WO1998002584A1 - Sensitiver epstein-barr-virus dna-nachweis - Google Patents

Sensitiver epstein-barr-virus dna-nachweis Download PDF

Info

Publication number
WO1998002584A1
WO1998002584A1 PCT/EP1997/003555 EP9703555W WO9802584A1 WO 1998002584 A1 WO1998002584 A1 WO 1998002584A1 EP 9703555 W EP9703555 W EP 9703555W WO 9802584 A1 WO9802584 A1 WO 9802584A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
probe
probes
bases
ebv
Prior art date
Application number
PCT/EP1997/003555
Other languages
English (en)
French (fr)
Inventor
Viviana Simon
Arndt Rolfs
Original Assignee
Boehringer Mannheim Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Boehringer Mannheim Gmbh filed Critical Boehringer Mannheim Gmbh
Publication of WO1998002584A1 publication Critical patent/WO1998002584A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster

Definitions

  • the invention relates to a nucleic acid probe for the detection of Epstein-Barr virus nucleic acids, a method for producing a large number of copies of fragments of the EBV genome and a method for the detection of EBV.
  • Epstein-Barr virus is a widespread human pathogenic gamma herpes virus. It has a pronounced organotropism: B lymphocytes that carry the CD 21 glycoprotein receptor are infected. Already the virus binding causes an activation of the B cells, which are immortalized early after the appearance of the first viral antigens in the cells (EBNA2) and the subsequent start of viral and cellular DNA synthesis. This results in the secretion of B cell growth factors. A typical infection state is latency with episomal viral DNA. Spontaneously or through induction mechanisms, a productive infection with the formation of infectious virus particles can occur in such cells.
  • EBV as the causative agent of infectious mononucleosis (Pfeif-Ferre's glandular fever) is also closely associated with numerous malignant diseases such as Burkitt's lymphoma and various B-cell lymphomas in immunosuppressed people.
  • herpes virus detection used so far are based on two principles:
  • the object of the present invention was to provide nucleic acid probes for the detection of EBV.
  • the invention relates to a nucleic acid probe with a length of less than 350 bases and more than 10 bases, which has one or more sequences of at least 10 successive bases, which are 90% or more complementary or homologous to SEQ.LD.NO. 12th
  • the sequence of the BamHIW region of EBV is shown in FIG. 1A - IC.
  • a nucleic acid probe is understood to mean a probe for the detection of nucleic acids.
  • This probe binds nucleic acids through the interaction of bases of the probe with bases of the nucleic acid. For this reason, the binding of the probe with the nucleic acid to be detected is based on the complementarity of a base sequence of the probe with a base sequence of the nucleic acid.
  • Nucleic acids for example, are suitable as the nucleic acid probe. The use of oligonucleotides is preferred.
  • base sequence-containing molecules can also serve as a probe, in which the natural sugar phosphate backbone is replaced by an artificial backbone, e.g. B. a peptide-containing backbone is replaced.
  • nucleic acid probes are described, for example, in WO 92/20702 and WO 92/20703.
  • a backbone is understood to be a long part of the molecule to which the bases are covalently bound (e.g. sugar-phosphate polymers or polypeptides).
  • the fact of hybridization or / and its enzymatic extension can be used to detect EBV
  • the length of the nucleic acid probe also depends on the planned use of the nucleic acid probe. A length of less than 350, but more than 10 nucleotides (nt) is generally considered to be usable in the sense of the invention. If the probe is to be used as a detection probe, lengths of between 350 and 50 nt, preferably between 300 and 100 nt, have proven to be particularly suitable. Oligonucleotides with a length of between 50 and 10 nt, particularly preferably between 25 and 13 nt, are particularly suitable for use as primers.
  • This probe contains a "sequence which contains at least 10 consecutive nucleobases on the backbone which is 90% or more complementary or homologous to a sequence of the nucleic acid to be detected.
  • a probe is included which has a length of 10 nt 9 or 10 contains nucleotides which are strictly complementary or homologous (to a corresponding sequence of successive bases of the EBV genome), but the probe can also have several such sequences of at least 10 successive bases which are distinguished from one another by other sequences (EBV-specific or non-EBV-specific)
  • the probe can therefore also contain further sequences which are not EBV-specific, for example for the recognition of the probe by other molecules, for example further probes however, sequences that contain nucleic acids from organisms other than EBV that could occur in the sample are selected among the conditions would lead to a detection signal.
  • a detection probe in the sense of the invention is understood to mean a probe whose hybridization with EBN sequences is used to detect EBV. In most cases, a detection probe contains functional groups that are not normally found in the EBV nucleic acids to be detected.
  • a primer is understood to mean a probe that enzymatically at one of its ends, preferably at the 3 'end, e.g. B. using a polymerase and monodeoxyribonucleoside tri- - ⁇ - phosphates, can be requested. Primers can also be modified by one or more functional groups.
  • the probe according to the invention can contain functional groups which are specifically selected for the planned use of the nucleic acid probes.
  • Such functional groups are, for example, detectable or immobilizable groups.
  • a detectable group in the sense of the present invention consists of a directly or indirectly detectable group.
  • Directly detectable groups are, for example, radioactive (- 2p), colored or fluorescent groups or metal atoms.
  • Indirectly detectable groups are, for example, immunologically or enzymatically active compounds such as antibodies, antigens, haptens or enzymes or enzymatically active partial enzymes. These are detected in a subsequent reaction or reaction sequence. Haptens are particularly preferred, since nucleoside triphosphates labeled with them can generally be used particularly well as substrates for polymerases and a subsequent reaction with a labeled antibody against the hapten or the haptenized nucleoside can easily be carried out.
  • nucleoside triphosphates are, for example, bromine nucleoside triphosphates or digoxigenin, digoxin, biotin or fluorescein coupled nucleoside triphosphates.
  • the steroids mentioned in EP-A-0 324 474 and their detection have proven to be particularly suitable.
  • An immobilizable group in the sense of the present invention is one which can be connected directly or indirectly to a solid phase. Interactions between immunologically active compounds, such as antibodies and antigens or haptens, or of receptors and ligands, such as e.g. B. avidin or streptavidin and biotin. A hapten is preferred as the immobilizable group.
  • Bases in connection with probes and nucleic acids are selected from the naturally occurring, such as the frequently occurring nucleic acid bases A, G, C, T and U, and more rarely bases, such as I etc. or artificial ones such as 7-Deaza-G.
  • Sequences or bases are complementary to each other due to the specific base-base-interaction effect, e.g. B. bases A and T, G and C, A and U or Deaza-G and C. -s ⁇
  • Homologous are sequences or bases which have the same binding properties to a base or sequence complementary thereto, e.g. B. A and A, Deaza-G and G or T and U.
  • sequence SEQ.ID.NO. 13 corresponds to nucleotides 615-1030 of the sequence from J. Virol. 44: 286-294, 1982, FIG. 1A-IC, the sequence of the long internal repeats of the BamHIW region of the EBV genome.
  • LIR Long Intemal Repeat
  • the sequence of the BamHIW region is known from the publications mentioned above (see also Nature (London), 310: 207-211, 1984).
  • the BamHIW region of the EBV genome has a length of approximately 3,071 bases with a total length of the genome of approximately 175 kb. This region repeats up to 1 times within the EBV genome. This is a highly conserved area which codes for 2 exons of the EBNA protein (J. Virol. 44: 286-294, 1982).
  • the sequence of an LIR is given in FIG. 1.
  • the length of the EBV-specific sequence of the probe is preferably shorter than a long internal repeat sequence (LIR).
  • LIR long internal repeat sequence
  • the sequence is therefore preferably within an LIR.
  • the sequence of at least 10 successive bases is particularly preferably 90% or more complementary or homologous to SEQ.ID.NO. 12, which correspond to the nucleotides 850 to 970 of FIG. 1A-IC.
  • the probes according to the invention can bind to EBV nucleic acids, but not to nucleic acids from other human pathogenic herpes viruses or to human DNA, can easily be determined by the person skilled in the art. To do this, he can carry out hybridization tests. A pre-selection can be obtained, for example, by comparing the sequences with databases which contain the genomic sequences of other human pathogenic herpes viruses and human DNA.
  • the hybridization conditions are preferably set so that a probe which contains an exactly complementary sequence hybridizes with the nucleic acid to be detected, but not a nucleic acid which has one or more mismatches within the binding region.
  • Probes which have proven to be particularly expedient are those which one of the sequences of SEQ.LD.NOS. Contains 1 and 3 or parts thereof with a length of 10 or more bases or contains a sequence complementary to this. Nucleic acid probes with a longer sequence can be produced, for example, by in-vitro amplification of part of the BamHIW region of the EBV genome. In vitro amplification is understood to mean an increase in part of the region that does not take place within a living cell. Examples of in vitro amplifications are the polymerase chain reaction (US-A-4,683,202) or NASBA (EP-B-0 329 822).
  • certain areas of the EBV genome can be made the basis of an amplification by selecting the primer sequence.
  • probes are obtained which each contain the primer sequences and the sequence located between the 3 'ends of the primers.
  • Probes according to the invention which can also be used as primers for the production of longer probes (e.g. the above-mentioned detection probes), are expediently produced by chemical synthesis. There are commercially available synthesizers and suitable activated and protected mononucleotides for this purpose.
  • the probes according to the invention are suitable as detection probes (longer sequences) or as primers (shorter sequences).
  • two shorter probes are combined with one another in order to provide a pair of primers for carrying out an application procedure.
  • the sequences of the probe are chosen so that they are complementary to different strands of the EBV genome.
  • the location of the hybridization positions of the primers is chosen so that the extension product of one primer can be used as a template for the extension of the other primer. A theoretically exponential amplification of nucleic acids is achieved in this way. If several areas (e.g.
  • primer pairs in different sequences of the EBV genome are to be amplified, further primer pairs can also be integrated into the combination.
  • the primers are particularly preferably packaged in a first container and the probes in a second container.
  • the invention also relates to a method for the specific production of a large number of copies of fragments of the EBV genome using at least 2 probes according to the invention.
  • the shorter ones mentioned above are recommended -> - Probes as P ⁇ mer
  • the method can be carried out analogously to the method described in US Pat. No. 4,683,202
  • One of the polymers is preferably selected from the range of SEQ LD NO 13, particularly preferably SEQ ID NO 12. In the event that a counter polymer is required, this can also be selected from this range, but it is preferred from the range of nucleotides selected, which correspond to the higher positions. The counterparts hybridize particularly preferably such that the 3 'end of this polymer lies to the right of nucleotide position 1150.
  • the second polymer is particularly preferably between positions 1180 and 1500 of FIGS. 1A-1C
  • the invention also relates to a method for the detection of EBV in which one or more probes according to the invention are bound to the EBV genome and the occurrence of the binding is used for the purpose of detection in the event that the probe according to the invention is a nucleic acid , then it is a special embodiment of a test based on a hybridization event. Tests based on hybridization events are known in their basic features to the person skilled in the art in the field of nucleic acid diagnostics.
  • the probe is a PNA probe, reference is made to the disclosure in WO 92/20703. These probes are distinguished in particular by the fact that their tendency to hybridize is less dependent on the salt content of the hybridization solution.
  • the detection methods according to the invention determine the occurrence of the bond between the probe and the nucleic acid to be detected as a sign of the presence or the - ⁇ -
  • Amount of EBV nucleic acid to be detected This can happen, for example, in that a sample in which EBV is suspected is applied to a membrane and the nucleic acids are immobilized on the membrane. A solution is then applied with a nucleic acid probe according to the invention and incubated under conditions in which the probe binds to the nucleic acid to be detected. The amount or appearance of a labeled group, which is bound to the probe, on the membrane indicates the presence of EBV nucleic acids.
  • primer pairs are used which are characterized in such a way that a first pair of primers generates an amplification product, which in turn is used as a template for the production of a shorter amplificate using the second pair of primers.
  • a procedure is ⁇ also known as nested PCR.
  • Preferred combinations of primers are therefore SEQ.ID.NO. 1 / SEQ.ID.NO. 2 and SEQ.ID.NO. 3 / SEQ.ID.NO. 4th
  • the primer pairs mentioned are distinguished by the fact that they have a similar melting behavior in the PCR. In addition, the primer pairs have practically no tendency to form primers. Surprisingly, a particularly large number of EBV isolates can be detected with the probes according to the invention. The probes lead to a particularly sensitive detection.
  • 0.5 to 2 ml cerebrospinal fluid is gently centrifuged in 1.5 ml test tubes at 350 g and 4 ° C for 10 minutes. The supernatant is removed and stored separately from the sediment at -20 ° C. Samples obtained intraoperatively, such as vitreous punctate, eye chamber punctate or eye rinsing liquid, are treated like liquor. Sediment and supernatant are stored separately at -20 ° C or processed directly
  • the leukocyte pellet is coated with 50 ⁇ l, the sediments of all other body fluids with 25 ⁇ l 50 mM NaOH, mixed well and briefly centrifuged. The samples are coated with 100 ⁇ l paraffinol and heated to 95 ° C for 10 minutes. To neutralize, pipette 4 ⁇ l of 1 M Tris HC1 (pH 7 4) through the oil layer for 25 ⁇ l of 50 mM NaOH. The neutralized lysate can be used directly in the PCR (Rolfs A, Schuller I, Finckh U., Weber-Rolfs I 1992 PCR: Clinical Diagnostics and Research. New York, Berlin, Sp ⁇ nger Verlag, 1992.
  • the reagents for the PCR are pipetted onto ice in 0.5 ⁇ l test tube.
  • the reagent tubes are placed directly on the ice in the thermal cycler preheated to 95 ° C (hot start PCR).
  • the location information for the probes refer to the numbers from J. Virol 44-286-294 (1982), FIG. 1 - jo -
  • Primer 1407/1408 (location: "+” primer 878-898, "-” primer 1170-1189) amplicon length 310 bp.
  • Steps 2 to 4 are repeated 35 times.
  • the aim of the PCR with inner oligonucleotide primer pair 1409/10 is to produce sufficient amounts of DNA for a dig-labeling reaction for the production of specific probes. - II -
  • Primer 1409/1410 (location: "+” - primer 933 - 952, "-" - primer 1082 - 1 101) amplicon length 167 bp.
  • Steps 2 to 4 are repeated 35 times.
  • the production of the double-stranded hybridization probes consists of two PCR reactions based on each other, ie the amplificates from the first (PCR with inner pri- -n- mem) are used as a matrix in the second, the labeling PCR, after agarose gel cleaning.
  • the temperature profile used is identical to that for the PCR with the inner primers, only the number of cycles was increased to 45.
  • a 3% agarose mixture consisting of 2 parts Biorad agarose (0.45 g) and one part NuSieve GTG agarose (0.15 g), is boiled with 22 ml 1 x Tris-borate-EDTA buffer (TBE) with 0.5 ⁇ l (1 ⁇ g / ⁇ l) pre-stained ethidium bromide and poured into an approx. 3 mm thick gel at 4 ° C.
  • TBE Tris-borate-EDTA buffer
  • Gel electrophoresis is carried out at a voltage of 100 volts and a current of 50 mA over a period of 30 minutes.
  • the gel is placed on a 302 nm UV transilluminator and with a polaroid camera (aperture: 4 5, exposure time:
  • a 1.5% low-melting agarose gel is prepared from 1.4 g of Nusieve GTG and 20 ml of 1 x Tris acetate buffer. After heating, 1 ⁇ l of ethidium bromide (10 mg / ml) is added to the homogeneous mass. 100 ⁇ l of the products of the inner PCR (Prime ⁇ aar 1409/10, SEQ ID NO 3/4)) are mixed with 10 ⁇ UQ. x Gel loading buffer mixed well and pipetted into a large gel pocket. After electrophoretic separation, the target band is cut out of the gel with a 302 nm UV transilluminator and transferred to a test tube. The gel piece is melted in a thermoblock and each
  • the quality of the newly manufactured probe is checked in two dilution series.
  • the probe In the first series of dilutions, the probe is diluted in a gel in decimal steps, blotted and, since the probe itself is digoxigenin-labeled, directly detected.
  • the target amplificate In the second series of dilutions, the target amplificate is applied decimally (1 ⁇ l, 0.1 ⁇ l, 0.01 ⁇ l, 0.001 ⁇ l) in the gel, blotted and hybridized with 2 ⁇ l of the newly synthesized probe under the standard conditions and detected.
  • Denaturation buffer 1.5 M NaCl [88 g / 1]; 0.5 M NaOH [20 g l]
  • Hybridization buffer 5 x SSC; 2.0% blocking reagent, 0.1% N-laurosyl sarcosine,
  • Boehringer positive probe BamHI linearized pBr328 DNA, randomly primed with digoxigenin; Boehringer, # 1062 590
  • the gel is incubated for 10 minutes in the denaturing solution (1.5 M NaCl, 0.5 M NaOH) and for 10 minutes in neutralization buffer (1 M Tris, 2 M NaCl, pH 5.0).
  • the neutralized gel is placed with the row of slots facing down on previously moistened Whatman paper.
  • the nylon membrane cut to a size of 6.8 x 10.3 cm, is then placed on the gel without air bubbles.
  • Amplificates are UV-crosslinked on the still wet membrane with 120 mJ UV.
  • the membrane is air dried and then kept dust-free until hybridization.
  • the nylon membrane is prehybridized with 5 ml hybridization buffer at 62 ° C. with rotation for 30 minutes.
  • 2 ⁇ l of the digoxigenin-labeled probes and the Boehringer positive probe (BamHI-linearized pBr328 DNA, randomly primed with digoxigenin) are thermally denatured together with hybridization buffer and added to the pre-hybridization mix.
  • the solution is discarded and the membrane is incubated twice at room temperature for 5 minutes with washing buffer 1 and twice with washing buffer 2 at 65 ° C. with constant rotation.
  • the blot membranes are immediately detected chromogenically.
  • - Detection buffer 1 100 mM maleic acid, 150 mM NaCl, 0.3% (w / v) Tween TM 20, pH 7.0 at 20 ° C.
  • Detection buffer 2 1.0% blocking reagent dissolved in detection buffer 1.
  • Detection buffer 3 100 mM Tris HC1, 100 mM NaCl, 50 mM MgC12, pH 9.5 at 20 °.
  • Color solution for chromogen detection freshly prepared: 45 ⁇ l nitroblue tetrazolium salt (NBT) solution; 35 ⁇ l 5-bromo-4-chloro-indolylphosphate (X-phosphate) in 10 ml detection buffer 3.
  • NBT nitroblue tetrazolium salt
  • X-phosphate 5-bromo-4-chloro-indolylphosphate
  • the membrane is incubated in detection buffer 1 for 30 seconds, followed by
  • CTATGGTTGGCTGCGCTGCT 8 TTGTGTGGACTCCTGGCGCT 7
  • MOLECULE TYPE Genomic DNA
  • HYPOTHETICAL NO

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Durch Auswahl einer Sequenz des EBV-Genoms wird ein besonders sensitiver Epstein-Barr-Virus DNA-Nachweis ermöglicht. Die bereitgestellten Sonden eignen sich für die Verwendung als PCR-Primer, für die Herstellung von EBV-Sonden und zum Nachweis von EBV durch Hybridisierung mit nachweisbar markierten Sonden.

Description

Sensitiver Epstein-Barr- Virus DNA-Nachweis
Gegenstand der Erfindung ist eine Nukleinsauresonde zum Nachweis von Epstein-Barr- Virus Nukleinsäuren, ein Verfahren zur Herstellung einer Vielzahl von Kopien von Fragmenten des EBV-Genoms und ein Verfahren zum Nachweis von EBV.
Hintergrund der Erfindung
Epstein-Barr-Virus (EBV) ist ein weitverbreitetes humanpathogenes gamma-Herpesvirus. Es hat einen ausgeprägten Organotropismus: es werden B-Lymphozyten, die den Glyko- proteinrezeptor CD 21 tragen, infiziert. Bereits die Virusbindung bewirkt eine Aktivierung der B-Zellen, die frühzeitig nach Auftreten der ersten viralen Antigene in den Zellen (EBNA2) und dem anschließendem Beginn der viralen und zellulären DNS-Synthese im- mortalisiert werden. Dabei kommt es zur Sekretion von B-Zell-Wachstumsfaktoren. Ein typischer Infektionszustand ist die Latenz mit episomal vorliegender viraler DNA. Spontan oder durch Induktionsmechanismen kann es in derartigen Zellen zu einer produktiven Infektion mit der Bildung von infektiösen Viruspartikeln kommen. EBV, als Erreger der infektiösen Mononukleose (PfeifFersches Drüsenfieber), wird auch eng mit zahlreichen malignen Erkrankungen wie dem Burkitt-Lymphom und verschiedenen B-Zell-Lymphomen bei Immunsupprirnierten assoziiert.
Stand der Technik
Die bisher verwendeten Methoden der Herpesvirennachweise basieren auf zwei Prinzipien:
Serologischer Nachweis vorhandener Antikörper, Vorraussetzung ist ein intaktes Immunsystem. Direkter Virusnachweis oder Virus-DNA-Nachweis. Unter den gentechnologischen Methoden bietet sich vor allem die Polymerase-Ketten-Reaktion (PCR, US-A-4,683,202) an. Mittlerweile wurden zahlreiche PCR-Assays für den DNA- Nachweis des Epstein-Barr-Virus beschrieben, z. B. in J. Clin. Microbiol. 28: 2187 - 2190, 1990; J. Clin. Microbiol. 30. 2826 - 2829, 1992; und Aids Res. and Hum. Retroviruses 8: 1869 - 1874, 1992.
Aufgabe der vorliegenden Erfindung war es, Nukleinsauresonden zum Nachweis von EBV bereitzustellen.
Gegenstand der Erfindung ist eine Nukleinsauresonde mit einer Länge von weniger als 350 Basen und mehr als 10 Basen, welche eine oder mehrere Sequenzen von mindestens 10 aufeinanderfolgenden Basen aufweist, die zu 90 % oder mehr komplementär oder homolog sind zu SEQ.LD.NO. 12.
Kurze Beschreibung der Figuren
In FIG 1 A - IC ist die Sequenz der BamHIW-Region von EBV gezeigt.
Detaillierte Beschreibung der Erfindung
Unter einer Nukleinsauresonde wird im Sinne der Erfindung eine Sonde zum Nachweis von Nukleinsäuren verstanden. Diese Sonde bindet Nukleinsäuren durch Wechselwirkung von Basen der Sonde mit Basen der Nukleinsäure. Aus diesem Grund beruht die Bindung der Sonde mit der nachzuweisenden Nukleinsäure auf der Komplementarität einer Basensequenz der Sonde mit einer Basensequenz der Nukleinsäure. Als Nukleinsauresonde kommen beispielsweise Nukleinsäuren in Frage. Bevorzugt ist die Verwendung von Oligo- nukleotiden. Als Sonde können jedoch auch basensequenzhaltige Moleküle dienen, bei denen der natürliche Zuckerphosphatbackbone durch einen künstlichen Backbone, z. B. einen peptidhaltigen Backbone, ersetzt ist. Solche Nukleinsauresonden sind beispielsweise beschrieben in WO 92/20702 bzw. WO 92/20703. Als Backbone wird ein langer Molekülteil verstanden, an welchen die Basen kovalent gebunden sind (z. B. Zucker-Phosphat-Polymere oder Polypeptide). Die Tatsache der Hybridisierung oder/und ihre enzymatische Verlängerung kann zum Nachweis von EBV verwendet werden
Die Lange der Nukleinsauresonde richtet sich auch nach der geplanten Verwendung der Nukleinsauresonde. Generell wird eine Länge von weniger als 350, jedoch mehr als 10 Nukleotiden (nt) als im Sinne der Erfindung für einsetzbar betrachtet. Wenn die Sonde als Nachweissonde eingesetzt werden soll, haben sich insbesondere Längen von zwischen 350 und 50 nt, bevorzugt zwischen 300 und 100 nt als geeignet erwiesen. Für die Verwendung als Primer sind insbesondere Oligonukleotide einer Länge von zwischen 50 und 10 nt, besonders bevorzugt zwischen 25 und 13 nt geeignet.
Diese Sonde enthält eine "Sequenz, die mindestens 10 aufeinanderfolgende Nukleobasen am Backbone enthält, die zu 90 % oder mehr komplementär oder homolog ist zu einer Sequenz der nachzuweisenden Nukleinsäure. Beispielsweise ist hiermit eine Sonde umfaßt, die bei einer Lange von 10 nt 9 oder 10 streng komplementäre oder homologe (zu einer entsprechenden Sequenz von aufeinanderfolgenden Basen des EBV-Genoms) Nukleotide enthält. Die Sonde kann aber auch mehrere solche Sequenzen von mindestens 10 aufeinanderfolgenden Basen aufweisen, welche durch andere Sequenzen (EBV-spezifische oder nicht EBV-spezifische) voneinander getrennt sind. Die Sonde kann also neben den EBV-spezi- fischen Sequenzen auch weitere Sequenzen enthalten, die nicht EBV-spezifisch sind, z. B. zur Erkennung der Sonde durch andere Moleküle, z. B. weitere Sonden. Nicht enthalten sein sollten allerdings Sequenzen, die mit Nukleinsäuren anderer Organismen, als EBV, die in der Probe vorkommen konnten, unter den gewählten Bedingungen zu einem Nachweissignal führen würden.
Unter einer Nachweissonde im Sinne der Erfindung wird eine Sonde verstanden, deren Hybridisierung mit EBN-Sequenzen zum Nachweis von EBV verwendet wird. In den meisten Fällen enthält eine Nachweissonde eine funktioneile Gruppen, die üblicherweise in den nachzuweisenden EBV Nukleinsäuren nicht vorkommt.
Unter einem Primer wird eine Sonde verstanden, die an einem ihrer Enden, bevorzugt am 3'- Ende enzymatisch, z. B. mit Hilfe einer Polymerase und Monodeoxyribonukleosidtri- - <ι - phosphaten, verlangen werden kann. Auch Primer können durch eine oder mehrere funktioneile Gruppen modifiziert sein.
Die erfindungsgemäße Sonde kann funktionelle Gruppen enthalten, die für die geplante Verwendung der Nukleinsauresonden gezielt ausgewählt sind. Solche funktioneilen Gruppen sind beispielsweise detektierbare oder immobilisierbare Gruppen.
Eine detektierbare Gruppe im Sinne der vorliegenden Erfindung besteht aus einer direkt oder indirekt nachweisbaren Gruppe. Direkt nachweisbare Gruppen sind beispielsweise radioaktive (- 2p), farbige, oder fluoreszierende Gruppen oder Metallatome. Indirekt nachweisbare Gruppen sind beispielsweise immunologisch oder enzymatisch wirksame Verbindungen, wie Antikörper, Antigene, Haptene oder Enzyme oder enzymatisch aktive Teilenzyme. Diese werden in einer nachfolgenden Reaktion oder Reaktionssequenz detektiert. Besonders bevorzugt sind Haptene, da mit ihnen markierte Nukleosidtriphosphate im allgemeinen besonders gut als Substrate von Polymerasen einsetzbar sind und eine anschließende Reaktion mit einem markierten Antikörper gegen das Hapten oder das hapteni- sierte Nukleosid leicht vorgenommen werden kann. Solche Nukleosidtriphosphate sind beispielsweise Brom-Nukleosidtriphosphate oder Digoxigenin-, Digoxin-, Biotin- oder Fluore- scein-gekoppelte Nukleosidtriphosphate. Als besonders geeignet haben sich die in EP-A-0 324 474 genannten Steroide und deren Detektion erwiesen. Für deren Inkorporation in Nukleinsäuren wird hiermit auf die EP-A-0 324 474 verwiesen.
Eine immobilisierbare Gruppe im Sinne der vorliegenden Erfindung ist eine, die direkt oder indirekt mit einer festen Phase verbunden werden kann. Hierzu eignen sich insbesondere Wechselwirkungen zwischen immunologisch aktiven Verbindungen, wie Antikörpern und Antigenen oder Haptenen oder von Rezeptoren und Liganden, wie z. B. Avidin oder Streptavidin und Biotin. Bevorzugt als immobilisierbare Gruppe ist ein Hapten.
Wenn im Folgenden von einer Sequenz gesprochen wird, wird davon ausgegangen, daß es eine Basensequenz ist.
Basen im Zusammenhang mit Sonden und Nukleinsäuren sind ausgewählt aus den natürlich vorkommenden, wie den häufig vorkommenden Nukleinsäurebasen A, G, C, T und U sowie selteneren Basen, wie I etc. oder künstlichen wie 7-Deaza-G.
Komplementär zueinander sind Sequenzen oder Basen aufgrund der spezifischen Basen- Basen- Wechsel Wirkung, z. B. der Basen A und T, G und C, A und U oder Deaza-G und C. -s~
Homolog sind Sequenzen oder Basen, welche dieselben Bindeeigenschaften zu einer hierzu komplementären Base oder Sequenz aufweisen, z. B. A und A, Deaza-G und G oder T und U.
Die Sequenz SEQ.ID.NO. 13 entspricht den Nukieotiden 615 - 1030 der Sequenz aus J. Virol. 44: 286 - 294, 1982, FIG 1 A - IC, der Sequenz der Long Intemal Repeats der BamHlW-Region des EBV-Genoms.
Als Long Intemal Repeat (LIR) werden Sequenzen der BamHlW-Region bezeichnet, die in jeder BamHlW-Region vorhanden sind, bevorzugt solche, die in jeder BamHlW-Region mehrfach vorkommen. Die Sequenz der BamHlW-Region ist aus den oben genannten Publikationen bekannt (siehe auch Natüre (London), 310: 207 - 211, 1984). Die BamHlW- Region des EBV-Genoms umfaßt eine Länge von ca. 3.071 Basen bei einer Gesamtlänge des Genoms von ca. 175 kb. Diese Region wiederholt sich bis zu 1 lmal innerhalb des EBV- Genoms. Dabei handelt es sich um einen hochkonservierten Bereich, der für 2 Exons des EBNA-Proteins codiert (J. Virol. 44: 286 - 294, 1982). Die Sequenz eines LIR ist in FIG 1 angegeben.
Die Länge der EBV-spezifischen Sequenz der Sonde ist bevorzugt kürzer als eine Long Intemal Repeat Sequenz (LIR). Daher liegt die Sequenz bevorzugt innerhalb einer LIR. Besonders bevorzugt ist die Sequenz von mindestens 10 aufeinanderfolgenden Basen zu 90 % oder mehr komplementär oder homolog zu SEQ.ID.NO. 12, die den Nukieotiden 850 bis 970 der FIG 1A - IC entsprechen.
Bedingungen, bei denen die erfindungsgemäßen Sonden an EBV-Nukleinsäuren binden können, aber nicht an Nukleinsäuren von anderen humanpathogenen Herpesviren oder an humane DNA, können von dem Fachmann auf einfache Weise ermittelt werden. Hierzu kann er Hybridisierungsversuche durchführen. Eine Vorauswahl kann beispielsweise durch Sequenzvergleich mit Datenbanken, welche die genomischen Sequenzen von anderen humanpathogenen Herpesviren und humaner DNA enthalten, erhalten werden. Bevorzugt werden die Hybridisierungsbedingungen so eingestellt, daß eine Sonde, die eine exakt komplementäre Sequenz enthält, mit der nachzuweisenden Nukleinsäure hybridisiert, nicht jedoch eine Nukleinsäure, die innerhalb des bindenden Bereiches ein oder mehrere Mis- matche aufweist.
Als besonders zweckmäßig haben sich Sonden erwiesen, die eine der Sequenzen der SEQ.LD.NOS. 1 und 3 oder Teilen davon mit einer Länge von 10 oder mehr Basen enthält oder eine hierzu komplementäre Sequenz enthält. Nukleinsauresonden mit einer längeren Sequenz sind beispielsweise durch in-vitro-Amplifϊkation eines Teils der BamHlW-Region des EBV-Genoms herstellbar. Unter in-vitro-Amplifikation wird eine Vermehrung eines Teils der Region verstanden, die nicht innerhalb einer lebenden Zelle stattfindet. Beispiele für in-vitro-Amplifikationen sind die Polymerase-Ketten-Reaktion (US-A-4,683,202) oder NASBA (EP-B-0 329 822). Mit Hilfe dieser Verfahren können durch Wahl der Primer- sequenz bestimmte Bereiche des EBV-Genoms zur Grundlage einer Amplifikation gemacht werden. Im Fall der PCR werden Sonden erhalten, die jeweils die Primersequenzen und die zwischen den 3'-Enden der Primer gelegenen Sequenz enthalten.
Erfindungsgemäße Sonden, die auch als Primer für die Herstellung längerer Sonden (z. B. der oben genannten Nachweissonden) verwendbar sind, werden zweckmäßigerweise durch chemische Synthese hergestellt. Hierfür existieren kommerziell erhältliche Synthesizer und geeignete aktivierte und geschützte Mononukleotide.
Je nach Länge eignen sich die erfindungsgemäßen Sonden als Nachweissonden (längere Sequenzen) oder als Primer (kürzere Sequenzen). Es ist jedoch auch möglich, zwei oder mehr Sonden miteinander zu kombinieren. In einem ersten bevorzugten Fall werden zwei kürzere Sonden miteinander kombiniert, um ein Primerpaar zur Durchführung eines A pli- fikationsverfahrens bereitzustellen. Hierzu werden die Sequenzen der Sonde so gewählt, daß sie zu unterschiedlichen Strängen des EBV-Genoms komplementär sind. Die Lage der Hybridisierungspositionen der Primer wird so gewählt, daß das Verlängerungsprodukt eines Primers als Templat für die Verlängerung des anderen Primers benutzt werden kann. Hierdurch wird eine theoretisch exponentielle Amplifikation von Nukleinsäuren erreicht. Sofern mehrere Bereiche (z. B. in unterschiedlichen Sequenzen des EBV-Genoms) amplifiziert werden sollen, können auch noch weitere Primerpaare in die Kombination integriert werden. Darüber hinaus hat es sich als zweckmäßig erwiesen, ein wie oben geschildert definiertes Primerpaar mit einer Nachweissonde zu kombinieren, wobei die Sequenz der Nachweissonde so gewählt wird, daß sie mit dem Amplifikationsprodukt in dem Bereich, der zwischen den Primerhybridisierungsstellen liegt, hybridisieren kann.
In den oben genannten Kombinationen ist jede erdenkliche Verpackung möglich. Besonders bevorzugt werden jedoch die Primer in einem ersten Gefäß und die Sonden in einem zweiten Gefäß verpackt.
Ebenfalls Gegenstand der Erfindung ist ein Verfahren zur spezifischen Herstellung einer Vielzahl von Kopien von Fragmenten des EBV-Genoms unter Verwendung von mindestens 2 erfindungsgemäßen Sonden. Für diesen Fall empfehlen sich die oben genannten kürzeren - > - Sonden als Pπmer Das Verfahren kann analog zu dem m US-A-4,683,202 geschilderten Verfahren geführt werden
Bevorzugt wird einer der Pπmer aus dem Bereich von SEQ LD NO 13, besonders bevorzugt SEQ ID NO 12 ausgewählt Für den Fall, daß ein Gegenpπmer erforderlich ist, kann dieser zwar ebenfalls aus diesem Bereich gewählt werden, bevorzugt wird er jedoch aus dem Bereich der Nukleotide gewählt, die den höheren Positionen entsprechen Besonders bevorzugt hybπdisieren die Gegenpπmer so, daß das 3'-Ende dieser Pπmer rechts von Nu- kleotidposition 1150 liegt Besonders bevorzugt liegt der zweite Pπmer zwischen Position 1180 und 1500 von FIG 1A - 1C
Ebenfalls Gegenstand der Erfindung ist ein Verfahren zum Nachweis von EBV wobei eine oder mehrere erfindungsgemaße Sonden an das EBV-Genom gebunden werden und das Auftreten der Bindung zum Gegenstand des Nachweises benutzt wird Für den Fall, daß es sich bei der erfindungsgemaßen Sonde um eine Nukleinsäure handelt, dann handelt es sich um eine spezielle Ausführungsform von auf einem Hybridisierungsereignis beruhenden Test Auf Hybπdisierungsereignisse beruhende Tests sind in ihren Grundzugen dem Fachmann auf dem Gebiet der Nukleinsaurediagnostik bekannt. Soweit experimentelle Details im Folgenden nicht ausgeführt sind, wird dazu vollinhaltlich auf "Nucleic acid hybridisation", Herausgeber B D Harnes und S J Higgins, IRL Press, 1986, z B. in den Kapiteln 1 (Hybridisation Strategy), 3 (Quantitative Analysis of Solution Hybridisation) und 4 (Quantitative Filter Hybπdisation), Current Protocols in Molecular Biology, Edt F M Ausubel et al , J Wiley and Son, 1987, und Molecular Cloning, Edt J Sambrook et al , CSH, 1989, Bezug genommen Zu den bekannten Methoden gehört auch die Herstellung von markierten Nukleo- sidtπphosphaten, wie sie in EP-A-0 324 474 beschrieben sind, die chemische Synthese von modifizierten und unmodifizierten Ohgonukleotiden, die Spaltung von Nukleinsäuren mittels Restπktionsenzymen, die Auswahl von Hybridisierungsbedingungen, durch welche eine Spezifitat erreicht werden kann, die unter anderem vom Ausmaß der Komplementaritat zwischen den zu hybridisierenden Nukleinsäuren, deren GC-Gehalt und deren Lange abhangt, sowie die Bildung von Nukleinsäuren aus Nukleosidtriphosphaten mit Hilfe von Polymera- sen, gegebenenfalls unter Verwendung von sogenannten Primem
Sofern es sich bei der Sonde um eine PNA-Sonde handelt, wird auf die Offenbarung in WO 92/20703 verwiesen Diese Sonden zeichnen sich insbesondere dadurch aus, daß ihre Hybπdisierungsneigung weniger vom Salzgehalt der Hybridisierungslosung abhangig ist.
Die erfindungsgemaßen Nachweisverfahren bestimmen das Auftreten der Bindung zwischen der Sonde und der nachzuweisenden Nukleinsäure als Zeichen für die Anwesenheit oder die - Θ-
Menge an nachzuweisender EBV-Nukleinsaure. Dies kann beispielsweise geschehen, in dem eine Probe, in der EBV vermutet wird, auf eine Membran aufgebracht und die Nukleinsäuren an der Membran immobilisieπ werden. Anschließend wird eine Losung mit einer erfindungsgemaßen Nukleinsauresonde aufgebracht und unter Bedingungen, bei denen eine Bindung der Sonde an der nachzuweisenden Nukleinsäure stattfindet, inkubiert. Die Menge bzw. das Auftreten einer markierten Gruppe, welche an die Sonde gebunden ist, auf der Membran zeigt die Anwesenheit von EBV-Nukleinsauren an.
In einem besonderen Verfahren werden Primerpaare eingesetzt, die so charakterisiert sind, daß ein erstes Primerpaar ein Amplifikationsprodukt erzeugt, welches wiederum als Tem- plat für die Herstellung eines kürzeren Amplifikates unter Verwendung des zweiten Primerpaares verwendet wird. Ein solches Vorgehen ist^ auch als nested PCR bekannt geworden. Bevorzugte Kombinationen von Primern sind daher SEQ.ID.NO. 1 / SEQ.ID.NO. 2 und SEQ.ID.NO. 3 / SEQ.ID.NO. 4.
Mit der oben genannten Kombination von 4 Primern ist es auch möglich, eine große Menge von EB V-spezifischen Sonden herzustellen. Nach getrennter Amplifikation mit beiden Primerpaaren wird das entstandene kürzere Amplifikat als Sonde eingesetzt. Das heißt, diese Sonde wird zur Hybridisierung mit EBV-Nukleinsäuren oder Amplifikaten einer zu untersuchenden Probe gebracht und die entstandenen Hybride nachgewiesen.
Die genannten Primerpaare zeichnen sich dadurch aus, daß sie ein ähnliches Schmelzverhalten in der PCR haben. Darüber hinaus neigen die Primerpaare praktisch nicht zur Primer- Dimerbildung. Überraschenderweise können mit den erfindungsgemäßen Sonden besonders viele EBV Isolate nachgewiesen werden. Die Sonden führen zu einem besonders sensitiven Nachweis.
Die folgenden Beispiele erläutern die Erfindung näher:
Beispiel 1 -9-
Leukozytenpraparation aus einer Blutprobe (Erylvsis
Zu 10 ml EDTA-antikoaguliertem peripheren Blut werden 20 ml Erylysispuffer hinzugefugt, gut durchmischt und 30 Minuten auf Eis gestellt Nach einer lOminutigen Zentπfugation bei 500 g und 4 °C wird der hamolysierte Überstand verworfen. Das Leukozytenpellet wird in lx PBS resuspendiert, in ein 1,5 ml Reagenzgefaß überführt und bei 500 g und 4 °C zentri- fügiert. Nach dem vorsichtigen Dekantieren des Uberstandes kann das Sediment entweder bei -20 °C aufbewahrt oder weiterverarbeitet werden.
Liquor cerebrospinalis und andere Korperflussiakeiten
0,5 bis 2 ml Liquor cerebrospinalis werden in 1,5 ml Reagenzgefaßen schonend bei 350 g und 4 °C 10 Minuten zentrifügiert. Der Überstand wird abgehoben und getrennt vom Sediment bei -20 °C gelagert Intraoperativ gewonnene Proben, wie Glaskorperpunktat, Augen- kammerpunktat oder Augenspülflüssigkeit, werden wie Liquor behandelt Sediment und Überstand werden getrennt bei -20 °C gelagert oder direkt weiterverarbeitet
Alkalische Lyse
Das Leukozytenpellet wird mit 50 μl, die Sedimente von allen anderen Korperflussigkeiten mit 25 μl 50 mM NaOH uberschichtet, gut durchmischt und kurz zentrifügiert Die Proben werden mit 100 μl Paraffinol uberschichtet und 10 Minuten lang auf 95 °C erhitzt. Zum Neutralisieren werden für je 25 μl 50 mM NaOH je 4 μl 1 M Tris HC1 (pH 7 4) durch die Olschicht durchpipettiert. Das neutralisierte Lysat kann direkt in die PCR eingesetzt werden (Rolfs A , Schuller I , Finckh U., Weber-Rolfs I 1992 PCR: Clinical Diagnostics and Research. New York, Berlin, Spπnger Verlag, 1992.
Durchführung der PCR
Die Reagenzien für die PCR werden auf Eis in 0,5 μl Reagenzgefäß pipettiert. Die Rea- genzgefaße werden direkt auf dem Eis in den auf 95 °C vorgeheizten Thermocycler gesetzt (Hot-Start-PCR). Die Lage-Angaben für die Sonden beziehen sich auf die Numerierungen aus J. Virol 44- 286 - 294 (1982), FIG. 1 - j o -
Figure imgf000012_0001
Tabelle: PCR-Pipettierschema (25 μl Ansatz) fyr die diagnostische EBV-PCR
Primer 1407/1408 ( Lage: "+"-Primer 878 - 898, "-"-Primer 1170 - 1189) Amplifikatlänge 310 bp.
+ Primer 5' gtc ccc acg cgc gca taa tg (SEQ.ID.NO. 1) - Primer 5' gtg gac tcc tgg cgc tct ga (SEQ.ID.NO. 2)
Temperaturprofil:
1. Initiale Denaturierung 5' 95° C
2. Denaturierung 45" 95° C
3. Annealing 90" 68° C
4. Elongation 45" 72° C
5. Terminale Elongation 5' 72° C
6. Abkühlung 4° C
Die Schritte 2. bis 4. werden 35 x wiederholt.
PCR mit inneren Primern
Ziel der PCR mit inneren Oligonukleotidprimerpaar 1409/10 ist die Herstellung ausreichender DNA-Mengen für eine Dig-Markierungsreaktion zur Herstellung spezifischer Sonden. - II -
Figure imgf000013_0001
Tabelle: PCR-Pipettierschema (25 μl Ansatz)*für die Herstellung eines inneren Amplifikates
Primer 1409/1410 (Lage: "+"-Primer 933 - 952, "-"-Primer 1082 - 1 101) Amplifikatlänge 167 bp.
+ Primer: 5' cta tgg ttg gct gcg ctg et (SEQ.ID.NO. 3) - Primer: 5' ttg gct gct gtc tgg ctt ac (SEQ.ID.NO. 4)
Verwendetes Temperaturprofil für die innere PCR;
1. Initiale Denaturierung 5' 95° C
2. Denaturierung 45" 95° C
3. Annealing 90" 68° C
4. Elongation 45" 72° C
5. Terminale Elongation 5' 72° C
6. Abkühlung 4° C
Die Schritte 2. bis 4. werden 35 x wiederholt.
Reamplifikation und Digoxigenin Markierungsreaktion
Die Herstellung der doppelsträngigen Hybridisierungssonden besteht aus zwei aufeinander basierenden PCR-Reaktionen, d. h. die Amplifikate aus der ersten (PCR mit inneren Pri- -n- mem) werden, nach einer Agarosegel-Reinigung, als Matrix in der zweiten, der Markie- rungs-PCR, eingesetzt.
Figure imgf000014_0001
Tabelle:
PCR-Pipettierschemata. Schema C (50 μl Ansatz) wird bei einer Reamplifikations-PCR und Schema D (50 μl Ansatz) bei einer Markierungs-PCR verwendet.
Das verwendete Temperaturprofil ist identisch mit dem für die PCR mit den inneren Primern, nur die Anzahl der Zyklen wurde auf 45 erhöht.
Darstellung der PCR-Produkte aus Agarosegel
Ein 3%iges Agarosegemisch, bestehend aus 2 Teilen Biorad Agarose (0,45 g) und einem Teil NuSieve GTG Agarose (0, 15 g), wird mit 22 ml 1 x Tris-Borat-EDTA-Puffer (TBE) aufgekocht, mit 0,5 μl (1 μg/μl) Ethidiumbromid vorgefärbt und bei 4 °C zu einem ca. 3 mm dicken Gel gegossen.
6 μl eines jeden PCR-Ansatzes werden in einer Microtiteφlatte mit 1 μl 10 x Gelladepuffer gut vermischt und in die Geltaschen pipettiert. Im ersten und letzten Slot einer jeden Reihe wird zur Beurteilung der Länge der -Amplifikate 1 μl des Boehringer DNA-Längen- Standard VI (Boehringer Mannheim GmbH, BRD) aufgetragen. - ι i-
Die Geleiektrophorese erfolgt bei einer Spannung von 100 Volt und einer Stromstarke von 50 mA über die Dauer von 30 Minuten Zur Auswertung wird das Gel auf einen 302 nm UV-Transilluminator gelegt und mit einer Polaroidkamera (Blende: 4 5, Belichtungsdauer:
2 Sekunden) fotografiert
Herstellung von DNA-Matrix mittels eines praparativen Agarosegels
Aus 1,4 g Nusieve GTG und 20 ml 1 x Tris-Acetat-Puffer wird ein 1,5 % niedrig- schmelzendes Agarosegel hergestellt. Nach dem Erhitzen wird der homogenen Masse 1 μl Ethidiumbromid (10 mg/ml) hinzugefügt 100 μl der Produkte der inneren PCR (Primeφaar 1409/10, SEQ ID NO 3/4)) werden mit lO.μUQ. x Gelladepuffer gut vermischt und in eine große Geltasche pipettiert Nach der elektrophoretischen Auftrennung wird mit einem 302 nm UV-Transilluminator die Zielbande aus dem Gel ausgeschnitten und in ein Reagenzgefäß überführt. Das Gelstuck wird in einem Thermoblock aufgeschmolzen und jeweils
3 μl in 0,5 μl Reagenzgefaßen für die spatere Markierungsreaktion aliquotiert
Nachweis der Markierungsreaktion im Agarosegel
In einem 3 % Agarosegel werden jeweils nach dem Mischen mit 10 x Gelladepuffer, 5 μl der markierten Amplifikate neben 5 μl nicht-markierten Amplifikate aufgetragen. Die markierten Amplifikate weisen im Vergleich zu dem nicht-markierten Amplifikat ein retardiertes Laufverhalten im Gel auf und ermöglichen damit einen Rückschluß auf die erfolgte Markierungsreaktion
Sensitivitat der hergestellten Sonden
Um die Unterschiede zwischen verschiedenen Markierungsreaktionen erfassen zu können, wird die Qualität der neu hergestellten Sonde in zwei Verdunnungsreihen geprüft. In der ersten Verdunnungsreihe wird die Sonde in dezimalen Schritten verdünnt in ein Gel aufgetragen, geblottet und, da die Sonde selbst Digoxigenin-markiert ist, direkt detektiert. Bei der zweiten Verdunnungsreihe wird das Zielamplifikat dezimal (1 μl, 0,1 μl, 0,01 μl, 0,001 μl) im Gel aufgetragen, geblottet und mit 2 μl der neu synthetisierten Sonde unter den Standardbedingungen hybridisiert und detektiert. - -
Southem Blot
Materialien
"DIG DNA Labelling and Detection Kit non-radioactive" : Boehringer Mannheim, # 1093 657.
- Denaturierungspuffer: 1,5 M NaCl [88 g/1]; 0,5 M NaOH [20g l]
- Neutralisierungspuffer: IM TrisHCl [121 g/1]; 2 M NaCl [117 g/1]; pH 5.0 Nylonmembran, positiv geladene, 0.45 μ, Fa. Boehringer, # 1417 240
- Waschpuffer 1 : 2 x SSC, 01 % SDS
- Waschpuffer 2: 0, 1 x;SSC, 0, 1 % SDS
Hybridisierungspuffer: 5 x SSC; 2,0 % Blocking Reagenz, 0,1 % N-Laurosylsarkosin,
Na-salt (Sigma); 0,02 % SDS (n-Dodecylsulfat-Natriumsalz)
Boehringer Positivsonde: BamHl linearisierte pBr328 DNA, random priming markiert mit Digoxigenin; Boehringer, # 1062 590
50 ml Falcon-Röhrchen
DNA-Transfer
Um die im Agarosegel doppelstrangig vorliegenden Amplifikate in einzelsträngige DNA zu trennen, wird das Gel 10 Minuten lang in der Denaturierungslösung (1,5 M NaCl, 0,5 M NaOH) inkubiert und 10 Minuten in Neutralisierungspuffer ( 1 M Tris, 2 M NaCl, pH 5.0) gelegt.
Das neutralisierte Gel wird mit der Slotreihe nach unten auf ein vorab befeuchtetes What- man-Papier gelegt. Anschließend wird die auf 6,8 x 10,3 cm zurechtgeschnittene Nylonmembran ohne Luftblasen auf das Gel plaziert.
Drei ebenfalls in Neutralisierungspuffer angefeuchtete Lagen Whatman-3MM-Papier werden nacheinander über die Nylonmembran gelegt. Abschließend werden noch 5 cm Papierhandtücher darübergeschichtet und mit 500 g Gewicht beschwert. Nach 6 Stunden hat der DNA-Transfer bei Amplifikation bis 400 bp stattgefunden. Die so transferierten DNA- - IS-
Amplifikate werden auf der noch feuchten Membran mit 120 mJ UV-gecrosslinkt. Die Membran wird an der Luft getrocknet und dann staubfrei bis zur Hybridisierung aufbewahrt.
Hvbridisierung mit spezifischen Proben
Die Nylonmembran wird mit 5 ml Hybridisierungspuffer bei 62 °C unter Rotation für 30 Minuten vorhybridisiert. Jeweils 2 μl der Digoxigenin-markierten Sonden und der Boehringer Positivsonde (BamHl-linearisierte pBr328 DNA, random priming markiert mit Di- goxigenin) werden, zusammen mit Hybridisierungspuffer, thermisch denaturiert und dem Vorhybridisierungs-Mix hinzugefügt. Nach 12 Stunden wird die Lösung verworfen und die Membran zweimal bei Raumtemperatur für 5,Minuten mit Waschpuffer 1 und zweimal mit Waschpuffer 2 bei 65 °C 'unter ständiger Rotation inkubiert. Die Blot-Membranen werden sofort chromogen detektiert.
Chromogen-Detektion der DNA-DNA-Hybride (nicht-radioaktive Detektion
Materialien
- Detektions-Puffer 1 : 100 mM Maleinsäure, 150 mM NaCl, 0,3 % (w/v) Tween™ 20, pH 7.0 bei 20 °C.
Detektions-Puffer 2: 1,0 % Blocking Reagenz gelöst in Detektions-Puffer 1.
- Detektions-Puffer 3: 100 mM Tris HC1, 100 mM NaCl, 50 mM MgC12, pH 9.5 bei 20°.
- Detektions-Puffer 4: 10 mM Tris HC1, 1 mM EDTA, pH 8.0 bei 20°
Alkalische Phosphatase konjugierter polyklonaier Schaf-anti-Digoxigenin-Antiköφer; Fab-Fragment, 750 U/ml, Boehringer, # 1093 328
Farblösung für chromogen-Detektion (frisch zubereitet): 45 μl Nitroblue-Tetrazolium- Salz(NBT)-Lösung; 35 μl 5-Brom-4-Chlor-Indolylρhosphat (X-Phosphat) in 10 ml Detektions-Puffer 3.
Durchführung
Die Membran wird für 30 Sekunden in Detektionspuffer 1 inkubiert, gefolgt von
30 Minuten in 20 ml Detektionspuffer 2. 2 μl Antiköφer-Konjugat werden mit 10 ml frisch angesetztem Detektionspuffer 2 gemischt und dann zu der Membran hinzugegeben. Nach 30 Minuten standigem leichten Schütteln wird die Antikorperlosung verworfen und zweimal für 10 Minuten mit Detektionspuffer 1 gewaschen. Während der kurzen (30 Sekunden) Äquilibrierung mit Detektionspuffer 3, wird die Farblosung (45 μl NBT und 35 μl X-Phosphat in 10 ml Detektionspuffer 3 verdünnt) frisch hergestellt. Zur Entwicklung werden die Membranen in eine Klarsichtfolie gelegt, mit der Farblosung beschichtet und unter Ausschluß von Licht aufbewahrt. Während der Entwicklung, die bei diagnostischen Fragestellungen mindestens 2 Stunden bis maximal 24 Stunden dauert, dürfen die Membranen nicht bewegt werden. Bei Erreichen der gewünschten Anfärbung wird die Reaktion mit 3 ml Detektionspuffer 4 abgestoppt.
Resultate
Sensitivität und Spezifität
Dezimale Verdunnungsreihen der EBV-Kontroll-DNA (B95-8 Strain) zeigen, daß nach der Amplifikation mit dem Primeφaar 1407/08 (SEQ.ID.NO. 1/2), gefolgt von der Hybridisierung und Detektion, zuveriassig ca. 2 bis 20 EBV-Kopien nachweisbar waren. Weder DNA von anderen humanpathogenen Heφesviren noch humane DNA wurde mit den Primerpaaren 1407/08, 1409/10 amplifiziert. Die experimentell nachgewiesenen Sensitivitäten waren im direkten Vergleich mit publizierten EBV-DNA-PCR-Systemen stets mindestens 1 Zehneφotenz sensitiver. Aufgrund der hohen Sensitivität eignet sich dieses Primersystem sowohl für die virologische Diagnostik bei akuten Erkrankungen wie auch für das Monitoring und Screening bei gefährdeten Patientenkollektiven wie Transplantationsempfängern und Immundefizienten.
-'? -
Beispiel 2
Weitere Primeφaare
(+)-Primer SEQ.ID.NO. (-)-Primer SEQ.ID.NO.
GGTCTATGGTTGGCTGCGCT 5 AGCGACGGTGATGAAGGTGG 6
GGTCTATGGTTGGCTGCGCT 5 TTGTGTGGACTCCTGGCGCT 7
CTATGGTTGGCTGCGCTGCT 8 TTGTGTGGACTCCTGGCGCT 7
CTATGGTTGGCTGCGCTGCT 8 TGGACTCCTGGCGCTCTGAT 9
GGCTGCGCTGCTGCTATCTT 10 GAACTGACAATTGGCTGCTG 11
Sequenzprotokoll
(1) ALLGEMEINE ANGABEN:
(l) ANMELDER:
(A) NAME: Boehringer Mannheim GmbH
(B) STRASSE: Sandhofer Strasse 116
(C) ORT: Mannheim
(E) LAND: Germany
(F) POSTLEITZAHL: 68298
(G) TELEFON: 0621/759-4348 (H) TELEFAX: 0621/759-4457
(11) BEZEICHNUNG DER ERFINDUNG: Sensitiver Epstein-Barr-Virus DNA-Nachweis
(m) ANZAHL DER SEQUENZEN: 13
(IV) COMPUTER-LESBARE FASSUNG.»
(A) DATENTRÄGER: ~Floppy disk
(B) COMPUTER: IBM PC compatible
(C) BETRIEBSSYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentin Release #1.0, Version #1.30 (EPA)
(2) ANGABEN ZU SEQ ID NO: 1:
(i) SEQUENZKENNZEICHEN:
(A) LANGE: 20 Basenpaare
(B) ART: Nucleotld
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsaure
(A) BESCHREIBUNG: /desc = "Oligodesoxyribonukleotid"
(in) HYPOTHETISCH: NEIN
(XI) SEQUENZBESCHREIBUNG: SEQ ID NO: 1: GTCCCCACGC GCGCATAATG 20
(2) ANGABEN ZU SEQ ID NO: 2:
(i) SEQUENZKENNZEICHEN:
(A) LANGE: 20 Basenpaare
(B) ART: Nucleotid
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsaure
(A) BESCHREIBUNG: /desc = "Oligodesoxyribonukleotid"
(Üi) HYPOTHETISCH: NEIN
(XI) SEQUENZBESCHREIBUNG: SEQ ID NO: 2: GTGGACTCCT GGCGCTCTGA 20
(2) ANGABEN ZU SEQ ID NO: 3:
(l) SEQUENZKENNZEICHEN:
(A) LANGE: 20 Basenpaare
(B) ART: Nucleotid
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(n) ART DES MOLEKÜLS: Sonstige Nucleinsaure
(A) BESCHREIBUNG: /desc = "Oligodesoxyribonukleotid"
(in) HYPOTHETISCH: NEIN
(XI) SEQUENZBESCHREIBUNG: SEQ ID NO: 3: CTATGGTTGG CTGCGCTGCT 20
(2) ANGABEN ZU SEQ ID NO: 4:
(i) SEQUENZKENNZEICHEN:
(A) LANGE: 20 Basenpaare
(B) ART: Nucleotid
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsaure
(A) BESCHREIBUNG: /desc = "Oligodesoxyribonukleotid"
(ill) HYPOTHETISCH: NEIN
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 4: TTGGCTGCTG TCTGGCTTAC 20
(2) ANGABEN ZU SEQ ID NO: 5:
(i) SEQUENZKENNZEICHEN:
(A) LANGE: 20 Basenpaare
(B) ART: Nucleotid
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsaure
(A) BESCHREIBUNG: /desc = "Oligodesoxyribonukleotid"
(m) HYPOTHETISCH: NEIN
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 5: GGTCTATGGT TGGCTGCGCT 20
(2) ANGABEN ZU SEQ ID NO: 6: ~ Zo-
(i) SEQUENZKENNZEICHEN:
(A) LANGE: 20 Basenpaare
(B) ART: Nucleotid
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsaure
(A) BESCHREIBUNG: /desc = "Oligodesoxyribonukleotid"
(iii) HYPOTHETISCH: NEIN
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 6: AGCGACGGTG ATGAAGGTGG 20
(2) ANGABEN ZU SEQ ID NO: 7:
(i) SEQUENZKENNZEICHEN':
(A) LANGE: 20 Basenpaare
(B) ART: Nucleotid
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsaure
(A) BESCHREIBUNG: /desc = "Oligodesoxyribonukleotid"
(iii) HYPOTHETISCH: NEIN
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 7: TTGTGTGGAC TCCTGGCGCT 20
(2) ANGABEN ZU SEQ ID NO: 8:
(i) SEQUENZKENNZEICHEN:
(A) LÄNGE: 20 Basenpaare
(B) ART: Nucleotid
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsaure
(A) BESCHREIBUNG: /desc = "Oligodesoxyribonuκleotid"
(iii) HYPOTHETISCH: NEIN
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 8: CTATGGTTGG CTGCGCTGCT 20
(2) ANGABEN ZU SEQ ID NO: 9:
(i) SEQUENZKENNZEICHEN:
(A) LÄNGE: 20 Basenpaare
(B) ART: Nucleotid - 2. » -
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsaure
(A) BESCHREIBUNG: /desc = "Oligodesoxyribonukleotid"
(iii) HYPOTHETISCH: NEIN
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 9: TGGACTCCTG GCGCTCTGAT 20
(2) ANGABEN ZU SEQ ID NO: 10:
(i) SEQUENZKENNZEICHEN:
(A) LÄNGE: 20 Basenpaare
(B) ART: Nucleotid
( C ) STRANGFORM : Einzels t rang
( D) TOPOLOGIE : linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsaure
(A) BESCHREIBUNG: /desc = "Oligodesoxyribonukleotid"
(iii) HYPOTHETISCH: NEIN
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 10: GGCTGCGCTG CTGCTATCTT 20
(2) ANGABEN ZU SEQ ID NO: 11:
(i) SEQUENZKENNZEICHEN:
(A) LÄNGE: 20 Basenpaare
(B) ART: Nucleotid
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Sonstige Nucleinsaure
(A) BESCHREIBUNG: /desc = "Oligodesoxyribonukleotid"
(iii) HYPOTHETISCH: NEIN
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 11: GAACTGACAA TTGGCTGCTG 20
(2) ANGABEN ZU SEQ ID NO: 12:
(i) SEQUENZKENNZEICHEN:
(A) LÄNGE: 121 Basenpaare
(B) ART: Nucleotid
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear
(ii) ART DES MOLEKÜLS: Genom-DNA un ) HYPOTHETISCH : NEIN
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 12: AAACTTTAGA GGCGAATGGG CGCCATTTTG TCCCCACGCG CGCATAATGG CGGACCTAGG 60 CCTAAAACCC CCAGGAAGCG GGTCTATGGT TGGCTGCGCT GCTGCTATCT TTAGAGGGGA 120
G 121
(2) ANGABEN ZU SEQ ID NO: 13:
(i) SEQUENZKENNZEICHEN:
(A) LÄNGE: 416 Basenpaare
(B) ART: Nucleotid
(C) STRANGFORM: Einzelstrang
(D) TOPOLOGIE: linear . ■■ »
(ii) ART DES MOLEKÜLS: Genom-DNA (iii) HYPOTHETISCH: NEIN
(xi) SEQUENZBESCHREIBUNG: SEQ ID NO: 13:
GAGGGTGAGG CCCAGCCCCC TCCCGCCCCT GTCCACTGCC CCGGTCCCCC CAGAAGCCCC 60
CAAAAGTAGA GGCTCAGGCC ATGCGCGCCC TGTCACCAGG CCTGCCAAAG AGCCAGATCT 120
AAGGCCGGGA GAGGCAGCCC CAAAGCGGGT GCAGTAACAG GTAATCTCTG GTAGTGATTT 180
GGACCCGAAA TCTGACACTT TAGAGCTCTG GAGGACTTTA AAACTCTAAA AATCAAAACT 240
TTAGAGGCGA ATGGGCGCCA TTTTGTCCCC ACGCGCGCAT AATGGCGGAC CTAGGCCTAA 300
AACCCCCAGG AAGCGGGTCT ATGGTTGGCT GCGCTGCTGC TATCTTTAGA GGGGAAAAGA 360
GGAATAAGCC CCCAGACAGG GGAGTGGGCT TGTTTGTGAC TTCACCAAAG GTCAGG 416

Claims

Patentansprüche
1. Nukleinsauresonde mit einer Länge von weniger als 350 Basen und mehr als
10 Basen, welche eine oder mehrere Sequenzen von mindestens 10 aufeinanderfolgenden Basen aufweist, die zu 90 % oder mehr komplementär oder homolog sind zu SEQ.ID.NO. 13.
2. Sonde gemäß Anspruch 1, dadurch gekennzeichnet, daß sie unter Bedingungen, bei denen sie an EBN-Nukleinsäuren binden kann, weder an Nukleinsäuren von anderen humanpathogenen Herpesviren noch an humane DNA bindet.
3. Sonde gemäß Anspruch 1 oder 2, dadurch gekennzeichnet, daß sie eine der Sequenzen der SEQ.ID.NOS. 1 bis 4 oder Teilen davon mit einer Länge von 10 oder mehr Basen oder eine der hierzu komplementären Sequenzen enthält.
4. Nukleinsauresonde, hergestellt durch in-vitro-Amplifikation eines Teils der BamHlW- Region des EBV-Genoms.
5. Sonde gemäß Anspruch 4, enthaltend mindestens eine der Sequenzen der SEQ.ID.NOS. 1 bis 4 oder Teilen davon mit einer Länge von 10 oder mehr Basen und mindestens einer zu einer Sequenz der SEQ.ID.NOS. 1 bis 4 oder Teilen davon mit einer Länge von 10 oder mehr Basen komplementären Sequenz.
6. Sonde gemäß Anspruch 4 oder 5, dadurch gekennzeichnet, daß sie unter Bedingungen, bei denen sie an EBV-Nukleinsäuren binden kann, weder an Nukleinsäuren von anderen humanpathogenen Herpesviren noch an humane DNA bindet.
7. Sonde gemäß einem der Ansprüche 4 bis 6, dadurch gekennzeichnet, daß sie eine Länge von mehr als 100 Basen hat.
8. Sonde gemäß einem der Ansprüche 1 bis 3, dadurch gekennzeichnet, daß sie eine Länge von weniger als 50 Basen hat.
9 Kombination enthaltend 2 oder mehr Sonden gemäß enem der vorangehenden Ansprüche.
10 Nerfahren zur spezifischen Herstellung einer Vielzahl von Kopien von Fragmenten des EBV-Genoms unter Verwendung von mindestens 2 Sonden gemäß einem der Ansprüche 1 bis 3 oder 8
11. Verfahren zum Nachweis von EBV, dadurch gekennzeichnet, daß eine oder mehr Sonden gemäß einem der Ansprüche 1 bis 8 an das EBV-Genom gebunden werden und das Auftreten der Bindung zum Gegenstand des Nachweises benutzt wird.
12 Kombination gemäß Anspruch 9, dadurch gekennzeichnet, daß die Nukleobasen am 3 '-Ende der Sonden nicht zueinander komplementär sind
13 Kombination gemäß Anspruch 9, dadurch gekennzeichnet, daß die Sonden einen ahnlichen GC-Gehalt haben.
PCT/EP1997/003555 1996-07-11 1997-07-05 Sensitiver epstein-barr-virus dna-nachweis WO1998002584A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE19627932.1 1996-07-11
DE1996127932 DE19627932A1 (de) 1996-07-11 1996-07-11 Sensitiver Epstein-Barr-Virus DNA-Nachweis

Publications (1)

Publication Number Publication Date
WO1998002584A1 true WO1998002584A1 (de) 1998-01-22

Family

ID=7799535

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP1997/003555 WO1998002584A1 (de) 1996-07-11 1997-07-05 Sensitiver epstein-barr-virus dna-nachweis

Country Status (2)

Country Link
DE (1) DE19627932A1 (de)
WO (1) WO1998002584A1 (de)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4472171B2 (ja) * 1998-03-04 2010-06-02 アクゾ・ノベル・エヌ・ベー エプスタイン−バーウイルス（ｅｂｖ）核酸の増幅と検出のためのオリゴヌクレオチド
EP1173615A2 (de) * 1999-04-30 2002-01-23 Advance Sentry Corporation System und verfahren zum screening auf karzinome der nasalen pharynx

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH05309000A (ja) * 1992-05-13 1993-11-22 Iatron Lab Inc エプスタイン−バールウイルスの検出方法
EP0605040A1 (de) * 1992-12-28 1994-07-06 SOLVAY (Société Anonyme) Pullulanase, Mikroorganismen die sie produzieren, Verfahren zur Herstellung und ihre Anwendung
WO1995019369A1 (en) * 1994-01-14 1995-07-20 Vanderbilt University Method for detection and treatment of breast cancer
WO1996003526A1 (fr) * 1994-07-21 1996-02-08 Parteurop Developpement Procede d'amplification d'acide nucleique a l'aide d'un nucleoside modifie, et detection du produit d'amplification a l'aide d'anticorps

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH05309000A (ja) * 1992-05-13 1993-11-22 Iatron Lab Inc エプスタイン−バールウイルスの検出方法
EP0605040A1 (de) * 1992-12-28 1994-07-06 SOLVAY (Société Anonyme) Pullulanase, Mikroorganismen die sie produzieren, Verfahren zur Herstellung und ihre Anwendung
WO1995019369A1 (en) * 1994-01-14 1995-07-20 Vanderbilt University Method for detection and treatment of breast cancer
WO1996003526A1 (fr) * 1994-07-21 1996-02-08 Parteurop Developpement Procede d'amplification d'acide nucleique a l'aide d'un nucleoside modifie, et detection du produit d'amplification a l'aide d'anticorps

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHEUNG A AND KIEFF E: "Long internal direct repeat in Epstein-Barr virus DNA", JOURNAL OF VIROLOGY, vol. 44, no. 1, 1982, pages 286 - 294, XP002045655 *
KON S ET AL: "Detection of Epstein-Barr virus DNA and EBV -determined nuclear antigen in angioimmunoblastic lymphadenopathy with dysproteinemia type T cell lymphoma.", PATHOLOGY, RESEARCH AND PRACTICE, vol. 189, no. 10, 1993, pages 1137 - 1144, XP002045657 *
LABRECQUE LG ET AL: "Epstein-Barr virus in epithelial cell tumors: a breast cancer study.", CANCER RESEARCH, vol. 55, no. 1, 1995, pages 39 - 45, XP002045656 *
PATENT ABSTRACTS OF JAPAN vol. 018, no. 114 (C - 1171) 24 February 1994 (1994-02-24) *

Also Published As

Publication number Publication date
DE19627932A1 (de) 1998-01-15

Similar Documents

Publication Publication Date Title
DE69836012T2 (de) Zwei-schritt hybridisierung und einfang von einem polynukleotid
DE69535384T2 (de) Verfahen zum nachweis von nukleinsäure mit einer spezifischen sequenzzusammensetzung
DE69633941T2 (de) Nachweis von unterschieden in nukleinsäuren
DE69532984T2 (de) Verfahren zur Koamplifikation einer Zielnukleinsäure unter Versendung eines Volumenabscheidungsmittel in der Reaktionszusammensetzung, Testsatz und Testvorrichtung
DE69737628T2 (de) Nukleinsäureprimer und -sonden zur detektion onkogener humaner papillomaviren
DE69734576T2 (de) Methode zur vervielfältigung und zum nachweis eines gewünschten nukleinsäurefragments
DE60309817T2 (de) Mehrzweck-Primer und -Sonden für verbesserte Hybridisierungsassays durch Zerstörung von Sekundärstrukturen
DE60308017T2 (de) Amplifizierungs-hybridisierungsverfahren zum nachweis und zur typisierung des mes menschlichen papillomavirus
JPH08501689A (ja) 改良型の鎖置換アッセイおよびそれに有用な複合体
EP1029083A2 (de) Spezifisches und sensitives nukleinsäurenachweisverfahren
EP0595167B1 (de) Spezifische Gensonden und Verfahren zur Diagnostik von Candida albicans
EP1595960B1 (de) DNA-Nachweis über einen Strangreassoziationskomplex
DE60004122T2 (de) Amplifizierung und Nachweis von Campylobacter jejuni und Campylobacter coli
EP2452198B1 (de) Detektion von antigenen
DE60122067T2 (de) Vervielfältigung und Detektion von Legionella pneumophila Nukleinsäuren
DE69735046T2 (de) Zusammensetzungen und Verfahren für den Nachweis von Mycobacterium kansasii
DE60011177T2 (de) Amplifikation und Detektion von Shigella spp. und enteroinvasiven Stämmen von Escherichia coli
DE60114816T2 (de) Umgekehrter nachweis zur identifizierung und/oder quantifizierung von nukleotid-zielsequenzen mittels biochips
EP0566050B2 (de) Verfahren zum Nachweis von Nukleinsäuren
EP0437774A1 (de) Verfahren zur Herstellung von modifizierten Nukleinsäuren
DE19548680A1 (de) Verfahren zum quantitativen Nachweis von spezifischen Nukleinsäuresequenzen
WO1998002584A1 (de) Sensitiver epstein-barr-virus dna-nachweis
DE69636917T2 (de) Nucleinsäuresonden und Amplifizierungsoligonukleotide für Neisseria Spezies
DE69921594T2 (de) Methoden zur synthese von polynukleotiden durch ligation von multiplen oligomeren
EP0422873B1 (de) Nukleinsäure-Sonden und Verfahren zum Nachweis von Cryptococcus Neoformans

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: JP

Ref document number: 1998505574

Format of ref document f/p: F

122 Ep: pct application non-entry in european phase