Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
  • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae

Definitions

• the current invention relates to the field of detection and identification of clinically important fungi. More particularely, the present invention relates to species specific probes originating from the Internal Transcribed Spacer (ITS) region of rDNA for the detection of fungal species such as Candida albicans, Candida par apsilosis, Candida tropicalis, Candida kefyr, Candida krusei, Candida glabrata, Candida dubliniensis, Aspergillus flavus, Aspergillus versicolor, Aspergillus nidulans, Aspergillus fumigatus, Cryptococcus neoformans and Pneumocystis carinii in clinical samples, and methods using said probes.
• ITS Internal Transcribed Spacer
• Fungi occur in a wide variety of forms, from yeasts (single-celled organisms which reproduce by budding) and moulds (which occur in long filaments known as hyphae) to the dimorphic fungi which have a chameleon-like ability to behave as yeasts in one environment and mould in another.
• Pneumocystis carinii is a major opportunistic infectious agent in immuno- compromised patients, causing pneumonia which has a high mortality rate if the patient is not properly treated (Stringer J.R., 1996). Therefore, timely diagnosis of P. carinii pneumonia
• PCP cardiovascular disease
• Candidoses comprise a range of human opportunistic infections which may occur in either acute or chronic forms.
• Candida infections frequently arise on the mucosal surfaces of the mouth or vagina.
• Chronic hyperplastic candidosis of the oral mucosa is of particular importance since it has been associated with the development of squamous cell carcinoma.
• deeper Candida infections such as esophagitis and endocarditis, may occur, particularly in immunocompromised individuals (Heimdahl et al.,
• Genotypic methods have been used for the detection and typing of Candida strains (Bart- Delabesse et al., 1993; Holmes et al., 1994), but have been used less frequently for differentiation of species.
• Candida species next to the most frequently isolated pathogen C. albicans, are C. glabrata, C krusei and C. tropicalis. The latter species are much less susceptible to classical antifungal drugs.
• Cryptococcus neoformans The genus Cryptococcus contains many species, wherein Cryptococcus neoformans is considered the only human pathogen.
• Initial cryptococcal infection begins by inhalation of the fungus into the lungs, usually followed by hematogeneous spread to the brain and meninges. Involvement of the skin, bones, and joints is seen, and Cryptococcus neoformans is often cultured from the urine of patients with disseminated infection.
• cryptococcosis In patients without HIV infection, cryptococcosis, particularly cryptococcal meningitis, usually is seen in association with underlying conditions such as lupus erythematosis, sarcoidosis, leukemia, lymphomas, and Cushing's syndrome (Chuck et al., 1989).
• Cryptococcosis is one of the defining diseases associated with AIDS. Patients with cryptococcosis and serologic evidence of HIV infections are considered to have AIDS. In nearly 45% of AIDS patients, cryptococcosis was reported as the first AIDS-defming illness. Because none of the representing signs or symptoms of cryptococcal meningitis (such as headache, fever, and malaise) are sufficiently characteristic to distinguish it from other infections that occur in patients with AIDS, determining cryptococcal antigen titers and culturing blood and cerebrospinal fluid are useful in making a diagnosis (Chuck et al., 1989).
• Aspergillosis is now considered the second most common fungal infection requiring hospitalization.
• Aspergillus species are the second most common isolate after Candida species (Goodwin et al., 1992).
• the pathological responses caused by members of the genus Aspergillus vary in severity and clinical course and may occur as both primary and secondary infections (Rinaldi, M.G., 1988).
• IA Invasive aspergillosis
• PCR has been used to detect DNA specific for Aspergillus species in bronchoalveolar lavage (BAL) fluid from patients with IA (Bretage et al, 1995).
• BAL bronchoalveolar lavage
• Laboratory diagnosis of fungal infections is often problematic. Fungi are often difficult to culture from readily accessible samples, such as patient's urine, blood or sputum. And because fungi are ubiquitous in nature, a single positive culture from urine or sputum is of limited clinical value. The possibility of contamination is always a very real consideration when interpreting laboratory results.
• a finding of Aspergillus in sputum for example, is in isolation of limited value and must be evaluated in the context of the patient's clinical signs and symptoms.
• tissue biopsies from lung or brain
• Isolation of yeast - such as Candida - from blood is highly predictive of invasive fungal disease.
• Candida is cultured from blood in less than 20% of patients with disseminated candidiasis.
• the diagnostics of mycoses is an area where there is a great need for new sophisticated techniques.
• the use of specific DNA probes, accompanied by DNA or RNA amplification systems, for the diagnosis of fungal infection may prove useful, and may revolutionize laboratory diagnosis and management of patients with serious fungal disease.
• ITS-2 probes for different Candida species and methods for detection and differentiation after a general amplification step with universal primers ITS3 and ITS4.
• Elie et al. (1998) and several related patent applications (WO98/11257; WO99/06596; US 5,426,027) describe a set of 18 Candida species probes originating from the ITS-2 region.
• Shin et al. (1999) describe detection and differentation of three Candida species in a single reaction tube, using amplification with the universal primers ITS3 and ITS4 and hybridization to ITS-2 probes.
• Botelho and Planta (1994) describe probes for Candida albicans, derived from the ITS-1 or ITS-2 regions. The ITS-2 region probes show a better species specificity.
• Species specific probes originating from the ITS-region of other medically important fungal species such as species belonging to Aspergillus, Cryptococcus, or Pneumocystis have not been described yet.
• methods for simultaneous detection and differentiation of a wide variety of fungal species with clinical importance have not been described yet. Such methods would provide an answer to the need for rapid, highly sensitive and species specific detection of fungal pathogens in clinical samples, allowing a quick installment of efficient treatment regimens, and close monitoring of a patient's progression.
• the present invention describes nucleic acid molecules (oligonucleotide probes) hybridizing specifically with the ITS region of different fungal species with clinical importance. More parti cularely, probes are described hybridizing selectively with the ITS-1 and/or ITS-2 region of several Candida species, Aspergillus species, Cryptococcus neoformans and Pneumocystis carinii. The most preferred probes of the current invention are located in the ITS-1 region, which separates the 18S and 5.8S rRNA genes.
• methods are described for quick, sensitive and specific detection and differentiation of these fungal pathogenic species. In particular, methods are described for the simultaneous detection and differentiation of different fungal species in one single hybridization assay. Such multi parameter detection methods may be particularly useful in the detection of opportunistic infections in patients with impaired immunity systems, such as organ transplant patients, patients receiving intensive anticancer treatments, diabetics or AIDS patients.
• the methods and probes described are useful tools in clinical diagnosis of fungal infections. Moreover, they may be used to monitor the disease and to guide an appropiate antifungal therapy. The probes and methods described may also be used as laboratory research tools to study the different fungal organisms, and their phylogenetic relationship.
• the fungal species detected and identified by the probes and methods of the invention include Candida albicans, Candida parapsilosis, Candida tropicalis, Candida kefyr, Candida krusei, Candida glabrata, Candida dubliniensis, Aspergillus flavus, Aspergillus versicolor, Aspergillus nidulans, Aspergillus fumigatus, Cryptococcus neoformans and Pneumocystis carinii.
• the methods of the current invention allow to detect any of the aforementioned species either alone, or in combinattion with each other, depending on the set of probes applied in the method. All probes are designed such that they are functional under identical hybridization conditions, thus allowing any possible combination.
• the particular set of probes combined in a given method may depend on several ad hoc parameters, such as: the type of sample (respiratory tract, urogenitary tract, gastrointestinal tract, cerebrospinal fluid, blood samples, skin or tissue biopsies%), the clinical symptoms of the patient, the desired level of specificity (genus, species, strain), the type of application (screening assay, confirmation assay, therapy monitoring, research tool for strain characterization, epidemiology).
• ITS Internal Transcribed Spacer
• the probes disclosed in the current invention hybridize to the ITS-1 or ITS-2 region, most preferably to the ITS-1 region.
• the "core sequence” of the probe is the central part, and represents more than 70%, preferably more than 80%, most often more than 90% of the total probe sequence.
• the probes of the current invention specifically hybridize to the fungal species for which they are designed.
• probes are always represented from the 5' end to the 3' end. They are represented as single stranded DNA molecules. It should be understood however that these probes may also be used in their RNA form (wherein T is replaced by U), or in their complementary form.
• the probes of the current invention may be formed by cloning of recombinant plasmids containing inserts comprising the corresponding nucleotide sequences, if need be by cleaving the latter out from the cloned plasmids upon using the adequate nucleases and recovering them, e.g. by fractionation according to molecular weight.
• the probes according to the present invention can also be synthesized chemically, for instance by the conventional phospho-triester method.
• the probes of the current invention have a length from about 10 to about 30 nucleotides. Variations are possible in the length of the probes and it should be clear that, since the central part of the probe is essential for its hybridization characteristics, possible deviations of the probe sequence versus the target sequence may be allowable towards head and tail of the probe, especially when longer probe sequences are used. These variant probes, which may be conceived from the common knowledge in the art, should however always be evaluated experimentally, in order to check if they result in equivalent hybridization characteristics than the original probes.
• isolated means that the oligonucleotides of the current invention are isolated from the environment in which they naturally occur. In particular, it means that they are not anymore part of the genome of the respective fungal species, and thus liberated from the remaining flanking nucleotides in the ITS region of said fungal species.
• nucleic acid sequences can form a perfect base-paired double helix with each other.
• Species specificity is a feature which has to be experimentally determined. Although it may sometimes be theoretically predictable, species specificity can only refer to those non-target organisms which have been tested experimentally.
• primer refers to an isolated single stranded oligonucleotide sequence capable of acting as a point of initiation for synthesis of a primer extension product which is complementary to the nucleic acid strand to be copied.
• the length and the sequence of the primer must be such that they allow to prime the synthesis of the extension products.
• the primer is about 5-50 nucleotides long, more preferably from 10 to 40 nucleotides long.
• oligonucleotides used as primers or probes may also comprise nucleotide analogues such as phosphorothiates (Matsukura et al., 1987), alkylphosphorothiates (Miller et al., 1979) or peptide nucleic acids (Nielsen et al., 1991; Nielsen et al., 1993) or may contain intercalating agents (Asseline et al., 1984).
• sample represents any material possibly containing fungal nucleic acids, which may have to be released from the cells.
• sample refers to a clinical sample, such as a sample taken from blood, from the respiratory tract (sputum, bronchoalveolar lavage (BAL)), from cerebrospinal fluid (CSF), from the urogenital tract
• sample may also refer to a sample of cultured fungal cells, either cultured in liquid medium or on solid growth media. Fungal DNA proesent in said samples may be prepared or extracted according to any of the techniques known in the art.
• ITS Internal Transcribed Spacer region located between the 18S and the 28S rRNA genes in the rRNA operon of the fungal species' nuclear
• the ITS region is subdivided in the ITS-1 region, which separates the 18S and 5.8S rRNA genes, and the ITS-2 region which is found between the 5.8S and 28S rRNA genes.
• the target sequence is that part of the ITS sequence which is fully complementary to the core part of the probe.
• the present invention provides in its most general form for a method to detect and identify fungal pathogenic species in a sample, comprising at least the following steps:
• ITS Internal Transcribed Spacer region
• step (iii) hybridizing the nucleic acids of step (i) or (ii) with at least one probe selected from the following group of species specific oligonucleotide probes: GTCTAAACTTACAACCAATT (SEQ ID NO 1), TGTCACACCAGATTATTACT (SEQ ID NO 2), TATCAACTTGTCACACCAGA (SEQ ID NO 3),
• GGAATATAGCATATAGTCGA (SEQ ID NO 9), GAGCTCGGAGAGAGAC ATC (SEQ ID NO 10),
• CTTCTAAATGTAATGAATGT SEQ ID NO 14
• C ATCTACACCTGTGAACTGT SEQ ID NO 15
• CCGCCATTCATGGCC SEQ ID NO 19
• CGGGGGCTCTCAGCC SEQ ID NO 20
• GAGCCTGAATACCAAATCAG SEQ ID NO 24
• GAGCCTGAATACAAATCAG SEQ ID NO 25
• GGTTTATCAACTTGTCACACCAGA SEQ ID NO 34
• GGTATCAACTTGTCACACCAGATT SEQ ID NO 35
• GTCTGAATATAAAATCAGTCA (SEQ ID NO 43), or variants of said probes, said variants differing from the sequences cited above by the deletion and/or addition of one or two nucleotides at the 5' and/or 3' extremity of the nucleotide sequence, without affecting the species specific hybridization behaviour of the probe, or the RNA equivalents of said probes, wherein T is replaced by U, or the complementary nucleic acids of said probes, and
• step (iv) detecting the hybridization complexes formed in step (iii).
• the probes used in the above described method for detection of fungal pathogens are all hybridizing to the Internal Transcribed Spacer region of fungal species. More particularely, as illustrated further in the examples section (see Table 1), the above-cited probes hybridize selectively to the following target regions: ITS-1 region of Candida albicans (probes represented by SEQ ID NO 1, 2, 3, 33, 34, 35), ITS-1 region of C. parapsilosis (probes represented by SEQ ID NO 4,5), ITS-1 region of C. tropicalis (probes represented by SEQ ID NO 6, 36), ITS-1 region of C. kefyr (probes represented by SEQ ID NO 7, 8), ITS-1 region of C.
• ITS-1 region of Candida albicans probes represented by SEQ ID NO 1, 2, 3, 33, 34, 35
• ITS-1 region of C. parapsilosis probes represented by SEQ ID NO 4,5
• ITS-1 region of C. tropicalis probes represented by SEQ ID NO 6, 36
• variants of the probes encompasses probes represented by a variant sequence which differs from any of the sequences cited above by the deletion and/or addition of 1 or 2 nucleotides at the 3 ' and/or 5 ' extremity of the probe sequence, in so far as such deletion or addition does not change the species specific character of the respective probe. It will be understood that the addition of 1 or 2 nucleotides at the extremities of the probes will usually be done in accordance with the sequence flanking the target sequence in the ITS region from which the probe is isolated. This means that one shall normally not choose "any" nucleotide to extend the probe sequence, but only those nucleotides which are flanking the probe sequence in the ITS region.
• the information about the flanking sequences of the probes can easily be obtained by aligning the probe sequence to the ITS sequence.
• the ITS sequence itself may be obtained by sequencing the ITS region, after cloning or e.g. PCR amplification of the ITS region with fungal universal primer pairs, or may be retrieved from publicly available sources.
• the above-described method may be applied for the detection of one single fungal species, so called “single analyte detection”, e.g. in microtiter plates, or for the detection of several fungal species simultaneously, so called “multi parameter detection”, e.g. in a Line Probe Assay (LiPA).
• the probes described have been selected such that they may all be functional (i.e. show the desired species specificity) under the same hybridization and wash conditions. This allows the method to be used for the simultaneous detection and differentiation of several fungal species in one single hybridization assay.
• the term "fungal universal primer pair” means that the primer pair amplifies the Internal Transcribed Spacer region of most, if not all, fungal species.
• the sequences of "fungal universal primer pairs” are phylogenetically conserved in order to enable amplification within different species of fungi. They are located in the rRNA genes flanking the ITS region, i.e. in the 18S, 5.8S or 28S rRNA genes. Amplification of the full ITS region, the ITS-1 or the ITS-2 region may be envisaged.
• "Fungal universal primer pairs” suitable for the methods described in the current invention have been described by a.o. White et al. (1990).
• the method described above includes an amplification step using a fungal universal primer pair which is chosen from the following group of primer pairs, as described by White et al. (1990):
• ITS5 forward: GGAAGTAAAAGTCGTAACAAGG and ITS4 (reverse): TCCTCCGCTTATTGATATGC,
• ITS5 forward: GGAAGTAAAAGTCGTAACAAGG and ITS2 (reverse): GCTGCGTTCTTCATCGATGC,
• ITS1 forward: TCCGTAGGTGAACCTGCGG and ITS4 (reverse): TCCTCCGCTTATTGATATGC,
• ITS1 forward: TCCGTAGGTGAACCTGCGG and ITS2 (reverse): GCTGCGTTCTTCATCGATGC,
• ITS3 forward: GCATCGATGAAGAACGCAGC and ITS4 (reverse): TCCTCCGCTTATTGATATGC.
• the full ITS region may be amplified using a combination of the ITS1 and ITS4 primer, or the ITS5 and ITS4 primer.
• the ITS-1 region may be amplified using a combination of the ITS1 and ITS2 primer, or the ITS5 and ITS2 primer, while the ITS-2 region may be amplified using a combination of the ITS3 and ITS4 primer.
• amplification of the ITS-1 region is envisaged, and probes will be chosen from the ITS-1 region.
• the current invention shows that methods based on amplification of and hybridization to the ITS-1 region usually show a higher sensitivity than methods based on amplification of and hybridization to the full ITS region, or the ITS-2 amplified region.
• the present invention furthermore shows that identification and differentiation of most, if not all, of the different fungal species listed can be accomplished by using probe sequences originating from the ITS-1 region only.
• the present invention provides for a method for the detection and identification of fungal pathogenic species in a sample, comprising at least the following steps:
• step (ii) amplifying the ITS-1 region of said nucleic acids with at least one of the following primer pairs according to White et al. (1990): (ITS5 and ITS2) or (ITSl and ITS2), (iii) hybridizing the nucleic acids of step (i) or (ii) with at least one probe selected from the following group of species specific oligonucleotide probes: GTCTAAACTTACAACCAATT (SEQ ID NO 1), TGTCACACCAGATTATTACT (SEQ ID NO 2), TATC AACTTGTC AC ACCAGA (SEQ ID NO 3),
• GGAATATAGCATATAGTCGA (SEQ ID NO 9), GAGCTCGGAGAGACATC (SEQ ID NO 10), GTTTTGTTCTGGACAAACTT (SEQ ID NO 13), CTTCTAAATGTAATGAATGT (SEQ ID NO 14), C ATCTACACCTGTGAACTGT (SEQ ID NO 15),
• GGACAGTAGAGAATATTGG (SEQ ID NO 16), GTTTACTGTACCTTAGTTGCT (SEQ ID NO 18), CCGCCATTCATGGCC (SEQ ID NO 19), CGGGGGCTCTCAGCC (SEQ ID NO 20), CCTCTCGGGGGCGAGCC (SEQ ID NO 21 ),
• GGTTATAACTAAACCAAACTTTTT SEQ ID NO 36
• GGGAATATAGCATATAGTCGA SEQ ID NO 37
• GAACTCTGTCTGATCTAGT SEQ ID NO 42
• GTCTGAATATAAAATCAGTCA SEQ ID NO 43
• variants of said probes said variants differing from the sequences cited above by the deletion and/or addition of one or two nucleotides at the 5' and/or 3' extremity of the nucleotide sequence, without affecting the species specific hybridization behaviour of the probe, or the RNA equivalents of said probes, wherein T is replaced by U, or the complementary nucleic acids of said probes, and
• step (iv) detecting the hybridization complexes formed in step (iii).
• Amplification of the nucleic acids may be carried out according to any method known in the art, including the polymerase chain reaction (PCR; Saiki et al., 1988), ligase chain reaction (LCR; Landgren et al., 1988), nucleic acid sequence-based amplification (NASBA; Guatelli et al., 1990), transcription-based amplification system (TAS; Kwoh et al., 1989), strand displacement amplification (SDA; Duck, 1990) or amplification by means of Q ⁇ replicase (Lomeli et al., 1989) or any other suitable method to amplify nucleic acid molecules known in the art.
• Amplification of the nucleic acids to be detected has of course the advantage of increasing the sensitivity of detection.
• ITS region of several fungal species can be combined with species specific hybridization.
• Amplification also allows the incorporation of a label into the amplified nucleic acids, which opens different ways of detecting the hybridization complexes formed, and which may increase the sensitivity of detection again.
• Labelling may be carried out by the use of labelled nucleotides incorporated during the polymerase step of the amplification such as illustrated by e.g. Bej et al. (1990) or labelled primers, or by any other method known to the person skilled in the art.
• the nature of the label may be isotopic ( 32 P, 35 S, etc.) or non-isotopic (biotin, digoxigenin, fluorescein etc.).
• the probes of the invention may be labelled.
• Hybridization of the nucleic acids is carried out according to standard methods.
• stringent hybridization conditions are used, i.e. conditions enabling differentiation by hybridization between nucleic acids which differ by only one single nucleotide.
• hybridization buffer and hybridization temperature any other combination of hybridization buffer and hybridization temperature resulting in the same degree of stringency is of course also suitable for the probes of the current invention.
• the design of hybridization conditions to meet certain stringency criteria is common knowledge in the art of hybridization.
• Hybridization may be carried out in solution or on a solid support, with either the probes being immobilized to the solid support or the nucleic acids to be detected being immobilized. Immobilization of the nucleic acids to a solid support may be done covalently, or using non-covalent binding forces.
• the oligonucleotide probes of the invention are immobilized to a solid support, and reverse hybridization is carried out.
• solid support in the current invention refers to any substrate to which an oligonucleotide probe can be coupled, provided that its hybridization characteristics are retained and provided that the background of hybridization remains low.
• the solid support will be a microtiter plate, a membrane (e.g. nylon or nitrocellulose) or a microsphere (bead).
• a membrane e.g. nylon or nitrocellulose
• a microsphere bead
• modifications may encompass homopolymer tailing, coupling with different reactive groups such as aliphatic groups, NH2 groups, SH groups, carboxylic groups, or coupling with biotin, haptens or proteins.
• the oligonucleotides used in the above described methods of detection are immobilized to a solid support by means of a homopolymer tailing sequence (e.g. polyT) which is added at the 3' or 5' extremity of the probe.
• a homopolymer tailing sequence e.g. polyT
• Said tailing may be done during chemical synthesis of the oligonucleotide, usually resulting in a 5' polyT tail, or afterwards, e.g. via enzymatic tailing using terminal deoxynucleotidyl transferase (Pharmacia), resulting in a 3' polyT tail.
• Detection of the hybridization complexes formed may be done according to any methods known in the art, the type of detection of course depending on the type of label used.
• streptavidin conjugated detection agents may be used, such as e.g. streptavidin conjugated alkaline phosphatase, causing a blue precipitation signal, or streptavidin conjugated horse raddish peroxidase, causing a color reaction in solution.
• the invention provides for a LiPA (Line Probe Assay) method for detecting and identifying fungal pathogens in a sample, as shown below in the examples section.
• LiPA is a reverse hybridization assay using oligonucleotide probes immobilized as parallel lines on a solid support strip (as described by Stuyver et al. (1993) and WO 94/12670). LiPA is particularly advantageous since it is fast and simple to perform. Moreover, this method is amenable to automation (Auto-LiPA, Irmogenetics, Zwijnaarde, Belgium) and thus particularly suitable for clinical settings where multiple samples can be processed simultaneously. It is to be understood however, that any other type of hybridization assay or format using any of the selected probes as described further, is also covered by the present invention.
• the method described above may be applied for the simultaneaous detection and differentiation of fungal pathogens present in a particular type of sample.
• the methods of the invention may comprise detection and differentiation of Candida species, Aspergillus species, and Cryptococcus species.
• the methods of the current invention may comprise detection and differentiation of Candida species, most often species other than Candida albicans, Aspergillus species, Cryptococcus species and Pneumocystis carinii.
• the methods of the invention may comprise detection and differentiaton of Candida species, Aspergillus species, Cryptococcus species and Pneumocystis carinii.
• the methods of the invention may comprise detection and differentiation of Aspergillus species, Candida species, Cryptococcus species.
• the methods of the invention enable detection and differentiation of different types of Candida species.
• the current invention provides for a method as described above, wherein said fungal pathogen is a Candida species, and wherein the probes of step (iii) are chosen from among SEQ ID NO 1, 2, 3, 33, 34 and 35 for C. albicans, SEQ ID NO 4 and 5 for C. parapsilosis, SEQ ID NO 6 and 36 for C. tropicalis, SEQ ID NO 7 and 8 for C. kefyr, SEQ ID NO 9 and 37 for C. krusei, SEQ ID NO 10 for C. glabrata, and SEQ ID NO 11, 12 , 13 and 38 for C. dubliniensis.
• the probes of step (iii) are chosen from among SEQ ID NO 1, 2, 3, 33, 34 and 35 for C. albicans, SEQ ID NO 4 and 5 for C. parapsilosis, SEQ ID NO 6 and 36 for C. tropicalis, SEQ ID NO 7 and 8 for C. kefyr, SEQ ID NO 9 and 37 for C. krusei
• the current invention provides for a method to detect Candida albicans in a sample, said method including
• the current invention provides for a method to detect Candida parapsilosis in a sample, said method including (i) hybridizing the nucleic acids present in the sample to at least one of the probes represented by SEQ ID NO 4 and 5, and
• the current invention provides for a method to detect Candida tropicalis in a sample, said method including
• the current invention provides for a method to detect Candida kefyr in a sample, said method including (i) hybridizing the nucleic acids present in the sample to at least one of the probes represented by SEQ ID NO 7 and 8, and
• the current invention provides for a method to detect Candida krusei in a sample, said method including
• the current invention provides for a method to detect Candida glabrata in a sample, said method including
• the current invention provides for a method to detect Candida dubliniensis in a sample, said method including
• the current invention provides for a method to detect and identify fungal pathogenic species as described above, wherein said fungal pathogen is an Aspergillus species, and wherein the probes of step (iii) are chosen from among SEQ ID NO 18, 19 , 20 and 42 for A. flavus, SEQ ID NO 21 and 43 for A. versicolor, SEQ ID NO 22, 23, 24 and 25 for A. nidulans, and SEQ ID NO 26, 27, 40 and 41 for A. fumigatus.
• the current invention provides for a method to detect Aspergillus flavus in a sample, said method including
• the current invention provides for a method to detect Aspergillus versicolor in a sample, said method including
• the current invention provides for a method to detect Aspergillus nidulans in a sample, said method including (i) hybridizing the nucleic acids present in the sample to at least one of the probes represented by SEQ ID NO 22, 23, 24 and 25, and
• the current invention provides for a method to detect Aspergillus fumigatus in a sample, said method including
• the present invention provides for a method to detect Cryptococcus neoformans in a sample, including
• the present invention provides for a method to detect Pneumocystis carinii in a sample, including (i) hybridization of the nucleic acids present in the sample to at least one of the probes represented by SEQ ID NO 28, 29, 30, 31 and 32, and
• the oligonucleotide probes used in the above described methods of detection are immobilized to a solid support.
• the current invention provides for a method for detection and identification of fungal pathogens in a sample as described above, whereby the amplification of step (ii) is mandatory, and includes the labelling of the nucleic acids to be detected.
• the current invention provides for a method for the simultaneous detection and differentiation of at least two fungal pathogenic species in one single assay, including
• step (iii) hybridizing the nucleic acids of step (i) or (ii) with at least two of the following species specific oligonucleotide probes: GTCTAAACTTACAACCAATT (SEQ ID NO 1)
• TGTCACACCAGATTATTACT SEQ ID NO 2
• TATCAACTTGTCACACCAGA SEQ ID NO 3
• GTAGGCCTTCTATATGGG SEQ ID NO 4
• TGCCAGAGATTAAACTCAAC SEQ ID NO 5
• GGTTATAACTAAACCAAACT SEQ ID NO 6
• TTTTCCCTATGAACTACTTC AGAGCTCGTCTCTCCAGT (SEQ ID NO 8) GGAATATAGCATATAGTCGA (SEQ ID NO 9) GAGCTCGGAGAGACATC (SEQ ID NO 10) TAGTGGTATAAGGCGGAGAT (SEQ ID NO 11 )
• GAACTCTGTCTGATCTAGT SEQ ID NO 42
• GTCTGAATATAAAATCAGTCA SEQ ID NO 43
• variants of said probes said variants differing from the sequences cited above by the deletion and/or addition of one or two nucleotides at the 5' and/or 3' extremity of the nucleotide sequence, without affecting the species specific hybridization behaviour of the probe, or the RNA equivalents of said probes, wherein T is replaced by U, or the complementary nucleic acids of said probes, wherein said probes have been immobilized to a solid support on specific locations,
• the probes of the invention are immobilized on a solid support on specific locations, e.g. as discrete parallel lines or spots on a membrane strip, or in different wells of a microtiter plate. Each location contains a determined amount of at least one species specific probe, and can therefore be considered as a "species specific location”. If necessary, several probes hybridizing to the same species may be combined on one single location.
• the immobilization of the probes to the solid support occurs via the non-covalent binding of a polyT tail which is attached to one of the extremities of the probe. If enzymatic tailing occurs, the polyT tail is added at the 3' end. If synthetic tailing (SGS) occurs, the polyT tail is usually added at the 5' end. Both types of tailing may be applied to the probes of the invention. If a different type of tailing results in a different hybridization behaviour of the probe, the oligonucleotide sequence may have to be adapted slightly. Examples of such slight variations are illustrated in Table 1 furtheron, where a certain type of probe may be mentioned twice: e.g. Calb2 (SEQ ID NO 2) and Calb2 (SGS) (SEQ ID NO 33), the former probe mentioned being functional with a 3' polyT tail, the latter probe being functional with a 5' polyT tail.
• the current invention also provides for an isolated oligonucleotide molecule having a nucleotide sequence represented by any of the sequences
• SEQ ID NO 1 to 43 or variants of said probes, said variants differing from the sequences cited above by the deletion and/or addition of one or two nucleotides at the 5' and/or 3' extremity of the nucleotide sequence, without affecting the species specific hybridization behaviour of the probe, or the RNA equivalents of said probes, wherein T is replaced by U, or the complementary nucleic acids of said probes.
• Preferred nucleic acids of the invention consist of a nucleotide sequence represented by any of the sequences SEQ ID NO 1-43.
• addition and/or deletion of 1 or 2 nucleotides at the 5' and/or 3' extremity may result in functional equivalent molecules, which are also encompassed by the current invention.
• the current invention provides for an isolated oligonucleotide molecule as described above for use as a species specific primer or probe in the detection of one of the following fungal pathogenic species: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida kefyr, Candida krusei, Candida glabrata, Candida dubliniensis, Aspergillus flavus, Aspergillus versicolor, Aspergillus nidulans, Aspergillus fumigatus, Cryptococcus neoformans or Pneumocystis carinii.
• Candida albicans Candida parapsilosis, Candida tropicalis, Candida kefyr, Candida krusei, Candida glabrata, Candida dubliniensis, Aspergillus flavus, Aspergillus versicolor, Aspergillus nidulans, Aspergillus fumigatus, Cryptococcus neoformans or Pneumocy
• the current invention also provides for a method as described above, wherein the sample is a blood sample, and wherein step (i) includes incubation of the blood sample with lysis buffer (10 mM Tris-HCl, ph 7.5, 10 mM
• FIGURE LEGEND Fig. 1 Hybridization results of full ITS, ITS-1 or ITS-2 amplicons to LiPA strips containing species-specific probes.
• neoformans 14: full ITS, 15: ITS-1) lanes 16,17 A. fumigatus (16: full ITS, 17: ITS-1) lanes 18 : A. nidulans (full ITS) lane 19 : A. flavus (full ITS) lane 20 : oligo-dA-bio (hybridizes to (poly-T) tail of the immobilized probes)
• Fig. 2 LiPA evaluation on clinical isolates lanes 1-15: different clinical isolates, identified as lanes 1-4, 6, 7, 10: C. albicans lane 5: C. glabrata lane 8, 9, 11, 12, 14, 15: A. fumigatus lane 13: A. flavus rows: see figure 1 Table 1 : ITS probe sequences for fungal detection and differentiation
• Table 2 Hybridization results obtained with a selection of the probes of the invention applied on a wide variety of fungal species.
• a rapid extraction method based on physical disruption of the fungal cells followed by crude separation of the cell debris from the genomic DNA was used for the production of DNA from single colonies of yeasts (Roberts, 1997).
• a more elaborate sample preparation method based on a combination of beadbeating and lysis with a GuSCN buffer followed by capturing of the DNA on silica was used.
• PCR amplification 20 - 50 ng genomic DNA or 5 ⁇ l of DNA extracted by the rapid extraction procedure described above were included in the PCR reaction.
• PCR reactions contained per 100 ⁇ l reaction : 200 ⁇ M of each dNTP's, 1 x Taq buffer, 3 mM MgC12, 15% glycerol, 40 pmol of each biotinylated primer (ITS5 and ITS4 for amplification of the full ITS region, ITS5 and ITS2 for amplification of ITS-1 only), 1 U Uracil N glycosylase and 2.5 U Taq polymerase.
• PCR thermal cycling conditions were the following : 95°C for 10 min for 1 cycle (hotstart), 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min. for 30 cycles, and a final extension at 72°C for 10 min. for 1 cycle.
• Chemically tailed probes may need a small modification (deletion and/or addition of a few nucleotides at one or both of the extremities) of the probe sequence as compared to the enzymatically tailed probe, in order to show comparable hybridization characteristics.
• the chemically tailed modified probes are indicated with the extension "(SGS)" in Table 1 and, if the modification is an addition of nucleotides, it is indicated in bold.
• Probes were dissolved in 6x SSC at their respective specific concentrations and applied as horizontal lines on membrane strips. Biotinylated DNA was applied alongside as positive control. The oligonucleotides were fixed to the membrane by baking at 80°C for 12 hours. The membrane was than sliced into 4mm strips.
• Equal volumes (5 to 10 ⁇ l) of the biotinylated PCR fragments and of the denaturation solution (400 mM NaOH/lOmM EDTA) were mixed in test troughs and incubated at room temperature for 5 min. Subsequently, 2 ml of the 50°C prewarmed hybridization solution (2x SSC/ 0.1% SDS) was added followed by the addition of one strip per test trough. Hybridization occurred for 1 hour at 50°C in a closed shaking water bath. The strips were washed twice with 2 ml of stringent was solution (2x SSC/ 0.1 % SDS) at room temperature for 20 sec, and once at 50°C for 15 min.
• strips were rinsed two times with 2 ml of the Innogenetics standard Rinse Solution (RS). Strips were incubated on a rotating platform with the alkaline phosphatase-labelled streptavidin conjugate, diluted in standard Conjugate Solution (CS) for 3 min. at room temperature. Strips were then washed twice with 2 ml of RS and once with standard Substrate Buffer (SB), and the colour reaction was started by adding BCIP and NBT to the SB. After 30 min. at room temperature, the colour reaction was stopped by replacing the colour compounds by distilled water. Immediately after drying, the strips were interpreted.
• RS Innogenetics standard Rinse Solution
• Species-specificity occurs when all the strains belonging to the respective fungal species show positive hybridization (+) and none of the other fungal species tested shows cross reaction with the species-specific probes under the hybridization conditions used.
• Fig. 1 represents an example of LiPA strips.
• ITS5/ITS2 amplifying the ITS-1 region only
• ITS5/ITS4 amplifying the full ITS region. Amplicons generated were visualised on ethidium-bromide stained gels and hybridized to LiPA strips containing the appropriate probes.
• Table 3 summarizes the detection limits obtained with dilution series of genomic DNA isolated from the following organisms : C. albicans, C neoformans and A. fumigatus.
• LiPA When hybridized to probes immobilized on LiPA strips (see e.g. figure 1), it is clearly seen that amplification of the ITS-1 region (smaller amplicon) results in a more sensitive detection limit compared to full ITS amplification.
• LiPA was able to specifically detect C. albicans DNA down to 100 fg, Cryptococcus neoformans DNA down to 1 pg, and A. fumigatus DNA down to 50 fg.
• ITS-1 amplification was performed using primer combination ITS5 + ITS2 and amplification of the full ITS region was performed using ITS5 and ITS4 primers. 3.3. Results
• 200 ⁇ l, 1 ml and 5 ml blood samples were inoculated with decreasing concentrations of C. albicans cells (10 5 -10' cells).
• the inoculated blood samples were pre-treated to lyse and remove the red blood cells.
• Blood samples of 200 ⁇ l were lysed in 800 ⁇ l of lysis buffer (10 mM Tris-HCl, [pH 7.5], 10 mM EDTA, 50 mM NaCl) at room temperature for 10 minutes and centrifuged at 13,000 rpm for 5 min, the supernatant discarded and the pellet was resuspended in 100 ⁇ l of sterile H 2 0.
• lysis buffer 10 mM Tris-HCl, [pH 7.5], 10 mM EDTA, 50 mM NaCl
• PCR amplification of the ITS region was performed in a final volume of 100 ⁇ l with 20 ⁇ l of DNA extracted from the blood samples (for DNA extracted from 5 ml blood samples, 20 ⁇ l of a 1/10 dilution is included in the PCR reaction) added to the PCR reaction containing a final concentration 0.25 mM deoxynucleotidetriphosphates (DU/dNTP's[2:l]), lx reaction buffer (Promega, USA), 3 mM MgCl , 1 unit Uracil DNA glycosylase (Longo et al.
• PCR amplification was performed in a TouchdownTM Thermocycler (Hybaid, UK), with the following cycling conditions: 37 °C for 10 minutes for 1 cycle followed by 94 °C for 2 minutes for 1 cycle followed by 40 cycles of DNA denaturation at 94 °C for 30 seconds, primer annealing at 55 °C for 30 seconds and DNA extension at 72 °C for 2 minutes, with a final extension cycle at 72 °C for 10 minutes.
• 50 ng of C. albicans DNA extracted as described above was included as a positive control in the PCR reaction along with a no template negative control in each PCR run.
• the assay technology may be a little cumbersome as the post-PCR hybridisation of the amplicons to the species-specific probes is performed in microcentrifuge tubes and then transferred to a micro titre-plate for the detection step.
• a more recent publication (Hee Shin et al. 1999) describes a very elegant assay for the detection of up to three Candida species in a single reaction tube by using DNA probes labelled with different fluorescent tags. This assay represents a two-step system, with the PCR amplification and post-PCR detection being performed in a single tube and reducing the assay time from 7 hours to 5 hours. The authors describe the application of the assay technology for the detection of Candida in blood culture bottles positive for the presence of fungal infection.
• the PCR-LiPA assay described in the current invention is also a multi-parameter test as a single LiPA membrane includes DNA probes for the detection of a wide range of different Candida species. It therefore has the potential to detect and identify mixed Candida infections. Moreover, a universal approach for the preparation of fungal DNA from Candida, Cryptococcus and Aspergillus ssp. in blood and/or respiratory specimens has been developed, as described above (see 4.1).
• Sobczak H.. 1985. A simple disc-diffusion test for differentation of yeast species. J. Med. Microbiol. 20:307-316.

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Analytical Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Health & Medical Sciences (AREA)
• Biotechnology (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Immunology (AREA)
• Mycology (AREA)
• Microbiology (AREA)
• Molecular Biology (AREA)
• Botany (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Biochemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Priority Applications (8)

Applications Claiming Priority (4)

Related Child Applications (3)

Publications (2)

Family

ID=46506639

Family Applications (1)

Country Status (7)

Cited By (15)

Families Citing this family (30)

Family Cites Families (21)

• 2000
  • 2000-05-24 JP JP2001500809A patent/JP4963765B2/ja not_active Expired - Lifetime
  • 2000-05-24 WO PCT/EP2000/004714 patent/WO2000073499A2/en not_active Ceased
  • 2000-05-24 AU AU55255/00A patent/AU782305B2/en not_active Ceased
  • 2000-05-24 CA CA2374878A patent/CA2374878C/en not_active Expired - Lifetime
  • 2000-05-24 EP EP00940266.0A patent/EP1185702B1/en not_active Expired - Lifetime
  • 2000-05-24 ES ES00940266.0T patent/ES2621547T3/es not_active Expired - Lifetime
  • 2000-09-15 US US09/662,462 patent/US6858387B1/en not_active Expired - Lifetime
• 2004
  • 2004-10-19 US US10/967,254 patent/US7741461B2/en not_active Expired - Fee Related
• 2012
  • 2012-01-26 JP JP2012014151A patent/JP2012120535A/ja active Pending

Also Published As

Similar Documents

Legal Events