WO2000023116A1 - Adeno-associated vectors for expression of factor viii by target cells - Google Patents

Adeno-associated vectors for expression of factor viii by target cells Download PDF

Info

Publication number
WO2000023116A1
WO2000023116A1 PCT/US1999/024495 US9924495W WO0023116A1 WO 2000023116 A1 WO2000023116 A1 WO 2000023116A1 US 9924495 W US9924495 W US 9924495W WO 0023116 A1 WO0023116 A1 WO 0023116A1
Authority
WO
WIPO (PCT)
Prior art keywords
factor viii
aav
vector
factor
recombinant adeno
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1999/024495
Other languages
English (en)
French (fr)
Inventor
Linda B. Couto
Peter C. Colosi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Avigen Inc
Original Assignee
Avigen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=27379851&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2000023116(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to BR9914643-6A priority Critical patent/BR9914643A/pt
Priority to IL14272199A priority patent/IL142721A0/xx
Priority to EP99955065A priority patent/EP1124583A4/en
Priority to MXPA01004067A priority patent/MXPA01004067A/es
Priority to KR1020017004962A priority patent/KR20010082234A/ko
Application filed by Avigen Inc filed Critical Avigen Inc
Priority to CA002348068A priority patent/CA2348068A1/en
Priority to AU11256/00A priority patent/AU757688B2/en
Priority to JP2000576889A priority patent/JP2002527493A/ja
Publication of WO2000023116A1 publication Critical patent/WO2000023116A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/36Blood coagulation or fibrinolysis factors
    • A61K38/37Factors VIII
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/42Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/80Vector systems having a special element relevant for transcription from vertebrates
    • C12N2830/85Vector systems having a special element relevant for transcription from vertebrates mammalian

Definitions

  • the present invention relates to AAV vectors suitable for hemophilia gene therapy. More particularly, these AAV vectors are suitable for delivering nucleic acids encoding Factor VIII into a recipient subject suffering from hemophilia A, such that the subject's blood is able to clot.
  • Hemophilia is a genetic disease characterized by a blood clotting deficiency.
  • hemophilia A classic hemophilia, Factor VTII deficiency
  • an X-chromosome-linked genetic defect disrupts the gene encoding Factor Nm, a plasma glycoprotein, which is a key component in the blood clotting cascade.
  • Human Factor NDI is synthesized as a single chain polypeptide, with a predicted molecular weight of 265 kDa.
  • the Factor NIII gene codes for 2351 amino acids, and the protein has six domains, designated from the amino to the carboxy terminus as A1-A2-B-A3-C1-C2 (Wood et al., Nature 312:330 [1984]; Vehar et al, Nature 312:337 [1984]; and Toole et al, Nature 312:342 [1984]).
  • Human Factor NIII is processed within the cell to yield a heterodimer primarily comprised of a heavy chain of 200 kDa containing the Al, A2, and B domains and an 80 kDa light chain containing the A3, Cl, and C2 domains (Kaufman et al, J. Biol.
  • the disease is relatively rare, afflicting approximately one in 10,000 males. Hemophilia in females is extremely rare, although it may occur in female children of an affected father and carrier mother, as well as in females with X-chromosomal abnormalities (e.g., Turner syndrome, X mosaicism, etc.).
  • the severity of each patient's disease is broadly characterized into three groups ⁇ "mild,” “moderate,” and “severe,” depending on the severity of the patient's symptoms and circulating Factor NIII levels. While normal levels of Factor NIII range between 50 and 200 ng/mL plasma, mildly affected patients have 6-60% of this value, and moderately affected patients have 1-5% of this value. Severely affected hemophiliacs have less than 1% of normal Factor VIII levels.
  • hemophiliacs While hemophiliacs clearly require clotting factor after surgery or severe trauma, on a daily basis, spontaneous internal bleeding is a greater concern. Hemophiliacs experience spontaneous hemorrhages from early infancy, as well as frequent spontaneous hemarthroses and other hemorrhages requiring clotting factor replacement. Without effective treatment, chronic hemophilic arthropathy occurs by young adulthood. Severely affected patients are prone to serious hemorrhages that may dissect through tissue planes, ultimately resulting in death due to compromised vital organs.
  • Hematomas are commonly observed in moderately and severely affected hemophiliacs. In these patients, hematomas have a tendency to progressively enlarge and dissect in all directions. Some of these hematomas expand locally, resulting in local compression of adjacent organs, blood vessels, and nerves. A rare, yet often fatal, complication of abdominal hematomas is the perforation and drainage of the hematoma into the colon, resulting in infection and septicemia. Intracranial and/or extracranial hemorrhage also represent very dangerous bleeding situations.
  • pharyngeal and retropharyngeal hematomas may enlarge and obstruct the airway, sometimes resulting in a life-threatening situation that requires administration of a sufficient dose of Factor NIII concentrate to normalize the Factor NIII level.
  • hemarthroses are commonly observed in hemophiliacs, with bleeding into the joint accounting for approximately 75% of hemophilic bleeding. Repeated hemorrhaging into the joints eventually results in extensive destruction of articular cartilage, synovial hyperplasia, and other reactive changes in adjacent tissues and bone. A major complication of repeated hemarthroses is joint deformity, which is often accompanied by muscle atrophy and soft tissue contractures; osteoporosis and cystic areas in the subchondral bone may also develop, along with progressive loss of joint space.
  • hemophiliacs Other symptoms are often observed in hemophiliacs, including hematuria and mucous membrane bleeding. Hematuria is experienced by virtually all severely affected hemophiliacs sometime during their lifetimes, and mucous membrane bleeding is common in hemophiliacs. Bone cysts (pseudotumors) are rare, but dangerous complications of hemophilic bleeding. In many of these cases, immediate treatment is necessary. In the early 1980s, many severely affected hemophiliacs were treated with
  • Factor VIII concentrate about three times weekly. Unfortunately, these concentrates transmitted viruses, such as hepatitis B and/or C, and human immunodeficiency virus (HTV). In the United States and Western Europe, at least 75% of Factor VIII concentrate recipients have been reported to have anti-HIV antibodies (See, Schrier and Leung, supra). Some of these patients also developed HIV-associated immune thrombocytopenia, a very serious complication in hemophiliacs. In spite of antiviral therapy (e.g., with zidovudine and pentamidine prophylaxis), which has tended to slow disease progression, full-blown AIDS (acquired immunodeficiency syndrome) occurs at an inexorable rate in hemophiliacs infected with HIV.
  • antiviral therapy e.g., with zidovudine and pentamidine prophylaxis
  • full-blown AIDS asquired immunodeficiency syndrome
  • hemophiliacs for hemophiliacs, the availability of viral-free concentrates and recombinant Factor VIII, while significant, is but part of the solution. In order to prevent spontaneous internal bleeding episodes, patients suffering from hemophilia A must consistently have serum Factor VIII levels of about 1%, and preferably 5%. Currently, the cost of viral-free concentrates and recombinant Factor VIII make it prohibitively expensive to administer the clotting factor prophylactically or on a maintenance basis. Indeed, most hemophiliacs in the U.S. do not receive recombinant Factor VIII therapy on a maintenance basis, but only receive it prior to activities or events which might cause bleeding (e.g., surgery), or as a treatment for spontaneous bleeding.
  • the present invention provides improved viral vectors suitable for gene therapy to treat hemophilia.
  • the present invention provides AAV vectors and methods for treating hemophilia A by delivering nucleic acids coding for the clotting protein Factor VIII.
  • the present invention also provides pharmaceutical compositions comprising such AAV vectors, as well as methods for making and using the vectors.
  • the present invention is particularly suited for use in hemophilia A gene therapy.
  • at least one AAV vector containing a nucleic acid molecule encoding Factor VIII is operably linked to control sequences that direct expression of Factor VIII in a suitable recipient cell.
  • the AAV vectors are then introduced into a recipient cell of the subject, under conditions that result in expression of Factor VIII.
  • the subject therefore, has a continuous supply of Factor VIII available to clot blood during bleeding episodes.
  • the present invention be limited to specific embodiments. Many different forms of recombinant Factor VIII have been made and tested both in vitro and in vivo, using a variety of different control and regulatory sequences. Any DNA sequence coding for biologically active Factor VIII can be expressed using the AAV vectors and methods taught in the present invention. Therefore, the present invention encompasses any AAV vector or vectors containing Factor VIII sequences that produce biologically active Factor VIII protein in vitro or in vivo.
  • the AAV vector contains the first 57 base pairs of the Factor VIII heavy chain which encodes the 10 amino acid signal sequence, as well as the human growth hormone (hGH) polyadenylation sequence.
  • the vector also contains the Al and A2 domains, as well as 5 amino acids from the N-terminus of the B domain, and/or 85 amino acids of the C- terminus of the B domain, as well as the A3, Cl, and C2 domains.
  • the nucleic acids coding for Factor VIII heavy chain and light chain were cloned into a single vector separated by 42 nucleic acids coding for 14 amino acids of the B domain.
  • the present invention also provides methods for administering the above- described vectors.
  • the present invention encompass methods suitable for delivery of the AAV vectors to the livers of recipient patients or test animals. It is not intended that the present invention be limited to any particular route of administration.
  • the AAV vectors of the present invention are successfully administered via the portal or arterial vasculature.
  • Figure 1 provides a schematic representation of the Factor VIII protein.
  • Figure 2 provides a schematic representation of a B-domain deleted form of Factor VDI protein.
  • Figure 3 provides a schematic representation of a B-domain deleted Factor VIII AAV construct (AAV-F8-1) from internal terminal repeat (ITR to ITR), including control sequences.
  • Figure 4 provides a schematic representation of a B-domain deleted Factor VIII AAV construct (PVM4JC-F8AB) from internal terminal repeat (ITR to ITR), including control sequences.
  • Figure 5 provides the sequence of pAAV-F8-l (ITR to ITR), with the plasmid backbone omitted.
  • Figure 6 provides the sequence of pVm4JcF8 ⁇ B (ITR to ITR), with the plasmid backbone omitted.
  • Figure 7 provides a map of rAAV-hFVIII-HC and rAAV-hFVIII-LC vectors.
  • Figure 8 provides a graph demonstrating the expression of various human FVIII constructs in mouse plasma.
  • Figure 9 provides Southern blot analyses of liver DNA using probes specific for (A) the light chain of hFVIII, and (B) the heavy chain of hFVHI.
  • Figure 10 provides Southern blot analyses of DNA from different tissues using probes specific for (A) the light chain of hFVIII, and (B) the heavy chain of hFVIII.
  • Figure 11 provides Northern blot analyses of liver RNA using probes specific for (A) the light chain of hFVIII, and (B) the heavy chain of hFVIII.
  • the present invention relates to improved viral vectors useful for expressing gene products at high levels in human cells.
  • the present invention provides AAV vectors suitable for gene therapy. These vectors are capable of delivering nucleic acid containing constructs which result in the production of Factor VTII protein in a host.
  • the present invention also provides pharmaceutical compositions comprising such AAV vectors, as well as methods for making and using the constructs.
  • the AAV vectors and rAAV virions of the present invention can be produced using standard methodology known to those of skill in the art.
  • the methods generally involve the steps of: (1) introducing an AAV vector into a host cell; (2) introducing an AAV helper construct into the host cell, where the helper construct includes AAV coding regions capable of being expressed in the host cell to complement AAV helper functions missing from the AAV vector; (3) introducing one or more helper viruses and/or accessory function vectors into the host cell, wherein the helper virus and/or accessory function vectors provide accessory functions capable of supporting efficient recombinant AAV (“rAAV”) virion production in the host cell; and (4) culturing the host cell to produce rAAV virions.
  • rAAV efficient recombinant AAV
  • the AAV vector, AAV helper construct and the helper virus or accessory function vector(s) can be introduced into the host cell either simultaneously or serially, using standard transfection techniques. Unless otherwise indicated, the practice of the present invention employs conventional methods of virology, microbiology, molecular biology and recombinant DNA techniques within the skill of the art, including those described in such references as Sambrook et al. (eds.) Molecular Cloning: A Laboratory Manual; Glover (ed.) DNA Cloning: A Practical Approach, Vols.
  • the terms “gene transfer” and “gene delivery” refer to methods or systems for reliably inserting a particular nucleotide sequence (e.g., DNA) into targeted cells.
  • the nucleotide sequence comprises at least a portion of Factor VTfl.
  • vector refers to any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc., which is capable of replication when associated with the proper control sequences and/or which can transfer nucleic acid sequences between cells.
  • vector includes cloning and expression vectors, as well as viral vectors.
  • Gene transfer vectors may include transcription sequences such as polyadenylation sites, selectable markers or reporter genes, enhancer sequences, and other control sequences which allow for the induction of transcription. Such control sequences are described more fully below.
  • expression vector refers to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host organism.
  • Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome binding site, as well as other sequences.
  • Eukaryotic cells are generally known to utilize promoters (constitutive, inducible or tissue specific), enhancers, and termination and polyadenylation signals, although some elements may be deleted and other elements added without sacrificing the necessary expression.
  • the terms "host” and "expression host” refer to organisms and/or cells which harbor an exogenous DNA sequence (e.g., via transfection), an expression vector or vehicle, as well as organisms and/or cells that are suitable for use in expressing a recombinant gene or protein. It is not intended that the present invention be limited to any particular type of cell or organism. Indeed, it is contemplated that any suitable organism and/or cell will find use in the present invention as a host.
  • viral replicons and “viral origins of replication” refer to viral DNA sequences that allow for the extrachromosomal replication of a vector in a host cell expressing the appropriate replication factors.
  • AAV vector refers to a vector having functional or partly functional ITR sequences.
  • the ITR sequences may be derived from an adeno- associated virus serotype, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-X7, etc.
  • the ITRs need not be the wild-type nucleotide sequences, and may be altered (e.g., by the insertion, deletion or substitution of nucleotides), so long as the sequences retain function provide for functional rescue, replication and packaging.
  • AAV vectors can have one or more of the AAV wild-type genes deleted in whole or part, preferably the rep and/or cap genes but retain functional flanking ITR sequences.
  • an "AAV vector” is defined herein to include at least those sequences required in cis for replication and packaging (e.g., functional ITRs) of the virus.
  • the term "ITR” refers to inverted terminal repeats.
  • AAV ITRs adeno-associated virus inverted terminal repeats
  • flanking AAV ITRs are positioned 5' and 3' of one or more selected heterologous nucleotide sequences.
  • the ITRs together with the rep coding region or the Rep expression product provide for the integration of the selected sequences into the genome of a target cell.
  • AAV rep coding region refers to the art-recognized region of the AAV genome which encodes the replication proteins Rep 78, Rep 68, Rep 52 and Rep 40. These Rep expression products have been shown to possess many functions, including recognition, binding and nicking of the AAV origin of DNA replication, DNA helicase activity and modulation of transcription from AAV (or other heterologous) promoters. The Rep expression products are collectively required for replicating the AAV genome. Muzyczka (Muzyczka, Curr. Top. Microbiol. Immunol., 158:97-129 [1992]) and Kotin (Kotin, Hum.
  • HHV-6 rep gene which is also known to mediate AAV-2 DNA replication (Thomson et al, Virol., 204:304-311 [1994]).
  • AAV cap coding region refers to the art-recognized region of the AAV genome which encodes the capsid proteins VP1, VP2, and VP3, or functional homologues thereof. These cap expression products supply the packaging functions which are collectively required for packaging the viral genome.
  • AAV helper function refers to AAV coding regions capable of being expressed in the host cell to complement AAV viral functions missing from the AAV vector.
  • the AAV helper functions include the AAV rep coding region and the AAV cap coding region.
  • An "AAV helper construct” is a vector containing AAV coding regions required to complement AAV viral functions missing from the AAV vector (e.g., the AAV rep coding region and the AAV cap coding region).
  • accessory functions and “accessory factors” refer to functions and factors that are required by AAV for replication, but are not provided by the AAV virion (or rAAV virion) itself.
  • a virus e.g., adenovirus or herpes simplex virus
  • another expression vector that is co-expressed in the same cell.
  • the El, E2A, E4 and VA coding regions of adenovirus are used to supply the necessary accessory function required for AAV replication and packaging (Matsushita et al, Gene Therapy 5:938 [1998]).
  • wild type refers to a gene or gene product which has the characteristics of that gene or gene product when isolated from a naturally occurring source.
  • a wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designed the "normal” or “wild-type” form of the gene.
  • modified or mutant refers to a gene or gene product which displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.
  • AAV virion refers to a complete virus particle, such as a "wild-type” (wt) AAV virus particle (comprising a linear, single-stranded AAV nucleic acid genome associated with an AAV capsid protein coat).
  • wt wild-type AAV virus particle
  • single-stranded AAV nucleic acid molecules of either complementary sense e.g., "sense” or “antisense” strands
  • rAAV virion refers to an infectious viral particle containing a heterologous DNA molecule of interest (e.g., Factor VIII sequence) which is flanked on both sides by AAV ITRs.
  • a heterologous DNA molecule of interest e.g., Factor VIII sequence
  • an rAAV virion is produced in a suitable host cell which contains an AAV vector, AAV helper functions and accessory functions introduced therein.
  • the host cell is rendered capable of encoding AAV polypeptides that are required for packaging the AAV vector containing a recombinant nucleotide sequence of interest, such as at least a portion of Factor VIII or portions of Factor VIII domains, into recombinant virion particles for subsequent gene delivery.
  • a recombinant nucleotide sequence of interest such as at least a portion of Factor VIII or portions of Factor VIII domains
  • transfection refers to the uptake of foreign DNA by a cell, and a cell has been "transfected” when exogenous DNA has been introduced inside the cell membrane.
  • transfection techniques are generally known in the art (See e.g., Graham et al, Virol, 52:456 [1973]; Sambrook et al, Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratories, New York [1989]; Davis et al, Basic Methods in Molecular Biology, Elsevier, [1986]; and Chu et al, Gene 13:197 [1981].
  • Such techniques can be used to introduce one or more exogenous DNA moieties, such as a gene transfer vector and other nucleic acid molecules, into suitable recipient cells.
  • stable transfection and “stably transfected” refers to the introduction and integration of foreign DNA into the genome of the transfected cell.
  • stable transfectant refers to a cell which has stably integrated foreign DNA into the genomic DNA.
  • transient transfection or “transiently transfected” refers to the introduction of foreign DNA into a cell where the foreign DNA fails to integrate into the genome of the transfected cell.
  • the foreign DNA persists in the nucleus of the transfected cell for several days. During this time the foreign DNA is subject to the regulatory controls that govern the expression of endogenous genes in the chromosomes.
  • transient transfectant refers to cells which have taken up foreign DNA but have failed to integrate this DNA.
  • the term “transduction” denotes the delivery of a DNA molecule to a recipient cell either in vivo or in vitro, via a replication-defective viral vector, such as via a recombinant AAV virion.
  • the term “recipient cell” refers to a cell which has been transfected or transduced, or is capable of being transfected or transduced, by a nucleic acid construct or vector bearing a selected nucleotide sequence of interest (i.e., Factor VIII).
  • the term includes the progeny of the parent cell, whether or not the progeny are identical in morphology or in genetic make-up to the original parent, so long as the selected nucleotide sequence is present.
  • heterologous as it relates to nucleic acid sequences such as coding sequences and control sequences, denotes sequences that are not normally joined together, and/or are not normally associated with a particular cell.
  • a heterologous region of a nucleic acid construct or a vector is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature.
  • a heterologous region of a nucleic acid construct could include a coding sequence flanked by sequences not found in association with the coding sequence in nature.
  • heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene). Similarly, a cell transfected with a construct which is not normally present in the cell would be considered heterologous for purposes of this invention. Allelic variation or naturally occurring mutational events do not give rise to heterologous DNA, as used herein.
  • "coding sequence” or a sequence which "encodes" a particular antigen is a nucleic acid sequence which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo, when placed under the control of appropriate regulatory sequences.
  • a coding sequence can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences.
  • a transcription termination sequence will usually be located 3' to the coding sequence.
  • nucleic acid refers to a DNA or RNA sequence.
  • sequences that include any of the known base analogues of DNA and RNA such as, but not limited to 4-acetylcytosine, 8-hydroxy-N6- methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl) uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2- dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5- methoxyaminomethyl-2-thiouracil, beta-D-mannosy
  • regulatory element refers to a genetic element which controls some aspect of the expression of nucleic acid sequences.
  • a promoter is a regulatory element which facilitates the initiation of transcription of an operably linked coding region.
  • Other regulatory elements are splicing signals, polyadenylation signals, termination signals, etc. (defined infra).
  • control sequences refers collectively to regulatory elements such as promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like, which collectively provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all of these control sequences need always be present so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate recipient cell.
  • Transcriptional control signals in eukaryotes generally comprise "promoter” and "enhancer” elements.
  • Promoters and enhancers consist of short arrays of DNA sequences that interact specifically with cellular proteins involved in transcription (Maniatis et al, Science 236:1237 [1987]). Promoter and enhancer elements have been isolated from a variety of eukaryotic sources including genes in yeast, insect and mammalian cells and viruses (analogous control sequences, i.e., promoters, are also found in prokaryotes). The selection of a particular promoter and enhancer depends on what cell type is to be used to express the protein of interest (i.e., Factor VIII).
  • eukaryotic promoters and enhancers have a broad host range while others are functional in a limited subset of cell types (See e.g., Voss et al, Trends Biochem. Sci., 11:287 [1986]; and Maniatis et al, supra, for reviews).
  • the SV40 early gene enhancer is very active in a wide variety of cell types from many mammalian species and has been widely used for the expression of proteins in mammalian cells (Dijkema et al, EMBO J. 4:761 [1985]).
  • promoter and enhancer elements active in a broad range of mammalian cell types are those from the human elongation factor l ⁇ gene (Uetsuki et al, J. Biol. Chem., 264:5791 [1989]; Kim et al, Gene 91:217 [1990]; and and Nagata, Nucl. Acids. Res., 18:5322 [1990]) and the long terminal repeats of the Rous sarcoma virus (Gorman et al, Proc. Natl. Acad. Sci. USA 79:6777 [1982]) and the human cytomegalovirus (Boshart et al, Cell 41:521 [1985]).
  • Promoters and enhances can be found naturally alone or together.
  • the long terminal repeats of retroviruses contain both promoter and enhancer functions
  • generally promoters and enhances act independently of the gene being transcribed or translated.
  • the enhancer and promoter may be "endogenous” or “exogenous” or “heterologous.”
  • An “endogenous” enhancer/promoter is one which is naturally linked with a given gene in the genome.
  • An “exogenous” or “heterologous” enhancer and promoter is one which is placed in juxtaposition to a gene by means of genetic manipulation (i.e., molecular biological techniques) such that transcription of that gene is directed by the linked enhancer/promoter.
  • tissue specific refers to regulatory elements or control sequences, such as a promoter, enhancers, etc., wherein the expression of the nucleic acid sequence is substantially greater in a specific cell type(s) or tissue(s).
  • the albumin promoter and the transthyretin promoter display increased expression of FVIII in hepatocytes, as compared to other cell types. It is not intended, however, that the present invention be limited to the albumin or transthyretin promoters or to hepatic-specific expression, as other tissue specific regulatory elements, or regulatory elements that display altered gene expression patterns, are contemplated.
  • Splicing signals mediate the removal of introns from the primary RNA transcript and consist of a splice donor and acceptor site (Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York [1989], pp. 16.7-16.8).
  • a commonly used splice donor and acceptor site is the splice junction from the 16S RNA of SV40. Efficient expression of recombinant DNA sequences in eukaryotic cells requires expression of signals directing the efficient termination and polyadenylation of the resulting transcript.
  • Transcription termination signals are generally found downstream of the polyadenylation signal and are a few hundred nucleotides in length.
  • the term "poly A site” or "poly A sequence” as used herein denotes a DNA sequence which directs both the termination and polyadenylation of the nascent RNA transcript. Efficient polyadenylation of the recombinant transcript is desirable as transcripts lacking a poly A tail are unstable and are rapidly degraded.
  • the poly A signal utilized in an expression vector may be "heterologous” or "endogenous.” An endogenous poly A signal is one that is found naturally at the 3' end of the coding region of a given gene in the genome.
  • a heterologous poly A signal is one which is one which is isolated from one gene and placed 3' of another gene.
  • a commonly used heterologous poly A signal is the SV40 poly A signal.
  • the SV40 poly A signal is contained on a 237 bp BamBIIBcll restriction fragment and directs both termination and polyadenylation (Sambrook et al, supra, at 16.6-16.7).
  • "Operably linked” refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function.
  • control sequences operably linked to a coding sequence are capable of effecting the expression of the coding sequence.
  • the control sequences need not be contiguous with the coding sequence, so long as they function to direct the expression thereof.
  • intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered “operably linked" to the coding sequence.
  • isolated when used in relation to a nucleic acid, as in “an isolated oligonucleotide” or “isolated polynucleotide” refers to a nucleic acid sequence that is identified and separated from at least one contaminant nucleic acid with which it is ordinarily associated in its natural source. Isolated nucleic acid is such present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids are nucleic acids such as DNA and RNA found in the state they exist in nature.
  • a given DNA sequence e.g., a gene
  • RNA sequences such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs which encode a multitude of proteins.
  • the isolated nucleic acid, oligonucleotide, or polynucleotide may be present in single- stranded or double-stranded form.
  • oligonucleotide or polynucleotide When an isolated nucleic acid, oligonucleotide or polynucleotide is to be utilized to express a protein, the oligonucleotide or polynucleotide will contain at a -ninimum the sense or coding strand (i.e., the oligonucleotide or polynucleotide may single-stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide or polynucleotide may be double- stranded).
  • the term "purified” or "to purify” refers to the removal of contaminants from a sample.
  • antibodies may be purified by removal of contaminating non-immunoglobulin proteins; they may also purified by the removal of immunoglobulin that does not bind the antigen of interest (e.g., at least a portion of Factor VIII).
  • the removal of non-immunoglobulin proteins and/or the removal of immuno globulins that do not bind the antigen of interest (e.g., at least a portion of Factor VIII) results in an increase in the percent of desired antigen-reactive immunoglobulins in the sample.
  • recombinant polypeptides of Factor VIII are expressed in bacterial host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant polypeptides is thereby increased in the sample.
  • chimeric protein refers to two or more coding sequences obtained from different genes, that have been cloned together and that, after translation, act as a single polypeptide sequence. Chimeric proteins are also referred to as "hybrid proteins.” As used herein, the term “chimeric protein” refers to coding sequences that are obtained from different species of organisms, as well as coding sequences that are obtained from the same species of organisms.
  • composition comprising a given polynucleotide sequence refers broadly to any composition containing the given polynucleotide sequence.
  • the composition may comprise an aqueous solution.
  • the term "at risk” is used in references to individuals who are at risk for experiencing hemorrhagic episodes.
  • the individuals are hemophiliacs with mild, moderate, or severe hemophilia.
  • the term "subject” refers to any animal (i.e., vertebrates and invertebrates), while the term “vertebrate subject” refers to any member of the subphylum Chordata. It is intended that the term encompass any member of this subphylum, including, but not limited to humans and other primates, rodents (e.g., mice, rats, and guinea pigs), lagamorphs (e.g., rabbits), bovines (e.g, cattle), ovines (e.g., sheep), caprines (e.g., goats), porcines (e.g., swine), equines (e.g., horses), canines (e.g., dogs), felines (e.g., cats), domestic fowl (e.g., chickens, turkeys, ducks, geese, other gallinaceous birds, etc.), as well as feral or wild animals, including, but not limited to, such animals as ungulates (
  • a “therapeutically effective amount” or “therapeutic effective dose” is an amount or dose of AAV vector or virions capable of producing sufficient amounts of Factor VIII to decrease the time it takes for a subject's blood to clot.
  • severe hemophiliacs having less than 1% of normal levels of FVIII have a whole blood clotting time of greater than 60 minutes as compared to approximately 10 minutes for non-hemophiliacs.
  • the present invention relates to AAV vectors suitable for hemophilia A gene therapy. More particularly, these AAV vectors are suitable for delivering nucleic acids encoding Factor VTII into a recipient host suspected of suffering from a blood clotting disorder. Using the nucleic acid as a template, the host produces Factor Vm, such that the subject's blood is able to clot.
  • the present invention also provides pharmaceutical compositions comprising such AAV vectors, as well as methods for making and using the constructs.
  • AAV Vectors Adeno-associated virus (AAV) is a non-pathogenic, replication-defective, helper-dependent parvovirus (or "dependovirus” or "adeno-satellite virus”). There are at least six recognized serotypes, designated as AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-X7, etc. Culture and serologic evidence indicates that human infection occurs with AAV-2 and AAV-3. Although 85% of the human population is seropositive for AAV-2, the virus has never been associated with disease in humans. Recombinant AAV (rAAV) virions are of interest as vectors for gene therapy because of their broad host range, excellent safety profile, and duration of transgene expression in infected hosts.
  • rAAV Recombinant AAV
  • AAV vectors of the present invention may be constructed using known techniques to provide, as operatively linked components in the direction of transcription, (a) control sequences including a transcriptional initiation and termination regions, and (b) a nucleotide sequence encoding at least a portion of Factor VIII.
  • the control sequences are selected to be functional in a targeted recipient cell.
  • the resulting construct which contains the operatively linked components is bounded (5' and 3') with functional AAV ITR sequences.
  • AAV ITR regions are known (See e.g., Kotin, Hum. Gene Ther., 5:793-801 [1994]; Berns, "Parvoviridae and Their Replication” in Fields and Knipe (eds), Fundamental Virology, 2nd Edition, for the AAV-2 sequence).
  • AAV ITRs used in the vectors of the invention need not have a wild-type nucleotide sequence, and may be altered (e.g., by the insertion, deletion or substitution of nucleotides).
  • AAV ITRs may be derived from any of several AAV serotypes, including without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAVX7, etc.
  • 5' and 3' ITRs which flank a selected nucleotide sequence in an AAV vector need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended.
  • heterologous control sequences are employed with the vectors.
  • Useful heterologous control sequences generally include those derived from sequences encoding mammalian or viral genes. Examples include, but are not limited to, the SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter (Ad MLP), a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), a rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like.
  • SV40 early promoter mouse mammary tumor virus LTR promoter
  • Ad MLP adenovirus major late promoter
  • HSV herpes simplex virus
  • CMV cytomegalovirus
  • CMVIE CMV immediate early promoter region
  • RSV rous sarcoma virus
  • tissue-specific expression may be desirable (e.g., expression of biologically active Factor VIII by hepatocytes). It is not intended that the present invention be limited to expression of biologically active Factor VIII by any particular cells or cell types. However, as hepatocytes (i.e., liver cells) are the cells that normally synthesized Factor VIII (See, Kaufman, Ann. Rev. Med., 43:325 [1992]), it is contemplated that in some particularly preferred embodiments, the compositions of the present invention be administered to the liver.
  • expression is achieved by coupling the coding sequence for Factor VIII with heterologous control sequences derived from genes that are specifically transcribed by a selected tissue type.
  • tissue-specific promoters have been described above which enable directed expression in selected tissue types.
  • control sequences used in the present AAV vectors can also comprise control sequences normally associated with the selected nucleic acid sequences.
  • AAV vectors that contain a control sequence and a nucleotide sequence of interest (i.e., at least a portion of the sequence encoding Factor VTII), bounded by AAV ITRs (i.e., AAV vectors), can be constructed by directly inserting selected sequences into an AAV genome with the major AAV open reading frames ("ORFs") excised. Other portions of the AAV genome can also be deleted, so long as a sufficient portion of the ITRs remain to allow for replication and packaging functions.
  • ORFs major AAV open reading frames
  • AAV ITRs can be excised from the viral genome or from an AAV vector containing the same and fused 5' and 3' of a selected nucleic acid construct that is present in another vector using standard ligation techniques, such as those described in Sambrook et al, supra.
  • ligations can be accomplished in 20 mM Tris-Cl pH 7.5, 10 mM MgCl 2 , 10 mM DTT, 33 ⁇ g/ml BSA, 10 mM-50 mM NaCl, and either 40 ⁇ M ATP, 0.01-0.02 (Weiss) units T4 DNA ligase at 0°C (for "sticky end” ligation) or 1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14°C (for "blunt end” ligation). Intermolecular "sticky end” ligations are usually performed at 30-100 ⁇ g/ml total DNA concentrations (5-100 nM total end concentration).
  • AAV vectors which contain ITRs have been described in (e.g., U.S. Patent No. 5,139,941, herein incorporated by reference).
  • AAV vectors are described therein which are available from the American Type Culture Collection (“ATCC") under Accession Numbers 53222, 53223, 53224, 53225 and 53226.
  • chimeric genes can be produced synthetically to include AAV ITR sequences ananged 5' and 3' of a selected nucleic acid sequence.
  • the complete chimeric sequence is assembled from overlapping oligonucleotides prepared by standard methods (See e.g., Edge, Nature 292:756 [1981]; Nambair et al, Science 223:1299 [1984]; and Jay et al, J. Biol. Chem., 259:6311 [1984]).
  • Nucleic acid sequences coding for the above-described Factor VIII can be obtained using recombinant methods, such as by screening cDNA and genomic libraries from cells expressing Factor VIII or by deriving the sequence from a vector known to include the same. Furthermore, the desired sequence can be isolated directly from cells and tissues containing the same, using standard techniques, such as phenol extraction and PCR of cDNA or genomic DNA (See e.g., Sambrook et al, supra, for a description of techniques used to obtain and isolate DNA). Nucleotide sequences encoding an antigen of interest (i.e., Factor VHI sequence) can also be produced synthetically, rather than cloned.
  • an antigen of interest i.e., Factor VHI sequence
  • the complete sequence can be assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence (See e.g., Edge, Nature 292:756 [1981]; Nambair et al, Sci- ence 223:1299 [1984]; and Jay et al, J. Biol. Chem., 259:6311 [1984]).
  • the present invention be limited to any particular methods for assessing the production of biologically active Factor VIII, such methods as immunoassays (e.g., ELISA) and biological activity assays are contemplated (e.g., coagulation activity assays).
  • immunoassays e.g., ELISA
  • biological activity assays e.g., coagulation activity assays
  • human Factor VIII is encompassed by the present invention, it is not intended that the present invention be limited to human Factor VIII.
  • the present invention encompass Factor VIII from animals other than humans, including but not limited to companion animals (e.g., canines, felines, and equines), livestock (e.g., bovines, caprines, and ovines), laboratory animals (e.g., rodents such as murines, as well as lagamorphs), and "exotic" animals (e.g., marine mammals, large cats, etc.).
  • companion animals e.g., canines, felines, and equines
  • livestock e.g., bovines, caprines, and ovines
  • laboratory animals e.g., rodents such as murines, as well as lagamorphs
  • exotic animals e.g., marine mammals, large cats, etc.
  • Virion Production Producing AAV Factor VIII vectors and rAAV Factor VIII virions of the present invention generally involve the steps of: (1) introducing an AAV vector containing the Factor VIII gene into a host cell; (2) introducing an AAV helper construct into the host cell, where the helper construct includes AAV coding regions capable of being expressed in the host cell to complement AAV helper functions missing from the AAV vector; (3) introducing one or more helper viruses and/or accessory function vectors into the host cell, wherein the helper virus and/or accessory function vectors provide accessory functions capable of supporting efficient recombinant AAV (“rAAV”) virion production in the host cell; and (4) culturing the host cell to produce rAAV virions.
  • AAV efficient recombinant AAV
  • transfection e.g., Graham et al, Virol., 52:456 [1973], Sambrook et al. supra, Davis et al, supra, and Chu et al, Gene 13:197 [1981]).
  • transfection methods include calcium phosphate co-precipitation (Graham et al, Virol., 52:456-467 [1973]), direct micro-injection into cultured cells (Capecchi, Cell 22:479-488 [1980]), electroporation (Shigekawa et al, BioTechn., 6:742-751 [1988]), liposome-mediated gene transfer (Mannino et al, BioTechn., 6:682-690 [1988]), lipid-mediated transduction (Feigner et al, Proc. Natl. Acad. Sci. USA 84:7413-7417 [1987]), and nucleic acid delivery using high-velocity microprojectiles (Klein et al, Nature 327:70-73 [1987]).
  • suitable host cells for producing rAAV virions include microorganisms, yeast cells, insect cells, and mammalian cells, that can be, or have been, used as recipients of a heterologous DNA molecule.
  • the term includes the progeny of the original cell which has been transfected.
  • a "host cell” as used herein generally refers to a cell which has been transfected with an exogenous DNA sequence.
  • Cells from the stable human cell line, 293 (ATCC Accession No. CRL1573) are prefened in the practice of the present invention.
  • the human cell line 293 is a human embryonic kidney cell line that has been transformed with adenovirus type-5 DNA fragments (Graham et al, J.
  • the 293 cell line is readily transfected, and provides a particularly convenient platform in which to produce rAAV virions.
  • AAV helper functions are generally AAV-derived coding sequences which can be expressed to provide AAV gene products that, in turn, function in trans for productive AAV replication.
  • AAV helper functions are used herein to complement necessary AAV functions that are missing from the AAV vectors.
  • AAV helper functions include one, or both of the major AAV ORFs, namely the rep and cap coding regions, or functional homologues thereof.
  • AAV helper functions are introduced into the host cell by transfecting the host cell with an AAV helper construct either prior to, or concurrently with, the transfection of the AAV vector.
  • AAV helper constructs are thus used to provide at least transient expression of AAV rep and/or cap genes to complement missing AAV functions that are necessary for productive AAV infection.
  • AAV helper constructs lack AAV ITRs and can neither replicate nor package themselves.
  • Both AAV vectors and AAV helper constructs can be constructed to contain one or more optional selectable markers.
  • Suitable markers include genes which confer antibiotic resistance or sensitivity to, impart color to, or change the antigenic characteristics of those cells which have been transfected with a nucleic acid construct containing the selectable marker when the cells are grown in an appropriate selective medium.
  • selectable marker genes that are useful in the practice of the invention include the gene encoding aminoglycoside phosphotranferase (APH) that allows selection in mammalian cells by conferring resistance to G418 (Sigma). Other suitable markers are known to those of skill in the art.
  • the host cell (or packaging cell) must also be rendered capable of providing non-AAV derived functions, or "accessory functions," in order to produce rAAV virions.
  • Accessory functions are non-AAV derived viral and/or cellular functions upon which AAV is dependent for its replication.
  • accessory functions include at least those non-AAV proteins and RNAs that are required in AAV replication, including those involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of rep and cap expression products and AAV capsid assembly.
  • Viral-based accessory functions can be derived from any of the known helper viruses.
  • accessory functions can be introduced into and then expressed in host cells using methods known to those of skill in the art.
  • accessory functions are provided by infection of the host cells with an unrelated helper virus.
  • helper viruses include adenoviruses; herpesviruses such as he ⁇ es simplex virus types 1 and 2; and vaccinia viruses.
  • Nonviral accessory functions will also find use herein, such as those provided by cell synchronization using any of various known agents (See e.g., Buller et al, J.
  • accessory functions can be provided using an accessory function vector.
  • Accessory function vectors include nucleotide sequences that provide one or more accessory functions.
  • An accessory function vector is capable of being introduced into a suitable host cell in order to support efficient AAV virion production in the host cell.
  • Accessory function vectors can be in the form of a plasmid, phage, virus, transposon or cosmid.
  • Accessory vectors can also be in the form of one or more linearized DNA or RNA fragments which, when associated with the appropriate control sequences and enzymes, can be transcribed or expressed in a host cell to provide accessory functions.
  • Nucleic acid sequences providing the accessory functions can be obtained from natural sources, such as from the genome of adenovirus, or constructed using recombinant or synthetic methods known in the art.
  • adenovirus-derived accessory functions have been widely studied, and a number of adenovirus genes involved in accessory functions have been identified and partially characterized (See e.g., Carter, "Adeno-Associated Virus Helper Functions," in CRC Handbook of Parvoviruses, Vol. I (P.
  • accessory functions are expressed which transactivate the AAV helper construct to produce AAV Rep and/or Cap proteins.
  • the Rep expression products direct excision of the recombinant DNA (including the DNA of interest encoding at least a portion of Factor VIII) from the AAV vector.
  • the Rep proteins also serve to duplicate the AAV genome.
  • the expressed Cap proteins assemble into capsids, and the recombinant AAV genome is packaged into the capsids.
  • productive AAV replication ensues, and the DNA is packaged into rAAV virions.
  • rAAV virions can be purified from the host cell using a variety of conventional purification methods, such as CsCl gradients.
  • helper virus infection is employed to express the accessory functions
  • residual helper virus can be inactivated, using known methods.
  • adenovirus can be inactivated by heating to temperatures of approximately 60°C for approximately 20 minutes or more, as appropriate. This treatment selectively inactivates the helper adenovirus which is heat labile, while preserving the rAAV which is heat stable.
  • compositions which can be delivered to a subject, so as to allow production of biologically active Factor VHI.
  • Pharmaceutical compositions comprise sufficient genetic material that allows the recipient to produce a therapeutically effective amount of Factor VTII so as to reduce, stop and/or prevent hemonhage.
  • the compositions may be administered alone or in combination with at least one other agent, such as stabilizing compound, which may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • the compositions may be administered to a patient alone, or in combination with other agents, clotting factors or factor precursors, drugs or hormones.
  • the pharmaceutical compositions also contain a pharmaceutically acceptable excipient.
  • excipients include any pharmaceutical agent that does not itself induce an immune response harmful to the individual receiving the composition, and which may be administered without undue toxicity.
  • Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, sugars and ethanol.
  • Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
  • auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
  • auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like.
  • compositions suitable for parenteral administration may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiologically buffered saline.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions of the active compounds may be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art.
  • the pharmaceutical compositions of the present invention may be manufactured in a manner that is known in the art (e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes).
  • the pharmaceutical composition may be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
  • the preferred preparation may be a lyophilized powder which may contain any or all of the following: 1-50 mM histidine, 0J%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use. After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment.
  • compositions suitable for use in the invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended pu ⁇ ose. Determining a therapeutic effective dose is well within the capability of those skilled in the art using the techniques taught in the present invention, such as ELISA and ChrornZ FVIII coagulation activity assay, and other techniques known in the art. Therapeutic doses will depend on, among other factors, the age and general condition of the subject, the severity of hemophilia, and the strength of the control sequences. Thus, a therapeutically effective amount in humans will fall in a relatively broad range that can be determined through clinical trials.
  • the dosage treatment and regimen used with the present invention will vary, depending upon the subject and the preparation to be used.
  • the dosage treatment may be a single dose schedule or a multiple dose schedule.
  • the subject may be administered as many doses as appropriate to achieve or maintain the desired blood clotting time.
  • compositions in vivo will generally be accomplished via injection using a conventional syringe, although other delivery methods such as convention-enhanced delivery are envisioned (See e.g., United States Patent No. 5,720,720, inco ⁇ orated herein by reference).
  • the compositions can be delivered subcutaneously, epidermally, intradermally, intrathecally, intraorbitally, intramucosally (e.g., nasally, rectally and vaginally), intraperitoneally, intravenously, intraarterially, orally, or intramuscularly.
  • Other modes of administration include oral and pulmonary administration, suppositories, and transdermal applications.
  • the compositions are administered intravenously in the portal vasculature or hepatic artery
  • the methods and compositions described above are also applicable to a range of other treatment regimens known in the art.
  • the methods and compositions of the present invention are compatible with ex vivo therapy (e.g., where cells are removed from the body, incubated with the AAV vector and the treated cells are returned to the body).
  • AAV vector can be administered to any tissue suitable for the expression of Factor VIII.
  • the AAV vectors of the present invention are successfully administered via the portal vasculature or hepatic artery where it is thought, without being bound by theory, that the vector transduces hepatocytes.
  • Current approaches to targeting genes to the liver have focused upon ex vivo gene therapy.
  • Ex vivo liver-directed gene therapy involves the surgical removal of liver cells, transduction of the liver cells in vitro (e.g., infection of the explanted cells with recombinant retroviral vectors) followed by injection of the genetically modified liver cells into the liver or spleen of the patient.
  • a serious drawback for ex vivo gene therapy of the liver is the fact that hepatocyctes cannot be maintained and expanded in culture. Therefore, the success of ex vivo liver-directed gene therapy depends upon the ability to efficiently and stably engraft the genetically modified (i.e., transduced) hepatocytes and their progeny. It has been reported that even under optimal conditions, autologous modified liver cells injected into the liver or spleen which engraft represent only a small percentage (less than 10%) of the total number of cells in the liver. Ectopic engraftment of transduced primary hepatocytes into the peritoneal cavity has been tried, in order to address the problem of engraftment in the liver.
  • in vivo approaches have been investigated for the transfer of genes into hepatocytes, including the use of recombinant retroviruses, recombinant adenoviruses, liposomes and molecular conjugates. While these in vivo approaches do not suffer from the drawbacks associated with ex vivo liver-directed gene therapy, they do not provide a means to specifically target hepatocytes. In addition, several of these approaches require performance of a partial hepatectomy, in order to achieve prolonged expression of the transferred genes in vivo. Adenovirus and molecular conjugate based delivery methods also result in liver toxicity and inflammation which is an undesirable feature of Factor VIII gene therapy.
  • the present invention provides compositions and methods for the long-term expression of biologically active Factor VIII. It is contemplated that the present invention will bypass the need for partial hepatectomy, while allowing expression of Factor VIII in concentrations that are therapeutic in vivo.
  • the present invention further provides gene therapy compositions and methods that target hepatocytes for the production of Factor VIII by treated individuals.
  • Muscle cells for example, have been shown to express biologically active blood clotting Factor IX even though it is normally synthesized in the liver.
  • the AAV vectors may contain any nucleic acid sequences coding for biologically active Factor V-TI. Additionally, the AAV vectors may contain a nucleic acid coding for fragments of Factor VDI which is itself not biologically active, yet when administered into the subject improves or restores the blood clotting time.
  • the Factor VHI protein comprises two polypeptide chains: a heavy chain and a light chain separated by a B-domain which is cleaved during processing. As demonstrated by the present invention, co-transducing recipient cells with the Factor VIII heavy and light chains leads to the expression of biologically active Factor VIII.
  • the present invention also provides methods for detecting Factor VIII expression comprising the steps of: a) providing a sample suspected of containing Factor VIII, and a control containing a known amount of known Factor VIII; and b) comparing the test sample with the known control, to determine the relative concentration of Factor VIII in the sample.
  • the methods are capable of identifying samples (e.g., patient samples) with sufficient or insufficient quantities of Factor VIII.
  • the methods may be conducted using any suitable means to determine the relative concentration of Factor VIII in the test and control samples, including but not limited to means selected from the group consisting of Western blot analysis, Northern blot analysis, Southern blot analysis, denaturing polyacrylamide gel electrophoresis (e.g., SDS-PAGE), reverse transcriptase-coupled polymerase chain reaction (RT-PCR), enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescent immunoassay (IF A).
  • suitable means selected from the group consisting of Western blot analysis, Northern blot analysis, Southern blot analysis, denaturing polyacrylamide gel electrophoresis (e.g., SDS-PAGE), reverse transcriptase-coupled polymerase chain reaction (RT-PCR), enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescent immunoassay (IF A).
  • the methods may be conducted to determine the presence of normal Factor VHI sequences in the genome of the animal source of the test sample, or the expression of Factor VTII (mRNA or protein), as well as detect the presence of abnormal or mutated Factor VIII gene sequences in the test samples.
  • the presence of Factor VIII is detected by immunochemical analysis.
  • the immunochemical analysis can comprise detecting binding of an antibody specific for an epitope of Factor VIII.
  • the antibody comprises polyclonal antibodies, while in another prefened embodiment, the antibody comprises monoclonal antibodies. It is further contemplated that antibodies directed against at least a portion of Factor VIII will be used in methods known in the art relating to the localization and structure of Factor VIII (e.g., for Western blotting), measuring levels thereof in appropriate biological samples, etc.
  • the antibodies can be used to detect Factor VIII in a biological sample from an individual (e.g., an individual treated using the methods and/or compositions of the present invention).
  • the biological sample can be a biological fluid, including, but not limited to, blood, serum, plasma, interstitial fluid, urine, cerebrospinal fluid, synovial fluid, and the like.
  • the antigen can be detected from cellular sources, including, but not limited to, hepatocytes.
  • cells can be obtained from an individual and lysed (e.g., by freeze-thaw cycling, or treatment with a mild cytolytic detergent including, but not limited to, TRITON X-100, digitonin, NONTDET P (NP)-40, saponin, and the like, or combinations thereof; See, e.g., International Patent Publication WO 92/08981).
  • the biological samples can then be tested directly for the presence of the Factor VIII using an appropriate strategy (e.g., ELISA or RIA) and format (e.g., microwells, dipstick [e.g., as described in International Patent Publication WO 93/03367], etc.).
  • an appropriate strategy e.g., ELISA or RIA
  • format e.g., microwells, dipstick [e.g., as described in International Patent Publication WO 93/03367], etc.
  • proteins in the sample can be size separated (e.g., by polyacrylamide gel electrophoresis (PAGE), with or without sodium dodecyl sulfate (SDS), and the presence of Factor VHt detected by immunoblotting [e.g., Western blotting]).
  • Immunoblotting techniques are generally more effective with antibodies generated against a peptide conesponding to an epitope of a protein, and hence, are particularly suited to the present invention.
  • the level of Factor VHI is assayed using the whole-blood clotting time and activated parial thromboplastin time (aPTT) of the subject's blood using techniques well known in the art (Herzog et al, Nature Medicine 5:56 [1999]).
  • N Normal
  • M M
  • mM millimolar
  • ⁇ M micromolar
  • g grams
  • mg milligrams
  • ⁇ g micrograms
  • ng nanograms
  • 1 or L L
  • ml milliliters
  • cm centimeters
  • mm millimeters
  • ⁇ m micrometers
  • nm nanometers
  • mU milliunits
  • 5, Cr Chromium 51
  • ⁇ Ci microcurie
  • EC degrees Centigrade
  • hFVIII human factor VDI
  • FVIII factor VTII
  • pH hydrogen ion concentration
  • JRH grade NaCl (sodium chloride)
  • HCI hydrochloric acid
  • OD optical density
  • bp base pair(s)
  • ATP adenosine 5'-triphosphate
  • PCR polymerase chain
  • the heavy and light chains of human Factor VIII were assembled according to those reported by Yonemura et al (Yonemura et al, Prot. Engineer., 6:669-674 [1993]) and cloned as expression cassettes into AAV vectors. Both vectors contain the promoter and the first non-coding intron (from -573 to +985) from the human elongation factor l ⁇ (EFl ⁇ ) gene (Uetsuki et al, J. Biol. Chem., 264:5791- 5798 [1989]; and Kim et al, Gene 9:217-223 [1990]).
  • EFl ⁇ human elongation factor l ⁇
  • Each vector also contains the first 57 base pairs of the FVIII heavy chain encoding the 19 amino acid signal sequence.
  • the heavy chain construct encodes the Al and A2 domains and 5 amino acids from the N terminus of the B domain.
  • the light chain vector encodes 85 amino acids of the carboxy terminal B domain, in addition to the A3, Cl, and C2 domains. Both vectors utilize the human growth hormone (hGH) polyadenylation signal.
  • hGH human growth hormone
  • the initial cloning step involved deleting 854 bp of EFl ⁇ sequences between the Spel and Xcml sites of pVm4.1e-hFIX (Nakai et al, Blood 91:1-9 [1998]), and religating to create pVm4.1e ⁇ D-hFIX.
  • This construct was then digested with EcoRI, which released the hFIX cDNA, and was ligated to an oligonucleotide containing Mfel ends (EcoRI-compatible) and an internal Clal restriction site, creating pVm4.1e ⁇ D-linker.
  • the heavy and light chain fragments, including the hGH polyadenylation sequences were isolated from pVm4.1cFVIII-HC and pVm4JcFVIII-LC, respectively as C7 ⁇ I-5.st ⁇ II fragments.
  • the upper line in each panel represents the gene structure of the vectors
  • the lower line represents the structure of the hFVIII protein domains enconded by the vectors (ITR, AAV inverted terminal repeat; EFl ⁇ Pro/Intron 1, human polypeptide elongation factor 1 ⁇ gene promoter and first intron; hFVIII-HC human FVIII cDNA; hFVIII-LC, human FVIII cDNA; hGH PA, human growth hormone polyadenylation signal; SS, human FVIII signal sequence; Al, A2, "B", A3, Cl, C2, complete and incomplete (") protein domains of the hFVIII protein).
  • the plasmid pAAV-F8-l construct containing both the light and heavy chains of factor VITI was constructed as follows.
  • a PCR fragment, Z8, containing cloning sites, 5 ' -splicing donor site of a synthetic intron based on EFl ⁇ and immunoglobulin G (IgG) intron sequences, Kozak sequence and the first 16 nucleotides of the human blood coagulation factor VTII (FVTII) coding sequence was generated using oligonucleotides Z8S and Z8A.
  • the sequences of the nucleic acids is shown below:
  • Oligonucleotide Z8S 5 ' cccaagcttgcggccgcccgggtgccgccctaggcaggtaagtgccgtgtgtggttcc 3 '
  • Nucleic acid Z8 was inserted into pZERO-2 (Invitrogen) between H-fldffi and . ⁇ T-oI sites to create pZ8.
  • a PCR fragment, INT3, containing the branching point, the polypyrimidine tract, and the 3 ' splicing acceptor site of the synthetic intron was generated using oligonucleotides INT3S and INT3A whose sequence is shown below.
  • Oligonucleotide INT3S 5 ' ttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattactga 3 '
  • Oligonucleotide INT3A Oligonucleotide INT3A:
  • Z8.I contains the entire synthetic intron between -4vrI3 and Clal sites.
  • a hFV ⁇ i cDNA fragment having S ⁇ cl and Xhol restriction sites was inserted between the S ⁇ cl and Xhol sites of pZ8.I to create pZ ⁇ .I.dB. Therefore, pZ8.I.dB contains a synthetic intron and the entire coding sequence of hFVIII.
  • a PCR fragment, EG3, containing three HNF-3 binding sites and -54 to +8 of mouse albumin gene was generated using oligonucleotides EG3S and EG3A with modifications to eliminate linker sequences.
  • the sequences of EG3S and EG3A are as follows:
  • Oligonucleotide EG3S Oligonucleotide EG3S:
  • EG3 was then phosphorylated using T4 polynucleotide kinase and inserted into the Smal site of pZ ⁇ .I.dB to create pZ8.LdB.egg.
  • Oligonucleotide SPA.S Oligonucleotide SPA.S:
  • Oligonucleotide SPA.A Oligonucleotide SPA.A:
  • PCR Fragment SPA 5 ' tcgagaataaaagatcagagctctagagatctgtgtgttggttttttgtgtgcggccgctcga 3 '
  • SPA was inserted into the Xhol site of pZero-2 to create pZero-2.SPA.
  • SPA was excised from a pZero-2.SPA clone and inserted into the Xhol site of pZ8.LdB.egg to create pZ ⁇ .I.dB.egg.A.
  • pAAV-CMV-FIX9 was digested with Clal, blunted with T4 polymerase and religated to create pAAV(Cla ' )-CMN-FIX9.
  • AAV vectors were produced from these plasmids using the Ad free system as previously described in U.S. Patent No. 5,858,351; U.S. Patent No. 5,846,528; U.S. Patent No. 5,622,856; and Matsushita et al, Gene Ther 5:938 (1998) all of which are hereby inco ⁇ orated by reference. Briefly, 293 cells (ATCC, catalog number CRL- 1573) were seeded in 10 cm dishes at a density of 3 x 10 6 cells per dish in 10 ml medium and incubated at 37°C with CO 2 and humidity. After an overnight incubation, cells were approximately seventy to eighty percent confluent.
  • the cells were then transfected with DNA by the calcium phosphate method, as is well known in the art. Briefly, 7 ⁇ g of AAV vector containing the Factor VIII coding region, 7 ⁇ g of pladeno5 which supplies the accessory functions, and 7 ⁇ g of 1909 AAV helper were added to a 3 ml sterile, polystyrene snap cap tube using sterile pipette tips. Then, 1.0 ml of 300 mM CaCl 2 (JRH grade) was added to each tube and mixed by pipetting up and down.
  • AAV vector containing the Factor VIII coding region 7 ⁇ g of pladeno5 which supplies the accessory functions
  • 7 ⁇ g of 1909 AAV helper were added to a 3 ml sterile, polystyrene snap cap tube using sterile pipette tips. Then, 1.0 ml of 300 mM CaCl 2 (JRH grade) was added to each tube and mixed by pipetting up and down.
  • the cells were harvested, pelleted, and resuspended in 1 ml TBS/1% BSA. Freeze/thaw extracts were prepared by repeatedly (three times) freezing the cell suspension on dry ice and thawing at 37°C. Viral preps were stored at -80°C and titered by dot blot assay prior to the first round of infection.
  • EXAMPLE 4 In Vitro Cell Transduction Cells from the stable human cell line, 293 (ATCC No. CRL1573) were seeded in six-well plates (i.e., plates having six wells for cell growth) at a density of 5x10 5 cells/well. When the monolayers reached 80-90% confluence, they were infected with rAAV virions AAV-e ⁇ D-FVIII-HC, AAV-e ⁇ D-FVHI-LC, an equal ratio of AAV-e ⁇ D- FVIII-HC and AAV-e ⁇ D-FVIII-LC, or AAV-e ⁇ D-FIX at MOIs of 3xl0 3 and 3xl0 4 .
  • ICA infectious center assay
  • the standards contained 50% media, and for analysis of mouse plasma, the standards were diluted into 10%, in normal pooled mouse plasma (Sigma).
  • a standard assay reference plasma (SARP; Helena Labs) was also included in the assay.
  • SARP standard assay reference plasma
  • the plate was incubated at room temperature for 2 hours, and washed five times with wash buffer (200 ⁇ l/well).
  • the ChromZ FVIII coagulation activity (FVIII-c) assay (Helena Labs, Beaumont, TX) was used to detect biologically active FVIII in the 293 cells infected as described in Example 4.
  • Bioclate recombinant human FVIII (Baxter Hyland) was used as a standard to analyze transfected culture supernatants.
  • the standards were diluted in plasma dilution buffer (supplied in kit) in the range of 10 ng/ml to 0.313 ng/ml, and were made 2.5% in media. Because this assay can detect both human and murine FVIII activity, it was modified to deplete biologically active human Factor VIII in the mouse plasma.
  • Mouse plasma was pre-incubated with an antibody specific for human FVIII prior to performing the assay.
  • the difference in FVIII activity between the untreated plasma sample and the antibody treated sample represent the amount of biologically active human FVIII in the plasma.
  • the standard used in the assay was normal pooled human plasma (FACT; obtained from George King Biomedical). Serial dilutions of FACT were made in FVLI deficient plasma from undiluted (200 ng/ml) to 6.25 ng/ml.
  • the standards (10 ⁇ l) were incubated at 37°C for 15 min., with or without the addition of 2 ⁇ l antibody N77110.
  • mouse plasma samples were diluted in FVIII deficient plasma and 10 ⁇ l of these diluted samples were incubated with or without 2 ⁇ l of N77110 at 37°C for 15 min., and immediately placed on ice. Thus, all incubations with antibody were done in a background of 100% plasma.
  • the antibody adsorbed and non-adsorbed FACT standards, as well as the mouse plasma samples were diluted 1 :20 in plasma detection buffer provided in the ChromZ kit.
  • the final concentration of the FACT standards used in the assay ranged from 10 ng/ml to 0.313 ng/ml. Twenty five microliters of these dilutions were added to a chilled 96 well plate.
  • EXAMPLE 8 Immunofluorescent Staining of FVIII Heavy and Light Chains
  • 293 cells transduced as described above were analyzed using immunofluorescent staining.
  • 293 cells were plated on rat tail collagen-coated two- well culture slides at a density of 4 x 10 5 cells per well. Forty-eight hours later, the cells were transduced at an MOI of 3 x 10 4 particles per cell of rAAV-hFVHI-HC and rAAV-hFVIII-LC.
  • the cells were fixed in situ with acetone, blocked with 2% BSA, and stained with a fluorescently labelled anti- hFVIII light chain antibody and a fluorescently labelled anti-hFVIII heavy chain antibody.
  • the anti-hFVIII light chain antibody used was ESH-4 monoclonal antibody (American Diagnostica), fluorescently labelled with alexa-488 (Molecular Probes), according to the manufacturer's instructions.
  • the anti-hFVIII heavy chain antibody used was MAS530P monoclonal antibody (Accurate Chemical) fluorescently labelled with alexa-594 (Molecular Probes), according to the manufacturer's instructions.
  • the cells were counter-stained with DAPI.
  • the images were collected using a Zeiss Axioskop fluorescence microscope equipped with separate filters for DAPI, FITC, and rhodamine signals and a CCD camera. Image analysis was performed using Quips imaging software (Vysis).
  • Table 2 shows that two single vector constructs containing the heavy and the light chain of Factor VHI driven by different promoters express biologically active Factor VHI.
  • the constructs pAAV-hF8-l (SEQ ID NO:13), and pVm4.1cF8 ⁇ B (SEQ ID NO: 14) were transfected into 293 cells. Following transfection, the cells were allowed to express factor VHI for 48-72 hours. Factor VHI in the culture media was assayed by the ChromZ FVIII coagulation activity (FVIII-c) assay, as per the manufacturer's instructions.
  • EXAMPLE 10 Factor Vi ⁇ Expression Using Tissue Specific Promoters In these experiments, different promoters and enhancer elements were used to drive expression of a Factor VII coding sequence. Expression of Factor VIII was compared in 293 cells and HepG2 cells using different promoters.
  • the pAAVeF8 ⁇ B contains an EF-l ⁇ promoter with a hGH intron, Factor VHI with a B-domain deletion (F8 ⁇ B) and a polyA.
  • F8 ⁇ B B-domain deletion
  • pAAV-hF8-l uses the HNF-3 albumin promoter with a minimal intron followed by F8 ⁇ B and a minimal polyA.
  • the construct pAAV-c8 uses the CMV enhancer-promoter and the F8 ⁇ B.
  • pAAV ⁇ bl contains the HNF-3 albumin promoter followed by the CMV/B-globin intron with the F8 ⁇ B and a minimal poly A site.
  • Table 3 describes Factor VHI expression using the albumin promoter relative to the control plasmid pV4JeF ⁇ B in HepG2 and 293 cells. These data show increased expression of Factor VIII in HepG2 liver cells with the albumin promoter as compared to Factor VTII expression in 293 cells.
  • TTR transthyretin
  • the TTR enhancer- promoter was modified by replacing the weak affinity binding sites with the strong affinity binding sites to create pAAV-hF ⁇ -2.
  • the ⁇ AAV-hF ⁇ -TTR-E-L-P202 construct contains the full TTR promoter with a linker between the enhancer and the promoter.
  • the remaining constructs are 5' deletions: pAAV-hF8-TTR-E-P202 has the promoter and enhancer with no linker; pAAV-hF8-TTR-E-P197 has a 5 base pair deletion from the promoter; pAAV-hF ⁇ -TTR-E-P151 has a 50 base pair deletion; pAAV-hF ⁇ -TTR- P202 lacks the TTR enhancer and pAAV-hF ⁇ -TTR(X) has a 65 base pair deletion in the enhancer.
  • the control plasmid, pAAV-hF8-l expressed approximately 4.6 mU/ml. Table 4 shows the fold-increase in Factor VIII activity using the TTR promoter series relative to the control plasmid. TABLE 4 Factor VIII Expression Using TTR-Derived Promoters
  • mice were injected via the portal vein with either 3x10" particles of AAV-e ⁇ D-FVm-HC, 3xl0 ⁇ particles of AAV-e ⁇ D- FVm-LC, or 3x10" particles of both AAV-e ⁇ D-FVm-HC and AAV-e ⁇ D-FVffl-LC.
  • a group of four animals was injected with 3x10" particles of AAV-e ⁇ D- FIX.
  • a modified ChromZ assay was used. Since this assay detects both human and murine FVIII, the amount of FVIII present in the plasma before and after adso ⁇ tion to an antibody specific to human FVIII was determined. The amount of FVIII remaining in the plasma after adso ⁇ tion represented the amount of active murine FVIII and the difference represented the amount of active human FVIII. Control experiments demonstrated that the antibody could remove ⁇ 0-90% of the human FVIII from a mouse plasma sample when the sample was spiked with up to 32 ng of human FVIII.
  • the modified ChromZ assay indicated that only those animals injected with both vectors produced biologically active FVIII, as indicated in Table 5.
  • mice co-injected with both the heavy and light chain vector did not express VHI, presumably due to an inefficient injection, and was omitted from the analysis.
  • Animals injected with both vectors produced over 2 ⁇ g/ml hFVHI light chain as measured by ELISA.
  • the ChromZ assay indicated that a total of 600-900 ng/ml of active hFVin was detected in the plasma.
  • the contribution from murine Factor VTII was approximately 400-500 ng/ml, indicating that about 230-430 ng/ml of active human Factor VIII was present in the plasma.
  • RNA with 5/gII-digested heavy or light chain plasmid DNA (pVm4.1e ⁇ D-hFVIII-HC and pVm4Je ⁇ D-hFVIII-LC, respectively), at ratios of 10, 5, 1, 01, and 0.01 copies per diploid genome.
  • the hybridized membranes were analyzed using a Storm ⁇ 60 phosphoimager (Molecular Dynamics), and quantitation of vector copy number was evaluated using ImageQuaNT software (Molecular Dynamics). Autoradiography of the hybridized membranes was also performed. Total RNA was isolated from liver tissue using the RNA Stat extraction kit (Tel-Test).
  • Northern blot analysis was also performed on 10 ⁇ g RNA using methods known in the art, in conjunction with the 32 P-labelled probes specific to the heavy and light chains of hFVIII described above and autoradiography was performed on the hybridized membranes.
  • Phosphoimage analysis revealed that the light chain vector was present at approximately 2.4 and 1.5 copies per diploid genome in animals injected with the light chain vector alone or both vectors, respectively.
  • -SgtTI-digested DNA was hybridized with an hFVIII heavy chain probe, the expected band of 231 ⁇ bp was observed in animals injected with the heavy chain vector alone or both vectors, but was not detected in animals injected with the light chain vector alone or the hFIX vector, as shown in Figure 9B.
  • the copy number in animals injected with the heavy chain vector alone and both vectors was 1.1 and 1.7 vector copies per diploid genome, respectively.
  • the expected hFVIII heavy chain transcripts (2.7 kb) were detected in animals that were injected with the heavy chain vector alone or both vectors, as shown in Figure 11B. Since the heavy and light chain DNA sequences were shown by Southern blot analysis to be present at approximately the same copy number (1.7 and 1.5 copies per diploid genome, respectively), in an animal injected with both vectors, these results demonstrate that both the heavy and light chains of hFVIII are expressed in the liver in approximately equivalent amounts.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Diabetes (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/US1999/024495 1998-10-20 1999-10-19 Adeno-associated vectors for expression of factor viii by target cells Ceased WO2000023116A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
JP2000576889A JP2002527493A (ja) 1998-10-20 1999-10-19 標的細胞による第viii因子の発現のためのアデノ随伴ベクター
IL14272199A IL142721A0 (en) 1998-10-20 1999-10-19 Adeno-associated vectors for expression of factor viii by target cells
EP99955065A EP1124583A4 (en) 1998-10-20 1999-10-19 ADENO-ASSOCIATED VECTORS FOR EXPRESSION OF FACTOR VIII BY TARGET CELLS
MXPA01004067A MXPA01004067A (es) 1998-10-20 1999-10-19 Vectores adeno-asociados para la expresion del factor viii por celulas objetivo.
KR1020017004962A KR20010082234A (ko) 1998-10-20 1999-10-19 표적 세포에 의한 인자 viii의 발현을 위한 아데노관련 벡터
BR9914643-6A BR9914643A (pt) 1998-10-20 1999-10-19 Vetores adeno-associados para expressão dofator viii por células alvo
CA002348068A CA2348068A1 (en) 1998-10-20 1999-10-19 Adeno-associated vectors for expression of factor viii by target cells
AU11256/00A AU757688B2 (en) 1998-10-20 1999-10-19 Adeno-associated vectors for expression of factor VIII by target cells

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US10499498P 1998-10-20 1998-10-20
US60/104,994 1998-10-20
US12597499P 1999-03-24 1999-03-24
US60/125,974 1999-03-24
US09/364,862 1999-07-30
US09/364,862 US6221349B1 (en) 1998-10-20 1999-07-30 Adeno-associated vectors for expression of factor VIII by target cells

Publications (1)

Publication Number Publication Date
WO2000023116A1 true WO2000023116A1 (en) 2000-04-27

Family

ID=27379851

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/024495 Ceased WO2000023116A1 (en) 1998-10-20 1999-10-19 Adeno-associated vectors for expression of factor viii by target cells

Country Status (11)

Country Link
US (1) US6221349B1 (enExample)
EP (1) EP1124583A4 (enExample)
JP (1) JP2002527493A (enExample)
KR (1) KR20010082234A (enExample)
CN (1) CN1329509A (enExample)
AU (1) AU757688B2 (enExample)
BR (1) BR9914643A (enExample)
CA (1) CA2348068A1 (enExample)
IL (1) IL142721A0 (enExample)
MX (1) MXPA01004067A (enExample)
WO (1) WO2000023116A1 (enExample)

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001027303A1 (en) * 1999-10-12 2001-04-19 The University Of North Carolina At Chapel Hill Adeno-associated virus vectors encoding factor viii and methods of using the same
US6593123B1 (en) * 2000-08-07 2003-07-15 Avigen, Inc. Large-scale recombinant adeno-associated virus (rAAV) production and purification
WO2002055110A3 (en) * 2000-10-25 2004-01-08 Genzyme Corporation Methods for treating blood coagulation disorders
WO2004111246A1 (en) * 2003-06-19 2004-12-23 Peter Bromley Protein production system
EP1379134A4 (en) * 2001-03-14 2006-04-05 Genteric Inc GENERAL TRANSFERRED TRANSFERRED TO THE RETRODUCTAL INFUSION OF VIRIONS BY RECOMBINANT ADENO-ASSOCIATED VIRUS
US7485291B2 (en) 2003-06-03 2009-02-03 Cell Genesys, Inc. Compositions and methods for generating multiple polypeptides from a single vector using a virus derived peptide cleavage site, and uses thereof
US7498024B2 (en) 2003-06-03 2009-03-03 Cell Genesys, Inc. Compositions and methods for enhanced expression of immunoglobulins from a single vector using a peptide cleavage site
WO2016012595A1 (en) * 2014-07-25 2016-01-28 Csl Behring Gmbh Improved factor viii preparations suitable for therapeutic use and processes to obtain these
WO2016073693A3 (en) * 2014-11-05 2016-06-30 Voyager Therapeutics, Inc. Aadc polynucleotides for the treatment of parkinson's disease
US11298041B2 (en) 2016-08-30 2022-04-12 The Regents Of The University Of California Methods for biomedical targeting and delivery and devices and systems for practicing the same
US11497576B2 (en) 2017-07-17 2022-11-15 Voyager Therapeutics, Inc. Trajectory array guide system
US11759506B2 (en) 2017-06-15 2023-09-19 Voyager Therapeutics, Inc. AADC polynucleotides for the treatment of Parkinson's disease
US11779656B2 (en) 2016-04-15 2023-10-10 The Trustees Of The University Of Pennsylvania Gene therapy for treating hemophilia A
US12168776B2 (en) 2017-08-09 2024-12-17 Bioverativ Therapeutics Inc. Nucleic acid molecules and uses thereof
US12319929B2 (en) 2018-05-15 2025-06-03 Voyager Therapeutics, Inc. Compositions and methods for the treatment of Parkinson's disease
US12364774B2 (en) 2018-08-09 2025-07-22 Bioverativ Therapeutics Inc. Nucleic acid molecules and uses thereof for non-viral gene therapy

Families Citing this family (70)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2265460A1 (en) 1996-09-11 1998-03-19 The Government Of The United States Of America, Represented By The Secre Tary, Department Of Health And Human Services Aav4 vector and uses thereof
US6436392B1 (en) * 1998-05-20 2002-08-20 University Of Iowa Research Foundation Adeno-associated virus vectors
US6797505B2 (en) * 1998-05-27 2004-09-28 Cell Genesys, Inc. Recombinant AAV vectors for gene therapy of hemophilia A
EP1082413B1 (en) * 1998-05-28 2008-07-23 THE GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES Aav5 vector and uses thereof
US6200560B1 (en) * 1998-10-20 2001-03-13 Avigen, Inc. Adeno-associated virus vectors for expression of factor VIII by target cells
US7122335B1 (en) 1999-06-08 2006-10-17 University Of Iowa Research Foundation Compounds and methods to enhance rAAV transduction
EP1190249A2 (en) * 1999-06-08 2002-03-27 University Of Iowa Research Foundation Compounds and methods to enhance raav transduction
US7241447B1 (en) * 1999-10-07 2007-07-10 University Of Iowa Research Foundation Adeno-associated virus vectors and uses thereof
US6582692B1 (en) * 1999-11-17 2003-06-24 Avigen, Inc. Recombinant adeno-associated virus virions for the treatment of lysosomal disorders
JP2003533437A (ja) * 2000-02-17 2003-11-11 ジェンザイム・コーポレイション 遺伝子デリバリーのための門戸としての肺の遺伝的修飾
US6855314B1 (en) * 2000-03-22 2005-02-15 The United States Of America As Represented By The Department Of Health And Human Services AAV5 vector for transducing brain cells and lung cells
US20020159978A1 (en) * 2001-02-06 2002-10-31 James Allen Muscle-directed gene transfer by use of recombinant AAV-1 and AAV-6 virions
CN1520259A (zh) * 2001-04-25 2004-08-11 ���ݴ�ѧУ��ίԱ�� 利用球状载体将第八因子/第九因子进行肝脏基因转移治疗血友病的方法
EP1395293B1 (en) 2001-05-14 2009-07-22 Gbp Ip, Llc Lentiviral vectors encoding clotting factors for gene therapy
US8241622B2 (en) * 2001-07-13 2012-08-14 University Of Iowa Research Foundation Adeno-associated virus vectors with intravector heterologous terminal palindromic sequences
WO2003013244A1 (en) 2001-08-03 2003-02-20 The Government Of The United State Of America, As Represented By The Secretary Of The Department Of Health And Human Services Oral treatment of hemophilia
WO2003018611A2 (en) 2001-08-24 2003-03-06 University Of Victoria Innovation And Development Corporation Proaerolysin containing protease activation sequences and methods of use for treatment of prostate cancer
US20030235555A1 (en) * 2002-04-05 2003-12-25 David Shealey Asthma-related anti-IL-13 immunoglobulin derived proteins, compositions, methods and uses
US7419817B2 (en) * 2002-05-17 2008-09-02 The United States Of America As Represented By The Secretary Department Of Health And Human Services, Nih. Scalable purification of AAV2, AAV4 or AAV5 using ion-exchange chromatography
KR100535325B1 (ko) * 2002-09-24 2005-12-09 한국생명공학연구원 Aav 유전자 전달체 제조용 헬퍼 플라스미드
US20040092008A1 (en) * 2002-11-12 2004-05-13 Snyder Richard O. Recombinant AAV vectors for gene therapy of hemophilia A
US20050095225A1 (en) * 2003-03-31 2005-05-05 Engelhardt John F. Compounds and methods for pharmico-gene therapy of epithelial sodium channel associated disorders
US7963956B2 (en) * 2003-04-22 2011-06-21 Antisense Pharma Gmbh Portable equipment for administration of fluids into tissues and tumors by convection enhanced delivery technique
US8927269B2 (en) 2003-05-19 2015-01-06 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Avian adenoassociated virus and uses thereof
ES2874298T3 (es) 2003-09-30 2021-11-04 Univ Pennsylvania Clados de virus adenoasociados (AAV), secuencias, vectores que contienen el mismo, y usos de los mismos
US8137960B2 (en) * 2003-12-04 2012-03-20 The United States Of America As Represented By The Department Of Health And Human Services Bovine adeno-associated viral (BAAV) vector and uses thereof
US20080188431A1 (en) * 2004-09-08 2008-08-07 Chiorini John A Transcytosis of Adeno-Associated Viruses
ES2428218T3 (es) 2005-04-07 2013-11-06 The Trustees Of The University Of Pennsylvania Cápsides de AAV rh48 modificadas, composiciones que las contienen y usos de las mismas
WO2006108590A1 (en) * 2005-04-14 2006-10-19 Csl Behring Gmbh Modified coagulation factor viii with enhanced stability and its derivates
US8283151B2 (en) * 2005-04-29 2012-10-09 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Isolation, cloning and characterization of new adeno-associated virus (AAV) serotypes
DK2282764T3 (da) * 2008-04-22 2019-10-14 Vib Vzw Leverspecifikke nukleinsyreregulerende elementer samt fremgangsmåder og anvendelser heraf
US9315825B2 (en) 2010-03-29 2016-04-19 The Trustees Of The University Of Pennsylvania Pharmacologically induced transgene ablation system
SG10201601110VA (en) 2011-02-17 2016-03-30 Univ Pennsylvania Compositions and methods for altering tissue specificity and improving aav9-mediated gene transfer
GB201210357D0 (en) 2012-06-12 2012-07-25 Ucl Business Plc Factor VIII sequences
CN103215308B (zh) * 2013-02-01 2015-12-23 中国科学院苏州生物医学工程技术研究所 表达重组人fviii的整合质粒、细胞株及其构建方法和应用
WO2015012924A2 (en) 2013-04-29 2015-01-29 The Trustees Of The University Of Pennsylvania Tissue preferential codon modified expression cassettes, vectors containing same, and use thereof
SI3044231T1 (sl) 2013-09-12 2020-12-31 Biomarin Pharmaceutical Inc. Vektorji AAV, ki vsebujejo gen, ki kodira faktor VIII
CN104087613B (zh) * 2014-06-30 2017-08-29 中国科学院苏州生物医学工程技术研究所 基于aav‑itr的基因表达微载体及其构建方法和应用
CA3237630A1 (en) * 2014-08-13 2016-02-18 The Children's Hospital Of Philadelphia An improved expression cassette for packaging and expression of variant factor viii for the treatment of hemostasis disorders
ES3009565T3 (en) * 2015-04-16 2025-03-27 Univ Emory Recombinant promoters and vectors for protein expression in liver and use thereof
KR102745604B1 (ko) * 2015-08-06 2024-12-23 더 트러스티스 오브 더 유니버시티 오브 펜실베니아 Glp-1 및 대사성 질환 치료용 조성물에서 이의 용도
RU2020126034A (ru) 2015-09-24 2020-09-02 Байомарин Фармасьютикал Инк. Векторы фактора fviii на основе аденоассоциированных вирусов, соответствующие вирусные частицы и содержащие их терапевтические композиции
EP3368664A4 (en) 2015-10-28 2019-08-28 Sangamo Therapeutics, Inc. LIFE-SPECIFIC CONSTRUCTS, FACTOR VIII EXPRESSION CASSETTES AND METHOD OF USE THEREOF
EA036944B1 (ru) * 2015-11-13 2021-01-19 Баксалта Инкорпорейтед Вирусные векторы, кодирующие рекомбинантные варианты fviii с повышенной экспрессией для генной терапии гемофилии a
AU2016353353B2 (en) * 2015-11-13 2020-07-09 Takeda Pharmaceutical Company Limited Viral vectors encoding recombinant FVIII variants with increased expression for gene therapy of hemophilia A
EP3384034B1 (en) 2015-12-02 2020-07-08 The Board of Trustees of the Leland Stanford Junior University Novel recombinant adeno-associated virus capsids with enhanced human skeletal muscle tropism
WO2017139381A1 (en) 2016-02-08 2017-08-17 University Of Iowa Research Foundation Methods to produce chimeric adeno-associated virus/bocavirus parvovirus
AU2017219865B2 (en) 2016-02-16 2023-04-13 The Board Of Trustees Of The Leland Stanford Junior University Novel recombinant adeno-associated virus capsids resistant to pre-existing human neutralizing antibodies
EP3210632B1 (en) * 2016-02-23 2022-09-28 EyeServ GmbH Gene therapy for the treatment of a retinal degeneration disease
MX2018010842A (es) 2016-03-07 2019-07-04 Univ Iowa Res Found Expresion mediada por el virus adeno-asociado (aav) usando un promotor y pontenciador sintetico.
WO2017205739A1 (en) 2016-05-26 2017-11-30 University Of Iowa Research Foundation cis AND trans REQUIREMENTS FOR TERMINAL RESOLUTION OF HUMAN BOCAVIRUS 1
WO2018132747A1 (en) 2017-01-13 2018-07-19 University Of Iowa Research Foundation Bocaparvovirus small noncoding rna and uses thereof
JOP20190200A1 (ar) 2017-02-28 2019-08-27 Univ Pennsylvania تركيبات نافعة في معالجة ضمور العضل النخاعي
WO2018160582A1 (en) 2017-02-28 2018-09-07 The Trustees Of The University Of Pennsylvania Adeno-associated virus (aav) clade f vector and uses therefor
US12416016B2 (en) 2018-02-27 2025-09-16 The Trustees Of The University Of Pennsylvania Adeno-associated virus (AAV) vectors, AAV vectors having reduced capsid deamidation and uses therefor
EP3774853A1 (en) 2018-03-30 2021-02-17 The Board of Trustees of the Leland Stanford Junior University Novel recombinant adeno-associated virus capsids with enhanced human pancreatic tropism
TW202005978A (zh) 2018-05-14 2020-02-01 美商拜奧馬林製藥公司 新穎肝靶向腺相關病毒載體
EP3802788B1 (en) * 2018-05-15 2025-07-02 Duke University Systems and methods for genetic manipulation of akkermansia species
EP3969061A1 (en) * 2019-05-14 2022-03-23 BioMarin Pharmaceutical Inc. Methods of redosing gene therapy vectors
JP7575761B2 (ja) * 2019-07-03 2024-10-30 学校法人日本医科大学 核酸封入aav中空粒子の製造方法
CN111876400B (zh) * 2020-08-06 2022-05-24 昆明理工大学 一种常温裂解酶Sly和编码此酶的多核苷酸
US20240043494A1 (en) 2020-08-07 2024-02-08 Amicus Therapeutics, Inc. Vesicle Targeting Proteins And Uses Of Same
EP4196170A1 (en) 2020-08-14 2023-06-21 The Trustees of The University of Pennsylvania Novel aav capsids and compositions containing same
CA3195553A1 (en) 2020-10-18 2022-04-21 Qiang Wang Improved adeno-associated virus (aav) vector and uses therefor
TW202233844A (zh) 2020-10-29 2022-09-01 賓州大學委員會 Aav衣殼及含有其之組成物
TW202309066A (zh) 2021-04-27 2023-03-01 賓州大學委員會 衍生自豬的腺相關病毒衣殼及其用途
US20250129381A1 (en) 2021-06-23 2025-04-24 Asklepios Biopharmaceutical, Inc. Regulatory nucleic acid sequences
WO2024015966A2 (en) 2022-07-15 2024-01-18 The Trustees Of The University Of Pennsylvania Recombinant aav having aav clade d and clade e capsids and compositions containing same
WO2024133600A1 (en) 2022-12-20 2024-06-27 Nanocell Therapeutics B.V. Integrating and self-inactivating viral vectors and constructs and uses thereof
EP4389899A1 (en) 2022-12-22 2024-06-26 Synpromics Ltd. Regulatory nucleic acid sequences

Family Cites Families (62)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4722848A (en) 1982-12-08 1988-02-02 Health Research, Incorporated Method for immunizing animals with synthetically modified vaccinia virus
US4886876A (en) 1983-03-31 1989-12-12 Scripps Clinic And Research Foundation Factor VIII coagulant polypeptides
US4757006A (en) 1983-10-28 1988-07-12 Genetics Institute, Inc. Human factor VIII:C gene and recombinant methods for production
WO1985001961A1 (en) 1983-10-28 1985-05-09 Genetics Institute Production of factor viii and related products
US5045455A (en) 1984-01-12 1991-09-03 Chiron Corporation Factor VIII:C cDNA cloning and expression
US4965199A (en) 1984-04-20 1990-10-23 Genentech, Inc. Preparation of functional human factor VIII in mammalian cells using methotrexate based selection
IL74909A (en) 1984-04-20 1992-01-15 Genentech Inc Preparation of functional human factor viii and dna sequences,expression vectors,transformed microorganisms and cell lines used therein
EP0182448A3 (en) 1984-08-24 1987-10-28 Genetics Institute, Inc. Production of factor viii and related products
DE3538181A1 (de) 1985-10-26 1987-04-30 Messer Griesheim Gmbh Vorrichtung zur automatischen begrenzung des fuellstandes kryogener fluessigkeiten
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
FI98829C (fi) 1986-01-27 1997-08-25 Chiron Corp Menetelmä rekombinoidun proteiinikompleksin valmistamiseksi, jolla on humaanitekijä VIII:C-aktiivisuutta
US5595886A (en) 1986-01-27 1997-01-21 Chiron Corporation Protein complexes having Factor VIII:C activity and production thereof
US5426029A (en) 1986-03-31 1995-06-20 T Cell Diagnostics, Inc. Therapeutic and diagnostic methods using leukocyte surface antigens
US5451521A (en) 1986-05-29 1995-09-19 Genetics Institute, Inc. Procoagulant proteins
US5422260A (en) 1986-05-29 1995-06-06 Genetics Institute, Inc. -Legal Affairs Human factor VIII:c muteins
US5219740A (en) 1987-02-13 1993-06-15 Fred Hutchinson Cancer Research Center Retroviral gene transfer into diploid fibroblasts for gene therapy
US5149637A (en) 1987-04-06 1992-09-22 Scripps Clinic & Research Foundation Recombinant Factor VIIIC fragments
IE69026B1 (en) 1987-06-12 1996-08-07 Immuno Ag Novel proteins with factor VIII activity process for their preparation using genetically-engineered cells and pharmaceutical compositions containing them
WO1988009809A2 (en) 1987-06-12 1988-12-15 Cetus Corporation Cell system for expression of recombinant protein without production of virus
FR2619314B1 (fr) 1987-08-11 1990-06-15 Transgene Sa Analogue du facteur viii, procede de preparation et composition pharmaceutique le contenant
DE10399032I1 (de) 1987-08-28 2004-01-29 Health Research Inc Rekombinante Viren.
US5004803A (en) 1988-11-14 1991-04-02 Genetics Institute, Inc. Production of procoagulant proteins
US5399346A (en) 1989-06-14 1995-03-21 The United States Of America As Represented By The Department Of Health And Human Services Gene therapy
US5436146A (en) 1989-09-07 1995-07-25 The Trustees Of Princeton University Helper-free stocks of recombinant adeno-associated virus vectors
US5225347A (en) 1989-09-25 1993-07-06 Innovir Laboratories, Inc. Therapeutic ribozyme compositions and expression vectors
JP2865861B2 (ja) 1989-11-17 1999-03-08 ノボ ノルディスク アクティーゼルスカブ 第▲viii▼:c因子活性を有するタンパク質複合体およびその製法
SE465222C5 (sv) 1989-12-15 1998-02-10 Pharmacia & Upjohn Ab Ett rekombinant, humant faktor VIII-derivat och förfarande för dess framställning
AU7906691A (en) 1990-05-23 1991-12-10 United States of America, as represented by the Secretary, U.S. Department of Commerce, The Adeno-associated virus (aav)-based eucaryotic vectors
WO1992001070A1 (en) 1990-07-09 1992-01-23 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce High efficiency packaging of mutant adeno-associated virus using amber suppressions
MY109299A (en) 1990-08-15 1996-12-31 Virogenetics Corp Recombinant pox virus encoding flaviviral structural proteins
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
US5661008A (en) 1991-03-15 1997-08-26 Kabi Pharmacia Ab Recombinant human factor VIII derivatives
SE468050C (sv) 1991-03-15 1998-04-27 Pharmacia & Upjohn Ab Rekombinant derivat av human faktor VIII
DE69230105T2 (de) 1991-07-29 2000-01-20 Serex Inc., Maywood Differentielle bindungsaffinitäten und darauf beruhende dissoziationstestverfahren
DK0648271T3 (da) 1991-08-20 2003-07-21 Us Gov Health & Human Serv Adenovirusmedieret overførsel af gener til mave-/tarmkanal
CA2078721A1 (en) 1991-09-24 1993-03-25 Hiroshi Yonemura Process for preparing human coagulation factor viii protein complex
US5252479A (en) 1991-11-08 1993-10-12 Research Corporation Technologies, Inc. Safe vector for gene therapy
US5587308A (en) 1992-06-02 1996-12-24 The United States Of America As Represented By The Department Of Health & Human Services Modified adeno-associated virus vector capable of expression from a novel promoter
CA2106260A1 (en) 1992-09-17 1994-03-18 Robert M. Kotin Human adeno-associated virus integration site dna and uses thereof
US5563045A (en) 1992-11-13 1996-10-08 Genetics Institute, Inc. Chimeric procoagulant proteins
AU5602394A (en) 1992-11-13 1994-06-08 Duke University Chimeric blood coagulation proteins
US5478745A (en) 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
DE69433925T2 (de) 1993-06-10 2005-07-28 Bayer Corp. Vektoren und Zelllinien von Säugetieren mit erhöhter Produktivität
JPH08511423A (ja) * 1993-06-10 1996-12-03 ジェネティック セラピー,インコーポレイテッド 血友病治療のためのアデノウイルスベクター
AU7676894A (en) 1993-08-27 1995-03-21 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Convection-enhanced drug delivery
US5834441A (en) 1993-09-13 1998-11-10 Rhone-Poulenc Rorer Pharmaceuticals Inc. Adeno-associated viral (AAV) liposomes and methods related thereto
DK0733103T3 (da) 1993-11-09 2004-07-12 Univ Johns Hopkins Fremstilling af höje titre af rekombinante AAV vektorer
US5693531A (en) 1993-11-24 1997-12-02 The United States Of America As Represented By The Department Of Health And Human Services Vector systems for the generation of adeno-associated virus particles
US5658785A (en) 1994-06-06 1997-08-19 Children's Hospital, Inc. Adeno-associated virus materials and methods
AUPM901594A0 (en) 1994-10-26 1994-11-17 Ici Australia Operations Proprietary Limited Apparatus and process for loading upholes with explosives
US5872005A (en) 1994-11-03 1999-02-16 Cell Genesys Inc. Packaging cell lines for adeno-associated viral vectors
US6342390B1 (en) 1994-11-23 2002-01-29 The United States Of America As Represented By The Secretary Of Health And Human Services Lipid vesicles containing adeno-associated virus rep protein for transgene integration and gene therapy
US5843742A (en) 1994-12-16 1998-12-01 Avigen Incorporated Adeno-associated derived vector systems for gene delivery and integration into target cells
US5681746A (en) 1994-12-30 1997-10-28 Chiron Viagene, Inc. Retroviral delivery of full length factor VIII
US5677158A (en) 1995-06-07 1997-10-14 Research Foundation Of State University Of New York In vitro packaging of adeno-associated virus DNA
AU6486196A (en) 1995-07-11 1997-02-10 Chiron Corporation Novel factor viii:c polypeptide analogs with altered protease sites
US5622856A (en) 1995-08-03 1997-04-22 Avigen High efficiency helper system for AAV vector production
US5858351A (en) 1996-01-18 1999-01-12 Avigen, Inc. Methods for delivering DNA to muscle cells using recombinant adeno-associated virus vectors
US5846528A (en) 1996-01-18 1998-12-08 Avigen, Inc. Treating anemia using recombinant adeno-associated virus virions comprising an EPO DNA sequence
US6521225B1 (en) * 1996-09-06 2003-02-18 Chiron Corporation AAV vectors
US6797505B2 (en) * 1998-05-27 2004-09-28 Cell Genesys, Inc. Recombinant AAV vectors for gene therapy of hemophilia A
AU4185699A (en) * 1998-05-27 1999-12-13 Avigen, Inc. Adeno-associated viral vector-mediated expression of factor viii activity

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CONNELLY ET AL.: "Complete short-term correction of canine hemophilia A by in vivo gene therapy", BLOOD, vol. 88, no. 10, 15 November 1996 (1996-11-15), pages 3846 - 3853, XP002926495 *
CONNELLY ET AL.: "Sustained phenotypic correction of murine hemophilia A by in vivo gene therapy", BLOOD, vol. 91, no. 9, 1 May 1998 (1998-05-01), pages 3273 - 3281, XP002926494 *
LOZIER ET AL.: "Gene therapy and the hemophilias", JAMA (J. AM. MED. ASSOC.), vol. 271, no. 1, 4 January 1994 (1994-01-04), pages 47 - 51, XP002926492 *
See also references of EP1124583A4 *
SNYDER R. O. ET AL.: "Persistent and therapeutic concentrations of human factor IX in mice after hepatic gene transfer of recombinant AAV vectors", NATURE GENETICS, vol. 16, no. 3, July 1997 (1997-07-01), pages 270 - 276, XP002926493 *
ZATLOUKAL K. ET AL.: "In vivo production of human factor VIII in mice after intrasplenic implantation of primary fibroblasts transfected by receptor-mediated, adenovirus-augmented gene delivery", PROC. NATL. ACAD. SCI. USA, vol. 91, no. 11, May 1994 (1994-05-01), pages 5148 - 5152, XP002926496 *

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001027303A1 (en) * 1999-10-12 2001-04-19 The University Of North Carolina At Chapel Hill Adeno-associated virus vectors encoding factor viii and methods of using the same
US6593123B1 (en) * 2000-08-07 2003-07-15 Avigen, Inc. Large-scale recombinant adeno-associated virus (rAAV) production and purification
WO2002055110A3 (en) * 2000-10-25 2004-01-08 Genzyme Corporation Methods for treating blood coagulation disorders
US7615537B2 (en) 2000-10-25 2009-11-10 Genzyme Corporation Methods for treating blood coagulation disorders
EP1379134A4 (en) * 2001-03-14 2006-04-05 Genteric Inc GENERAL TRANSFERRED TRANSFERRED TO THE RETRODUCTAL INFUSION OF VIRIONS BY RECOMBINANT ADENO-ASSOCIATED VIRUS
US7485291B2 (en) 2003-06-03 2009-02-03 Cell Genesys, Inc. Compositions and methods for generating multiple polypeptides from a single vector using a virus derived peptide cleavage site, and uses thereof
US7498024B2 (en) 2003-06-03 2009-03-03 Cell Genesys, Inc. Compositions and methods for enhanced expression of immunoglobulins from a single vector using a peptide cleavage site
US7662623B2 (en) 2003-06-03 2010-02-16 Biosante Pharmaceuticals, Inc. Compositions and methods for enhanced expression of recombinant polypeptides from a single vector using a peptide cleavage site
US7709224B2 (en) 2003-06-03 2010-05-04 Biosante Pharmaceuticals, Inc. Compositions and methods for enhanced expression of recombinant polypeptides from a single vector using a peptide cleavage site
WO2004111246A1 (en) * 2003-06-19 2004-12-23 Peter Bromley Protein production system
WO2016012595A1 (en) * 2014-07-25 2016-01-28 Csl Behring Gmbh Improved factor viii preparations suitable for therapeutic use and processes to obtain these
WO2016073693A3 (en) * 2014-11-05 2016-06-30 Voyager Therapeutics, Inc. Aadc polynucleotides for the treatment of parkinson's disease
US10335466B2 (en) 2014-11-05 2019-07-02 Voyager Therapeutics, Inc. AADC polynucleotides for the treatment of parkinson's disease
US11027000B2 (en) 2014-11-05 2021-06-08 Voyager Therapeutics, Inc. AADC polynucleotides for the treatment of Parkinson's disease
US11975056B2 (en) 2014-11-05 2024-05-07 Voyager Therapeutics, Inc. AADC polynucleotides for the treatment of Parkinson's disease
US11779656B2 (en) 2016-04-15 2023-10-10 The Trustees Of The University Of Pennsylvania Gene therapy for treating hemophilia A
US11298041B2 (en) 2016-08-30 2022-04-12 The Regents Of The University Of California Methods for biomedical targeting and delivery and devices and systems for practicing the same
US12318183B2 (en) 2016-08-30 2025-06-03 The Regents Of The University Of California Methods for biomedical targeting and delivery and devices and systems for practicing the same
US11759506B2 (en) 2017-06-15 2023-09-19 Voyager Therapeutics, Inc. AADC polynucleotides for the treatment of Parkinson's disease
US11497576B2 (en) 2017-07-17 2022-11-15 Voyager Therapeutics, Inc. Trajectory array guide system
US12168776B2 (en) 2017-08-09 2024-12-17 Bioverativ Therapeutics Inc. Nucleic acid molecules and uses thereof
US12319929B2 (en) 2018-05-15 2025-06-03 Voyager Therapeutics, Inc. Compositions and methods for the treatment of Parkinson's disease
US12364774B2 (en) 2018-08-09 2025-07-22 Bioverativ Therapeutics Inc. Nucleic acid molecules and uses thereof for non-viral gene therapy

Also Published As

Publication number Publication date
BR9914643A (pt) 2001-12-11
IL142721A0 (en) 2002-03-10
EP1124583A4 (en) 2002-04-17
CA2348068A1 (en) 2000-04-27
MXPA01004067A (es) 2003-03-10
AU757688B2 (en) 2003-03-06
AU1125600A (en) 2000-05-08
EP1124583A1 (en) 2001-08-22
JP2002527493A (ja) 2002-08-27
KR20010082234A (ko) 2001-08-29
US6221349B1 (en) 2001-04-24
CN1329509A (zh) 2002-01-02

Similar Documents

Publication Publication Date Title
US7351577B2 (en) Adeno-associated vector compositions for expression of Factor VIII
EP1124583A1 (en) Adeno-associated vectors for expression of factor viii by target cells
US20250108093A1 (en) Factor VIII Sequences
US20220016264A1 (en) Aav virions with decreased immunoreactivity and uses therefor
US7943374B2 (en) Super-size adeno-associated viral vector harboring a recombinant genome larger than 5.7 kb
EP3313991B1 (en) Modified factor ix, and compositions, methods and uses for gene transfer to cells, organs and tissues
EP1228234A2 (en) Production of chimeric capsid vectors
US20040002159A1 (en) Methods for the production of chimeric adeno-associated virus (AAV) vectors, compositions of chimeric AAV vectors, and methods of use thereof
EP3013855B1 (en) Mutant factor viii compositions and methods
KR20210040984A (ko) 점액다당류증 iva의 치료
CN115948408A (zh) 改进的人凝血因子viii基因表达盒及其应用
US20240166722A1 (en) Modified plasma clotting factor viii and method of use thereof
WO2022211791A1 (en) Modified plasma clotting factor viii and method of use thereof
KR20230104136A (ko) 조성물 및 이의 용도

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 99814128.3

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2000 11256

Country of ref document: AU

Kind code of ref document: A

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2348068

Country of ref document: CA

Ref document number: 2348068

Country of ref document: CA

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 142721

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 2000 576889

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: PA/a/2001/004067

Country of ref document: MX

Ref document number: 1020017004962

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 1999955065

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 11256/00

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 1999955065

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 1020017004962

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: 11256/00

Country of ref document: AU

WWR Wipo information: refused in national office

Ref document number: 1020017004962

Country of ref document: KR