example 1 serve as a model for screening iRNA targets. In this case, a cell that provides a selectable phenotype which a particular gene is downregulated is used.
  • the iRNA constructs are screened for their capactity to produce the selecable phenotype. When useful iRNA construct are identified, they can be linked to other genes or other DNA fragments to provide a selectable phenotype.
  • this sfrategy can be used to create combinations of genes that allow selection of homologous recombination events.
  • a non-iRNA selectable marker gene is included between two targeting arms. Outside of these arms an anti-selectable marker iRNA transgene is placed.
  • the iRNA fransgene is identified as in above examples using the selectable marker gene as the target gene. Upon random integration, the iRNA transgene prevents function of the selectable marker and the integration event is not selected. Upon homologous recombination, the iRNA transgene is not present and the selectable marker gene functions. Similarly and alternatively, the iRNA fransgene can be directed against a gene essential to cell survival.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Environmental Sciences (AREA)
  • Virology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Communicable Diseases (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2004/039191 2003-11-21 2004-11-22 Use of interfering rna in the production of transgenic animals Ceased WO2005081714A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2004316293A AU2004316293A1 (en) 2003-11-21 2004-11-22 Use of interfering RNA in the production of transgenic animals
NZ547388A NZ547388A (en) 2003-11-22 2004-11-22 Use of interfering RNA in the production of transgenic animals
JP2006541617A JP2007512027A (ja) 2003-11-21 2004-11-22 トランスジェニック動物の産生における干渉rnaの使用
EP04821501A EP1734811A4 (en) 2003-11-21 2004-11-22 USE OF INTERFERENCE RNA IN TRANSGENIC ANIMAL PRODUCTION
CA2546853A CA2546853C (en) 2003-11-21 2004-11-22 Use of interfering rna in the production of transgenic animals

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US52393803P 2003-11-21 2003-11-21
US60/523,938 2003-11-21

Publications (2)

Publication Number Publication Date
WO2005081714A2 true WO2005081714A2 (en) 2005-09-09
WO2005081714A3 WO2005081714A3 (en) 2006-11-16

Family

ID=34910676

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/039191 Ceased WO2005081714A2 (en) 2003-11-21 2004-11-22 Use of interfering rna in the production of transgenic animals

Country Status (7)

Country Link
US (1) US10793873B2 (https=)
EP (2) EP2514826A3 (https=)
JP (1) JP2007512027A (https=)
CN (2) CN1972593A (https=)
AU (1) AU2004316293A1 (https=)
CA (1) CA2546853C (https=)
WO (1) WO2005081714A2 (https=)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1582591A3 (en) * 2004-02-27 2005-12-21 Bundesrepublik Deutschland vertreten durch das Bundesminsterium für Gesundheit, dieses vertr. durch das Robert-Koch-Institut Sirna and their use for knock down expression of porcine endogenous retrovirus
JP2007104969A (ja) * 2005-10-13 2007-04-26 Bio Think Tank Co Ltd ショートヘアピン型RNA(shRNA)前駆体を産生するための核酸及びその利用
EP2530152A1 (en) * 2007-05-31 2012-12-05 University of Iowa Research Foundation Reduction of off-target RNA interference toxicity
US9181544B2 (en) 2011-02-12 2015-11-10 University Of Iowa Research Foundation Therapeutic compounds
US9420770B2 (en) 2009-12-01 2016-08-23 Indiana University Research & Technology Corporation Methods of modulating thrombocytopenia and modified transgenic pigs
US9523093B2 (en) 2014-05-20 2016-12-20 University Of Iowa Research Foundation Huntington's disease therapeutic compounds
US9529001B2 (en) 2009-08-14 2016-12-27 The Regents Of The University Of California Methods of diagnosing and treating autism
US11098082B2 (en) 2015-06-26 2021-08-24 The Regents Of The University Of California Antigenic peptides and uses thereof for diagnosing and treating autism
US20220012673A1 (en) * 2020-07-13 2022-01-13 ZenDesk, Inc. Maintaining status information for customer-support agents across multiple channels
WO2022256294A1 (en) * 2021-06-01 2022-12-08 University Of Massachusetts Cas9 nickase-mediated gene editing

Families Citing this family (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4948163B2 (ja) * 2003-05-23 2012-06-06 サーナ・セラピューティクス・インコーポレイテッド 化学修飾した低分子干渉核酸(siNA)を使用する遺伝子発現のRNA干渉仲介抑制
CA2533259C (en) * 2003-07-21 2014-01-28 Lifecell Corporation Acellular tissue matrices made from galactose .alpha.-1,3-galactose-deficient tissue
US20070033666A1 (en) * 2005-06-24 2007-02-08 Harris Reuben S Using cytosine deaminases to diminish retroelement transfer from pigs to humans
JP5832721B2 (ja) * 2007-03-14 2015-12-16 バイオンシル・エス.アール.エル.Bionsil S.R.L. 上皮腫瘍細胞における薬剤耐性のモジュレータ化合物
JP5554231B2 (ja) * 2007-06-13 2014-07-23 コモンウェルス サイエンティフィック アンドインダストリアル リサーチ オーガナイゼーション トリの生産形質の改変
WO2010008562A2 (en) * 2008-07-16 2010-01-21 Recombinetics Methods and materials for producing transgenic animals
WO2010125117A2 (en) * 2009-04-29 2010-11-04 Ralph Wirtz A method to assess prognosis and to predict therapeutic success in cancer by determining hormone receptor expression levels
JP2013534824A (ja) * 2010-06-24 2013-09-09 ジ・オハイオ・ステート・ユニバーシティ 標的化されたmiR−29発現によりマウスにおいてモデル化された慢性リンパ性白血病
EP2698379A4 (en) * 2011-03-18 2015-04-29 Shanghai Inst Biol Sciences INSECTROSIVE PREPARATION AND METHODS BASED ON RNAI TECHNOLOGY
WO2013188358A1 (en) * 2012-06-12 2013-12-19 The General Hospital Corporation Miniature swine transgenic for one or more coagulation factors
WO2015066668A1 (en) 2013-11-04 2015-05-07 Lifecell Corporation Methods of removing alpha-galactose
CN104677866A (zh) * 2014-03-25 2015-06-03 中国科学院大连化学物理研究所 测定CP装载siRNA体系中siRNA释放的方法
CN104232670A (zh) * 2014-08-25 2014-12-24 中国水产科学研究院黑龙江水产研究所 一种采用鱼类转基因方法构建的基于鲤鱼mstn干涉载体及其构建方法
CN108513580A (zh) 2015-10-08 2018-09-07 哈佛学院董事及会员团体 多重基因组编辑
CN106918697B (zh) * 2017-02-15 2018-07-31 中国医学科学院北京协和医院 一种预测ra药物疗效的诊断标志物及其应用
KR102746223B1 (ko) 2017-04-20 2024-12-27 이제네시스, 인크. 유전자 변형 동물의 생성 방법
CN107760682B (zh) * 2017-10-18 2020-12-18 云南大学 一种可用于分子防治害虫的核酸序列及其应用
CN110628807B (zh) * 2018-05-30 2021-06-18 中国科学院植物研究所 盐角草SePSS蛋白及其编码基因与应用
US20210277421A1 (en) * 2018-08-06 2021-09-09 NemaMetrix, Inc Homologous Recombination Reporter Construct and Uses Thereof
US10883084B2 (en) 2018-10-05 2021-01-05 Xenotherapeutics, Inc. Personalized cells, tissues, and organs for transplantation from a humanized, bespoke, designated-pathogen free, (non-human) donor and methods and products relating to same
MX2021003866A (es) 2018-10-05 2021-09-08 Xenotherapeutics Inc Productos y metodos de xenotransplante.
US20210395738A1 (en) 2018-11-08 2021-12-23 Greenlight Biosciences, Inc. Control of insect infestation
CN110055253A (zh) * 2019-04-28 2019-07-26 复旦大学附属金山医院 一种针对人半胱氨酸蛋白酶抑制剂B的siRNA分子及其应用
EP4256061A1 (en) * 2020-12-01 2023-10-11 ETH Zurich Dna constructs comprising alternative promoters
WO2022235971A2 (en) * 2021-05-06 2022-11-10 Systems Oncology, Llc Compositions for inhibiting growth of targeted cells
WO2023004365A1 (en) * 2021-07-20 2023-01-26 Sio Gene Therapies Inc. Vector constructs for delivery of nucleic acids encoding therapeutic proteasome activator complex subunits and methods of using the same
CN115011601B (zh) * 2022-06-27 2023-07-21 山东大学齐鲁医院 一种干扰JUND表达的shRNA、重组腺相关病毒载体及其应用
CN118581151B (zh) * 2024-05-29 2024-12-06 中国农业科学院兰州兽医研究所(中国动物卫生与流行病学中心兰州分中心) 一种猪becn1基因敲除细胞的构建方法及其应用
CN120608104B (zh) * 2025-08-12 2025-11-25 中国科学院水生生物研究所 lasp1基因在鱼类抗病毒免疫调控中的功能和应用

Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4517338A (en) 1983-06-20 1985-05-14 Chiron Corporation Multiple reactor system and method for polynucleotide synthesis
US4888274A (en) 1985-09-18 1989-12-19 Yale University RecA nucleoprotein filament and methods
WO1999049029A1 (en) 1998-03-20 1999-09-30 Benitec Australia Ltd Control of gene expression
US6261806B1 (en) 1998-08-18 2001-07-17 Biotransplant, Inc. Molecular sequence of swine retrovirus and methods of use
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
WO2003006477A1 (en) 2001-07-12 2003-01-23 University Of Massachusetts IN VIVO PRODUCTION OF SMALL INTERFERING RNAs THAT MEDIATE GENE SILENCING
WO2003012052A2 (en) 2001-07-30 2003-02-13 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Specific inhibition of gene expression by small double stranded rnas
WO2003023015A2 (en) 2001-09-13 2003-03-20 California Institute Of Technology Method for expression of small antiviral rna molecules within a cell
US6573099B2 (en) 1998-03-20 2003-06-03 Benitec Australia, Ltd. Genetic constructs for delaying or repressing the expression of a target gene
US20030108923A1 (en) 2000-03-30 2003-06-12 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
WO2003056012A1 (en) 2001-12-24 2003-07-10 Cancer Research Technology Limited A system for stable expression of sirnas in mammalian cells
WO2003056022A2 (en) 2001-12-21 2003-07-10 Oxford Biomedica (Uk) Limited Method for producing a transgenic organism using a lentiviral expression vector such as eiav
WO2003059923A2 (en) 2001-12-21 2003-07-24 Tranzyme, Inc. Methods and compositions for generating a genetically modified animal using lentiviral vectors
US20030148519A1 (en) 2001-11-14 2003-08-07 Engelke David R. Intracellular expression and delivery of siRNAs in mammalian cells
US20030166282A1 (en) 2002-02-01 2003-09-04 David Brown High potency siRNAS for reducing the expression of target genes
US20040045043A1 (en) 2002-05-20 2004-03-04 Finney Robert E. Compositions and methods for generating conditional knockouts

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2646438B1 (fr) 1989-03-20 2007-11-02 Pasteur Institut Procede de remplacement specifique d'une copie d'un gene present dans le genome receveur par l'integration d'un gene different de celui ou se fait l'integration
US5464764A (en) * 1989-08-22 1995-11-07 University Of Utah Research Foundation Positive-negative selection methods and vectors
WO1999046388A1 (en) 1998-03-12 1999-09-16 Taisho Pharmaceutical Co., Ltd. Nucleic acid enzyme showing allosteric rna-cleaving activity on target rna
EP1272630A2 (en) * 2000-03-16 2003-01-08 Genetica, Inc. Methods and compositions for rna interference
US20030084471A1 (en) * 2000-03-16 2003-05-01 David Beach Methods and compositions for RNA interference
US20030143597A1 (en) * 2000-12-28 2003-07-31 Finney Robert E. Methods for making polynucleotide libraries, polynucleotide arrays, and cell libraries for high-throughput genomics analysis
EP1386004A4 (en) 2001-04-05 2005-02-16 Ribozyme Pharm Inc MODULATION OF GENE EXPRESSION ASSOCIATED WITH INFLAMMATORY PROLIFERATION AND GROWTH OF NEURITIES BY METHODS INVOLVING NUCLEIC ACID
KR20040023596A (ko) * 2001-05-01 2004-03-18 도꾸리쯔교세이호진 상교기쥬쯔 소고겡뀨죠 신규 맥시자임
US20030203868A1 (en) * 2002-02-06 2003-10-30 Bushman Frederic D. Inhibition of pathogen replication by RNA interference
DK1534819T3 (da) 2002-08-21 2010-04-19 Revivicor Inc Griselignende dyr, som mangler enhver ekspression af funktionel alfa-1,3-galactosyltransferase
US20040072769A1 (en) * 2002-09-16 2004-04-15 Yin James Qinwei Methods for design and selection of short double-stranded oligonucleotides, and compounds of gene drugs
CN1276976C (zh) * 2003-10-30 2006-09-27 封江南 单一载体编码多个发夹结构小干扰性rna表达系统及其构建方法
EP1582591A3 (en) * 2004-02-27 2005-12-21 Bundesrepublik Deutschland vertreten durch das Bundesminsterium für Gesundheit, dieses vertr. durch das Robert-Koch-Institut Sirna and their use for knock down expression of porcine endogenous retrovirus

Patent Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4517338A (en) 1983-06-20 1985-05-14 Chiron Corporation Multiple reactor system and method for polynucleotide synthesis
US4888274A (en) 1985-09-18 1989-12-19 Yale University RecA nucleoprotein filament and methods
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
WO1999049029A1 (en) 1998-03-20 1999-09-30 Benitec Australia Ltd Control of gene expression
US6573099B2 (en) 1998-03-20 2003-06-03 Benitec Australia, Ltd. Genetic constructs for delaying or repressing the expression of a target gene
US6261806B1 (en) 1998-08-18 2001-07-17 Biotransplant, Inc. Molecular sequence of swine retrovirus and methods of use
US20030108923A1 (en) 2000-03-30 2003-06-12 Whitehead Institute For Biomedical Research RNA sequence-specific mediators of RNA interference
WO2003006477A1 (en) 2001-07-12 2003-01-23 University Of Massachusetts IN VIVO PRODUCTION OF SMALL INTERFERING RNAs THAT MEDIATE GENE SILENCING
WO2003012052A2 (en) 2001-07-30 2003-02-13 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Specific inhibition of gene expression by small double stranded rnas
WO2003023015A2 (en) 2001-09-13 2003-03-20 California Institute Of Technology Method for expression of small antiviral rna molecules within a cell
US20030148519A1 (en) 2001-11-14 2003-08-07 Engelke David R. Intracellular expression and delivery of siRNAs in mammalian cells
WO2003056022A2 (en) 2001-12-21 2003-07-10 Oxford Biomedica (Uk) Limited Method for producing a transgenic organism using a lentiviral expression vector such as eiav
WO2003059923A2 (en) 2001-12-21 2003-07-24 Tranzyme, Inc. Methods and compositions for generating a genetically modified animal using lentiviral vectors
WO2003056012A1 (en) 2001-12-24 2003-07-10 Cancer Research Technology Limited A system for stable expression of sirnas in mammalian cells
US20030166282A1 (en) 2002-02-01 2003-09-04 David Brown High potency siRNAS for reducing the expression of target genes
US20040045043A1 (en) 2002-05-20 2004-03-04 Finney Robert E. Compositions and methods for generating conditional knockouts

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP1734811A4

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1582591A3 (en) * 2004-02-27 2005-12-21 Bundesrepublik Deutschland vertreten durch das Bundesminsterium für Gesundheit, dieses vertr. durch das Robert-Koch-Institut Sirna and their use for knock down expression of porcine endogenous retrovirus
JP2007104969A (ja) * 2005-10-13 2007-04-26 Bio Think Tank Co Ltd ショートヘアピン型RNA(shRNA)前駆体を産生するための核酸及びその利用
US9650631B2 (en) 2007-04-26 2017-05-16 University Of Iowa Research Foundation Reduction of off-target RNA interference toxicity
US8524881B2 (en) 2007-04-26 2013-09-03 University Of Iowa Research Foundation Reduction of off-target RNA interference toxicity
US10093927B2 (en) 2007-04-26 2018-10-09 University Of Iowa Research Foundation Reduction of off-target RNA interference toxicity
EP2164967B1 (en) * 2007-05-31 2015-07-08 University of Iowa Research Foundation Reduction of off-target rna interference toxicity
EP2530152A1 (en) * 2007-05-31 2012-12-05 University of Iowa Research Foundation Reduction of off-target RNA interference toxicity
US9529001B2 (en) 2009-08-14 2016-12-27 The Regents Of The University Of California Methods of diagnosing and treating autism
US10520499B2 (en) 2009-08-14 2019-12-31 The Regents Of The University Of California Methods of diagnosing and treating autism
US9420770B2 (en) 2009-12-01 2016-08-23 Indiana University Research & Technology Corporation Methods of modulating thrombocytopenia and modified transgenic pigs
US9181544B2 (en) 2011-02-12 2015-11-10 University Of Iowa Research Foundation Therapeutic compounds
US9523093B2 (en) 2014-05-20 2016-12-20 University Of Iowa Research Foundation Huntington's disease therapeutic compounds
US11098082B2 (en) 2015-06-26 2021-08-24 The Regents Of The University Of California Antigenic peptides and uses thereof for diagnosing and treating autism
US20220012673A1 (en) * 2020-07-13 2022-01-13 ZenDesk, Inc. Maintaining status information for customer-support agents across multiple channels
WO2022256294A1 (en) * 2021-06-01 2022-12-08 University Of Massachusetts Cas9 nickase-mediated gene editing

Also Published As

Publication number Publication date
AU2004316293A1 (en) 2005-09-09
EP2514826A2 (en) 2012-10-24
EP2514826A3 (en) 2013-04-03
CN103397019A (zh) 2013-11-20
CN1972593A (zh) 2007-05-30
CA2546853A1 (en) 2005-09-09
EP1734811A4 (en) 2009-03-25
CA2546853C (en) 2020-04-21
US20050266561A1 (en) 2005-12-01
JP2007512027A (ja) 2007-05-17
US10793873B2 (en) 2020-10-06
WO2005081714A3 (en) 2006-11-16
EP1734811A2 (en) 2006-12-27

Similar Documents

Publication Publication Date Title
US10793873B2 (en) Use of interfering RNA in the production of transgenic animals
Oberdoerffer et al. Efficiency of RNA interference in the mouse hematopoietic system varies between cell types and developmental stages
US10300112B2 (en) Transgenic ungulates expressing CTLA4-IG and uses thereof
EP1462525B1 (en) siRNA EXPRESSION SYSTEM AND PROCESS FOR PRODUCING FUNCTIONAL GENE KNOCKDOWN CELL OR THE LIKE USING THE SAME
KR20040072643A (ko) siRNA 발현시스템 및 이것을 이용한 기능유전자넉다운 세포 등의 생산방법
KR20150014446A (ko) 세포 형질감염 방법
US20050202077A1 (en) Targeted delivery of RNA interference molecules
JP2022113700A (ja) CRISPR-Casゲノム編集に基づく、Fel d1ノックアウト並びに関連組成物及び方法
US20040235764A1 (en) Methods of inhibiting expression of a target gene in mammalian cells
EP2201116B1 (en) Means and methods for shrna mediated conditional knockdown of genes
AU2015204349B2 (en) Use of interfering RNA in the production of transgenic animals
CN118389520B (zh) 小鼠进行基因敲除的方法及构建的ghr基因敲除小鼠模型
Baup et al. Variegation and silencing in a lentiviral-based murine transgenic model
NZ547388A (en) Use of interfering RNA in the production of transgenic animals
AU2012205138A1 (en) Use of interfering RNA in the production of transgenic animals
WO2006091112A1 (en) Compositions for the delivery of rna interference molecules and methods for their use
US20100305195A1 (en) microrna mediator of cardiomyopathy and heart failure
US20250051759A1 (en) METHODS AND MOLECULES FOR RNA INTERFERENCE (RNAi)
Buccheri et al. Genetic activation of canonical RNA interference in mice
DA et al. interference.
WO2005070044A2 (en) Systems and methods for short rna expression
Peoples Identification and Characterization of Bovine Pol III Promoters to Express a Short-Hairpin RNA

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2546853

Country of ref document: CA

Ref document number: 2006541617

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2004316293

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 547388

Country of ref document: NZ

WWW Wipo information: withdrawn in national office

Ref document number: DE

WWE Wipo information: entry into national phase

Ref document number: 2004821501

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 3408/DELNP/2006

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2004316293

Country of ref document: AU

Date of ref document: 20041122

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004316293

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 200480040601.X

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2004821501

Country of ref document: EP