WO2004081166A2 - Nukleotidsequenzen coryneformer bakterien codierend für am l-serinstoffwechsel beteiligte proteine sowie verfahren zur mikrobiellen herstellung von l-serin - Google Patents

Nukleotidsequenzen coryneformer bakterien codierend für am l-serinstoffwechsel beteiligte proteine sowie verfahren zur mikrobiellen herstellung von l-serin Download PDF

Info

Publication number
WO2004081166A2
WO2004081166A2 PCT/DE2004/000248 DE2004000248W WO2004081166A2 WO 2004081166 A2 WO2004081166 A2 WO 2004081166A2 DE 2004000248 W DE2004000248 W DE 2004000248W WO 2004081166 A2 WO2004081166 A2 WO 2004081166A2
Authority
WO
WIPO (PCT)
Prior art keywords
serine
nucleotide sequences
mutated
corynebacterium
microorganism
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/DE2004/000248
Other languages
German (de)
English (en)
French (fr)
Other versions
WO2004081166A3 (de
Inventor
Petra Peters-Wendisch
Roman Netzer
Lothar Eggeling
Hermann Sahm
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Forschungszentrum Juelich GmbH
Original Assignee
Forschungszentrum Juelich GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Forschungszentrum Juelich GmbH filed Critical Forschungszentrum Juelich GmbH
Priority to MXPA05009796A priority Critical patent/MXPA05009796A/es
Priority to BRPI0408219-2A priority patent/BRPI0408219A/pt
Priority to AU2004220016A priority patent/AU2004220016B2/en
Priority to US10/549,262 priority patent/US20060204963A1/en
Priority to EP04710333A priority patent/EP1601773A2/de
Priority to JP2006504233A priority patent/JP2006519598A/ja
Publication of WO2004081166A2 publication Critical patent/WO2004081166A2/de
Publication of WO2004081166A3 publication Critical patent/WO2004081166A3/de
Anticipated expiration legal-status Critical
Priority to US12/136,190 priority patent/US8119374B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/06Alanine; Leucine; Isoleucine; Serine; Homoserine

Definitions

  • the invention relates to nucleotide sequences of coryneform bacteria coding for proteins involved in L-serine metabolism with reduced or switched-off L-serine dehydratase as well as microorganisms and methods for producing L-serine.
  • the amino acid L-serine is used in the food, feed and pharmaceutical industries, as well as in human medicine. In addition, it serves as a building block for the synthesis of other industrially usable products, such as. B. L-tryptophan from indole and L-serine.
  • L-serine can be produced by fermentation of strains of coryneform bacteria.
  • So z. B. a strain of Corynebacterium glycinophilum able to form L-serine from glycine and carbohydrates (Kubota K, Kageyama K, Shiro T and Okumura S (1971) Journal of General Applications in Microbiology, 17: 167-168; Kubota K, Kageyama K, Maeyashiki I, Yamada K and Okumura S (1972) Journal of General Applications in Microbiology 18: 365).
  • L-serine hydroxymethyl transferase The enzyme L-serine hydroxymethyl transferase is involved in the conversion of glycine to L-serine (Kubota K and Yokozeki K (1989) Journal of Fermentation and Bioengeneering, 67 (6): 387-390).
  • These Corynebacterium glycinophylum strains have a defective serine dehydratase, which is caused by Mutagenesis was produced (Kubota K (1985) Improved production of L-serine by mutants of Corynebacterium glycinophylum with less serine dehydratase activity. Agricultural Biological Chemistry, 49: 7-12).
  • Hyphomicrobium strains (Izumi Y, Yoshida T, Miyazaki SS, Mitsunaga T, Ohshiro T, Shiamo M, Miyata A and Tanabe T (1993) Applied Microbiology and Biotechnology, 39: 427-432).
  • the amino acid glycine must be used as a precursor for the formation of the amino acid L-serine.
  • coryneform bacteria which can produce L-serine directly from carbohydrates without the addition of further precursors. This is more advantageous for an economical production of L-serine on an industrial scale, since L-serine can be produced directly from carbohydrates without the complex addition of precursors.
  • These strains which belong to the genus Corynebacterium glutamicum, are characterized by the fact that they are e.g. B. resistant to the
  • L-serine analogs are serine hydroxamate and ⁇ -chloroalanine and have been obtained by undirected mutagenesis (Yoshida H and Nakayama K (1974) Nihon-Nogei-Kagakukishi 48: 201-208).
  • Brevibacterium flavum strains which have defects in L-serine degradation due to undirected mutagenesis, have an increased activity of the 3-phosphoglycerate dehydrogenase encoded by serA, and overexpress the genes serB and serC originating from Escherichia coli (EP0931833A2).
  • the object is achieved according to the invention with the features specified in the characterizing part of claim 1. Furthermore, the object is achieved based on the preamble of claim 7 according to the invention, with the features specified in the characterizing part of claim 7.
  • the Task is also achieved based on the preamble of claim 8 according to the invention, with the features specified in the characterizing part of claim 8.
  • the object is also achieved according to the invention on the basis of the preamble of claim 9, with the features specified in the characterizing part of claim 9.
  • the object is further achieved according to the invention on the basis of the preamble of claim 14, with the features specified in the characterizing part of claim 14.
  • the object is also achieved according to the invention by the features specified in the characterizing part of claim 20.
  • the object is achieved based on the preamble of claim 21 according to the invention, by the features specified in the characterizing part of claim 21.
  • nucleic acids and polypeptides according to the invention it is now possible to provide an L-serine dehydratase which causes less or no L-serine degradation. It is also possible to provide microorganisms and processes with which L-serine production is possible with higher yields than previously known microbial processes.
  • the invention relates to microorganisms of the genus Corynebacterium which are replicable, optionally recombinant nucleic acids, the nucleotide sequence coding for the L-serine dehydratase, hereinafter also referred to as SDA, in part or completely deleterious. is mutated or mutated or is expressed less or not at all compared to naturally occurring nucleotide sequences.
  • the invention furthermore relates to the provision of nucleic acids whose sdaA gene sequence has been partially or completely deleted or mutated or is expressed less or not at all compared to naturally occurring nucleotide sequences.
  • nucleic acid with a nucleotide sequence according to SEQ ID No 1 whose nucleotides from position 506 to 918 have been partially or completely deleted or mutated, or an allele, homologue or derivative of this nucleotide sequence or nucleotide sequences hybridizing with it has proven to be advantageous.
  • the deletion or mutation of the sequence motif containing the cysteine required for the formation of the iron-sulfur cluster can also be advantageous (Hofmeister et al., (1994) Iron-sulfur cluster-containing L-serine dehydratase from Peptostreptococcus asaccharolyticus: correlation of the cluster type with enzymatic activity. FEBS Letters 351: 416-418).
  • the wild type L-serine dehydratase (sdaA) gene sequence is generally known and can be known to those skilled in the art
  • NCBI Accession No. AP005279 or the attached sequence listing according to SEQ ID No. 1 can be removed.
  • L-serine dehydratase (sdaA) gene can be achieved, for example, by directed recombinant DNA techniques. Suitable methods for this are described in Shufer et al. (Gene (1994) 145: 69-73) or Link et al. (Journal of Bacteriology (1998) 179: 6228-6237). Only parts of the gene can also be deleted, or mutated fragments of the L-serine dehydratase gene can also be exchanged. Deletion or exchange results in a loss or reduction in L-serine dehydratase activity. An example of such a mutant is the C. glutamicum strain ATCC13032 ⁇ sdaA, which carries a deletion in the sdaA gene.
  • the promoter and regulatory region which is located upstream of the structural gene can be mutated.
  • Expression regulation cassettes which are installed upstream of the structural gene act in the same way.
  • adjustable promoters it is additionally possible to reduce expression in the course of fermentative serine formation.
  • translation regulation is also possible, for example, by reducing the stability of the m-RNA.
  • genes can be used which code for the corresponding enzyme with low activity.
  • a reduced expression of the L-serine dehydratase gene can also be achieved by changing the media composition and culture management. The person skilled in the art can find instructions, inter alia, from Martin et al.
  • the nucleic acids according to the invention are distinguished in that they are isolated from coryneform bacteria, preferably of the genus Corynebacterium or Brevibacterium, particularly preferably from Corynebacterium glutamicum.
  • Examples of wild types of coryneform bacteria deposited in stock cultures are, for example, Corynebacterium acetoacidophilum ATCC 13870; Corynebacterium acetoglutamicum ATCC 15806; Corynebacterium callunae ATCC 15991; Corynebacterium glutamicum ATCC 13032; Brevibacterium divaricatum ATCC 14020; Brevibacterium lactofermentum ATCC 13869; Corynebacterium lilium ATCC 15990; Brevibacterium flavum ATCC 14067; Corynebacterium melassecola ATCC 17965; Brevibacterium saccharolyticum ATCC 14066; Brevibacterium immariophilum ATCC 14068; Brevibacterium roseum ATCC
  • mutants or production strains suitable for the production of L-serine are organisms from the group Arthrobacter, Pseudomonas, Nocardia, Methylobacterium, Hyphomycrobium, Alcaligenes or Klebsiel-la.
  • the present invention is accomplished by specifying the characterized bacterial strains mentioned above, which, however, does not have a limiting effect.
  • a nucleic acid or a nucleic acid fragment is to be understood as a polymer made from RNA or DNA, which can be single or double-stranded and optionally contain natural, chemically synthesized, modified or artificial nucleotides.
  • DNA polymer also includes genomic DNA, cDNA or mixtures thereof.
  • alleles are functional equivalents, i. H. to understand essentially equivalent nucleotide sequences.
  • Functionally equivalent sequences are those sequences which, despite a different nucleotide sequence, for example due to the degeneracy of the genetic code, still have the desired functions.
  • Functional equivalents thus include naturally occurring variants of the sequences described here, as well as artificial, e.g. B. obtained by chemical synthesis and possibly adapted to the codon use of the host organism nucleotide sequences.
  • a functional equivalent is also understood to mean, in particular, natural or artificial mutations in an originally isolated sequence which continue to show the desired function. Mutations include substitutions, additions, deletions, exchanges or insertions of one or more nucleotide residues. So-called meaning mutations are also included here, which can lead to the exchange of conserved amino acids at the protein level, but which lead to do not lead to a fundamental change in the activity of the protein and are therefore function-neutral. This also includes changes in the nucleotide sequence that affect the N-terminus of a protein at the protein level, but without significantly impairing the function of the protein.
  • the present invention also includes those nucleotide sequences which are obtained by modifying the nucleotide sequence, resulting in corresponding derivatives.
  • the aim of such a modification can e.g. B. the further limitation of the coding sequence contained therein or z. B. also the insertion of further restriction enzyme interfaces.
  • artificial DNA sequences are the subject of the present invention as long as they impart the desired properties, as described above.
  • Such artificial DNA sequences can be determined, for example, by back-translating proteins created using computer-aided programs (molecular modeling) or by in-vitro selection. Coding DNA sequences obtained by back-translating a polypeptide sequence according to the codon usage specific for the host organism are particularly suitable. The specific codon usage can easily be determined by a person skilled in molecular genetic methods by computer analysis of other, already known genes of the organism to be transformed.
  • homologous sequences are to be understood as those which are complementary to the nucleotide sequences according to the invention and / or hybrid with these Sieren.
  • hybridizing sequences includes, according to the invention, substantially similar nucleotide sequences from the group of DNA or RNA, which enter into a specific interaction (binding) with the aforementioned nucleotide sequences under stringent conditions known per se. This also includes short nucleotide sequences with a length of, for example, 10 to 30, preferably 12 to 15 nucleotides. According to the invention, this also includes so-called primers or probes.
  • sequence regions preceding the coding regions are also included.
  • sequence regions with a regulatory function are included here. You can use the transcription, the RNA -Stability or affect RNA processing and translation Examples of regulatory sequences include promoters, enhancers, operators, terminators or translation enhancers.
  • the invention furthermore relates to a gene structure comprising at least one of the nucleotide sequences described above and regulatory sequences operatively linked to them which control the expression of the coding sequences in the host cell.
  • the present invention relates to a vector comprising a nucleotide sequence of the type described above, regulative nucleotide sequences operatively linked thereto and additional nucleotide sequences for the selection of transformed host cells, for replication within the host cell or for integration into the corresponding host cell genome.
  • the vector according to the invention can contain a gene structure of the aforementioned type.
  • Suitable vectors are those that are replicated in coryneform bacteria such as. B. pZl (Menkel E, Thierbach G, Eggeling L, Sahm H., 1989, Appl Environ Microbiol 55 (3): 684-688), pEKEx2 (Eikmanns et al., Gene 102: 93-98 (1991), or pXMJ19 (Jacoby M., Burkovski A (1999) Construction ans application of new Corynebacterium glutamicum vectors. Biotechnol. Technique 13: 437-441).
  • Other plasmid vectors can be used in the same way. However, this list is not for the present invention limiting.
  • probes or primers can be synthesized and used to amplify and isolate, for example, genes from other microorganisms, preferably coryneform bacteria, using the PCR technique.
  • the present invention thus also relates to a probe for identifying and / or isolating genes coding for proteins involved in the biosynthesis of L-serine, this probe being produced on the basis of the nucleic acid sequences of the type described above and a suitable one for detection Contains marker.
  • the probe can be a partial section of the sequence according to the invention, for example from a conserved area which, for. B. has a length of 10 to 30 or preferably 12 to 15 nucleotides and under stringent conditions specifically with homologous nucleotide sequences can hybridize sequences. Suitable markings are well known from the literature.
  • the present invention furthermore relates to an L-serine dehydratase with reduced L-serine breakdown compared to the wild type L-serine dehydratase, coded by a nucleic acid sequence according to the invention or its variations of the type described above.
  • the present invention also relates to an L-serine Dehydratase, or an L-serine dehydratase mutein, with an amino acid sequence according to SEQ ID No 2 whose amino acids have been changed from positions 135 to 274, for example as a result of directed mutagenesis at the DNA level, or a modified form of this polypeptide - sequences or isoforms thereof or mixtures thereof.
  • “changed” means the complete or partial removal or replacement of the amino acids from positions 135 to 274.
  • Isoforms are to be understood as enzymes with the same or comparable substrate and activity specificity, but which have a different primary structure.
  • modified forms are to be understood as enzymes in which there are changes in the sequence, for example at the N-terminus or C-terminus of the polypeptide or in the region of conserved amino acids, but without impairing the function of the enzyme. These changes can be made in the form of amino acid exchanges according to methods known per se.
  • the polypeptides according to the invention are distinguished by the fact that they originate from coryneform bacteria, preferably of the genus Corynebacterium or Brevibacterium, particularly preferably of the species Corynebacterium glutamicum or Brevibacterium, particularly preferably from Corynebacterium glutamicum.
  • coryneform bacteria preferably of the genus Corynebacterium or Brevibacterium, particularly preferably of the species Corynebacterium glutamicum or Brevibacterium, particularly preferably from Corynebacterium glutamicum.
  • Examples of wild types of coryneform bacteria deposited in stock cultures are, for example, Corynebacterium acetoacidophilum ATCC 13870; Corynebacterium acetoglutamicum ATCC 15806;
  • the present invention is characterized in more detail by the specification of the bacterial strains mentioned above, which, however, has no limiting effect.
  • the present invention further relates to a genetically modified microorganism, characterized in that the nucleotide sequence coding for L-serine dehydratase is partially or completely deleted or mutated or is expressed less or not at all compared to the naturally occurring nucleotide sequences.
  • the invention further relates to a microorganism which is characterized in that the sdaA gene is partially or completely deleted or mutated or is expressed less or not at all compared to the naturally occurring sdaA genes.
  • the present invention also includes a genetically modified microorganism containing, in replicable form, a gene structure or a vector of the type described above.
  • the present invention also relates to a genetically modified microorganism containing a polypeptide according to the invention of the type described above, which has reduced or no L-serine breakdown compared to the correspondingly non-genetically modified microorganism.
  • a genetically modified microorganism according to the invention is further characterized in that it is a coryne-shaped bacterium, preferably of the genus Corynebacterium or Brevibacterium, particularly preferably of the species Corynebacterium glutamicum or Brevibacterium flavum.
  • genes can be amplified by methods known per se, such as, for example, the polymerase chain reaction (PCR) using short, synthetic nucleotide sequences (primers) and then isolated.
  • the primers used are generally produced using known gene sequences based on existing homologies in conserved areas of the genes and / or taking into account the GC content of the DNA of the microorganism to be examined.
  • a further procedure for isolating coding nucleotide sequences is the complementation of so-called defect mutants of the organism to be examined, which have at least a phenotypic loss of function in the activity of the gene to be examined or the corresponding protein. Complementation is to be understood as the elimination of the genetic defect of the mutant and extensive restoration of the original appearance before the mutagenesis, which is achieved by introducing functional genes or gene fragments from the microorganism to be examined.
  • a classic mutagenesis method for producing defect mutants or mutants with a reduced or deactivated L-serine dehydratase is for example the treatment of the bacterial cells with chemicals such as. B.
  • the present invention also relates to a method for the microbial production of L-serine, wherein the nucleic acid coding for L-serine dehydratase is partially or completely deleted or mutated in a microorganism or not at all or compared to naturally occurring nucleic acids is expressed less, this genetically modified microorganism is used for the microbial production of L-serine and the correspondingly formed L-serine is isolated from the culture medium.
  • the genetically modified microorganisms produced according to the invention can be cultured continuously or discontinuously in the batch process (batch cultivation) or in the fed batch (feed process) or repeated fed batch process (repetitive feed process) for the purpose of producing L-serine.
  • batch cultivation batch cultivation
  • feed process fed batch
  • repetitive feed process repetitive feed process
  • the culture medium to be used must meet the requirements of the respective strains in a suitable manner. Descriptions of culture media of various microorganisms are contained in the manual "Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington D.C., USA, 1981). As a carbon source, sugar and carbohydrates such as B.
  • Glucose sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as B. soybean oil, sunflower oil, peanut oil and coconut oil, fatty acids such as. As palmitic acid, stearic acid and linoleic acid, alcohols such as. B. glycerol and ethanol and organic acids such as. B. acetic acid can be used. These substances can be used individually or as a mixture.
  • Organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be used as the nitrogen source.
  • the nitrogen sources can be used individually or as a mixture.
  • Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used as the source of phosphorus.
  • the culture medium must also contain salts of metals such.
  • the culture medium can Suitable precursors are also added.
  • the feedstocks mentioned can be added to the culture in the form of a single batch or can be added in a suitable manner during the cultivation.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid are used in a suitable manner to control the pH of the culture.
  • anti-foaming agents such as B. fatty acid polyglycol esters.
  • suitable selectively acting substances e.g. B. Antibiotics can be added.
  • oxygen or oxygen-containing gas mixtures such as. B. air introduced into the culture.
  • the temperature of the culture is usually 20 ° C to 45 ° C and preferably 25 ° C to 40 ° C.
  • the culture is continued until a maximum of L-serine has formed. This goal is usually achieved within 10 hours to 160 hours.
  • L-serine formation can be carried out by anion exchange chromatography with subsequent ninhydrin derivatization, as in Spackman et al.
  • the microorganisms which are the subject of the present invention can L-serine from glucose, sucrose, lactose, mannose, fructose, maltose, molasses, starch, Produce cellulose or from glycerin and ethanol. It can be the representatives of coryneform bacteria already described in more detail above. A selection of results from the fermentation is shown in Table 1.
  • the genetically modified microorganisms according to the invention are distinguished here by a significantly improved L-serine production compared to the correspondingly non-transformed microorganisms (wild types) or the microorganisms which only contain the vector without a gene insert. In a special embodiment variant of the present invention, it is shown that C.
  • glutamicum ATCC 13032 ⁇ panBC ⁇ sdaA leads to an at least 4-fold increase in L-serine accumulation in the medium in comparison to the control strains (Table 1).
  • Table 1 glutamicum ATCC 13032 ⁇ panBC ⁇ sdaA
  • amino acid production strains are to be understood as Corynebacterium glutamicum strains or homologous microorganisms which have been modified by classic and / or molecular genetic methods in such a way that their metabolic flow increases in the direction of the biosynthesis of amino acids or their derivatives (metabolic engineering).
  • these amino acid production strains one or more genes and / or the corresponding enzymes which are at crucial and correspondingly complexly regulated key positions in the metabolic pathway (bottleneck) are changed or even deregulated.
  • the present invention already includes all of them known amino acid production strains, preferably of the genus Corynebacterium or homologous organisms.
  • those production strains are also included which the person skilled in the art can produce by analogy with knowledge from other microorganisms, for example enterobacteria, bacillaceae or yeast species, by customary methods.
  • Fig. 1 Integration plasmid pK19mobsacB-Deltasda ⁇
  • the markings indicated on the outer edge of the plasmid identify the respective restriction sites.
  • the sections within the circle indicate the following genes: kanamycin resistance sacB sucrase
  • Fig. 2 Growth behavior (square symbols) and L-serine degradation (circular symbols) of C. glutamicum 13032 ⁇ panBC ⁇ sdaA, clone 1 (D, O) and C. glutamicum 13032 ⁇ panBC ⁇ sdaA, clone 2
  • the abscissa X indicates the fermentation time in hours [h].
  • the ordinate Yi indicates the growth of the microorganisms measured as optical density (OD) at 600 nm.
  • the ordinate Y 2 indicates the L-serine concentration in mM.
  • Fig. 3 Expression plasmid pEC-T18mob2-serA fbr CB.
  • the markings indicated on the outer edge of the plasmid identify the respective restriction interfaces.
  • Corynebacterium glutamicum has a nucleotide sequence (Genbank accession number BAB99038; SEQ-ID-No. 1) whose derived polypeptide sequence has 40% identity to the described L-serine dehydratase from E. coli (NCBI accession number P16095) , By directed mutagenesis according to a method by Link et al. (Link AJ, Phillips D, Church GM. Methods for generating precise deletions and insertions in the genome of wildtype Escherichia coli: application to open reading frame characterization. J Bacteriol. 1997
  • SdaA-2 5 -CCCATCCACTAAACTTAAACACGTCATAATGAACCCACC-3 (AP005279 complementary to nucleotide 74121-74139);
  • SdaA 3 5 ⁇ -TGTTTA ⁇ GTTT ⁇ GTGGATGGGCCGACTAATGGTGCTGCG 3-x (AP005279 complementary to nucleotides 74553-74571);
  • sdaA 4 5 -CGGGAAGCCCAAGGTGGT 3-x (AP005279 nucleotide 75044 -75062)
  • Primers sdaA-1 and sdaA-2 flank the beginning and end of the sdaA gene, respectively.
  • the primers sdaA-2 and sdaA-3 each have complementary linker regions (highlighted text) which make it possible to generate a deletion in the sdaA gene in vitro in a two-stage PCR approach (cross-over PCR).
  • cross-over PCR In a first PCR reaction with chromosomal DNA from C. glutamicum, the primer combinations sdaA-1 and sdaA-2 as well as sdaA-3 and sdaA-4 were used.
  • the PCR reaction was carried out in 30 cycles in the presence of 200 ⁇ M deoxynucleotide triphosphates (dATP, dCTP, dGTP, dTTP), 600 nM each of the corresponding oligonucleotides sdaA-1 and sdaA-4 and 60 nM of the oligonucleotides sdaA-2 and sdaA-3, 100 ng of chromosomal DNA from Corynebacterium glutamicum ATCC13032, 1/10 volume of 10-fold reaction buffer and 2.6 units of a heat-stable Taq / Pwo DNA polymerase mixture (Expand High Fidelity PCR System from Röche Diagnostics, Mannheim, Germany) in a thermal cycler (PTC-100, MJ Research, Inc., Watertown, USA) carried out under the following conditions: 94 ° C.
  • deoxynucleotide triphosphates dATP, dCTP, dGTP, dT
  • the DNA fragments obtained, each having a length of 500 bp, were isolated from a 0.8% agarose gel using the QIAExII gel extraction kit (Qiagen) according to the manufacturer, and both
  • Fragments were used as templates in the second PCR.
  • the primers sdaA-1 and sdaA-4 were now used as primers. This time the reaction took place in 35 cycles in the presence of 200 ⁇ M deoxynucleotide triphosphates, 600 nM each of the corresponding oligonucleotide, 20 ng each of the isolated template DNA from the first PCR, 1/10 volume of 10-fold reaction buffer and 2.6 Units of the Taq / Pwo DNA polymerase mixture under the following conditions: 94 ° C for 30 seconds, 50 ° C for 30 seconds and 72 ° C for 80 seconds. Again, the elongation step was extended by 5 seconds after 10 cycles.
  • the 1000 bp DNA fragment obtained which now contains the inactivated sdaA gene with a 420 bp central deletion, was isolated from a 0.8% agarose gel and blunt-ended using the Sure clone kits (Amersham Pharmacia Biotech) into the S al interface of the inactivation vector pK19mobsacB (Schäfer et al. Gene 145: 69-73 (1994), which can replicate only in E. coli but not in C. glutamicum.
  • the plasmid pK19mobsacB_ ⁇ sdaA obtained was checked for correctness by restriction mapping.
  • the cloning was carried out in the Escherichia coli strain DH5o; mcr (Grant et al., Proceedings of the National Academy of Sciences of the United States of America USA (1990) 87: 4645-4649).
  • the plasmid was then electroporated into C. glutamicum 13032 ⁇ panBC (Radmacher E, Vaitsikova A,
  • This strain is pantotenate-auxotrophic due to the deletion of the pantothenate biosynthesis genes panB and panC, and is characterized by the fact that it secretes approx. 50 mM alanine and 8 mM valine under pantothenate limitation due to an increased accumulation of pyruvate.
  • the strain forms approximately 100 ⁇ M L-serine and is therefore suitable as a starting strain for the construction of an L-serine producer.
  • Kanamycin-resistant clones of C. glutamicum 13032 ⁇ panBC were obtained in which the inactivation vector was integrated in the genome.
  • kanamycin-resistant clones were placed on LB medium containing sucrose ((Sa brook et al., Molecular cloning. A laboratory manual (1989) Cold Spring Harbor Laboratory Press) with 15 g / l agar , 2% glucose / 10% sucrose) and colonies are obtained which have lost the vector through a second recombination event (Jäger et al. 1992, Journal of Bacteriology 174: 5462-5465).
  • FIG. 2 shows that the deletion of the sdaA gene leads to an approximately 40% reduced degradation of L-serine.
  • strains 13032 ⁇ panBC ⁇ sdaA (clone 1, clone 2) and 13032 ⁇ panBC (Kon 1, clone 2) were used with the plasmid pEC- T18mob2 - serA tx serCserB transformed.
  • the plasmid (FIG. 3) is composed of the vector pEC-T18mob2 (Tauch, A., Kirchner, 0., Loffler, B., Gotker, S., Puhler, A. and Kalinowski, J.
  • strains 13032 ⁇ panBC ⁇ sdaApserA fbr CB and 13032 ⁇ panBCpser ⁇ fbr CB were obtained.
  • the two strains 13032 ⁇ panBC ⁇ sdaAps ⁇ r ⁇ fbr CB and 13032 ⁇ panBCpserA fbr CB were grown in complex medium (CgIII with 2% glucose and 5 ⁇ g / 1 tetracycline), and the fermentation medium CGXII (J Bacteriol (1993) 175: 5595-5603) inoculated from the previous cultures.
  • the medium additionally contained 50 ⁇ g / 1 kanamycin and 1 ⁇ M pantothenate.
  • the two starting strains 13032 ⁇ panBC and 13032 ⁇ panBC ⁇ sdaA were cultivated in the same way, but the media contained no tetracycline b. At least two were independent
  • the wild-type strain WT pXMJ19 (Jacoby M., Burkovski A (1999) Construction ans application of new Corynebacterium glutamicum vectors. Biotechnol. Technique 13: 437-441), the overexpression strain WT pXMJl 9_sdaA and the Deletion strain AsdaA pXMJ19 in CgXII minimal medium as in Keilhauer et al. , (1993).
  • the medium contained 30 mg / 1 protocatechic acid, 100 mM glu kose and 100 mM L-serine.
  • the cells were cultivated in the presence of 1 mM isopropyl-beta-D-thiogalactopyranoside and harvested in the exponential growth phase at an optical density of 6-8, measured on the spectrophotomer Pharmacia Biotech ultrospec 3000. They were then centrifuged at 4500 rpm and 4 ° C. for 10 min, in 50 mM N-2-
  • Hydroxyethylpiperazin-N '-2-ethanesulfonic acid buffer respired, and centrifuged again. The cells were then taken up in 50 mM N-2-hydroxyethylpiperazine-N '-2-ethanesulfonic acid buffer (pH 8.0), 1 M FeS0 4 and 10 mM dithiothreitol. The cells were disrupted using ultrasound treatment (Branson sonifier 250; duty cycle 25%, output control 2.5, 10 minutes) on ice.
  • the reaction mixture contained 50 mM N-2-hydroxyethylpiperazine-N '-2-ethanesulfonic acid buffer (pH 8.0), 10 mM dithiothreitol and 10-100 ⁇ l crude extract.
  • the detection of the pyruvate formed from the serine was carried out as described (Ohmori et al., 1991).
  • the reaction was started by adding 50 mM L-serine and stopped after 10 minutes by adding 1, 2-diamino-4, 5-dimethoxybenzene reagent in a ratio of 1: 1.
  • the reagent was as described in Ohmori et al.
  • Table 2 Specific activity of L-serine dehydrate in strains 13032 WT pXMJ19_sdaA (overexpressor), 13032 WT pXMJ19 (wild type with empty vector) and 13032 AsdaA pXMJ19 (deletion mutant with empty vector) under inducing conditions.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
PCT/DE2004/000248 2003-03-13 2004-02-12 Nukleotidsequenzen coryneformer bakterien codierend für am l-serinstoffwechsel beteiligte proteine sowie verfahren zur mikrobiellen herstellung von l-serin Ceased WO2004081166A2 (de)

Priority Applications (7)

Application Number Priority Date Filing Date Title
MXPA05009796A MXPA05009796A (es) 2003-03-13 2004-02-12 Secuencias nucleotidas de bacterias corineformes que codifican a las proteinas participantes en el metabolismo de la l-serina y metodo para producir l-serina.
BRPI0408219-2A BRPI0408219A (pt) 2003-03-13 2004-02-12 seqüências de nucleotìdeos de bactérias corineformes codificando proteìnas envolvidas no metabolismo da l-serina bem como microorganismo e processo para a preparação microbiana de l-serina
AU2004220016A AU2004220016B2 (en) 2003-03-13 2004-02-12 Nucleotide sequences of coryneform bacteria coding for proteins involved in L-serine metabolism and method for producing L-serine
US10/549,262 US20060204963A1 (en) 2003-03-13 2004-02-12 Nucleotide sequences of coryneform bacteria coding for proteins involved in l-serine metabolism and method for producing l-serine
EP04710333A EP1601773A2 (de) 2003-03-13 2004-02-12 Nukleotidsequenzen coryneformer bakterien codierend f r am l -serinstoffwechsel beteiligte proteine sowie verfahren zur mikrobiellen herstellung von l-serin
JP2006504233A JP2006519598A (ja) 2003-03-13 2004-02-12 L−セリン代謝に関与する蛋白質をコードするコリネ型バクテリアのヌクレオチド配列並びにl−セリンの微生物による産生方法
US12/136,190 US8119374B2 (en) 2003-03-13 2008-06-10 Nucleotide sequences of coryneform bacteria coded for proteins participating in L-serine metabolism and method for microbial production of L-serine

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10311399.1 2003-03-13
DE10311399A DE10311399A1 (de) 2003-03-13 2003-03-13 Nukleotidsequenzen coryneformer Bakterien codierend für am L-Serinstoffwechsel beteiligte Proteine sowie Verfahren zur mikrobiellen Herstellung von L-Serin

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/136,190 Division US8119374B2 (en) 2003-03-13 2008-06-10 Nucleotide sequences of coryneform bacteria coded for proteins participating in L-serine metabolism and method for microbial production of L-serine

Publications (2)

Publication Number Publication Date
WO2004081166A2 true WO2004081166A2 (de) 2004-09-23
WO2004081166A3 WO2004081166A3 (de) 2005-03-17

Family

ID=32892226

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE2004/000248 Ceased WO2004081166A2 (de) 2003-03-13 2004-02-12 Nukleotidsequenzen coryneformer bakterien codierend für am l-serinstoffwechsel beteiligte proteine sowie verfahren zur mikrobiellen herstellung von l-serin

Country Status (11)

Country Link
US (2) US20060204963A1 (https=)
EP (1) EP1601773A2 (https=)
JP (1) JP2006519598A (https=)
KR (1) KR20050108387A (https=)
AU (1) AU2004220016B2 (https=)
BR (1) BRPI0408219A (https=)
DE (1) DE10311399A1 (https=)
DK (1) DK200900060U3 (https=)
MX (1) MXPA05009796A (https=)
WO (1) WO2004081166A2 (https=)
ZA (1) ZA200508232B (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011080301A3 (en) * 2009-12-30 2012-04-12 Metabolic Explorer Strains and method for the production of methionine

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102005049527B4 (de) * 2005-10-17 2013-05-08 Forschungszentrum Jülich GmbH Verfahren zur Herstellung von L-Serin, Gensequenz, Vektoren sowie Mikroorganismus
PL2342103T3 (pl) 2008-10-22 2014-11-28 Johnson Controls Tech Co Zamek siedzenia pojazdu
KR101500848B1 (ko) * 2013-07-23 2015-03-09 씨제이제일제당 (주) 천연 뉴트럴 조미소재의 제조 방법
KR101500846B1 (ko) * 2013-07-23 2015-03-16 씨제이제일제당 (주) 천연 소고기 풍미 조미소재의 제조 방법
KR101500847B1 (ko) * 2013-07-23 2015-03-16 씨제이제일제당 (주) 천연 코쿠미 조미소재의 제조 방법
KR101500850B1 (ko) * 2013-08-07 2015-03-18 씨제이제일제당 (주) 천연 조미소재 제조를 위한 이노신산 발효액 또는 글루탐산 발효액의 제조 방법
DK3250700T3 (da) * 2015-01-27 2020-07-27 Cysbio Aps Fremgangsmåde til fremstilling af L-serin under anvendelse af genmodificerede mikroorganismer, der mangler serin-nedbrydningspathways
KR102279696B1 (ko) * 2021-04-20 2021-07-20 씨제이제일제당 주식회사 신규한 l-세린 암모니아 분해 효소 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
KR20250169494A (ko) * 2024-05-24 2025-12-03 씨제이제일제당 (주) 글리신 절단 시스템의 활성이 강화된 미생물 및 이의 용도

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3623952A (en) * 1967-11-29 1971-11-30 Ajinomoto Kk Method of producing l-serine by fermentation
US4528273A (en) * 1983-11-22 1985-07-09 W. R. Grace & Co. Microorganism strains for the fermentative preparation of L-serine
CA1226541A (en) * 1984-01-13 1987-09-08 Stauffer Chemical Company Mutant strain deficient in l-serine deaminase activity
JP4066543B2 (ja) 1998-01-12 2008-03-26 味の素株式会社 発酵法によるl−セリンの製造法
JP3997631B2 (ja) * 1998-01-12 2007-10-24 味の素株式会社 発酵法によるl−セリンの製造法
MXPA01013123A (es) * 1999-06-25 2002-06-21 Basf Ag Genes de corynebacterium glutamicum que codifican proteinas de via metabolica.
JP4623825B2 (ja) * 1999-12-16 2011-02-02 協和発酵バイオ株式会社 新規ポリヌクレオチド

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011080301A3 (en) * 2009-12-30 2012-04-12 Metabolic Explorer Strains and method for the production of methionine
US9382561B2 (en) 2009-12-30 2016-07-05 Metabolic Explorer Strains and method for the production of methionine

Also Published As

Publication number Publication date
US20060204963A1 (en) 2006-09-14
AU2004220016B2 (en) 2009-07-16
WO2004081166A3 (de) 2005-03-17
AU2004220016A1 (en) 2004-09-23
KR20050108387A (ko) 2005-11-16
US8119374B2 (en) 2012-02-21
DK200900060U3 (da) 2009-07-10
JP2006519598A (ja) 2006-08-31
BRPI0408219A (pt) 2006-02-14
MXPA05009796A (es) 2005-10-26
ZA200508232B (en) 2007-04-25
DE10311399A1 (de) 2004-09-23
US20090061482A1 (en) 2009-03-05
EP1601773A2 (de) 2005-12-07

Similar Documents

Publication Publication Date Title
EP1094111B1 (de) Coryneforme Bakterien mit einer Deletion der Phosphoenolpyruvat-Carboxykinase und ihre Verwendung
US8119374B2 (en) Nucleotide sequences of coryneform bacteria coded for proteins participating in L-serine metabolism and method for microbial production of L-serine
EP1096013A2 (de) Corynebacterium poxB-Gen codierende Nukleotidsequenzen, und die Verwendung zur Herstellung von L-Lysin
EP1103611A1 (de) Für die Gene sucC und sucD kodierende Nukleotidsequenzen
EP2089525B1 (de) Allele des oxyr-gens aus coryneformen bakterien
DE102005019967A1 (de) Verfahren zur fermentativen Herstellung von L-Aminosäuren
DE10117816A1 (de) Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung coryneformer Bakterien
DE102004009454A1 (de) Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung von rekombinanten Mikroorganismen
DE10224088A1 (de) Verfahren zur Herstellung von L-Aminosäuren unter Verwendung coryneformer Bakterien die ein abgeschwächtes mez-Gen enthalten
EP1574582A1 (de) Verfahren zur Herstellung von L-Aminosäuren unter Verwendung coryneformer Bakterien
DE10244581A1 (de) Aminosäure produzierende Bakterien und Verfahren zur Herstellung von L-Aminosäuren
US7732176B2 (en) Nucleotide sequences that encode deregulated phosphoglycerate dehydrogenases of coryneform bacteria and method for producing L-serine
EP1259622A2 (de) Nukleotidsequenzen kodierend fur proteine beteiligt an der biosynthese von l-serin, verbessertes verfahren zur mikrobiellen herstellung von l-serin sowie ein dazu geeigneter genetisch veranderter mikroorganismus
DE102005049527B4 (de) Verfahren zur Herstellung von L-Serin, Gensequenz, Vektoren sowie Mikroorganismus
DE19947792A1 (de) Neue für das Irp Gen codierende Nukleotidsequenzen
DE10220574A1 (de) Verfahren zur Herstellung von Aminosäuren mit coryneformen Bakterien unter Verwendung von Phosphoglucose-Isomerasen aus coryneformen Bakterien
DE10113011A1 (de) Verfahren zur fermentativen Herstellun von L-Aminosäuren unter Verwendung coryneforme Bakterien
EP1143003A2 (de) Nukleotidsequenzen, die für das rplk-Gen kodieren, und Verfahren zur Herstellung von L-Aminosäuren
DE10017057A1 (de) Neue für das rpIK Gen kodierende Nukleotidsequenzen
DE10009799A1 (de) Nukleotidsequenzen kodierend für Proteine beteiligt an der Biosynthese von L-Serin und Verfahren zu dessen Herstellung
DE10042051A1 (de) Neue für das cstA-Gen kodierende Nukleotidsequenzen

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2004710333

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2006504233

Country of ref document: JP

Ref document number: 1020057017047

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: PA/a/2005/009796

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2004220016

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2005/08232

Country of ref document: ZA

Ref document number: 200508232

Country of ref document: ZA

ENP Entry into the national phase

Ref document number: 2004220016

Country of ref document: AU

Date of ref document: 20040212

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004220016

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 1020057017047

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2004710333

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0408219

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 10549262

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 10549262

Country of ref document: US