WO2005007189A1 - Subunit vaccine against respiratory syncytial virus infection - Google Patents
Subunit vaccine against respiratory syncytial virus infection Download PDFInfo
- Publication number
- WO2005007189A1 WO2005007189A1 PCT/CA2004/001007 CA2004001007W WO2005007189A1 WO 2005007189 A1 WO2005007189 A1 WO 2005007189A1 CA 2004001007 W CA2004001007 W CA 2004001007W WO 2005007189 A1 WO2005007189 A1 WO 2005007189A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- rsv
- seq
- amino acid
- acid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/155—Paramyxoviridae, e.g. parainfluenza virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
- A61K2039/541—Mucosal route
- A61K2039/543—Mucosal route intranasal
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55505—Inorganic adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55572—Lipopolysaccharides; Lipid A; Monophosphoryl lipid A
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55588—Adjuvants of undefined constitution
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55588—Adjuvants of undefined constitution
- A61K2039/55594—Adjuvants of undefined constitution from bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18511—Pneumovirus, e.g. human respiratory syncytial virus
- C12N2760/18522—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18511—Pneumovirus, e.g. human respiratory syncytial virus
- C12N2760/18534—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- the present invention relates generally to the prevention of infectious disease, and more specifically, to compositions, and the use thereof, comprising one or more respiratory syncytial virus G protein immunogens and fragments or variants thereof capable of eliciting protective immunity without eliciting an immunopathological response or with a reduced immunopathological response (e.g. , reducing associated pulmonary pathology).
- Respiratory syncytial virus is the leading cause of lower respiratory tract infection (acute bronchiolitis and pneumonia) in early infancy (Glezen et al., Amer. J. Dis. Child. 140:543, 1986; Holberg et al., Am. J. Epidemiol. 733:1135, 1991; "Fields Virology", Fields, B. N. et al. Raven Press, N. Y. (1996), particularly, Chapter 44, pp 1313-1351 "Respiratory Syncytial Virus” by Collins, P., Mclntosh, K., and Chanock, R. M.).
- RSV has two major surface glycoproteins (designated F and G), which have been examined for use in potential vaccines.
- the F protein is involved in membrane fusion between the virus and target cell (Walsh and Hruska, J. Virol. 47: ⁇ 1 ⁇ , 1983), whereas the G protein is thought to mediate attachment of the virus to a cell receptor (Levine et al, J. Gen. Virol. 68:252 ⁇ , 1987).
- Both RSV F and G proteins induce strong serum and mucosal immunity, which are important for protection against RSV infection (Glezen et al, 1986; Holberg et al; Glezen et al, J. Pediatr. 98:10 , 1981; Lamprecht et al, J. Infect. Dis.
- mice have demonstrated that formalin- inactivated RSV and some G protein-encoding vaccinia recombinants prime for a harmful lung inflammatory response in which eosinophils are a prominent participant (Connors et -7/., J. Virol. 68:5321, 1994; Doherty, Trends Microbiol. 2:148, 1994; Waris et ⁇ /., J. Virol. 70:2852, 1996; Graham et al, J. Immunol. 757:2032, 1993; Beasley et al, Thorax 43:619, 1988; Openshaw et al, Int.
- Eosinophils and the eosinophil-attractant cytokine IL-5 are considered to be a feature of the so-called type 2 immune response, which has fostered the idea that immunization with RSV antigen has the potential to trigger type 2 responses depending on factors, such as the nature of specific viral immunogens and their route of presentation (Openshaw et al, 1992; Kakuk et ⁇ /., J. Infect. Dis. 167:553, 1993; Openshaw and O'Donnell, Thorax 49:101, 1994).
- compositions therapeutically effective against RSV infections particularly those compositions that can function as a vaccine by eliciting protective immunity without any or with a reduced associated harmful pulmonary inflammation.
- vaccine formulations that can be varied to protect against or treat for infection by different RSV immunogenic subtypes and subgroups.
- the present invention meets such needs, and further provides other related advantages.
- the present invention provides the discovery of therapeutic formulations of respiratory syncytial virus (RSV) immunogens, particularly G protein immunogens useful for eliciting a protective immune response without eliciting an, or with a reduced, immunopathological response.
- RSV respiratory syncytial virus
- the invention provides a method for treating or preventing an RSV infection, comprising administering to a subject in need thereof a composition comprising at least one respiratory syncytial virus G protein immunogen or fragment thereof comprising an amino acid sequence that is at least 80% identical to SEQ ID NO:2, wherein said G protein immunogen has an epitope that elicits a protective immune response without eliciting an, or with a reduced, immunopathological response, and a pharmaceutically acceptable carrier, diluent, or excipient, at a dose sufficient to elicit an immune response specific for one or more G protein immunogen or fragments and variants thereof.
- the G protein immunogen is an amino acid sequence comprising or consisting of SEQ ID NO:2.
- the invention provides a method for treating or preventing a respiratory syncytial virus infection wherein the G protein immunogen comprises an amino acid sequence selected from SEQ ID NOS:6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70.
- the invention provides a method wherein the composition further comprises at least one respiratory syncytial virus F protein immunogen or M protein immunogen, wherein the F protein and M protein immunogens have an epitope that elicits a protective immune response without eliciting an, or with a reduced, immunopathological response, or has at least two G protein immunogens.
- any of the aforementioned G protein immunogens and fragments or variants thereof further comprise a hydrophobic portion or moiety (e.g., to act as an anchor or foot in a lipid environment such as a membrane or proteosome or liposome), particularly when formulated with a proteosome adjuvant delivery vehicle.
- the hydrophobic moiety comprises an amino acid sequence or a lipid.
- the carrier is a liposome, and in other embodiments the liposome contains Deinococcus radiodurans lipids or ⁇ -galactosylphosphotidylglycerol alkylamine.
- any of the aforementioned compositions further comprise an adjuvant, such as alum, Freund's adjuvant, or a proteosome-based formulation (e.g., a proteosome adjuvant delivery system).
- the adjuvant is suitable for use in humans.
- the G protein immunogen or fragment and variants thereof further comprise a second amino acid sequence to form a fusion protein, wherein the second amino acid sequence can be a tag, an enzyme or a combination thereof, such as a polyhistidine, thioredoxin, or both.
- such fusion proteins may further comprise a hydrophobic moiety.
- any of the aforementioned methods are provided for use when the immunopathological response resulting from or associated with RSV infection is eosinophilia (such as pulmonary eosinophilia) or asthma.
- the invention provides any of the aforementioned methods for use when the infection is due to an RSV of subgroup A, subgroup B, or both subgroup A and subgroup B.
- any of the disclosed compositions may be administered in any of the aforementioned methods by a route selected from enteral, parenteral, transdermal, transmucosal, nasal or inhalation.
- the invention provides a plurality of antibodies, Th cells, or both produced by a method according to any one of aforementioned methods.
- a method for treating or preventing an RSV infection comprising administering to a subject in need thereof a composition comprising a pharmaceutically acceptable carrier or a proteosome adjuvant delivery vehicle, and a plurality of antibodies as just described.
- a composition comprising a respiratory syncytial virus G protein immunogen formulated with a proteosome adjuvant delivery vehicle, wherein said G protein immunogen comprises an amino acid sequence that is at least 80% identical to SEQ ID NO:2 or fragment thereof and wherein said G protein immunogen or fragment thereof has an epitope that elicits a protective immune response without eliciting an immunopathological response or with a reduced immunopathological response.
- the composition includes any of the aforementioned G protein immunogens and fragments or variants thereof, fusion proteins, multivalent fusions, cocktail compositions or any combination thereof, and other additives, such as an adjuvant.
- the adjuvant is alum, proteosome or protollin.
- FIG. 1 shows the induction of serum antibodies in mice immunized with wild type or mutant Trx-(polyHis)-G(128-229) proteins in alum and their ability to recognize wild type RSV G protein and the effect of G protein mutations on such induction. Extracts of RSV-infected HEp-2 cells were resolved by SDS-PAGE, transferred to membranes, and probed with pooled sera from each group of mice (mice were immunized twice at 14-day intervals with PBS/alum, or alum-adjuvanted wild type or mutant Trx-(polyHis)-G( 128-229) proteins).
- FIG. 2A and 2B show how G protein variants affect protective immunity (A) and eosinophilic infiltration in bronchoalveolar fluids (B) in immunized mice challenged with RSV.
- Mice were immunized twice subcutaneously at 14-day intervals with PBS/alum or wild type or mutant Trx-G128-229 proteins in alum, followed by RSV challenge.
- RSV titers in lung homogenates, as well as bronchoalveolar lavage eosinophils were determined four days after RSV challenge.
- Figures 3 A and 3B show the nucleic acid sequence (SEQ ID NO:l) and amino acid sequence (SEQ ID NO:2) of RSV group A, Long strain G protein. Shown in bold is an exemplary mutation of an amino acid (N191A, from codon A AC to GCC) to generate a G protein immunogen of the invention, from which fragments and variants thereof can be used as described herein.
- Figures 4A and 4B show polyacrylamide gel autoradiograms of ribonuclease protection assays (RPAs) of cytokine mRNA in lung tissue.
- RPAs ribonuclease protection assays
- the results illustrate relative levels of cytokine mRNA in lungs of mice assayed four days after RSV challenge, having been previously immunized twice subcutaneously at 14-day intervals with PBS/alum alone, alum-adjuvanted wild type Trx-Gl 28-229 protein, or variant Trx-G128-229 proteins.
- Panels A and B show different regions of the polyacrylamide gel that exposed radiographic film for 3 days (A) or 1 hour (B).
- Figure 5 shows the detection by ELISA of specific serum IgG antibodies from BALB/c mice immunized with wild type or mutant Trx-(polyHis)-G(l 28-229) fusion proteins alone, or adjuvanted with protollin or alum.
- mice were immunized three times with a dose of 6 ⁇ g or 2 ⁇ g of Trx-(polyHis)-G(l 28-229) fusion proteins.
- Protollin alone or fusion proteins formulated with protollin were administered intranasally, and alum alone or fusion proteins formulated with alum were administered subcutaneously.
- Serum samples were obtained after the second immunization (day 35) and two weeks after the third immunization (day 62).
- Figure 6 shows the detection by ELISA of specific bronchoalveolar lavage (BAL) IgA antibodies from BALB/c mice immunized with wild type or mutant Trx-(polyHis)-G( 128-229) fusion proteins alone, or adjuvanted with protollin or alum.
- Mice were immunized three times with a dose of 6 ⁇ g or 2 ⁇ g of Trx-(polyHis)-G(128- 229) fusion proteins.
- Protollin alone or fusion proteins formulated with protollin were administered intranasally, and alum alone or fusion proteins formulated with alum were administered subcutaneously.
- BAL samples were collected on day 62 (two weeks after the third immunization).
- the present invention provides compositions and methods for using and making respiratory syncytial virus (RSV) G protein immunogen to treat or prevent respiratory syncytial virus infection.
- RSV respiratory syncytial virus
- protection against RSV re-infection i.e., challenge
- previous vaccines consisting of various forms and immunization modes of the RSV G protein, this was often associated with an unwanted and harmful pulmonary inflammation characterized by pronounced eosinophilia.
- RSV G protein fragments can be modified to induce or elicit protective immunity against RSV and not induce or have a reduced level of a concomitant immunopathological event that leads to, for example, pulmonary inflammation and aggravated disease upon subsequent infection with RSV.
- these G protein immunogens are useful for treating or preventing infections involving RSV.
- any concentration range, percentage range, ratio range or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.
- fractions thereof such as one tenth and one hundredth of an integer
- the use of the alternative should be understood to mean either one, both or any combination thereof of the alternatives.
- the present invention is directed generally to immunogenic RSV polypeptide immunogens of G protein or fragments and variants thereof, including fusions to other polypeptides (e.g., a tag, another protein, a hydrophobic amino acid sequence, or any combination thereof) or other modifications (e.g., addition of a lipid or glycosylation).
- the immunogenic G polypeptides may comprise any portion or fragment of a G protein that has an epitope capable of eliciting a protective immune response against RSV infection without eliciting an immunopathological response or with a reduced immunopathological response.
- Immunogenic polypeptides of the instant invention may be arranged or combined in a linear form, and each immunogen may or may not be reiterated, wherein the reiteration may occur once or multiple times.
- a plurality of different RSV immunogenic polypeptides e.g. , different G protein, F protein, or M protein variants and fragments or variants thereof
- G protein immunogen or "RSV immunogen” refers to all full length polypeptides, full length variants, fragments and variants thereof, multivalent fusions, cocktail compositions, fusion proteins, or any combination thereof, capable of eliciting a protective immune response against RSV infection without eliciting an immunopathological response or with a reduced immunopathological response, as described herein.
- the present invention further provides methods for producing synthetic or recombinant multivalent RSV polypeptide immunogens, including fusion proteins.
- host cells containing G protein immunogen-encoding nucleic acid expression constructs may be cultured to produce recombinant G protein immunogens and fragments or variants thereof.
- immunopathological response refers to a condition or disease resulting from an immune reaction, which may or may not have detectable clinical symptoms.
- immunopathological responses include hypersensitivity or asthma.
- Another exemplary immunopathological response can be an atypical induction of granulocytes in response to type 2 cytokines, such as is found in blood eosinophilia or pulmonary eosinophilia, which can be characteristic of an allergic state or a microbial infection (such as a parasitic infection or a respiratory syncytial virus infection).
- cytokines such as is found in blood eosinophilia or pulmonary eosinophilia
- a microbial infection such as a parasitic infection or a respiratory syncytial virus infection.
- RSV has a negative-sense, non-segmented, single-stranded RNA genome, which encodes at least 10 viral proteins (G, F, SH, M, M2, N, P, L, NS1, and NS2).
- RSV has two major surface glycoproteins (designated F and G), which have been examined for use in potential vaccines.
- the F protein is involved in membrane fusion between the virus and target cell (Walsh and Hruska, J. Virol. 47:111, 1983), whereas the G protein is thought to mediate attachment of the virus to a cell receptor (Levine et al, J. Gen. Virol. 68:252 ⁇ , 1987). Both RSV F and G proteins induce strong serum and mucosal immunity, which are important for protection against RSV infection (Glezen et al,
- mice have demonstrated that formalin-inactivated RSV and some G protein-encoding vaccinia recombinants prime for a harmful lung inflammatory response in which eosinophils are a prominent participant (Connors et al, J. Virol. 65:5321, 1994;
- a surprising result of the instant invention is the identification of G protein immunogens (e.g., variants and mutants of wild-type G protein; an exemplary wild-type G protein is set forth in SEQ ID NO:4, which can be encoded by a nucleic acid sequence as set forth in SEQ ID NO:3) that elicit a protective immune response without eliciting an, or with a reduced, immunopathological response.
- G protein immunogens e.g., variants and mutants of wild-type G protein; an exemplary wild-type G protein is set forth in SEQ ID NO:4, which can be encoded by a nucleic acid sequence as set forth in SEQ ID NO:3
- a respiratory syncytial virus G protein immunogen or fragment thereof that has an epitope that elicits a protective immune response without eliciting an, or with a reduced, immunopathological response is used to prepare compositions useful for treating or preventing RSV infections.
- the RSV G protein immunogens have at least 50%) to 100% amino acid identity to an amino acid sequence of the full length G protein mutant as set forth in SEQ ID NO:2 (from RSV Group A, Long strain; SEQ ID NO:l is the nucleic acid sequence that encodes amino acid sequence of SEQ ID NO:2), or fragments thereof as set forth in SEQ ID NOS:6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70; preferably 60%-99% identity, more preferably 70%-97% identity, and most preferably 80%-95% identity, wherein the G protein immunogen variants retain at least one epitope that elicits a protective immune response against RSV without eliciting an immunopathological response or with a reduced immunopathological response (e.g., eosinophilia).
- SEQ ID NO:l is the nucleic acid sequence that encodes amino acid sequence of SEQ ID NO:2
- a G protein immunogen is a variant of wild-type G protein having a point mutation, wherein an amino acid at, for example, position 191 (Asn) is changed to an Ala (see SEQ ID NO:2 and Figure 3, also referred to as G protein N191 A), and in a more preferred embodiment, a G protein immunogen variant is a fragment of full length G protein.
- G protein fragment may include from about amino acid 128 to about amino acid 229, wherein the fragment contains the N191 A mutation (SEQ ID NO:6).
- G protein immunogen variants span amino acids 128 to 229, wherein the variants include double point mutants, such as P190A and N191A (SEQ ID NO:56), or R188A and N191A (SEQ ID NO:58).
- Point mutants of use in the instant invention could include those at the Asn at positions 178 (SEQ ID NO:60) and 179 (SEQ ID NO:62), and at the Lys at positions 196 (SEQ ID NO:64), 197 (SEQ ID NO:66), 204 (SEQ ID NO:68), or 205 (SEQ ID NO:70).
- the representative G protein immunogen variants described herein include an Ala substitution, but the invention is not so limited and a person of skill in the art would know that other amino acids could be used for substitutions.
- variant immunogens of the instant invention could be made to include one or more of a variety of mutations, such as point mutations, frameshift mutations, missense mutations, additions, deletions, and the like, or the variants can be a result of modifications, such as by certain chemical substituents, including glycosylation, alkylation, etc.
- Each of the variants of the instant disclosure preferably is capable of eliciting a protective immune response against RSV without eliciting an immunopathological response or with a reduced immunopathological response (e.g. , eosinophilia).
- preferred fragments of G protein are immunogens that retain at least one epitope that elicits a protective immune response against RSV and elicits a reduced immunopathological response, or is incapable of eliciting an immunopathological response.
- the immunogen fragments or variants thereof e.g., the Nl 91 A mutation
- the immunogen fragments or variants thereof have mutations or variations from wild-type G protein in amino acid sequences that span from about amino acid 120 to about amino acid 300 of SEQ ID NO:2, preferably from about amino acid 125 to about amino acid 250, more preferably from about amino acid 150 to about amino acid 225, and most preferably from about amino acid 165 to about amino acid 195.
- the G protein immunogen fragment includes amino acids 128 to 229 and mutations can be found in the range of about amino acids 178 to about 205 of G protein. Sequence comparisons can be performed using any standard software program, such as BLAST, tBLAST, pBLAST, or MegAlign. Still others include those provided in the Lasergene bioinformatics computing suite, which is produced by DNASTAR ® (Madison, Wisconsin). References for algorithms such as ALIGN or BLAST may be found in, for example, Altschul, J Mol. Biol. 219:555-565, 1991; or Henikoff and Henikoff, Proc. Nad. Acad. Sci. USA 59:10915-10919, 1992.
- BLAST is available at the NCBI website (www.ncbi.nlm.nih.gov/BLAST).
- Other methods for comparing multiple nucleotide or amino acid sequences by determining optimal alignment are well known to those of skill in the art (see, e.g., Peruski and Peruski, The Internet and the New Biology: Tools for Genomic and Molecular Research (ASM Press, Inc. 1997); Wu et al. (eds.), "Information Superhighway and Computer Databases of Nucleic Acids and Proteins," in Methods in Gene Biotechnology, pages 123-151 (CRC Press, Inc. 1997); and Bishop (ed.), Guide to Human Genome Computing, 2nd Edition, Academic Press, Inc., 1998).
- similarity between two peptides or polypeptides is generally determined by comparing the amino acid sequence of one peptide or polypeptide to the amino acid sequence and conserved amino acid substitutes thereto of a second peptide or polypeptide.
- Fragments or portions of the G protein immunogens or variants thereof of the present description may be employed for producing the corresponding full-length G protein immunogens by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length G protein immunogens.
- fragments or portions of the nucleic acids of the present invention may be used to synthesize full-length nucleic acids of the present disclosure.
- G protein immunogens and fragments or variants thereof of the instant disclosure have an epitope that elicits a protective immune response without eliciting an immunopathological response or with a reduced immunopathological response.
- the fragments and variants may be identified using in vivo and in vitro assays known in the art, such as animal immunization studies (e.g., using a mouse or rabbit model) and Western immunoblot analysis, respectively, and combinations thereof.
- Other examples include plaque reduction assays to assess whether G protein immunogens and fragments or variants thereof of the instant description are capable of eliciting an immune response, particularly a protective (neutralizing) immune response.
- an animal is immunized with one or more G protein immunogens, or composition thereof, by subcutaneous administration, sera is collected from the immunized animals, and then the sera is tested for its ability to inhibit RSV infection of a cell culture monolayer (infection being measured as the number of plaques that form; i.e., "holes" in the monolayer arising from RSV causing cells to lyse) (see, e.g., Example 8).
- altered (reduced or enhanced) immunopathological responses can be indirectly identified by, for instance, examining cytokine expression patterns in animals challenged with RSV after immunization with G protein immunogens of the invention.
- cytokine levels can be measured in tissues of interest using a ribonuclease protection assay (RPA) to deduce whether a type 1 or type 2 response is prevalent after immunization with a G protein immunogen of the invention and subsequent challenge with RSV (see Example 9).
- RPA ribonuclease protection assay
- RSV G protein polypeptides, fragments thereof, and fusion proteins thereof, as well as corresponding nucleic acids of the present invention are preferably provided in an isolated form, and in certain preferred embodiments, are purified to homogeneity.
- isolated means that the material is removed from its original or natural environment.
- nucleic acid molecules or polypeptide present in a living animal or cell is not isolated, but the same nucleic acid molecule or polypeptide is isolated when separated from some or all of the co-existing materials in the natural system.
- the nucleic acid molecules could be part of a vector and/or such nucleic acids or polypeptides could be part of a composition and still be isolated in that such vector or composition is not part of its natural environment.
- the present invention also pertains to RSV G protein immunogens and fragments or variants thereof produced synthetically or recombinantly, and preferably recombinantly.
- the immunogenic polypeptide components of the immunogens may be synthesized by standard chemical methods, including synthesis by automated procedure.
- immunogenic peptides are synthesized based on the standard solid-phase Fmoc protection strategy with HATU as the coupling agent.
- the immunogenic peptide is cleaved from the solid-phase resin with trifluoroacetic acid containing appropriate scavengers, which also deprotects side chain functional groups.
- Crude immunogenic peptide is further purified using preparative reverse phase chromatography. Other purification methods, such as partition chromatography, gel filtration, gel electrophoresis, or ion-exchange chromatography may be used.
- Other synthesis techniques known in the art may be employed to produce similar immunogenic peptides, such as the tBoc protection strategy, use of different coupling reagents, and the like.
- a synthetic G protein immunogen of the invention will have an amino acid sequence that is at least 80% identical to SEQ ID NOS:2, 6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70.
- the G protein immunogens and fragments or variants thereof of certain embodiments may be recombinant, wherein a desired G protein immunogen is expressed from a polynucleotide that is operably linked to an expression control sequence (e.g., promoter) in a nucleic acid expression construct.
- a recombinant G protein immunogen will comprise an amino acid sequence that is at least 80% identical to SEQ ID NO:2.
- Some preferable recombinant G protein immunogens comprise an amino acid sequence of SEQ ID NO:2 or consist solely of an amino acid sequence as set forth in SEQ ID NO:2.
- a recombinant G protein immunogens and variants thereof comprise an amino acid sequence as set forth in SEQ ID NOS:6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, and more preferably comprise an amino acid sequence as set forth in SEQ ID NO:6, SEQ ID NO:56 or SEQ ID NO:58.
- recombinant G protein immunogens and fragments or variants thereof have an epitope that elicits a protective immune response without eliciting an, or with a reduced, immunopathological response.
- Nucleic acid or “nucleic acid molecule” refers to any of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action.
- Nucleic acids may be composed of monomers that are naturally occurring nucleotides (such as deoxyribonucleotides and ribonucleotides), analogs of naturally occurring nucleotides (e.g., ⁇ -enantiomeric forms of naturally-occurring nucleotides), or a combination of both.
- Modified nucleotides can have modifications in sugar moieties and/or in pyrimidine or purine base moieties.
- Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters.
- the entire sugar moiety may be replaced with sterically and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs.
- modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes.
- Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like.
- nucleic acid also includes so-called “peptide nucleic acids,” which comprise naturally occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single stranded or double stranded.
- an "isolated nucleic acid molecule” refers to a polynucleotide molecule in the form of a separate fragment, or as a component of a larger nucleic acid construct, which has been separated from its source cell (including the chromosome it normally resides in) at least once in a substantially pure form.
- a DNA molecule that encodes an RSV polypeptide, peptide, or variant thereof, which has been separated from an RSV particle or from a host cell infected with or harboring RSV is an isolated DNA molecule.
- Another example of an isolated nucleic acid molecule is a chemically synthesized nucleic acid molecule.
- Nucleic acid molecules may be comprised of a wide variety of nucleotides, including DNA, cDNA, RNA, nucleotide analogues or some combination thereof.
- an isolated nucleic acid molecule comprises a sequence encoding a G protein immunogen or fragment thereof comprising an amino acid sequence that is at least 80% identical to SEQ ID NO:2, wherein said G protein immunogen has an epitope that elicits a protective immune response without eliciting an, or with a reduced, immunopathological response.
- an isolated nucleic acid molecule comprises a sequence encoding a G protein immunogen that has an amino a ⁇ id sequence comprising or consisting of SEQ ID NO:2.
- an isolated nucleic acid molecule comprises a sequence encoding a G protein immunogen fragment that comprises an amino acid sequence as set forth in NOS:6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, and more preferably comprises an amino acid sequence as set forth in SEQ ID NO:6, SEQ ID NO:56, or SEQ ID NO:58.
- the invention relates to nucleic acid vectors and constructs that include nucleic acid sequences of the present invention, and in particular to "nucleic acid expression constructs" that include any polynucleotide encoding an RSV polypeptide and fragments or variants thereof as provided above.
- the instant disclosure pertains to host cells that are genetically engineered with vectors or constructs of the invention, and to the production and use in methods for treating or preventing an RSV infection or eliciting an immune response.
- the RSV polypeptides and fragments or variants thereof may be expressed in mammalian cells, yeast, bacteria or other cells under the control of appropriate expression control sequences.
- Cell-free translation systems may also be employed to produce such proteins using RNAs derived from the nucleic acid expression constructs of the present invention.
- Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described, for example, by Sambrook et al, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, (1989), and may include plasmids, cosmids, shuttle vectors, viral vectors and vectors comprising a chromosomal origin of replication as disclosed therein.
- a nucleic acid expression construct comprises an expression control sequence operably linked to a polynucleotide encoding a G protein immunogen or fragment thereof comprising an amino acid sequence that is at least 80% identical to SEQ ID NO:2, wherein said G protein immunogen has an epitope that elicits a protective immune response without eliciting an immunopathological response or with a reduced immunopathological response.
- a nucleic acid expression construct comprises an expression control sequence operably linked to a polynucleotide encoding a G protein immunogen that has an amino acid sequence comprising or consisting of SEQ ID NO:2.
- a nucleic acid expression construct comprises an expression control sequence operably linked to a polynucleotide encoding a G protein immunogen or fragment thereof comprising an amino acid sequence as set forth inNOS:6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, and more preferably comprises an amino acid sequence as set forth in SEQ ID NO:6, SEQ ID NO:56, or SEQ ID NO:58.
- the nucleic acid expression constructs described herein have an inducible promoter, which may be lac, tac, trc, ara, trp, ⁇ phage, T7 phage, and T5 phage promoter, and more preferably is a T5 phage promoter// ⁇ c operator expression control sequence (plasmid pT5) as described in U.S. Patent Application Publication No. 2003/0143685.
- the "expression control sequence” refers to any sequence sufficient to allow expression of a protein of interest in a host cell, including one or more promoter sequences, enhancer sequences, operator sequences (e.g., lacO), and the like.
- the RSV polypeptide-encoding nucleic acid is in a plasmid, preferably in plasmid pT5, and the host cell is a bacterium, preferably Escherichia coli.
- Injection of mammals with gene delivery vehicles (e.g., naked DNA) encoding antigens of various pathogens has been shown to result in protective immune responses (Ulmer et al., Science 259:1745-9, 1993; Bourne et al., J Infect. Dis. 773:800- 7, 1996; Hoffman et al., Vaccine 12: 1529-33, 1994).
- polynucleotide sequences that encode a G protein immunogen or fragment thereof are ligated into plasmids that are specifically engineered for mammalian cell expression (see, e.g., Hartikka et al., Hum Gene Ther 7:1205-17, 1996, which contains the promoter/enhancer element from cytomegalovirus early gene, the signal peptide from human tissue plasminogen activator and a terminator element from the bovine growth hormone gene).
- the RSV polypeptides can be cloned into a plasmid that is used to transfect human cell lines to assure recombinant protein expression.
- the plasmid may be propagated in bacteria, such as E.
- mice can be immunized with, for example, 50 ⁇ g of an isolated recombinant plasmid in 50 ⁇ l saline intramuscularly (i.m.).
- Booster injections of the same dose may be further given at three and six week intervals after the initial injection.
- gene delivery vehicles can likewise be utilized within the context of the present invention, including viruses, retrotransposons and cosmids.
- adenoviral vectors e.g., WO 94/26914, WO 93/9191; Yei et al., Gene Therapy 7:192-200, 1994; Kolls et al., PNAS 97(1):215-219, 1994; Kass- ⁇ isler et al., PNAS 90(24): 11498-502, 1993; Guzman et al., Circulation 55(6):2838-48, 1993; Guzman et al., Cir. Res. 73(6): 1202-1207, 1993; Zabner et al., Cell 75(2):207-216, 1993; Li et al, Hum Gene Ther.
- adenoviral vectors e.g., WO 94/26914, WO 93/9191; Yei et al., Gene Therapy 7:192-200, 1994; Kolls et al., PNAS 97(1):215-219, 1994; Kass- ⁇ isler et al., PNAS 90
- retroviral vectors e.g., ⁇ P 0 415 731; WO 90/07936; WO 91/02805; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Patent No. 5,219,740; WO
- Gene-delivery vehicles may be introduced into a host cell utilizing a vehicle, or by various physical methods.
- Such methods include transformation using calcium phosphate precipitation (Dubensky et al., PNAS 57:7529-7533, 1984), direct microinjection of such nucleic acid molecules into intact target cells (Acsadi et al., Nature 352:815-818, 1991), and electroporation whereby cells suspended in a conducting solution are subjected to an intense electric field in order to transiently polarize the membrane, allowing entry of the nucleic acid molecules.
- Other procedures include the use of nucleic acid molecules linked to an inactive adenovirus (Cotton et al., PNAS 59:6094, 1990), lipofection (Feigner et al., Proc. Natl. Acad. Sci.
- Serum from a subject immunized with gene delivery vehicles containing RSV polypeptide immunogens and fragments or variants thereof, and fusions thereof can be assayed for total antibody titer by ⁇ LIS A using native RSV polypeptides as the antigen.
- Serum protective antibodies may be assayed as described herein or as known in the art.
- Protective efficacy of DNA RSV polypeptide vaccines can be determined by, for example, direct animal protection assays (i.e., challenge infection studies) using an RSV serotype that is represented in the pharmaceutical composition or vaccine (i.e., challenge infection studies).
- an RSV polypeptide-encoding nucleic acid may be a variant of the natural sequence due to, for example, the degeneracy of the genetic code (including homologs or strain variants or other variants).
- variants may result from natural polymorphisms or may be synthesized by recombinant methodology (e.g. , to obtain codon optimization for expression in a particular host) or chemical synthesis, and may differ from wild-type polypeptides by one or more amino acid substitutions, insertions, deletions, and the like.
- Variants encompassing conservative amino acid substitutions include, for example, substitutions of one aliphatic amino acid for another, such as He, Val, Leu, or Ala or substitutions of one polar residue for another, such as between Lys and Arg, Glu and Asp, or Gin and Asn. Such substitutions are well known in the art to provide variants having similar physical properties, structural properties, and functional activities, such as for example, the ability to elicit and cross-react with similar antibodies (e.g., antibodies that specifically bind to wild-type G protein).
- variants include nucleic acids sequences that encode G protein immunogen fragments having at least 50% to 100% amino acid identity to SEQ ID NOS:2, 6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70.
- Preferred embodiments are those variants having greater than 90% or 95% identity with the amino acid sequence of SEQ ID NOS:2, 6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70.
- the present invention includes any of the aforementioned degenerate nucleic acid molecules that encode G protein immunogens and fragments or variants thereof comprising an amino acid sequence as set forth in SEQ ID NOS:2, 6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, and that retain functional activity (such as having an epitope that elicits a protective immune response without eliciting an immunopathological response or with a reduced immunopathological response).
- nucleic acid molecules that encode G protein immunogens and fragments or variants thereof having conservative amino acid substitutions or deletions or substitutions, such that the RSV polypeptide variant(s) retain (from wild-type) or have at least one epitope capable of eliciting antibodies specific for one or more RSV strains.
- a nucleic acid sequence may be modified to encode an RSV immunogen or functional variant thereof wherein specific codons of the nucleic acid sequence have been changed to codons that are favored by a particular host and can result in enhanced levels of expression (see, e.g., Haas et al, Curr. Biol. 6:315, 1996; Yang et al, Nucleic Acids Res.
- codons of the immunogenic peptides can be optimized, without changing the primary sequence of the peptides, for improved expression in Escherichia coli.
- arginine (Arg) codons of AGG/AGA can be changed to the Arg codons of CGT/CGC.
- AGG/AGA Arg codons can be optimized to CGT/CGC codons.
- codons may be optimized for a host in which the G protein immunogens and fragments or variants thereof are to be expressed, including bacteria, fungi, insect cells, plant cells, and mammalian cells.
- codons encoding different amino acids may be changed as well, wherein one or more codons encoding different amino acids may be altered simultaneously as would best suit a particular host (e.g., codons for arginine, glycine, leucine, and serine may all be optimized or any combination thereof).
- Exemplary nucleic acid sequences with codons optimized for expression in bacteria include sequences as set forth in SEQ ID NOS:23, 25, 27, 29, 31 and 33. These nucleic acid sequences encode G protein immunogen fragment fusion proteins ( . e. , fused to thioredoxin or a hexahistidine tag) as set forth in SEQ ID NOS:24, 26, 28, 30, 32 and 34, respectively.
- codon optimization may result in one or more changes in the primary amino acid sequence, such as a conservative amino acid substitution, addition, deletion, and combinations thereof.
- isolated nucleic acids encoding RSV immunogens are depicted in SEQ ID NOS:l, 3, 5, 7, 9, 1 1, 13,15, 17, 19, 21, 55, 57, 59, 61, 63, 65 67 or 69, within the context of the present disclosure, reference to one or more isolated nucleic acids includes variants of these sequences that are substantially similar in that they encode native or non-native RSV polypeptides with similar structure and similar functional ability to elicit specific antibodies to at least one G protein epitope contained in the RSV polypeptides of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70.
- the nucleotide sequence is deemed to be "substantially similar" when: (a) the nucleotide sequence is derived from the coding region of an RSV G protein gene (including, for example, portions of the sequence or homologous variations of the sequences discussed herein) and contains a G protein epitope with substantially the same ability to elicit a protective immune response without eliciting an, or with a reduced, immunopathological response; (b) the nucleotide sequence is capable of hybridization to the nucleotide sequences of the present invention under moderate or high stringency; (c) the nucleotide sequences are degenerate (i.e., sequences which code for the same amino acids using a different codon sequences) as a result of the genetic code to the nucleotide sequences defined in (a) or (b); or (d) is a complement of any of the sequences described in (a), (b) or (c).
- two nucleotide sequences are said to "hybridize” under conditions of a specified stringency when stable hybrids are formed between substantially complementary nucleic acid sequences.
- Stringency of hybridization refers to a description of the environment under which hybrids are annealed and washed (i.e., conditions under which annealed hybrids remain hybridized or annealed), which typically includes varying ionic strength and temperature. Other factors that might affect hybridization include the probe size and the length of time the hybrids are allowed to form.
- high stringency is 0.1 x SSPE or SSC, 0.1% SDS, 65°C; medium stringency is 0.2 x SSPE or SSC, 0.1% SDS, 50°C; and low stringency is 1.0 x SSPE or SSC, 0.1% SDS, 50°C.
- high stringency conditions means that one or more sequences will remain hybridized only if there is at least 95%, and preferably at least 97%, identity between the sequences.
- the nucleic acid sequences that remain hybridized to a G protein immunogen-encoding nucleic acid molecule encode polypeptides that retain at least one epitope of a G protein immunogen of any one of SEQ ID NOS:2, 6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, and have an epitope with substantially the same ability to elicit a protective immune response without eliciting an immunopathological response or with a reduced immunopathological response.
- Methods for producing the RSV polypeptides of the subject invention are also provided wherein any of the nucleic acid molecules and host cells described herein may be used.
- a method of producing a G protein immunogen and fragments or variants thereof comprises culturing a host cell containing a nucleic acid expression vector comprising at least one expression control sequence operably linked to a nucleic acid molecule encoding an RSV polypeptide, such as an RSV G protein immunogen and fragment or variant thereof as set forth in any one of SEQ ID NOS:2, 6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, under conditions and for a time sufficient for expression of the polypeptide.
- an RSV G protein immunogen and fragment or variant thereof is produced by this method, and more preferably the RSV polypeptides produced comprise an amino acid sequence as set forth in SEQ ID NOS: 2, 6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, and more preferably the RSV polypeptides produced comprise an amino acid sequence as set forth in SEQ ID NO:6, 56, or 58.
- multivalent vaccines are contemplated.
- such multivalent compositions may comprise a combination of two or more different G protein immunogens, or a combination of one or more G protein immunogens with one or more other RSV immunogens (such as an F protein or an M protein immunogen).
- the combination of antigens may be formulated as a cocktail (i.e., a mixture of a plurality of different immunogens), or the combination may be a plurality of different immunogens conjugated, linked or fused together (chemically or recombinantly).
- the fused immunogens may have one or more immunogens reiterated at least once within the multivalent fusion protein, which reiteration may occur at the amino-terminal end, the carboxy-terminal end, an internal position of a selected multivalent immunogen polypeptide, at multiple positions, or any combination thereof.
- such multivalent hybrid RSV immunogens may comprise one or more peptide fragments of the G protein and one or more peptides fragments of an F protein or M protein of RSV, and any combination thereof.
- such multivalent hybrid RSV multivalent hybrid RSV immunogen vaccine compositions may combine immunogenic epitopes from different RSV antigenic groups, for example, immunogens from subgroup A viruses (e.g., Long and A2) or subgroup B viruses (e.g., CH- 18537 and 8/60), or immunogens from both subgroup A and B viruses (or any other RSV subgroups that are found to, for example, infect humans).
- the RSV immunogens may be linked by, for example, at least two amino acids encoded by a nucleic acid sequence that is a restriction enzyme recognition site, wherein the restriction sites may be any one or more of BamRl, Clal, EcoRI, Hwdlll, Kpnl, Ncol, Nhel, Pmll, Pstl, Sail, Xhol, and the like. Additional amino acid linkers may also be added synthetically, as is known in the art and described herein. Preferably, the additional amino acids do not create any identity in sequence encompassing a five amino acid stretch of a human protein so as to minimize the possibility of eliciting human tissue cross-reactive antibodies.
- the hybrid polypeptides of the subject invention may further comprise at least one additional carboxy-terminal amino acid, wherein the additional amino acid is a D- or an L-amino acid.
- additional amino acid is a D- or an L-amino acid.
- Any of the twenty naturally occurring amino acids or derivatives thereof may be added, such as cysteine, histidine, leucine, and glutamic acid.
- cysteine may be useful to attach (e.g., enzymatically or by chemical cross- linking) other constituents, such as a lipid, a carrier protein, a tag, an enzyme, and the like.
- the invention also provides RSV immunogen fusion proteins comprising a G protein immunogen or fragment thereof fused to an additional functional or non-functional polypeptide sequence that permits, for example, detection, isolation, and purification of the hybrid polypeptide fusion proteins.
- an additional functional polypeptide sequence may be a tag sequence, which includes fusion proteins that may in certain embodiments be detected, isolated or purified by protein-protein affinity (e.g., receptor-ligand), metal affinity or charge affinity methods.
- the hybrid polypeptide fusion proteins may be detected by specific protease cleavage of a fusion protein having a sequence that comprises a protease recognition sequence, such that the hybrid polypeptides may be separable from the additional polypeptide sequence.
- hybrid polypeptides may be made synthetically including additional amino acids, a carrier protein, a hydrophobic portion or moiety (e.g., a lipid), or a tag sequence, which may be located at the amino-terminal end, carboxy-terminal end, or at a site internal (non-terminal) of the fusion protein.
- a carrier protein e.g., a lipid
- a tag sequence which may be located at the amino-terminal end, carboxy-terminal end, or at a site internal (non-terminal) of the fusion protein.
- recombinant RSV immunogens are fused in-frame to a tag, which tag may be any one of alkaline phosphatase, thioredoxin (Trx), ⁇ -galactosidase, hexahistidine (6xHis), FLAG ® epitope tag (DYKDDDDK, SEQ ID NO:71), GST or the like, and any combination thereof.
- tag may be any one of alkaline phosphatase, thioredoxin (Trx), ⁇ -galactosidase, hexahistidine (6xHis), FLAG ® epitope tag (DYKDDDDK, SEQ ID NO:71), GST or the like, and any combination thereof.
- Preferred embodiments include hybrid polypeptide fusion proteins that facilitate affinity detection and isolation of the hybrid polypeptides, and may include, for example, poly-His or the defined antigenic peptide epitopes described in U.S. Patent No.
- the affinity sequence may be a hexa-histidine tag as supplied by a vector.
- a pBAD/His Invitrogen
- a pET vector Invitrogen
- a pQE vector Qiagen, Valencia, CA
- the affinity sequence may be added either synthetically or engineered into the primers used to recombinantly generate the nucleic acid sequence (e.g., using the polymerase chain reaction) encoding an immunogenic peptide of RSV.
- any of the aforementioned G protein immunogens and fragments or variants thereof, and fusion proteins thereof may also have a hydrophobic portion (anchor or foot) that is conjugated, linked or fused (chemically or recombinantly) to the amino-terminal end or carboxy-terminal end.
- hydrophobic moieties include an amino acid sequence of at least five amino acids, such as MFLLAVFYGG (SEQ ID NO:35) or GGYFVALLF (SEQ ID NO:36),or a lipid.
- RSV immunogens are fused to a thioredoxin or a polyhistidine tag, which are encoded by a recombinant nucleic acid sequence encoding such a fusion protein.
- RSV G protein immunogen fragments are fused to a thioredoxin and a polyhistidine tag, which are encoded by a nucleic acid sequence as set forth in SEQ ID NOS: 23 or 25.
- Exemplary amino acid sequences of RSV G protein immunogen fragments fused to a thioredoxin and a polyhistidine tag are set forth in SEQ ID NOS:24 and 26.
- nucleic acid sequences that encode an RSV G protein immunogen fusion protein further comprising a nucleic acid sequence that encodes a hydrophobic moiety or foot linked or fused to the G immunogen fusion protein, as found in the sequences set forth in SEQ ID NOS:27, 29, 31 or 33.
- Exemplary amino acid sequences of RSV G protein immunogen fragments fused to a thioredoxin and a polyhistidine tag, and further comprising a hydrophobic portion or foot are set forth in SEQ ID NOS:28, 30, 32 and 34.
- the hydrophobic moiety is an amino acid sequence of MFLLAVFYGG (SEQ ID NO:35) fused to the amino-terminal end of the fusion protein or GGYFVALLF (SEQ ID NO: 36) fused to the carboxy-terminal end of the fusion protein.
- a fusion protein may comprise a hydrophobic moiety fused to the amino-terminal end or carboxy-terminal end of a G protein immunogen or fragment thereof.
- fusion protein may comprise a hydrophobic portion fused to a linker (e.g. , one or more amino acids, preferably two or four) which in turn is fused to the amino-terminal end or carboxy-terminal end of a G protein immunogen or fragment thereof.
- a fusion protein may comprise a hydrophobic moiety fused to one or more amino acid sequences (e.g., a tag, such as a thioredoxin or a polyhistidine) which in turn is fused to the amino-terminal end of a G protein immunogen or fragment thereof, or a fusion protein may comprise one or more amino acid sequences (e.g.
- a tag such as a thioredoxin or a polyhistidine fused to the amino- terminal end of a G protein immunogen or fragment thereof which in turn is fused to a hydrophobic portion.
- a fusion protein of the instant disclosure may be constructed to contain one or more G protein immunogens or fragments and variants thereof, one or more linkers, one or more additional amino acid tag sequences, one or more hydrophobic portions, or any combination thereof.
- compositions that contain one or more RSV immunogens, which may be used to elicit an immune response without the concomitant immunopathological response or at least a reduced immunopathological response.
- This description further relates to methods for treating and preventing RSV infections by administering to a subject a G protein immunogen or fragment and variants thereof, fusion protein, multivalent immunogen, or a mixture of such immunogens at a dose sufficient to elicit antibodies specific for RSV, as described herein.
- G protein immunogens or fragments and variants thereof, or a cocktail of such immunogens are preferably part of a pharmaceutically acceptable composition when used in the methods of the present invention.
- a G plus F composite RSV antigen vaccine of the instant description is expected to elicit both a CD4 + and a CD8 + protective immune response, without eliciting an, or with a reduced, immunopathological proliferative lymphocyte response, such a response being harmful or otherwise unwanted.
- proteosome technology-based components combined with RSV antigen(s) may influence a shift in the immune response raised to an RSV antigen from a predominantly type 2 response towards a preferential type 1 response (as determined by cytokine profiles known by those of ordinary skill in the art), and thereby eliminating or reducing, in a statistically significant manner, an undesired eosinophilic response, an undesired IgE response or both, following immunization with a vaccine or pharmaceutical composition of the instant description.
- a preferential type 1 response as determined by cytokine profiles known by those of ordinary skill in the art
- a vaccine of the instant invention is capable of eliciting an immune response that protects from or otherwise moderates the pathological consequences of an RSV infection, while at the same time ablating or otherwise diminishing a subsequent IgE antibody response to common allergens.
- the invention provides a composition comprising a respiratory syncytial virus G protein immunogen formulated with a proteosome or a liposome, wherein said G protein immunogen comprises an amino acid sequence that is at least 80% identical to SEQ ID NO:2 or fragment thereof and wherein said G protein immunogen or fragment thereof has an epitope that elicits a protective immune response without eliciting an, or with a reduced, immunopathological response.
- G protein immunogen comprising an amino acid sequence as set forth in SEQ ID NO:2 or consisting of SEQ ID NO:2.
- G protein immunogens that comprise an amino acid sequence selected from SEQ ID NOS:6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, more preferably SEQ ID NO:6, SEQ ID NO:56 or SEQ ID NO:58.
- liposomes formulated to contain one or more RSV immunogens further comprise Deinococcus radiodurans lipids or ⁇ -galactosylphosphotidylglycerolalkylamine.
- Respiratory syncytial virus immunogens of the present invention may further include a covalently attached hydrophobic moiety.
- a hydrophobic moiety may be, for example, an amino acid sequence or a lipid, as disclosed in U.S. Patent No. 5,726,292.
- the hydrophobic moiety is an amino acid sequence of MFLLAVFYGG (SEQ ID NO: 35) fused to the amino-terminal end of an immunogen or GGYFVALLF (SEQ ID NO:36) fused to the carboxy-terminal end of an immunogen.
- Naturally occurring RSV G protein contains a hydrophobic transmembrane amino acid sequence, which may function as a hydrophobic moiety according to the instant invention.
- an RSV composition e.g., a vaccine composition of the instant application comprises an RSV G protein immunogen or fragment thereof as described herein formulated with a proteosome or protollin.
- the G protein immunogens When formulated with a proteosome or protollin, the G protein immunogens preferably further comprise a hydrophobic moiety, which may be composed of a hydrophobic amino acid sequence or a lipid (as used herein, lipid refers to a solubility characteristic and, therefore, includes alkyls, arylalkls, aryls, fatty acids, glycerides and glyceryl ethers, phospholipids, sphingolipids, long chain alcohols, steroids, vitamins, and the like).
- lipid refers to a solubility characteristic and, therefore, includes alkyls, arylalkls, aryls, fatty acids, glycerides and glyceryl ethers, phospholipids, sphingolipids, long chain alcohols, steroids, vitamins, and the like).
- the G protein immunogens may further contain a second amino acid sequence to form a fusion, wherein the second amino acid sequence is a tag, carrier, enzyme or a combination thereof, as described herein.
- One preferred RSV vaccine of the instant invention can comprise a non-infectious RSV polypeptide or fragment thereof that is highly immunogenic and capable of immunoneutralizing virus growth.
- such an RSV subunit vaccine has reduced or no unwanted immunopathological side effects (e.g., eosinophilia or asthma) in a vaccinated subject, such as a human or animal.
- the pharmaceutical composition will preferably include at least one of a pharmaceutically acceptable vehicle, carrier, diluent, or excipient, in addition to one or more RSV immunogen or fusion protein thereof and, optionally, other components.
- pharmaceutically acceptable carriers suitable for use with a composition of a G protein immunogen or fusion protein thereof, or cocktail of two or more G protein immunogens or fusion proteins thereof, or cocktail of G, F, and M immunogens or fusion proteins thereof may include, for example, a thickening agent, a buffering agent, a solvent, a humectant, a preservative, a chelating agent, an adjuvant, and the like, and combinations thereof.
- Exemplary adjuvants include alum (aluminum hydroxide, REHYDRAGEL ® ), aluminum phosphate, proteosome adjuvant with LPS (protollin) or without LPS (see, e.g., U.S. Patent Nos. 5,726,292 and 5,985,284, and U.S. Patent Application Publication Nos. 2001/0053368 and US 2003/0044425), virosomes, liposomes with and without Lipid A, Detox (Ribi/Corixa), MF59, or other oil and water emulsions type adjuvants, such as nanoemulsions (see, e.g., U.S. Patent No.
- the G protein immunogens and fragments or variants thereof are formulated with proteosome.
- proteosome or “projuvant” refers to preparations of outer membrane proteins (OMPs, also known as porins) from Gram- negative bacteria, such as Neisseria species (see, e.g., Lowell et al, J. Exp. Med.
- Proteosomes have the interesting ability to auto- assemble into vesicle or vesicle-like OMP clusters of 20-800 nm, and to noncovalently incorporate, coordinate, associate (e.g., electrostatically or hydrophobically), or otherwise cooperate with protein antigens (Ags), particularly antigens that have a hydrophobic moiety.
- protein antigens e.g., electrostatically or hydrophobically
- Proteosomes may be prepared, for example, as described in the art (see, e.g., U.S. Patent Nos. 5,726,292 or 5,985,284).
- the G protein immunogens and fragments or variants thereof are formulated with protollin.
- protollin As used herein, “proteosome:LPS” or “protollin” (also known as "IVX-908") refers to preparations of projuvant admixed as described herein with at least one kind of liposaccharide to provide an OMP-LPS composition (which can function as an immunostimulatory composition).
- the OMP-LPS adjuvant can be comprised of two of the basic components of Protollin, which include (1) an outer membrane protein preparation of Proteosomes (i.e., projuvant) prepared from Gram- negative bacteria, such as Neisseria meningitides, and (2) a preparation of one or more liposaccharides. It is also contemplated that components of Protollin may be or include lipids, glycolipids, glycoproteins, small molecules, or the like. The Protollin may be prepared, for example, as described in U.S. Patent Application Publication No. 2003/0044425.
- Projuvant is generally used in conjunction with antigens (naturally- occurring or modified) that possess a naturally occurring, modified, or supplementary hydrophobic moiety or portion (also referred to as a "foot” or “anchor”).
- Protollin containing exogenously added LPS
- an antigen that does not contain a hydrophobic foot domain and that can be largely hydrophilic in nature.
- Protollin can be admixed or combined with an antigen containing a hydrophobic foot, an antigen lacking a hydrophobic foot, or with a combination of antigens having and not having a hydrophobic portion or foot.
- liposaccharide refers to native (isolated or prepared synthetically with a native structure) or modified lipopolysaccharide or lipooligosaccharide (collectively, also referred to as "LPS") derived from Gram-negative bacteria, such as Shigella flexneri or Plesiomonas shigelloides, or other Gram-negative bacteria (including Alcaligenes, Bacteroides, Bordetella, Borrellia, Brucella, Campylobacter, Chlamydia, Citrobacter, Edwardsiella, Ehrlicha, Enterobacter, Escherichia, Francisella, Fusobacterium, Gardnerella, Hemophillus, Helicobacter, Klebsiella, Legionella, Leptospira (including Leptospira interrogans), Moraxella, Morganella, Neiserria, Pasteurella, Proteus, Providencia, other Plesiomon
- the liposaccharide may be in a detoxified form (i.e., having the Lipid A core removed) or may be in a form that has not been detoxified. In the instant disclosure, the liposaccharide need not be and preferably is not detoxified.
- the two components of an OMP-LPS adjuvant may be formulated at specific initial ratios to optimize interaction between the components resulting in stable association and formulation of the components for use in the preparation of an immunogenic composition of the invention. The process generally involves the mixing of components in a selected detergent solution (e.g.
- an immunogenic composition comprises one or more G protein immunogens and an adjuvant, wherein the adjuvant comprises a Projuvant (i. e. , Proteosome) and liposaccharide.
- the adjuvant comprises a Projuvant (i. e. , Proteosome) and liposaccharide.
- the final liposaccharide content by weight as a percentage of the total Proteosome protein can be in a range from about 1% to about 500%, more preferably in range from about 10% to about 200%, or in a range from about 30% to about 150%.
- Another embodiment includes an adjuvant wherein the Proteosomes are prepared from Neisseria meningitides and the liposaccharide is prepared from Shigella flexneri or Plesiomonas shigelloides, and the final liposaccharide content is between 50% to 150% of the total Proteosome protein by weight.
- Proteosomes are prepared with endogenous lipooligosaccharide (LOS) content ranging from about 0.5% up to about 5% of total OMP.
- LOS endogenous lipooligosaccharide
- Another embodiment of the instant invention provides Proteosomes with endogenous liposaccharide in a range from about 12% to about 25%, and in a preferred embodiment between about 15% and about 20% of total OMP.
- the instant disclosure also provides a composition containing liposaccharide derived from any Gram-negative bacterial species, which may be from the same Gram-negative bacterial species that is the source of Proteosomes or is a different bacterial species.
- the Proteosome or Protollin to G protein immunogen ratio in the immunogenic composition is greater than 1 :1, greater than 2:1, greater than 3 : 1 or greater than 4:1.
- the ratio can be as high as 8 : 1 or higher.
- the ratio of Proteosome or Protollin to coronavirus antigen of the immunogenic composition ranges from about 1 : 1 to about 1 :500, preferably the ratio is at least 1 :5, at least 1 : 10, at least 1 :20, at least 1 :50, or at least 1 : 100.
- ProtollimG protein immunogen ratios ranging from 1 :2 to 1 :200 is that the amount of Proteosome-based adjuvant can be reduced dramatically with no significant effect on the ability of a G protein immunogen to elicit an immune response.
- pharmaceutically acceptable salt refers to salts of the compounds of the present invention derived from the combination of such compounds and an organic or inorganic acid (acid addition salts) or an organic or inorganic base (base addition salts).
- the compounds of the present invention may be used in either the free base or salt forms, with both forms being considered as being within the scope of the present invention.
- the pharmaceutical composition of the instant invention may further include a diluent or excipient, such as water or phosphate buffered saline (PBS).
- a diluent or excipient is PBS with a final phosphate concentration range from about 0.1 mM to about 1 M, more preferably from about 0.5 mM to about 500 mM, even more preferably from about 1 mM to about 50 mM, and most preferably from about 2.5 mM to about 10 mM; and the final salt concentration ranges from about 100 mM to about 200 mM and most preferably from about 125 mM to about 175 mM.
- the final PBS concentration is about 5 mM phosphate and about 150 mM salt (such as NaCl).
- pharmaceutical compositions of the instant disclosure comprising any of the herein described RSV immunogens or cocktails of RSV immunogens are sterile.
- the compositions can be sterile either by preparing them under an aseptic environment or they can be terminally sterilized using methods available in the art.
- Many pharmaceuticals are manufactured to be sterile and this criterion is defined by the USP XXII ⁇ 1211>. Sterilization in this embodiment may be accomplished by a number of means accepted in the industry and listed in the USP XXII ⁇ 1211>, including gas sterilization, ionizing radiation or filtration.
- Sterilization may be maintained by what is termed aseptic processing, defined also in USP XXII ⁇ 1211>.
- Acceptable gases used for gas sterilization include ethylene oxide.
- Acceptable radiation types used for ionizing radiation methods include gamma, for instance from a cobalt 60 source and electron beam. A typical dose of gamma radiation is 2.5 MRad.
- filtration may be accomplished using a filter with suitable pore size, for example 0.22 ⁇ m and of a suitable material, for instance Teflon ® .
- USP refers to U.S. Pharmacopeia (see www.usp.org; Rockville, MD).
- the present description also pertains to methods for treating or preventing RSV infection, comprising administering to a subject in need thereof a composition comprising at least one respiratory syncytial virus G protein immunogen or fragment thereof comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 2, wherein the G protein immunogen has an epitope that elicits a protective immune response without eliciting an immunopathological response or with a reduced immunopathological response, and pharmaceutically acceptable carrier, diluent, or excipient, at a dose sufficient to elicit an immune response specific for one or more G protein immunogen or fragment thereof.
- an infection is due to a subgroup A, subgroup B, or both subgroups A and B of RSV.
- the G protein immunogens used in any of the compositions and methods described herein have an amino acid sequence as set forth in SEQ ID NOS:6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, more preferably SEQ ID NO:6, SEQ ID NO:56 or SEQ ID NO:58.
- the present description also pertains to methods for reducing the risk of an immunopathological response associated with RSV infection, comprising administering to a subject in need thereof a composition comprising at least one respiratory syncytial virus G protein immunogen or fragment thereof comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 2, wherein the G protein immunogen has an epitope that elicits a protective immune response without eliciting an immunopathological response or with a reduced immunopathological response, and pharmaceutically acceptable carrier, diluent, or excipient, at a dose sufficient to elicit an immune response specific for one or more G protein immunogen or fragment thereof.
- an infection is due to a subgroup A, subgroup B, or both subgroups A and B of RSV.
- the G protein immunogens used in any of the compositions and methods described herein have an amino acid sequence as set forth in SEQ ID NOS:6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, more preferably SEQ ID NO:6, SEQ ID NO:56 or SEQ ID NO:58.
- a subject suitable for treatment with a RSV immunogen formulation may be identified by well-established indicators of risk for developing a disease or well-established hallmarks of an existing disease. For example, indicators of an infection include fever, pus, microorganism positive cultures, inflammation, and the like.
- Infections that may be treated or prevented with a RSV immunogen vaccine of the subject invention include those caused by or due to RSV, whether the infection is primary, secondary, opportunistic, or the like.
- RSV include any subtype, strain, antigenic variant, and the like, of these viruses.
- certain known risk factors for acquiring an RSV infection include premature birth, children with chronic lung disease, children that attend daycare, presence of school-age siblings in the home, exposure to passive smoke in the home, and immunocompromised subjects (adult and children).
- Pharmaceutical compositions containing one or more RSV immunogens of the instant description may be in any form that allows the composition to be administered to a subject, such as a human or animal.
- G protein immunogen, fusion protein, and multivalent compositions of the present description may be prepared and administered as a liquid solution or prepared as a solid form (e.g., lyophilized), which may be administered in solid form, or resuspended in a solution in conjunction with administration.
- the hybrid polypeptide composition is formulated so as to allow the active ingredients contained therein to be bioavailable upon administration of the composition to a subject or patient or bioavailable via slow release.
- Compositions that will be administered to a subject or patient take the form of one or more dosage units, where for example, a tablet may be a single dosage unit, and a container of one or more compounds of the invention in aerosol form may hold a plurality of dosage units.
- any of the herein described pharmaceutical compositions comprising a RSV immunogen or cocktail of immunogens of the invention are in a container, preferably in a sterile container.
- the therapeutic composition is administered nasally, wherein cells, such as cells located in the nasal associated lymphoid tissue, can take up an RSV immunogen or cocktail composition of this disclosure.
- Other typical routes of administration include, without limitation, enteral, parenteral, transdermal/transmucosal, nasal, and inhalation.
- enteral as used herein, is a route of administration in which the immunogenic composition is absorbed through the gastrointestinal tract or oral mucosa, including oral, rectal, and sublingual.
- parenteral describes administration routes that bypass the gastrointestinal tract, including intraarterial, intradermal, intramuscular, intranasal, intraocular, intraperitoneal, intravenous, subcutaneous, submucosal, and intravaginal injection or infusion techniques.
- transdermal/transmucosal is a route of administration in which the immunogenic composition is administered through or by way of the skin, including topical.
- nasal and inhalation encompass techniques of administration in which an immunogenic composition is introduced into the pulmonary tree, including intrapulmonary or transpulmonary.
- the compositions of the present invention are administered nasally.
- compositions comprising at least one respiratory syncytial virus G protein immunogen or fragment thereof can be used in prophylactic methods.
- an RSV immunogen or cocktail composition of the invention may be administered to a mother during gestation to prevent an RSV infection in the mother and to provide passive immunity to the fetus or new born.
- a prophylactic method may comprise administering to a first subject a composition comprising an RSV immunogen and pharmaceutically acceptable carrier, diluent or excipient, followed by administration to a second subject of a second composition comprising at least one respiratory syncytial virus immunogen wherein said first composition comprises a different RSV immunogen than that administered to the second subject and the second composition comprises at least one respiratory syncytial virus G protein immunogen or fragment thereof comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 2 and a pharmaceutically acceptable carrier, diluent or excipient, wherein the G protein immunogen has an epitope that elicits a protective immune response without eliciting an, or with a reduced, immunopathological response.
- the G protein immunogens for prophylactic use can have an amino acid sequence as set forth in SEQ ID NOS:6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, more preferably SEQ ID NO:6, SEQ ID NO:56 or SEQ ID NO:58.
- a representative first subject can be a mother during gestation and a representative second subject can be the mother's newborn child.
- Each composition is provided at a dose sufficient to elicit an immune response specific for one or more RSV immunogen (such as G protein immunogens described herein).
- G protein immunogens and compositions thereof can be administered systemically (e.g., intravenously) to the mother, which would elicit IgG antibodies similar to the antibodies the mother already has due to exposure to RSV.
- the newborn child can then be immunized via the mucosa (e.g., intranasally), which would elicit secretory IgA antibodies - hence, the G protein immunogens administered via the mucosa will not be detected by the systemic maternal (IgG) antibodies the child inherited because the IgG antibodies will not be at the mucosal interface.
- the administered compositions may prevent an infection due to a subgroup A, subgroup B, or both subgroups A and B of RSV.
- a subject suitable for treatment with a RSV immunogen formulation may be identified by well-established indicators of risk for developing a disease or well-established hallmarks of an existing disease as described herein and is known in the art.
- Infections that may be treated with a RSV immunogen of the subject invention include those caused by or due to RSV, whether the infection is primary, secondary, opportunistic, or the like.
- RSV examples include any strain, subtype, antigenic variant, and the like of these viruses.
- the invention further provides a plurality of antibodies produced by the method for preventing a RSV infection that comprises administering to a subject a composition of the subject invention at a dose sufficient to elicit antibodies specific for one or more RSV immunogen wherein said G protein immunogen has an epitope that elicits a protective immune response without eliciting an, or with a reduced, immunopathological response.
- the antibodies comprise at least one antibody specific for a subgroup A RSV, or a subgroup B RSV, or for both subgroup A and B RSVs.
- a method for treating or preventing a RSV infection comprises administering to a subject a composition comprising a pharmaceutically acceptable carrier, with or without an adjuvant, and a plurality of antibodies of the subject invention.
- a subject at risk for an RSV infection can have a plurality of antibodies according to this description administered before, simultaneous with, or after administration of a composition comprising at least one different respiratory syncytial virus G protein immunogen or fragment thereof comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 2 and pharmaceutically acceptable carrier, diluent or excipient, according to the instant description.
- the G protein immunogens used in any of the compositions and methods described herein have an amino acid sequence as set forth in SEQ ID NOS:6, 8, 10, 12, 14,16, 18, 20, 22, 56, 58, 60, 62, 64, 66, 68 or 70, more preferably SEQ ID NO:6, SEQ ID NO:56 or SEQ ID NO:58.
- antibodies specific for one or more RSV immunogens can be provided passively, while the subject is vaccinated to actively elicit antibodies against one or more different RSV immunogens.
- the RSV G protein immunogens and fragments, variants thereof of the present invention are utilized to elicit antibodies specific for at least one epitope present on the G protein immunogens and fragments or variants thereof provided herein. Accordingly, the present invention also provides such antibodies. In preferred embodiments the antibodies bind to specific protective epitopes present on an RSV G protein.
- the term "antibodies" includes polyclonal antibodies, monospecific antibodies, monoclonal antibodies, anti-idiotypic antibodies, fragments thereof such as F(ab') 2 and Fab fragments, and recombinantly or synthetically produced antibodies.
- Such antibodies incorporate the variable regions that permit a monoclonal antibody to specifically bind, which means an antibody is able to selectively bind to a peptide or polypeptide from an RSV G protein from subtype A or B.
- “Specific for” refers to the ability of a protein (e.g. , an antibody) to selectively bind a polypeptide or peptide encoded by a nucleic acid molecule encoding a from an RSV G protein from subtype A or B, or a synthesized RSV G protein from subtype A or B, of this invention.
- Association or "binding" of an antibody to a specific antigen generally involve electrostatic interactions, hydrogen bonding, Van der Waals interactions, and hydrophobic interactions.
- any one of these or any combination thereof can play a role in the binding between an antibody and its antigen.
- Such an antibody generally associates with an antigen, such as a G protein immunogen, with an affinity constant (K a ) of at least 10 4 , preferably at least 10 5 , more preferably at least .
- affinity constants may be determined by one of ordinary skill in the art using well- known techniques (see Scatchard, Ann. N. Y. Acad. Sci. 57:660-672, 1949).
- the affinity of a monoclonal antibody or antibody can be readily determined by one of ordinary skill in the art (see Scatchard, Ann. N Y. Acad. Sci. 51 :660-612, 1949).
- antibody includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, single chain antibodies, chimeric, bifunctional and humanized antibodies, fully human antibodies, as well as antigen-binding fragments thereof.
- non-naturally occurring antibodies may be constructed using solid phase peptide synthesis, may be produced recombinantly, or may be obtained, for example, by screening combinatorial libraries consisting of variable heavy chains and variable light chains (Huse et al, Science 246:1215-1281 (1989)).
- Huse et al Science 246:1215-1281 (1989)
- chimeric, humanized, CDR-grafted, single chain, and bifunctional antibodies are well known in the art (Winter and Harris, Immunol. Today 14:243, 1993; Ward et al, Nature 341:544, 1989; Harlow and Lane, Antibodies: A Laboratory Manual, Cold 005/007189
- Polyclonal antibodies can be readily generated by one of ordinary skill in the art from a variety of warm-blooded animals, including horses, cows, goats, sheep, dogs, chickens, turkeys, rabbits, mice, or rats. Briefly, the desired G protein immunogen or fragment thereof, or mixtures of RSV immunogens, or variants thereof are administered to immunize an animal through parenteral, intraperitoneal, intramuscular, intraocular, or subcutaneous injections.
- the immunogenicity of the hybrid polypeptide of interest may be increased through the use of an adjuvant, such as alum and Freund's complete or incomplete adjuvant. Following several booster immunizations over a period of weeks, small samples of serum are collected and tested for reactivity to the desired immunogen. Once the titer of the animal has reached a plateau in terms of its reactivity to a G protein immunogen of the invention, larger quantities of polyclonal immune sera may be readily obtained either by weekly bleedings or by exsanguinating the animal.
- the RSV immunogens of the instant invention can be easily identified using in vitro and in vivo assays known in the art and as described herein. Representative assays are described in the Examples. Similarly, several assays are available as described herein to examine the activity of the antibodies elicited by the RSV immunogens of the subject invention.
- Immunogens of the instant invention may be formulated with proteosomes by way of non-covalent interactions to form a vaccine composition capable of eliciting a protective immune response in an immunized human or animal subject.
- Proteosomes of the instant application are mucosal adjuvant delivery vehicles comprising outer membrane proteins purified from, for example, Group B type 2 Neisseria meningitides. The use of proteosomes for the formulation of vaccines has been reviewed by Lowell, G. H., in "New Generation Vaccines 2 nd ed., Marcel Dekker, Inc., New York, Basil, Hong Kong (1997) pages 193-206.
- Proteosomes of the instant invention may be prepared by extraction of phenol-killed bacterial paste with a solution of 6% Empigen BB (EBB) (Albright and Wilson, Whithaven, UK) in 1 M calcium chloride followed by precipitation with ethanol, solubilization in 1% EBB-Tris/EDTA- saline and then precipitation with ammonium sulfate. The precipitates are re-solubilized in the 1% EBB buffer, dialyzed, and stored in 0.1% EBB at -70°C.
- Alternative processes may be used in the preparation of proteosomes, for example, proteosomes may be prepared by omitting the ammonium sulfate precipitation step to shorten the process. Preparation of proteosomes are disclosed in U.S. Patent Application Publication No. 2001/0053368 and in U.S. Patent No. 6,476,201 Bl.
- Immunogens of the instant invention may be combined non-covalently with liposomes as a vaccine composition capable of eliciting a protective immune response in an immunized human or animal subject.
- Immunogens may be encapsulated with multilamellar liposomes according to procedures known to those of ordinary skill in the art using, for example, a dehydration coupled reconstitution method (Kirby and Gregoriadis, BioTechnology 2:979, 1984). Briefly, liposomes are prepared by sonication of dioleoylphosphatidyl choline (DOPC/cholesterol, Sigma Chemical Co., St.
- DOPC/cholesterol dioleoylphosphatidyl choline
- the liposome with or without one or more immunogens, are lyophilized and resuspended in sterile water.
- Immunogen that is not incorporated into liposomes may be removed by repeated washing and centrigugation (e.g., microcentrifugation for 1 min at 13,200 rpm) of the liposomes in phosphate buffered saline (PBS).
- the protein content of washed liposomes, with and without immunogen is determined by, for example, quantitative silver-stained SDS-PAGE using calibrated amounts known protein standards, such as serum albumin.
- the protein content of the liposomes is determined and adjusted as desired, for example, the protein content may be adjusted to 0.3 mg per mg of lipid (as liposomes) per ml.
- liposomes containing aliquots of G protein immunogens and fragments thereof may be incubated for 1 hour at 37°C in PBS with proteinase K (Gibco/BRL) at 1.0, 0.1 and 0.01 ⁇ g/ml. Some incubations may also contain 1% Triton X-100 to disrupt liposomes, thereby allowing complete access of the proteinase K to the proteins, fusion proteins, or polypeptide fragments thereof.
- Incubations are terminated and samples analyzed by SDS-PAGE and silver staining. Such procedures may be used to determine the extent of liposome encapsulation of the immunogen (e.g., one or more viral proteins) preparation.
- immunogen e.g., one or more viral proteins
- G protein encoding nucleic acid sequences from the RSV (Long strain) corresponding to amino acids 128-229, as well as, for example, mutant 128-229 sequences were amplified from viral RNA by RT-PCR, and the resultant PCR products cloned into the EcoRI and Xhol sites of a pET-32-LIC bacterial expression plasmid (Novagen, Madison, WI).
- Site-directed mutagenesis of the RSV G128-229 protein sequence was performed according to the Stratagene QuikChange® site-directed mutagenesis protocol. Briefly, PCR was performed on template pET-32-LIC-G 128-229 DNA (G128-229 sequence cloned into EcoRI and Xhol sites). In these experiments, the primer pairs designed for mutagenesis were as follows:
- CTGCTGGGCTATCGCCAAAAGAATACCAAACAAAAAACCAGG SEQ IDNO:39
- CCTGGTTTTTTGTTTGGTATTCTTTTGGCGATAGCCCAGCAG SEQ IDNO:40
- CTGCTGGGCTATCTGCGCAAGAATACCAAACAAAAAACCAGG SEQ ID NO:41
- CCTGGTTTTTTGTTTGGTATTCTTGCGCAGATAGCCCAGCAG SEQ ID NO:42
- CTGCTGGGCTATCTGCAAAGCAATACCAAACAAAAAACCAGG SEQ ID NO:43
- CCTGGTTTTTTGTTTGGTATTGCTTTGCAGATAGCCCAGCAG SEQ ID NO:44
- CTGCTGGGCTATCTGCAAAAGAGCACCAAACAAAAAACCAGG SEQ ID NO:45
- CCTGGTTTTTTGTTTGGTGCTCTTTTGCAGATAGCCCAGCAG SEQ IDNO:46
- CTGCTGGGCTATCTGCAAAAGAATAGCAAACAAAAAACCAGG (SEQ H>NO:47) and CCTGGTTTTTTGTTTGCTATTCTTTTGCAGATAGCCCAGCAG (SEQ ID NO:48) (for the G 128-229, P190A mutant); CTGCAAAAGAATACCAGCCAAAAAACCAGGAAAGAAAACCACC (SEQ ID NO:49) and GGTGGTTTTCTTTCCTGGTTTTTTTTGGCTGGTATTCTTTTGCAG (SEQ ID NO:50) (for the G128-229, N191 A mutant);
- CTGGGCTATCTGCAAAAGAATACCAAACGCAAAACCAGGAAAG SEQ ID NO:51
- CTTTCCTGGTTTTGCGTTTGGTATTCTTTTGCAGATAGCCCAG SEQ ID NO:52
- Trx Thioredoxin-fusion proteins containing wild type, and the above mutant RSV G protein fragments were prepared as described in Example 4.
- RSV G protein immunogens can be prepared as pharmaceutical compositions by mixing with a pharmaceutically acceptable carrier, excipient or diluent.
- a pharmaceutically acceptable carrier for example, the RSV G protein sequences described herein and encoded by nucleic acid contained in modified pET-32-LIC plasmids were expressed as thioredoxin (Trx)-fusion proteins in transformed E. coli BL21/DE3 cells following induction with IPTG. All Trx-fusion proteins were recovered from transformed cell pellets by extraction with 8M urea, followed by affinity purification using TALON ® (Clontech, Palo Alto, CA) and dialysis against PBS.
- Trx thioredoxin
- Trx-G128-229 polypeptides were freed from contaminating endotoxin by treatment with polymyxin B beads (BioRad, Mississauga, ON, Canada). Details and modifications of this procedure are well known to those of ordinary skill in the art.
- immunogens can be further combined or admixed with an adjuvant, such as alum or a proteosome-based adjuvant.
- mice Charles River, Ste. Constance, QC, Canada
- ketamine 2.3 mg/mouse; Bimeda-MTC Pharmaceuticals, Cambridge, ON, Canada
- xylazine 0.5 mg/mouse; Bayer, Toronto, ON, Canada
- groups of seven to nine BALB/c mice (6-8 wks old) were immunized twice subcutaneously, at 14-day intervals, with PBS/alum, Trx-G128-229, or mutant Trx-G128-229 proteins, in PBS/alum (10 ⁇ g protein in a volume of 50 ⁇ l).
- mice Fourteen days after the second dose, mice were challenged intranasally with RSV (2 x 10° pfu in 50 ⁇ l). Mice were sacrificed using sodium pentobarbital four days later and assayed for lung virus titers and leukocyte infiltration in bronchoalveolar fluids according to procedures well known to a person of ordinary skill in the art. Immunoblot analysis demonstrated that serum antibodies raised against amino acids 128-229 of RSV G protein were capable of specifically recognizing RSV G protein in mice immunized with wild type or mutant Trx-G128-229 proteins (Fig. 1).
- Extracts of RSV-infected HEp-2 cells were resolved by SDS-PAGE, and transferred to membranes (e.g., polyvinyldene difluoride (PVDF) membranes).
- membranes e.g., polyvinyldene difluoride (PVDF) membranes.
- PVDF polyvinyldene difluoride
- Membranes containing transferred protein were blocked (to prevent non-specific interactions) with 4% skim milk and 0.5% casein (Hammerstein grade) in TBST (0.8% NaCl, 0.1 %
- mice were immunized (as described in Example 6) with either wild type Trx-G128-229 or one of each of the 9 mutants and then challenged with RSV. Induction of eosinophilia was determined according to procedures described in Mader et al. Vaccine 75:1110, 2000. As shown in Figure 2A, wild type Trx-G128- 229 and various single mutants protected mice against RSV challenge to varying degrees. Comparatively, the N191 A mutated Trx-G 128-229 provided better protection than did mutants P190A, R188A and I189A. The remaining Trx-G128-229 mutant proteins conferred intermediate levels of protection.
- Plaque reduction is calculated as the plaque reduction neutralization titer 5 o (PRNT 5 o), which is the reciprocal dilution of sera required to neutralize 50% of RSV plaques on a sub- confluent monolayer of HEp-2 cells.
- PRNT 5 o plaque reduction neutralization titer 5 o
- Results of an RSV plaque reduction assay are shown in Table 1.
- the RSV neutralization titers in sera from immunized mice showed a strong dependence of neutralizing antibody responses upon the amino acid sequence within the 185-193 region of the Trx-G 128-229 protein used for immunization (similar to the immunization results of Example 6).
- Table 1 Neutralization titers of sera from mice immunized with Trx-G variant proteins * Immunogen PRNT50
- Trx-G128-229 144 ⁇ 37 Trx-G128-229 (I185A) 18 ⁇ 5 Trx-G128-229 (C186A) 81 ⁇ 12 Trx-G128-229 (K187A) 34 ⁇ 11 Trx-G128-229 (R188A) 39 ⁇ 13 Trx-G128-229 (I189A) 115 ⁇ 38 Trx-G128-229 (P190A) 98 ⁇ 26 Trx-G128-229 (N191A) 95 ⁇ 21 Trx-G128-229 (K192A) 27 ⁇ 7 Trx-G128-229 (K193A) 31 ⁇ 12
- PRNT50 Pulque Reduction Neutralization Titer 5 o
- RNA was quantitated and subjected to ribonuclease protection assay (RPA) using a transcription kit (BD-Pharmingen, Mississauga, ON, Canada) to synthesize probe from a cytokine (MCK-1) template (BD- Pharmingen, Mississauga, ON, Canada), radiolabeled using ⁇ - P [UTP] and followed by hybridization and RNase digestion using an RPAIII kit (Ambion, Austin, TX). Reaction mixtures were resolved on a 5% polyacrylamide 8M urea gel according to the manufacturer's instructions followed by drying and autoradiography at -70°C using an intensifying screen.
- RPA ribonuclease protection assay
- the RPA results illustrated striking differences among the mice immunized with wild-type or mutant Trx-G proteins and subsequently challenged with RSV (Figure 4).
- the Th2 type cytokines most prone to upregulation were IL-4, IL-10, IL-13 and, to a lesser extent, IL-5.
- G protein variants K193A, PI 90 A and 1189 A were found to provoke dramatic IL-4, IL-10 and IL-13 responses.
- Weak IL-4, IL-10 and IL-13 responses were observed with other G protein variants, such as N192A, N191A, R188A, K187A and C186A.
- Thl cytokine IFN- ⁇
- this may reflect the expression of IFN- ⁇ from NK cells as well as Thl cells (Trinchieri, Adv. Immunol. 47: 187, 1989), the rapid induction of IFN- ⁇ upon RSV infection (Hussell and Openshaw, J. Gen. Virol. 79: 2593, 1998), and/or the prevalent nature of IFN- ⁇ expression even in immune processes in which a Th2 response appears to predominate (Waris et al, J. Virol. 70:2852, 1996; Spender et al., J. Gen. Virol. 79: 1751, 1998; Srikiatkhachorn and Braciale, J. Virol. 71: 678, 1997).
- EXAMPLE 10 PREPARATION OF PROTEOSOMES CONTAINING RSV G PROTEIN IMMUNOGENS
- Portions of stock RSV G protein product immunogens may be formulated with proteosomes using, by way of example, diafiltration ultrafiltration methods or by using dialysis.
- the RSV G protein product is dissolved in, for example, a saline buffered solution containing the desired detergent (e.g., Empigen BB (EBB) at 1% or, at 0.1%-2% of EBB or other suitable detergent depending on the type of detergent used) and is then mixed with proteosomes in saline buffered 1% Empigen solution (or other appropriate detergent at appropriate concentrations) at various proteosome:
- EBB Empigen BB
- Empigen solution or other appropriate detergent at appropriate concentrations
- the mixture may then be subjected to ultrafiltration/diafilt-ration technology or is exhaustively dialyzed across a dialysis membrane with, for example, a 10,000 molecular weight cut-off (MWCO) or functionally similar membranes with MWCO ranges of 1,000-30,000 against buffered saline for 1 -2 weeks at 4°C exchanging at least 500 parts buffer each day.
- MWCO molecular weight cut-off
- immunological assays such as ELISA and single radial immunodiffusion (SRID) may be used to measure potency.
- the halo immunodiffusion technique is used to determine the content of formulate RSV G antigen with proteosomes at various ratios (for details on the preparation of proteosomes, see, e.g., U.S.
- Multivalent vaccines may also be prepared by making individual monovalent proteosome vaccines and then combining them at the required proportions prior to final formulation and fill. Multivalent preparations may also be formulated by pooling individual RSV G antigens in the desired proportions and formulating the mixture with proteosomes. Multivalent vaccine preparations may contain one or more RSV F protein immunogens and/or one or more M protein immunogens in combination with one or more RSV G protein immunogens. The vaccine composition is then passed through membrane filters of 0.8 ⁇ m pore size and stored at 4°C prior to and during immunizations.
- RSV G protein immunogens may also be formulated with various amounts of proteosome-LPS adjuvant as disclosed in, for example, U.S. Patent No. 6,476,201 Bl, and described herein.
- mice were immunized intranasally with RSV G wild-type (amino acids 128-229) or the mutant (N191A) proteins formulated with Protollin to determine whether RSV-specific systemic and mucosal titers were elicited.
- BALB/c mice were immunized three times with a dose of 6 ⁇ g or 2 ⁇ g of either the Trx-(polyHis)-G(128- 229) fusion proteins alone, or adjuvanted with protollin or alum.
- Protollin alone or fusion proteins formulated with protollin were administered intranasally, and alum alone or fusion proteins formulated with alum were administered subcutaneously.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Pulmonology (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AT04761567T ATE451119T1 (de) | 2003-07-15 | 2004-07-14 | Untereinheit-impfstoff gegen das respiratorische synzytialvirus |
| DE602004024542T DE602004024542D1 (de) | 2003-07-15 | 2004-07-14 | Untereinheit-impfstoff gegen das respiratorische synzytialvirus |
| AU2004257363A AU2004257363A1 (en) | 2003-07-15 | 2004-07-14 | Subunit vaccine against respiratory syncytial virus infection |
| JP2006519734A JP2007505033A (ja) | 2003-07-15 | 2004-07-14 | 呼吸器合胞体得ウイルス感染に対するサブユニットワクチン |
| CA002532164A CA2532164A1 (en) | 2003-07-15 | 2004-07-14 | Subunit vaccine against respiratory syncytial virus infection |
| EP04761567A EP1651264B1 (en) | 2003-07-15 | 2004-07-14 | Subunit vaccine against respiratory syncytial virus infection |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US48780403P | 2003-07-15 | 2003-07-15 | |
| US60/487,804 | 2003-07-15 | ||
| US56758604P | 2004-05-03 | 2004-05-03 | |
| US60/567,586 | 2004-05-03 | ||
| US10/888,805 | 2004-07-09 | ||
| US10/888,805 US7368537B2 (en) | 2003-07-15 | 2004-07-09 | Subunit vaccine against respiratory syncytial virus infection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2005007189A1 true WO2005007189A1 (en) | 2005-01-27 |
Family
ID=34084525
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA2004/001007 Ceased WO2005007189A1 (en) | 2003-07-15 | 2004-07-14 | Subunit vaccine against respiratory syncytial virus infection |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US7368537B2 (https=) |
| EP (2) | EP1651264B1 (https=) |
| JP (1) | JP2007505033A (https=) |
| AT (1) | ATE451119T1 (https=) |
| AU (1) | AU2004257363A1 (https=) |
| CA (1) | CA2532164A1 (https=) |
| DE (1) | DE602004024542D1 (https=) |
| ES (1) | ES2337901T3 (https=) |
| WO (1) | WO2005007189A1 (https=) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7255867B2 (en) | 2002-11-15 | 2007-08-14 | Id Biomedical Corporation Of Quebec | Vaccine |
| WO2011030218A1 (en) | 2009-09-10 | 2011-03-17 | Novartis Ag | Combination vaccines against respiratory tract diseases |
| US8173140B2 (en) | 2003-10-22 | 2012-05-08 | Id Biomedical Corporation Of Quebec | Compositions and methods for activating innate and allergic immunity |
| US9487593B2 (en) | 2010-07-07 | 2016-11-08 | Artificial Cell Technologies, Inc | Respiratory syncytial virus antigenic compositions and methods |
| EP3373961A4 (en) * | 2015-11-10 | 2019-07-31 | Ohio State Innovation Foundation | METHODS AND COMPOSITIONS ASSOCIATED WITH ACCELERATED HUMORAL AFFINITY |
| US11773143B2 (en) | 2017-10-13 | 2023-10-03 | Trellis Bioscience, Llc | Conformational epitopes in respiratory syncytial virus G protein central conserved region |
| US12246063B2 (en) | 2018-08-08 | 2025-03-11 | Trellis Bioscience, Inc. | Immunogen providing an extended protective lifetime against respiratory syncytial virus (RSV) and vaccines thereof |
Families Citing this family (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE60238471D1 (de) * | 2001-03-09 | 2011-01-13 | Id Biomedical Corp Quebec | Proteosom-liposaccharid-vakzine-adjuvans |
| US7368537B2 (en) * | 2003-07-15 | 2008-05-06 | Id Biomedical Corporation Of Quebec | Subunit vaccine against respiratory syncytial virus infection |
| CA2571035A1 (en) * | 2004-06-25 | 2006-01-12 | Id Biomedical Corporation Of Quebec | Compositions and methods for treating neurological disorders |
| PL2222710T3 (pl) | 2007-12-24 | 2017-01-31 | Id Biomedical Corporation Of Quebec | Rekombinowane antygeny rsv |
| MX2011000668A (es) * | 2008-07-18 | 2011-07-29 | Id Biomedical Corp Quebec | Antigenos quimericos polipeptidicos del virus sincitial respiratorio. |
| US20110318376A1 (en) * | 2008-12-24 | 2011-12-29 | University Of Rochester | Recombinant expression of self-folding neutralizing epitope-bearing subdomains of the respiratory syncytial virus attachment and fusion proteins |
| US9566323B2 (en) * | 2009-06-19 | 2017-02-14 | Eyegene Inc. | Vaccine for cervical cancer |
| AU2010264686A1 (en) | 2009-06-24 | 2012-01-19 | Glaxosmithkline Biologicals S.A. | Vaccine |
| MX2012000035A (es) | 2009-06-24 | 2012-02-28 | Id Biomedical Corp Quebec | Antigenos de virus de sincicio respiratorio recombinantes. |
| US9907746B2 (en) | 2009-07-06 | 2018-03-06 | Variation Biotechnologies, Inc. | Methods for preparing vesicles and formulations produced therefrom |
| AU2010270722B2 (en) | 2009-07-06 | 2015-06-04 | Variation Biotechnologies, Inc. | Methods for preparing vesicles and formulations produced therefrom |
| EP4218799A1 (en) | 2009-07-15 | 2023-08-02 | GlaxoSmithKline Biologicals S.A. | Rsv f protein compositions and methods for making same |
| US8846056B2 (en) * | 2009-08-04 | 2014-09-30 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control | Anti-RSV immunogens and methods of immunization |
| US8730396B2 (en) * | 2010-06-23 | 2014-05-20 | MindTree Limited | Capturing events of interest by spatio-temporal video analysis |
| HUE026646T2 (en) | 2010-07-06 | 2016-07-28 | Glaxosmithkline Biologicals Sa | Preferred liposomes containing lipids of PKA value for delivery of RNA |
| PL2591114T3 (pl) | 2010-07-06 | 2017-08-31 | Glaxosmithkline Biologicals Sa | Immunizacja dużych ssaków małymi dawkami rna |
| HUE047796T2 (hu) | 2010-07-06 | 2020-05-28 | Glaxosmithkline Biologicals Sa | RNS bevitele több immunútvonal bekapcsolására |
| MX342138B (es) | 2010-07-06 | 2016-09-14 | Variation Biotechnologies Inc | Composiciones y metodos para el tratamiento de influenza. |
| RS63817B1 (sr) * | 2010-07-06 | 2023-01-31 | Glaxosmithkline Biologicals Sa | Čestice za isporuku slične virionu za molekule samoreplicirajuće rnk |
| RS63890B1 (sr) * | 2010-08-31 | 2023-02-28 | Glaxosmithkline Biologicals Sa | Mali lipozomi za isporuku rnk koja kodira imunogen |
| PT3970742T (pt) | 2010-08-31 | 2022-06-27 | Glaxosmithkline Biologicals Sa | Lipossomas peguilados para entrega de arn codificador de imunogénio |
| JP2013544504A (ja) | 2010-10-11 | 2013-12-19 | ノバルティス アーゲー | 抗原送達プラットフォーム |
| KR20120068647A (ko) * | 2010-12-18 | 2012-06-27 | 아이진 주식회사 | 개선된 면역반응을 유도하는 백신 |
| CA2862864C (en) | 2011-01-13 | 2018-12-11 | Variation Biotechnologies Inc. | Compositions and methods for treating viral infections |
| CA2862871C (en) * | 2011-01-13 | 2020-09-22 | Variation Biotechnologies Inc. | Methods for preparing vesicles and formulations produced therefrom |
| RU2456020C1 (ru) * | 2011-03-30 | 2012-07-20 | Государственное образовательное учреждение дополнительного профессионального образования Российская медицинская академия последипломного образования Федерального агентства по здравоохранению и социальному развитию (ГОУ ДПО РМАПО Росздрава) | Способ профилактики гриппа и острых респираторных инфекций у детей с бронхиальной астмой |
| CA2834349A1 (en) * | 2011-04-26 | 2012-11-01 | Molecular Express, Inc. | Liposomal formulations |
| DK2707385T3 (da) | 2011-05-13 | 2017-11-20 | Glaxosmithkline Biologicals Sa | RSV-F-præfusionsantigener |
| WO2013006838A1 (en) | 2011-07-06 | 2013-01-10 | Novartis Ag | Immunogenic combination compositions and uses thereof |
| US20140356399A1 (en) | 2012-01-12 | 2014-12-04 | Variation Biotechnologies, Inc. | Compositions and methods for treating viral infections |
| US20150079077A1 (en) | 2012-01-27 | 2015-03-19 | Variation Biotechnologies, Inc. | Methods and compositions for therapeutic agents |
| MY171498A (en) | 2012-08-01 | 2019-10-15 | Bavarian Nordic As | Recombinant modified vaccinia virus ankara (mva) respiratory syncytial virus (rsv) vaccine |
| WO2014024026A1 (en) | 2012-08-06 | 2014-02-13 | Glaxosmithkline Biologicals S.A. | Method for eliciting in infants an immune response against rsv and b. pertussis |
| US20140037680A1 (en) | 2012-08-06 | 2014-02-06 | Glaxosmithkline Biologicals, S.A. | Novel method |
| AU2014304545A1 (en) | 2013-08-05 | 2016-02-25 | Glaxosmithkline Biologicals S.A. | Combination immunogenic compositions |
| US9415101B2 (en) * | 2013-09-25 | 2016-08-16 | Sequoia Sciences, Inc. | Compositions of vaccines and adjuvants and methods for the treatment of urinary tract infections |
| KR101695518B1 (ko) * | 2014-09-30 | 2017-01-12 | 이화여자대학교 산학협력단 | 호흡기 신시치아 바이러스 범용 백신 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999014334A1 (en) * | 1997-09-19 | 1999-03-25 | American Cyanamid Company | Peptides derived from the attachment (g) protein of respiratory syncytial virus |
| WO2001060402A2 (en) * | 2000-02-15 | 2001-08-23 | Intellivax International Inc. | Proteosome influenza vaccine |
| WO2002058725A2 (fr) * | 2001-01-23 | 2002-08-01 | Pierre Fabre Medicament | Peptides non glycosyles derives de la proteine g du vrs et leur utilisation dans un vaccin |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4707543A (en) | 1985-09-17 | 1987-11-17 | The United States Of America As Represented By The Secretary Of The Army | Process for the preparation of detoxified polysaccharide-outer membrane protein complexes, and their use as antibacterial vaccines |
| US5726292A (en) | 1987-06-23 | 1998-03-10 | Lowell; George H. | Immuno-potentiating systems for preparation of immunogenic materials |
| US5576016A (en) | 1993-05-18 | 1996-11-19 | Pharmos Corporation | Solid fat nanoemulsions as drug delivery vehicles |
| US5961970A (en) | 1993-10-29 | 1999-10-05 | Pharmos Corporation | Submicron emulsions as vaccine adjuvants |
| IL123720A (en) | 1995-09-18 | 2002-02-10 | Us Army Medical Res Material C | Methods for the creation of immune subunits of proteasomes that are multivolent and non-covalently linked |
| US5848152A (en) | 1995-09-26 | 1998-12-08 | Motorola, Inc. | Communication device having interchangeable faceplates and active keypad cover |
| US6699478B1 (en) | 1997-09-19 | 2004-03-02 | Wyeth Holdings Corporation | Enhanced immune response to attachment (G) protein of Respiratory Syncytial Virus |
| DE60238471D1 (de) * | 2001-03-09 | 2011-01-13 | Id Biomedical Corp Quebec | Proteosom-liposaccharid-vakzine-adjuvans |
| US7368537B2 (en) * | 2003-07-15 | 2008-05-06 | Id Biomedical Corporation Of Quebec | Subunit vaccine against respiratory syncytial virus infection |
-
2004
- 2004-07-09 US US10/888,805 patent/US7368537B2/en not_active Expired - Fee Related
- 2004-07-14 WO PCT/CA2004/001007 patent/WO2005007189A1/en not_active Ceased
- 2004-07-14 ES ES04761567T patent/ES2337901T3/es not_active Expired - Lifetime
- 2004-07-14 EP EP04761567A patent/EP1651264B1/en not_active Expired - Lifetime
- 2004-07-14 EP EP09178294A patent/EP2204188A1/en not_active Withdrawn
- 2004-07-14 AT AT04761567T patent/ATE451119T1/de not_active IP Right Cessation
- 2004-07-14 DE DE602004024542T patent/DE602004024542D1/de not_active Expired - Lifetime
- 2004-07-14 CA CA002532164A patent/CA2532164A1/en not_active Abandoned
- 2004-07-14 AU AU2004257363A patent/AU2004257363A1/en not_active Abandoned
- 2004-07-14 JP JP2006519734A patent/JP2007505033A/ja active Pending
-
2008
- 2008-03-19 US US12/051,397 patent/US20080226673A1/en not_active Abandoned
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999014334A1 (en) * | 1997-09-19 | 1999-03-25 | American Cyanamid Company | Peptides derived from the attachment (g) protein of respiratory syncytial virus |
| WO2001060402A2 (en) * | 2000-02-15 | 2001-08-23 | Intellivax International Inc. | Proteosome influenza vaccine |
| WO2002058725A2 (fr) * | 2001-01-23 | 2002-08-01 | Pierre Fabre Medicament | Peptides non glycosyles derives de la proteine g du vrs et leur utilisation dans un vaccin |
Non-Patent Citations (7)
| Title |
|---|
| HUANG Y ET AL: "A single amino acid substitution in a recombinant G protein vaccine drastically curtails protective immunity against respiratory syncytial virus (RSV)", VACCINE, BUTTERWORTH SCIENTIFIC. GUILDFORD, GB, vol. 21, no. 19-20, 2 June 2003 (2003-06-02), pages 2500 - 2505, XP004424161, ISSN: 0264-410X * |
| HUANG Y ET AL: "Enhanced immune protection by a liposome-encapsulated recombinant respiratory syncytial virus (RSV) vaccine using immunogenic lipids from Deinococcus radiodurans", VACCINE, BUTTERWORTH SCIENTIFIC. GUILDFORD, GB, vol. 20, no. 11-12, 22 February 2002 (2002-02-22), pages 1586 - 1592, XP004340380, ISSN: 0264-410X * |
| RYAN E J ET AL: "Immunomodulators and delivery systems for vaccination by mucosal routes", TRENDS IN BIOTECHNOLOGY, ELSEVIER, AMSTERDAM,, GB, vol. 19, no. 8, 1 August 2001 (2001-08-01), pages 293 - 304, XP004254296, ISSN: 0167-7799 * |
| SPARER T E ET AL: "Eliminating a region of respiratory syncytial virus attachment protein allows induction of protective immunity without vaccine-enhanced lung eosinophilia", JOURNAL OF EXPERIMENTAL MEDICINE, TOKYO, JP, vol. 187, no. 11, 1 June 1998 (1998-06-01), pages 1921 - 1926, XP002091345, ISSN: 0022-1007 * |
| SRIKIATKHACHORN ANON ET AL: "Induction of Th-1 and Th-2 responses by respiratory syncytial virus attachment glycoprotein is epitope and major histocompatibility complex independent", JOURNAL OF VIROLOGY, vol. 73, no. 8, August 1999 (1999-08-01), pages 6590 - 6597, XP002306391, ISSN: 0022-538X * |
| TEBBEY PW ET AL: "Atypical pulmonary eosinophilia is mediated by a specific amino acid sequence of the atachment (G) protein of respiratory syncytial virus", JOURNAL OF EXPERIMENTAL MEDICINE, TOKYO, JP, vol. 188, no. 10, 16 November 1998 (1998-11-16), pages 1967 - 1972, XP002091346, ISSN: 0022-1007 * |
| VARGA S M ET AL: "The attachment (G) glycoprotein of respiratory syncytial virus contains a single immunodominant epitope that elicits both Th1 and Th2 CD4+ T cell responses.", JOURNAL OF IMMUNOLOGY (BALTIMORE, MD. : 1950) 1 DEC 2000, vol. 165, no. 11, 1 December 2000 (2000-12-01), pages 6487 - 6495, XP002306390, ISSN: 0022-1767 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7255867B2 (en) | 2002-11-15 | 2007-08-14 | Id Biomedical Corporation Of Quebec | Vaccine |
| US8173140B2 (en) | 2003-10-22 | 2012-05-08 | Id Biomedical Corporation Of Quebec | Compositions and methods for activating innate and allergic immunity |
| US8709447B2 (en) | 2003-10-22 | 2014-04-29 | Id Biomedical Corporation Of Quebec | Compositions and methods for activating innate and allergic immunity |
| WO2011030218A1 (en) | 2009-09-10 | 2011-03-17 | Novartis Ag | Combination vaccines against respiratory tract diseases |
| US9487593B2 (en) | 2010-07-07 | 2016-11-08 | Artificial Cell Technologies, Inc | Respiratory syncytial virus antigenic compositions and methods |
| EP3373961A4 (en) * | 2015-11-10 | 2019-07-31 | Ohio State Innovation Foundation | METHODS AND COMPOSITIONS ASSOCIATED WITH ACCELERATED HUMORAL AFFINITY |
| US10835601B2 (en) | 2015-11-10 | 2020-11-17 | Ohio State Innovation Foundation | Methods and compositions related to accelerated humoral affinity |
| US11773143B2 (en) | 2017-10-13 | 2023-10-03 | Trellis Bioscience, Llc | Conformational epitopes in respiratory syncytial virus G protein central conserved region |
| US12246063B2 (en) | 2018-08-08 | 2025-03-11 | Trellis Bioscience, Inc. | Immunogen providing an extended protective lifetime against respiratory syncytial virus (RSV) and vaccines thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US20080226673A1 (en) | 2008-09-18 |
| US20050042230A1 (en) | 2005-02-24 |
| EP1651264A1 (en) | 2006-05-03 |
| ES2337901T3 (es) | 2010-04-30 |
| US7368537B2 (en) | 2008-05-06 |
| CA2532164A1 (en) | 2005-01-27 |
| DE602004024542D1 (de) | 2010-01-21 |
| EP2204188A1 (en) | 2010-07-07 |
| JP2007505033A (ja) | 2007-03-08 |
| ATE451119T1 (de) | 2009-12-15 |
| AU2004257363A1 (en) | 2005-01-27 |
| EP1651264B1 (en) | 2009-12-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7368537B2 (en) | Subunit vaccine against respiratory syncytial virus infection | |
| TWI756828B (zh) | Rsv f蛋白突變體 | |
| US5843913A (en) | Nucleic acid respiratory syncytial virus vaccines | |
| JP5796011B2 (ja) | ワクチン | |
| JP6062245B2 (ja) | 組換えrsv抗原 | |
| CN101952321B (zh) | 重组rsv抗原 | |
| JP3602448B2 (ja) | 核酸呼吸器シンシチウムウイルスワクチン | |
| US20060286124A1 (en) | Vaccine compositions and methods of treating coronavirus infection | |
| US20080248057A1 (en) | Multivalent immunogenic composition containing RSV subunit compostion and influenza virus preparation | |
| KR20220008875A (ko) | 계절성 인플루엔자 백신과 아데노바이러스 기반 호흡기 세포융합 바이러스 백신의 공동투여 | |
| US20050152919A1 (en) | Measles subunit vaccine | |
| Ren et al. | Intranasal immunization with HRSV prefusion F protein and CpG adjuvant elicits robust protective effects in mice | |
| EP0996730A1 (en) | Nucleic acid vaccines encoding g protein of respiratory syncytial virus | |
| CN117203243A (zh) | 用于预防rsv和piv3感染的组合物和方法 | |
| KR20230021115A (ko) | 생 약독화된 호흡기 세포융합 바이러스 (live attenuated respiratory syncytial virus) | |
| EP3383428B1 (en) | Respiratory syncytial virus vaccine | |
| RU2788403C2 (ru) | Мутанты белка f rsv | |
| JP2023003315A (ja) | コロナウイルスワクチン | |
| Rigter et al. | A Protective and Safe Intranasal RSV Vaccine Based on a Recombinant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2532164 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004257363 Country of ref document: AU Ref document number: 2006519734 Country of ref document: JP |
|
| ENP | Entry into the national phase |
Ref document number: 2004257363 Country of ref document: AU Date of ref document: 20040714 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004761567 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004761567 Country of ref document: EP |