WO2001047996A1 - NOUVEAU POLYPEPTIDE, FAMILLE DE PROTEINE SOD Cu/Zn 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE - Google Patents

NOUVEAU POLYPEPTIDE, FAMILLE DE PROTEINE SOD Cu/Zn 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE Download PDF

Info

Publication number
WO2001047996A1
WO2001047996A1 PCT/CN2000/000676 CN0000676W WO0147996A1 WO 2001047996 A1 WO2001047996 A1 WO 2001047996A1 CN 0000676 W CN0000676 W CN 0000676W WO 0147996 A1 WO0147996 A1 WO 0147996A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
protein family
sod protein
sequence
Prior art date
Application number
PCT/CN2000/000676
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU21441/01A priority Critical patent/AU2144101A/en
Publication of WO2001047996A1 publication Critical patent/WO2001047996A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0089Oxidoreductases (1.) acting on superoxide as acceptor (1.15)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y115/00Oxidoreductases acting on superoxide as acceptor (1.15)
    • C12Y115/01Oxidoreductases acting on superoxide as acceptor (1.15) with NAD or NADP as acceptor (1.15.1)
    • C12Y115/01001Superoxide dismutase (1.15.1.1)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, Cu ⁇ Zn SOD protein family 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • Cu / Zn SODC Copper / zinc superoxide dismutase
  • Cu / Zn SODC has a molecular weight of approximately 32kd. Its two subunits are relatively independent of each other and there is no covalent bond between each other. Each subunit contains 1-g atoms of Cu / Zn.
  • Cu / Zn SODC combines one zinc atom and one copper atom each.
  • Cu / Zn SODC has the following forms: Cytoplasmic form of eukaryotic cells, extra chloroplast form in plants, extracellular form of some eukaryotic cells, periplasmic form of prokaryotic cells.
  • the metal binding sites are all conserved. These binding sites are histidine 48, 50, 77, 135 that binds to copper atoms, and histidine 77, 86 that binds to zinc atoms. , 95 and aspartic acid 98.
  • Histidine 77 is a bridge between copper and zinc atoms, and the binding sites of copper and oxygen anions are separate and highly intact.
  • the Cu / Zn SODC family has two characteristic sequences. [1] [GA]-[IFAT] -H- [LIVF] -HX (2)-[GP]-[SDX] -X- [STAGD] fleshwhere two H represent copper ligands. [2] G -[GN]-[SGA] -GXRX- [SGA] -CX (2)-[IV]. Where C is related to a disulfide bond. The previous sequence contains two histidine residues bound to a copper atom. The two sequences are located at the C-terminus of SODC and contain a cysteine residue associated with a disulfide bond.
  • the human Cu / Zn SODC gene is located on the human chromosome 21, is 1 lkb long, and has 5 exogenous and 4 endogenous genes.
  • the first foreign element had 5'-GC, rather than the highly conservative 5'-GT.
  • Cu / Zn S0DC abnormalities will cause, but not be limited to, the following diseases: oxidative hemolytic anemia, undersea anaemia, malaria, Fankang anemia, muscle dislocation, gallbladder fibrosis, and various inflammations.
  • Cu / Zn SOD protein family 9 proteins play an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more Cu / Zn SOD proteins involved in these processes.
  • Family 9 proteins in particular the amino acid sequence of this protein is identified. Isolation of the 9 protein encoding genes of the new Cu / Zn SOD protein family also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding D.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector comprising a polynucleotide encoding a Cu / Zn SOD protein family 9.
  • Another object of the present invention is to provide a method for producing Cu / Zn SOD protein family 9.
  • Another object of the present invention is to provide an antibody against the polypeptide-Cu / Zn SOD protein family 9 of the present invention.
  • Another object of the present invention is to provide analog compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-Cu / Zn SOD protein family 9.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in the Cu / Zn SOD protein family 9.
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1159-141 in SEQ ID NO: 1; and (b) having a sequence in SEQ ID NO: 1 in 1- 1582-bit sequence.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
  • a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the Cu / Zn SOD protein family 9 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to the Compound.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of Cu / Zn SOD protein family 9 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or The amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of Cu / Zn SOD protein family 9.
  • FIG. 1 is a comparison diagram of amino acid sequence homology of a characteristic protein of the Cu / Zn SOD protein family 9 of the present invention in a total of 78 amino acids and domains from 3 to 80 in the Cu / Zn SOD protein family 9.
  • the upper sequence is the Cu / Zn SOD protein family 9, and the lower sequence is the characteristic protein domain of the Cu / Zn SOD protein family.
  • " And ":” and ".” Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated Cu / Zn SOD protein family 9.
  • 9Kda is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in the amino acid / F column or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with the Cu / Zn SOD protein family 9, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind the Cu / Zn SOD protein family 9.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of the Cu / Zn SOD protein family 9 when combined with the Cu / Zn SOD protein family 9.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the Cu / Zn SOD protein family 9.
  • Regular refers to a change in the function of the Cu / Zn SOD protein family 9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of the Cu / Zn SOD protein family 9. change.
  • substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify the Cu / Zn SOD protein family 9 using standard protein purification techniques. Basically pure Cu / Zn SOD protein family 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of Cu / Zn SOD protein family 9 peptides can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not imply that conditions with reduced stringency allow Non-specific binding is possible because conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks each pair by checking the distance between all pairs. Groups of sequences are arranged into clusters. Each cluster is then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun He in (Hein J., (1990) Methods in enzymo logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitopes of Cu / Zn SOD protein family 9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not its natural environment The ingredients, they are still separated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated Cu / Zn SOD protein family 9 means that the Cu / Zn SOD protein family 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify the Cu / Zn SOD protein family 9 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the Cu / Zn SOD protein family 9 peptides can be analyzed by amino acid sequence analysis.
  • the present invention provides a new polypeptide ⁇ Cu / Zn SOD protein family 9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of the Cu / Zn SOD protein family 9.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the Cu / Zn SOD protein family 9 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
  • Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
  • a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify this polypeptide or protein sequence).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1582 bases and its open reading frame of 1159-141 0 encodes 83 amino acids.
  • This peptide has the characteristic sequence of the characteristic protein of the Cu / Zn SOD protein family, and it can be deduced that the Cu / Zn SOD protein family Group 9 has the structure and function represented by the characteristic proteins of the Cu / Zn SOD protein family.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0. /.
  • hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding Cu / Zn SOD protein family 9.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the Cu / Zn SOD protein family 9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These technologies include, but are not limited to In: 1) hybridize a probe to a genomic or cDNA library to detect a homologous polynucleotide sequence, and 2) screen the antibody against the expression library to detect a cloned polynucleotide fragment with common structural features.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the D-sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript level of the Cu / Zn SOD protein family 9; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the Cu / Zn SOD protein family 9 gene expression protein.
  • a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. To obtain full-length cDNA Sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a Cu / Zn SOD protein family 9 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding the Cu / Zn SOD protein family 9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding the Cu / Zn SOD protein family 9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a Cu / Zn SOD protein family 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
  • host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells Plague cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells, etc. .
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. Alternatively, MgCl 2 is used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequences of the present invention can be used to express or produce recombinant Cu / Zn SOD protein family 9 by conventional recombinant DNA technology (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases Therapy, for example, can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Cu / Zn SODC abnormalities will cause, but are not limited to, the following diseases: oxidative hemolytic anemia, thalassemia, malaria, Fankang anemia, muscle dislocation, gallbladder fibrosis, and various inflammations.
  • the abnormal expression of the specific copper / zinc superoxide dismutase mot if will cause the function of the polypeptide containing this mot if to be abnormal, which will cause the decomposition of H 2 0 2 and superoxide radicals which are harmful to the cell.
  • Abnormal and can produce glycogen gluconeogenesis, abnormal lipid metabolism, and related diseases such as anemia, abnormal inflammatory process, abnormal immune system function, organic acidemia, abnormal thyroid hormone production.
  • the abnormal expression of the Cu / Zn SOD protein family 9 of the present invention will produce various diseases, especially anemia, abnormal inflammatory process, abnormal immune system function, organic acidemia, and thyroid diseases. These diseases include, but are not limited to:
  • Anemia oxidative hemolytic anemia, thalassemia, Fancome anemia, malaria
  • inflammatory abnormalities caused by various infections and traumas such as viral hepatitis, Borrelia infection, tuberculosis, HIV, syphilis, allergic reactions, bronchial asthma, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, Osteoarthritis, glomerulonephritis, immune complex glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, Addison's disease, Graves's Disease, chronic active hepatitis, intestinal emergency syndrome, atrophic gastritis, systemic lupus erythematosus, cerebrospinal multiple sclerosis, Guillain-Barre syndrome, intracranial granulomatosis, Wegener granulomatosis, autoimmune thyroiditis, Autoimmune interstitial nephritis, ulcerative co
  • Immune system diseases antibody-based primary specific immunodeficiency disease, combined immunodeficiency disease, immunodeficiency disease of phagocytic cells deficiency, complement system deficiency disease, Down syndrome, biotin-dependent carboxylase deficiency, D m Can syndrome, thymoma, chronic cutaneous mucosal candidiasis, aplastic anemia, Di George syndrome, Wiscot t-Aldr ich syndrome, immunodeficiency disease with ataxia capillary dilatation, acquired immunodeficiency Syndrome
  • Organic acidemia propionic acidemia, methylmalonic aciduria, isovalerate, combined carboxylation Enzyme deficiency, glutaemia type I
  • Thyroid diseases toxic goiter, non-toxic goiter, cretinism, myxedema, thyroiditis
  • Abnormal expression of the Cu / Zn SOD protein family 9 of the present invention will also generate certain tumors, certain hereditary, hematological diseases, etc.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially anemia, abnormal inflammatory process, abnormal immune system function, organic acidemia, thyroid disease , Some tumors, some hereditary, hematological diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that enhance (agonist) or repress (antagonist) the Cu / Zn SO D protein family 9.
  • Agonists enhance biological functions such as Cu / Zn SOD protein family 9 to stimulate cell proliferation, and antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing Cu / Zn SOD protein family 9 can be cultured with labeled Cu / Zn SOD protein family 9 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of the Cu / Zn SOD protein family 9 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • the antagonist of Cu / Zn SOD protein family 9 can bind to Cu / Zn SOD protein family 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology.
  • Cu / Zn SOD protein family 9 can be added to the bioanalytical assay, and the effect of the compound on the interaction between Cu / Zn SOD protein family 9 and its receptor can be determined to determine whether the compound Antagonist.
  • Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Polypeptide molecules capable of binding to the Cu / Zn SOD protein family 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 9 molecules of Cu / Zn SOD protein family should be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against Cu / Zn SOD protein family 9 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of Cu / Zn SOD protein family 9 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
  • Techniques for preparing monoclonal antibodies to Cu / Zn SOD protein family 9 include, but are not limited to, hybridization Tumor technology (Kohler and Milstein n. Nature, 1 975, 256: 495-497), triple tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morri et al, PNAS, 1 985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single-chain antibodies against Cu / Zn SOD protein family 9.
  • Antibodies against Cu / Zn SOD protein family 9 can be used in immunohistochemistry to detect Cu / Zn SOD protein family 9 in biopsy specimens.
  • Monoclonal antibodies that bind to the Cu / Zn SOD protein family 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • Cu / Zn SOD protein family 9 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through disulfide exchange.
  • This hybrid antibody can be used to kill Cu / Zn SOD protein family 9 positive cell.
  • the antibodies of the present invention can be used to treat or prevent diseases related to the Cu / Zn SOD protein family 9.
  • Administration of appropriate doses of antibodies can stimulate or block the production or activity of the Cu / Zn SOD protein family 9.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of Cu / Zn SOD protein family 9 levels. These tests are well known in the art and include F I SH assays and radioimmunoassays. The levels of Cu / Zn SOD protein family 9 detected in the test can be used to explain the importance of Cu / Zn SOD protein family 9 in various diseases and to diagnose diseases in which Cu / Zn SOD protein family 9 plays a role.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding the Cu / Zn SOD protein family 9 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of Cu / Zn SOD protein family 9.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated Cu / Zn SOD protein family 9 to inhibit endogenous Cu / Zn SOD protein family 9 activity.
  • a mutated Cu / Zn SOD protein family 9 may be a shortened Cu / Zn SOD protein family 9 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity.
  • the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of Cu / Zn SOD protein family 9.
  • Virus-derived expression vectors such as retroviruses, adenoviruses, and adenovirus-related diseases Viruses, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding the Cu / Zn SOD protein family 9 into cells.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a Cu / Zn SOD protein family 9 can be found in existing literature (Sambrook, eta l.).
  • a polynucleotide encoding the Cu / Zn SOD protein family 9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DM
  • ribozymes that inhibit the Cu / Zn SOD protein family 9 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding Cu / Zn SOD protein family 9 can be used for the diagnosis of diseases related to Cu / Zn SOD protein family 9.
  • the polynucleotide encoding Cu / Zn SOD protein family 9 can be used to detect the expression of Cu / Zn SOD protein family 9 or the abnormal expression of Cu / Zn SOD protein family 9 in disease states.
  • the DNA sequence encoding Cu / Zn SOD protein family 9 can be used to hybridize biopsy specimens to determine the expression status of Cu / Zn SOD protein family 9.
  • Hybridization techniques include Sout hern blotting, Nor thern blotting, in situ hybridization, and the like.
  • Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microray) or a D chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and genes diagnosis.
  • a microarray Microray
  • a D chip also known as a "gene chip”
  • Cu / Zn SOD protein family 9 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect Cu / Zn SOD protein family 9 transcription products.
  • Detection of mutations in the Cu / Zn SOD protein family 9 gene can also be used to diagnose Cu / Zn SOD protein family 9-related diseases.
  • Cu / Zn SOD protein family 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type Cu / Zn SOD protein family 9 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of the protein, so the Nort hern blotting and Western blotting can be used to indirectly determine whether there is a mutation in the gene.
  • the sequences of the invention are also valuable for chromosome identification.
  • This sequence will specifically target a specific position on a human chromosome and can hybridize to it.
  • specific sites for each gene on the chromosome need to be identified.
  • only a few chromosome markers based on actual sequence data are available for labeling chromosome positions.
  • an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • the Cu / Zn SOD protein family 9 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of the Cu / Zn SOD protein family 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms cDM by reverse transcription.
  • the Smart cDNA Cloning Kit purchased from Clontech ⁇ cDNA fragment was inserted into the multicloning site of pBSK (+) vector (Clontech)) to transform DH5 a to form a cDNA library.
  • Dye terminate cycl e react ion sequenc ing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) determined the 5 'and 3' end sequences of all clones.
  • the determined cDNA sequences were compared with existing public DM sequence databases (Genebank ), The result showed that the cloned cDNA sequence of one of the clones 1050c09 was new DNA.
  • a series of primers were synthesized to determine the inserted cDNA fragment in both directions.
  • the sequence of the Cu / Zn SOD protein family 9 of the present invention and the protein sequence encoded by the Cu / Zn SOD protein family 9 were profiled by the prog i le scan program (Basic loca l al ignment search tool) in GCG [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed in databases such as Prote.
  • the Cu / Zn SOD protein family 9 of the present invention has homology with the characteristic proteins of the domain Cu / Zn SOD protein family at 3-80. The results of the homology are shown in FIG. 1 with a homology of 0.14 and a score of 8.06; the threshold is 8.05 .
  • Example 3 Cloning of a gene encoding Cu / Zn SOD protein family 9 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:
  • Primer 1 5'— TGGGGGCATTTCTATCCCAAGACA— 3 '(SEQ ID NO: 3)
  • Primer2 5'- TCTTTGAACCTTCCTGTTGACTGT- 3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
  • Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
  • Amplification reaction conditions A reaction volume of 50 ⁇ 1 contains 50 mmol / L KC1, 10 ramol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 20 (raol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. At RT-PCR At the same time, ⁇ -actin was used as a positive control and the template blank was used as a negative control.
  • the amplified product was purified using a QIAGEN kit and connected to a pCR vector using a TA cloning kit (Invitrogen). DM sequence analysis results showed that the PCR product The DNA sequence is exactly the same as 1-1582 bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of Cu / Zn SOD protein family 9 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 ( pH7.4) -5 ⁇ SSC-5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1 ° /. SDS at 55 ° C for 30 minutes. Then, Analysis and quantification were performed using a Phosphor Imager.
  • Example 5 In vitro expression, isolation, and purification of recombinant Cu / Zn SOD protein family 9 Based on the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed. The sequences are as follows:
  • Primer3 5-CCCCATATGATGCGTTCTGGAACTCTACCTTCC-3 '(Seq ID No: 5)
  • Primer4 5-CATGGATCCTTAGAAGGCCCAGACAGAGTGGAG-3' (Seq ID No: 6)
  • the 5 'ends of these two primers contain Ndel and BaraHI restriction sites, respectively, and thereafter The coding sequences for the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and BamHI restriction sites correspond to the selective endonucleases on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Site.
  • the PCR reaction was performed using the pBS-1050c09 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-1050c09 plasmid, primers Primer-3, and Primer-4 were lOpmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5c by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were selected by colony PCR method and sequenced. Correct positive clone (pET-1050c09) The recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • a peptide synthesizer (product of PE) was used to synthesize the following Cu / Zn SOD protein family 9-specific peptides: NH 2 -Met-Arg-Ser-Gly-Thr-Leu-Pro-Ser-Arg-Leu-Pro-Leu -Pro-Glu-Ser-COOH (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same steps to fix the polynucleotide sample to be tested on the filter and then hybridize.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • GC content is 30% -70%, if it exceeds, non-specific hybridization increases
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomes The sequence and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe for subsequent experiments.
  • the film is washed with high-strength conditions and strength conditions, respectively.
  • the 32 P-Pr 0 be (the second peak is free ⁇ - 32 P- dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardfs; 6xSSC, 0.1 lrag / ml CT DM (calf thymus DM)) was added. After closing the bag, 68. C water bath for 2 hours.
  • prehybridization solution lOxDenhardfs; 6xSSC, 0.1 lrag / ml CT DM (calf thymus DM)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une famille de protéine SOD Cu/Zn 9, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la famille de protéine SOD Cu/Zn 9.
PCT/CN2000/000676 1999-12-27 2000-12-25 NOUVEAU POLYPEPTIDE, FAMILLE DE PROTEINE SOD Cu/Zn 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE WO2001047996A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU21441/01A AU2144101A (en) 1999-12-27 2000-12-25 A novel polypeptide, cu/zn sod protein family 9 and the polynucleotide encoding thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 99125785 CN1301744A (zh) 1999-12-27 1999-12-27 一种新的多肽——Cu/Zn SOD蛋白家族9和编码这种多肽的多核苷酸
CN99125785.5 1999-12-27

Publications (1)

Publication Number Publication Date
WO2001047996A1 true WO2001047996A1 (fr) 2001-07-05

Family

ID=5284195

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000676 WO2001047996A1 (fr) 1999-12-27 2000-12-25 NOUVEAU POLYPEPTIDE, FAMILLE DE PROTEINE SOD Cu/Zn 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE

Country Status (3)

Country Link
CN (1) CN1301744A (fr)
AU (1) AU2144101A (fr)
WO (1) WO2001047996A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012103684A1 (fr) * 2011-02-01 2012-08-09 Tianjin Xiji Biotechnology Co., Ltd. Protéines de fusion et méthodes de traitement d'une infection par le vih et de symptômes associés au sida
CN109810196B (zh) * 2019-03-27 2020-08-25 湖南农业大学 一种水稻Cu/Zn-SOD多克隆抗体的制备方法和应用

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NUCLEIC ACIDS RES., vol. 13, no. 6, 25 March 1985 (1985-03-25), pages 2017 - 2034 *
PROC. NATL. ACAD. SCI. USA, vol. 83, no. 11, June 1986 (1986-06-01), pages 3619 - 3623 *

Also Published As

Publication number Publication date
AU2144101A (en) 2001-07-09
CN1301744A (zh) 2001-07-04

Similar Documents

Publication Publication Date Title
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001047996A1 (fr) NOUVEAU POLYPEPTIDE, FAMILLE DE PROTEINE SOD Cu/Zn 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001068689A1 (fr) Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide
WO2001055404A1 (fr) Nouveau polypeptide, alcool deshydrogenase humaine 39, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001085903A2 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier de p5cr, et polynucleotide codant pour ce polypeptide
WO2001048168A1 (fr) Nouveau polypeptide, gamma1-pyroline-5-hydroxy reductase 14, et polynucleotide codant pour ce polypeptide
WO2001072815A1 (fr) Nouveau polypeptide, ferredoxine humaine 12, et polynucleotide codant pour ce polypeptide
WO2001046430A1 (fr) Nouveau polypeptide, peroxydase 12, et polynucleotide codant pour ce polypeptide
WO2001072980A1 (fr) Nouveau polypeptide, peroxydase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001072983A1 (fr) Nouveau polypeptide, peroxydase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001048213A1 (fr) Nouveau polypeptide, peroxydase 11, et polynucleotide codant pour ce polypeptide
WO2001046431A1 (fr) Nouveau polypeptide, catalase 10, et polynucleotide codant pour ce polypeptide
WO2001055417A1 (fr) Nouveau polypeptide, proteine a f-box 65, et polynucleotide codant pour ce polypeptide
WO2001073047A1 (fr) Nouveau polypeptide, superoxyde dismutase humaine a cuivre et a zinc 17, et polynucleotide codant pour ce polypeptide
WO2001049858A1 (fr) NOUVEAU POLYPEPTIDE, η-GLUTAMYL TRANSPEPTIDASE 9, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE
WO2001081382A1 (fr) Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide
WO2001048222A1 (fr) Nouveau polypeptide, unite de repetition hexapeptidique contenant une transferase 11, et polynucleotide codant pour ce polypeptide
WO2001048219A1 (fr) Nouveau polypeptide, proteine de transport phosphorylee 10, et polynucleotide codant pour ce polypeptide
WO2001088153A1 (fr) Nouveau polypeptide, nadh-ubiquinone oxydoreductase humaine 14, et polynucleotide codant ce polypeptide
WO2001046424A1 (fr) Nouveau polypeptide, deshydrogenase nadh 12, et polynucleotide codant pour ce polypeptide
WO2001070994A1 (fr) Nouveau polypeptide, dihydropyridine dicarboxylate deshydrogenase humaine 18, et polynucleotide codant pour ce polypeptide
WO2001075034A2 (fr) Nouveau polypeptide, peroxydase proteine humaine 15, et polynucleotide codant pour ce polypeptide
WO2001087944A1 (fr) Proteine 10, polypeptide humain caracterise en ce qu'il contient la sequence de la gamma glutamyl transpeptidase, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP