WO1996039515A1 - Human vascular endothelial growth factor 2 - Google Patents

Human vascular endothelial growth factor 2 Download PDF

Info

Publication number
WO1996039515A1
WO1996039515A1 PCT/US1996/009001 US9609001W WO9639515A1 WO 1996039515 A1 WO1996039515 A1 WO 1996039515A1 US 9609001 W US9609001 W US 9609001W WO 9639515 A1 WO9639515 A1 WO 9639515A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
vegf2
polynucleotide
dna
arg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1996/009001
Other languages
English (en)
French (fr)
Other versions
WO1996039515A9 (en
Inventor
Craig A. Rosen
Jing-Shan Hu
Liang Cao
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=23849909&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO1996039515(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to DE69636752T priority Critical patent/DE69636752T2/de
Priority to AU60467/96A priority patent/AU714484B2/en
Priority to EP96918130A priority patent/EP0837934B1/en
Priority to CA002224093A priority patent/CA2224093C/en
Priority to JP9501427A priority patent/JPH11513883A/ja
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Priority to KR1019970709003A priority patent/KR100511692B1/ko
Publication of WO1996039515A1 publication Critical patent/WO1996039515A1/en
Publication of WO1996039515A9 publication Critical patent/WO1996039515A9/en
Priority to MXPA/A/1997/009243A priority patent/MXPA97009243A/xx
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/08Vasodilators for multiple indications
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/14Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/49Platelet-derived growth factor [PDGF]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • Thi ⁇ invention relate ⁇ to newly identified polynucleotide ⁇ , polypeptide ⁇ encoded by ⁇ uch polynucleotide ⁇ , the u ⁇ e of ⁇ uch polynucleotide ⁇ and polypeptide ⁇ , a ⁇ well a ⁇ the production of ⁇ uch polynucleotide ⁇ and polypeptide ⁇ .
  • the polypeptide of the pre ⁇ ent invention ha ⁇ been, identified a ⁇ a member of the va ⁇ cular endothelial growth factor family. More particularly, the polypeptide of the pre ⁇ ent invention i ⁇ va ⁇ cular endothelial growth factor 2, sometime ⁇ hereinafter referred to a ⁇ "VEGF2. ⁇
  • the invention also relates to inhibiting the action of such polypeptide.
  • angiogenesis i ⁇ e ⁇ ential for embryonic development, subsequent growth, and tissue repair.
  • Angiogenesis is an essential part of certain pathological conditions such a ⁇ neopla ⁇ ia, for example, tumors and gliomas, and abnormal angiogenesis i ⁇ a ⁇ ociated with other disea ⁇ e ⁇ ⁇ uch a ⁇ inflammation, rheumatoid arthritis, psoriasis, and diabetic retinopathy (Folkman, J. and Klagsbrun, M., Science 235:442-447, (1987)) .
  • Both acidic and ba ⁇ ic fibrobla ⁇ t growth factor molecule ⁇ are mitogen ⁇ for endothelial cell ⁇ and other cell type ⁇ .
  • Angiotropin and angiogenin can induce angiogenesis, although their function ⁇ are unclear (Folkman, J., 1993, Cancer Medicine pp. 153-170, Lea and Febiger Pre ⁇ s) .
  • a highly selective mitogen for vascular endothelial cells is vascular endothelial growth factor or VEGF (Ferrara, N. , et al., Endocr. Rev. 13:19-32, (1992)), al ⁇ o known a ⁇ va ⁇ cular permeability factor (VPF) .
  • Va ⁇ cular endothelial growth factor i ⁇ a ⁇ ecreted angiogenic mitogen who ⁇ e target cell ⁇ pecificity appear ⁇ to be restricted to vascular endothelial cells.
  • the murine VEGF gene has been characterized and its expres ⁇ ion pattern in embryogene ⁇ i ⁇ ha ⁇ been analyzed.
  • a per ⁇ i ⁇ tent expression of VEGF wa ⁇ observed in epithelial cell ⁇ adjacent to fene ⁇ trated endo elium, e.g., in choroid plexus and kidney glomeruli.
  • the data wa ⁇ con ⁇ i ⁇ tent with a role of VEGF a ⁇ a multifunctional regulator of endothelial cell growth and differentiation (Breier, G. et al . Development, 114:521-532 (1992)).
  • PDGF platelet-derived growth factor
  • PLGF placenta growth factor
  • the ⁇ e three protein ⁇ belong to the same family and share a conserved motif. Eight cy ⁇ teine re ⁇ idue ⁇ contributing to disulfide-bond formation are strictly conserved in these proteins.
  • spliced mRNAs have been identified for both VEGF, PLGF and PDGF and the ⁇ e different splicing products differ in biological activity and in receptor-binding specificity.
  • VEGF and PDGF function as homo-dimers or hetero-dimer ⁇ and bind to receptor ⁇ which elicit intrin ⁇ ic tyrosine kinase activity following receptor dimerization.
  • VEGF ha ⁇ four different forms of 121, 165, 189 and 206 amino acids due to alternative splicing.
  • VEGF121 and VEGF165 are soluble and are capable of promoting angiogenesis, wherea ⁇ VEGF189 and VEGF206 are bound to heparin containing proteoglycan ⁇ in the cell ⁇ urface.
  • the factor can be i ⁇ olated from pituitary cell ⁇ and ⁇ everal tumor cell line ⁇ , and ha ⁇ been implicated in some human glioma ⁇ (Plate, K.H. Nature 359:845-848, (1992)) .
  • expre ⁇ ion of VEGF121 or VEGF165 confers on Chinese ham ⁇ ter ovary cell ⁇ the ability to form tumor ⁇ in nude mice (Ferrara, N. , et al., J. Clin. Invest. 91:160-170, (1993)) .
  • Vascular permeability factor has also been found to be respon ⁇ ible for per ⁇ i ⁇ tent microva ⁇ cular hyperpermeability to plasma protein ⁇ even after the ce ⁇ ation of injury, which i ⁇ a characteri ⁇ tic feature of normal wound healing. Thi ⁇ ⁇ ugge ⁇ t ⁇ that VPF is an important factor in wound healing. Brown, L.F. et al . , J. Exp. Med., 176:1375-9 (1992) .
  • VEGF ha ⁇ also been shown to induce angiogenesi ⁇ in vivo. Since angiogenesi ⁇ i ⁇ essential for the repair of normal tis ⁇ ue ⁇ , e ⁇ pecially va ⁇ cular ti ⁇ ues, VEGF ha ⁇ been propo ⁇ ed for u ⁇ e in promoting va ⁇ cular ti ⁇ ue repair (e.g., in athero ⁇ clero ⁇ i ⁇ ) .
  • U.S. Patent No. 5,073,492, issued December 17, 1991 to Chen et al. discloses a method for synergistically enhancing endothelial cell growth in an appropriate environment which comprises adding to the environment, VEGF, effectors and serum-derived factor.
  • the DNA encodes a protein that may exi ⁇ t a ⁇ either a hetero-dimer or homo-dimer.
  • the protein i ⁇ a mammalian va ⁇ cular endothelial cell mitogen and, a ⁇ ⁇ uch, is useful for the promotion of va ⁇ cular development and repair, a ⁇ di ⁇ clo ⁇ ed in European Patent Application No. 92302750.2, published September 30, 1992.
  • polypeptide ⁇ of the pre ⁇ ent invention have been putatively identified a ⁇ a novel va ⁇ cular endothelial growth factor ba ⁇ ed on amino acid ⁇ equence homology to human VEGF.
  • novel mature polypeptide ⁇ a ⁇ well a ⁇ biologically active and diagno ⁇ tically or therapeutically u ⁇ eful fragment ⁇ , analog ⁇ and derivative ⁇ thereof.
  • the polypeptide ⁇ of the pre ⁇ ent invention are of human origin.
  • isolated nucleic acid molecules encoding the polypeptide ⁇ of the pre ⁇ ent invention, including mRNA ⁇ , DNA ⁇ , cDNA ⁇ , genomic DNA a ⁇ well a ⁇ biologically active and diagno ⁇ tically or therapeutically useful fragment ⁇ , analog ⁇ and derivative ⁇ thereof.
  • proce ⁇ ses for producing such polypeptide ⁇ by recombinant technique ⁇ compri ⁇ ing culturing recombinant prokaryotic and/or eukaryotic ho ⁇ t cell ⁇ , containing a nucleic acid ⁇ equence encoding a polypeptide of the present invention, under conditions promoting expres ⁇ ion of said proteins and ⁇ ub ⁇ equent recovery of ⁇ aid protein ⁇ .
  • a proce ⁇ for utilizing such polypeptide, or polynucleotide encoding ⁇ uch polypeptide for therapeutic purpose ⁇ , for example, to ⁇ timulate angiogene ⁇ i , wound-healing, and to promote va ⁇ cular ti ⁇ ue repair.
  • antibodie ⁇ again ⁇ t ⁇ uch polypeptide ⁇ there are provided antibodie ⁇ again ⁇ t ⁇ uch polypeptide ⁇ .
  • antagoni ⁇ t ⁇ to ⁇ uch polypeptide ⁇ which may be used to inhibit the action of such polypeptides, for example, to inhibit the growth of tumors, to treat diabetic retinopathy, inflammation, rheumatoid arthritis and psoria ⁇ i ⁇ .
  • nucleic acid probe ⁇ compri ⁇ ing nucleic acid molecule ⁇ of ⁇ ufficient length to ⁇ pecifically hybridize to nucleic acid sequences of the present invention.
  • a proce ⁇ for utilizing ⁇ uch polypeptide ⁇ , or polynucleotide ⁇ encoding such polypeptides, for in vitro purpo ⁇ e ⁇ related to ⁇ cientific re ⁇ earch, ⁇ ynthe ⁇ i ⁇ of DNA and manufacture of DNA vector ⁇ .
  • Fig. 1 shows the cDNA ⁇ equence and the corre ⁇ ponding deduced amino acid ⁇ equence of the polypeptide of the pre ⁇ ent invention.
  • the ⁇ tandard one letter abbreviations for amino acid ⁇ are used.
  • Sequencing wa ⁇ performed using 373 Automated DNA Sequencer (Applied Biosy ⁇ tem ⁇ , Inc.) . Sequencing accuracy is predicted to be greater than 97%.
  • Fig. 2 is an illustration of the amino acid sequence homology between the polypeptide of the present invention and other members of the human PDGF/VEGF family.
  • the boxed areas indicate the conserved ⁇ equence ⁇ and the location of the eight con ⁇ erved cysteine residue ⁇ .
  • Fig. 3 shows a photograph of a gel after in vitro transcription, translation and electrophore ⁇ i ⁇ of the polypeptide of the pre ⁇ ent invention.
  • Lane 1 14 C and rainbow M.W. marker
  • Lane 2 FGF control
  • Lane 3 VEGF2 produced by Ml3-rever ⁇ e and forward primers
  • Lane 4 VEGF2 produced by M13 reverse and VEGF-F4 primer ⁇
  • Lane 5 VEGF2 produced by M13 rever ⁇ e and VEGF-F5 primer ⁇ .
  • Fig. 5 The medium from Sf9 cell ⁇ infected with a nucleic acid ⁇ equence of the present invention wa ⁇ precipitated and the re ⁇ u ⁇ pended precipitate wa ⁇ analyzed by SDS-PAGE and wa ⁇ ⁇ tained with cooma ⁇ ie brilliant blue.
  • VEGF2 wa ⁇ purified from the medium ⁇ upernatant and analyzed by SDS-PAGE in the presence or absence of the reducing agent ⁇ -mercaptoethanol and ⁇ tained by cooma ⁇ ie brilliant blue.
  • Fig. 7 Reverse phase HPLC analy ⁇ i ⁇ of purified VEGF2 u ⁇ ing a RP-300 column (0.21 x 3 cm, Applied Bio ⁇ y ⁇ tems, Inc.) .
  • the column was equilibrated with 0.1% trifluoroacetic acid (Solvent A) and the proteins eluted with a 7.5 min gradient from 0 to 60% Solvent B, composed of acetonitrile containing 0.07% TFA.
  • the protein elution was monitored by absorbance at 215 nm (Red line) and 280 nm (Blue line) .
  • Fig. 8 illustrates the effect of partially-purified VEGF2 protein on the growth of vascular endothelial cells in comparison to basic fibroblast growth factor.
  • Fig. 9 illustrates the effect of purified VEGF2 protein on the growth of vascular endothelial cells.
  • gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) , as well as intervening sequences (introns) between individual coding segments (exons) .
  • nucleic acid molecules which encode for the mature polypeptides having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 97161 on May 24, 1995 or for polypeptides which have fewer amino acid residues than those showing in Figure 1.
  • a polynucleotide encoding a polypeptide of the present invention may be obtained from early stage human embryo (week 8 to 9) osteocla ⁇ toma ⁇ , adult heart or ⁇ everal brea ⁇ t cancer cell line ⁇ .
  • the polynucleotide of thi ⁇ invention was discovered in a cDNA library derived from early stage human embryo week 9. It is structurally related to the VEGF/PDGF family.
  • VEGF2 contains an open reading frame encoding a protein of 419 amino acid residue ⁇ of which approximately the fir ⁇ t 23 amino acid residues are the putative leader sequence such that the mature protein comprises 396 amino acids, and which protein exhibits the highest amino acid sequence homology to human vascular endothelial growth factor (30% identity) , followed by PDGF ⁇ (23%) and PDGFS (22%) .
  • the VEGF2 polypeptide of the pre ⁇ ent invention i ⁇ meant to include the full length polypeptide and polynucleotide ⁇ equence which encodes for any leader sequence ⁇ and for active fragment ⁇ of the full length polypeptide.
  • Active fragments are meant to include any portions of the full length amino acid sequence which have les ⁇ than the full 419 amino acid ⁇ of the full length amino acid ⁇ equence a ⁇ ⁇ hown in SEQ ID No. 2 and Figure 2, but ⁇ till contain the eight cysteine re ⁇ idues ⁇ hown conserved in Figure 2 and such fragments still contain VEGF2 activity.
  • VEGF2 mRNA ⁇ equence ⁇ pre ⁇ ent there are at least two alternatively spliced VEGF2 mRNA ⁇ equence ⁇ pre ⁇ ent in normal ti ⁇ ue ⁇ .
  • the ⁇ ize of the two VEGF2 mRNA ⁇ equence ⁇ which corre ⁇ pond to the full-length and truncated ver ⁇ ion re ⁇ pectively are ⁇ hown in Figure 3, lane 5 shows two bands indicating the pre ⁇ ence of the alternatively ⁇ pliced mRNA encoding the VEGF2 polypeptide of the pre ⁇ ent invention. • - —
  • the polynucleotide of the pre ⁇ ent invention may be in the form of RNA or in the form of DNA, which DNA include ⁇ cDNA, genomic DNA, and ⁇ ynthetic DNA.
  • the DNA may be double- stranded or single-stranded, and if single ⁇ tranded may be the coding ⁇ trand or non-coding (anti- ⁇ en ⁇ e) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide a ⁇ the DNA of Figure 1 or the depo ⁇ ited cDNA.
  • the polynucleotide which encode ⁇ for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the depo ⁇ ited cDNA may include: only the coding ⁇ equence for the mature polypeptide; the coding ⁇ equence for the mature polypeptide (and optionally additional coding ⁇ equence) and non-coding ⁇ equence, ⁇ uch a ⁇ intron ⁇ or non- coding ⁇ equence 5' and/or 3' of the coding ⁇ equence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide a ⁇ well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragment ⁇ , analog ⁇ and derivative ⁇ of the polypeptide having the deduced amino acid ⁇ equence of Figure 1 or the polypeptide encoded by the cDNA of the depo ⁇ ited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
  • the pre ⁇ ent invention include ⁇ polynucleotide ⁇ encoding the ⁇ ame mature polypeptide a ⁇ ⁇ hown in Figure 1 or the ⁇ ame mature polypeptide encoded by the cDNA of the depo ⁇ ited clone a ⁇ well a ⁇ variant ⁇ of ⁇ uch polynucleotide ⁇ which variant ⁇ encode for a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA of the depo ⁇ ited clone.
  • nucleotide variant ⁇ include deletion variant ⁇ , ⁇ ub ⁇ titution variant ⁇ and addition or insertion variant ⁇ .
  • the polynucleotide may have a coding ⁇ equence which i ⁇ a naturally occurring allelic variant of the coding ⁇ equence ⁇ hown in Figure 1 or of the coding ⁇ equence of the depo ⁇ ited clone.
  • an allelic variant i ⁇ an alternate form of a polynucleotide ⁇ equence which may have a ⁇ ub ⁇ titution, deletion or addition of one or more nucleotide ⁇ , which doe ⁇ not ⁇ ubstantially alter the function of the encoded polypeptide.
  • the polynucleotides of the present invention may also have the coding ⁇ equence fu ⁇ ed in frame to a marker ⁇ equence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa- hi ⁇ tidine tag ⁇ upplied by a pQE-9 vector to provide for purification of the mature polypeptide fu ⁇ ed to the marker in the ca ⁇ e of a bacterial ho ⁇ t, or, for example, the marker ⁇ equence may be a hemagglutinin (HA) tag when a mammalian ho ⁇ t, e.g. COS-7 cells, is used.
  • the HA tag corre ⁇ pond ⁇ to an epitope derived from the influenza hemagglutinin protein (Wil ⁇ on, I., et al., Cell, 37:767 (1984)).
  • gene means the segment of DNA involved in producing a polypeptide chain; it include ⁇ region ⁇ preceding and following the coding region (leader and trailer) a ⁇ well a ⁇ intervening ⁇ equence ⁇ ⁇ intron ⁇ ) between individual coding segments (exon ⁇ ) .
  • Fragments of the full length gene of the present invention may be u ⁇ ed a ⁇ a hybridization probe for a cDNA library to i ⁇ olate the full length cDNA and to i ⁇ olate other cDNAs which have a high sequence ⁇ imilarity to the gene or ⁇ imilar biological activity.
  • Probes of thi ⁇ type preferably have at lea ⁇ t 30 ba ⁇ e ⁇ and may contain, for example, 50 or more ba ⁇ e ⁇ .
  • the probe may al ⁇ o be u ⁇ ed to identify a cDNA clone corre ⁇ ponding to a full length tran ⁇ cript and a genomic clone or clone ⁇ that contain the complete gene including regulatory and promoter region ⁇ , exon ⁇ , and intron ⁇ .
  • An example of a ⁇ creen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe.
  • Labeled oligonucleotides having a ⁇ equence complementary to that of the gene of the pre ⁇ ent invention are u ⁇ ed to ⁇ creen a library of human cDNA, genomic DNA or mRNA to determine which member ⁇ of the library the probe hybridize ⁇ to.
  • the present invention further relates to polynucleotide ⁇ which hybridize to the hereinabove-de ⁇ cribed ⁇ equence ⁇ if there i ⁇ at lea ⁇ t 70%, preferably at lea ⁇ t 90%, and more preferably at lea ⁇ t 95% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under ⁇ tringent conditions to the hereinabove-described polynucleotide ⁇ .
  • stringent conditions means hybridization will occur only if there i ⁇ at lea ⁇ t 95% and preferably at lea ⁇ t 97% identity between the ⁇ equence ⁇ .
  • the polynucleotide ⁇ which hybridize to the hereinabove de ⁇ cribed polynucleotide ⁇ in a preferred embodiment encode polypeptide ⁇ which either retain substantially the same biological function or activity a ⁇ the mature polypeptide encoded by the cDNA ⁇ of Figure 1 (SEQ ID NO:l) or the depo ⁇ ited cDNA( ⁇ ) .
  • the polynucleotide may have at lea ⁇ t 20 bases, preferably 30 base ⁇ , and more preferably at lea ⁇ t 50 ba ⁇ e ⁇ which hybridize to a polynucleotide of the pre ⁇ ent invention and which ha ⁇ an identity thereto, a ⁇ hereinabove described, and which may or may not retain activity.
  • such polynucleotides may be employed as probes for the polynucleotide of SEQ ID N0:1, for example, for recovery of the polynucleotide or a ⁇ a diagno ⁇ tic probe or a ⁇ a PCR primer. . - , . occidental _
  • the pre ⁇ ent invention i ⁇ directed to polynucleotide ⁇ having at lea ⁇ t a 70% identity, preferably at lea ⁇ t 90% and more preferably at lea ⁇ t a 95% identity to a polynucleotide which encode ⁇ the polypeptide of SEQ ID NO:2 as well as fragments thereof, which fragment ⁇ have at lea ⁇ t 30 bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotide ⁇ .
  • the deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure.
  • the ⁇ e depo ⁇ it ⁇ are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. ⁇ 112.
  • the sequence of the polynucleotide ⁇ contained in the deposited materials, as well as the amino acid sequence of the polypeptide ⁇ encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any de ⁇ cription of ⁇ equence ⁇ herein.
  • a license may be required to make, use or sell the deposited materials, and no ⁇ uch licen ⁇ e is hereby granted.
  • the present invention further relate ⁇ to a polypeptide ⁇ which have the deduced amino acid ⁇ equence of Figure 1 or which ha ⁇ the amino acid ⁇ equence encoded by the depo ⁇ ited cDNA, a ⁇ well a ⁇ fragment ⁇ , analog ⁇ and derivatives of such polypeptide.
  • fragment, " “derivative” and “analog” when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, means a polypeptide which retains the conserved motif of VEGF protein ⁇ a ⁇ ⁇ hown in Figure 2 and e ⁇ entially the ⁇ ame biological function or activity.
  • polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or ⁇ ynthetic polypeptide ⁇ , preferably recombinant polypeptide ⁇ .
  • the fragment, derivative or analog of the ⁇ polypeptide of Figure 1 or that encoded by the depo ⁇ ited cDNA may be (i) one in which one or more of the amino acid re ⁇ idue ⁇ are ⁇ ub ⁇ tituted with a con ⁇ erved or non-con ⁇ erved amino acid residue (preferably a con ⁇ erved amino acid re ⁇ idue) and such ⁇ ub ⁇ tituted amino acid re ⁇ idue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fu ⁇ ed with another compound, ⁇ uch a ⁇ a compound to increa ⁇ e the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acids are fused to the mature polypeptide or (v) one in which compri ⁇ e ⁇ fewer amino acid re
  • polypeptide ⁇ and polynucleotide ⁇ of the pre ⁇ ent invention are preferably provided in an i ⁇ olated form, and preferably are purified to homogeneity.
  • i ⁇ olated mean ⁇ that the material i ⁇ removed from it ⁇ original environment (e.g., the natural environment if it i ⁇ naturally occurring) .
  • original environment e.g., the natural environment if it i ⁇ naturally occurring
  • a naturally- occurring polynucleotide or polypeptide present in a living animal i ⁇ not i ⁇ olated, but the ⁇ ame polynucleotide or polypeptide, ⁇ eparated from some or all of the coexisting materials in the natural sy ⁇ tem, i ⁇ i ⁇ olated.
  • Such polynucleotide ⁇ could be part of a vector and/or ⁇ uch polynucleotide ⁇ or polypeptide ⁇ could be part of a compo ⁇ ition, and ⁇ till be i ⁇ olated in that ⁇ uch vector or compo ⁇ ition i ⁇ not part of its natural environment.
  • the polypeptide ⁇ of the pre ⁇ ent invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) a ⁇ well a ⁇ polypeptide ⁇ which have at lea ⁇ t 70% ⁇ imilarity (preferably at l'ea ⁇ t 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at lea ⁇ t 90% ⁇ imilarity (more preferably at lea ⁇ t 95% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at lea ⁇ t 95% ⁇ imilarity ( ⁇ till more preferably at lea ⁇ t 90% identity) to the polypeptide of SEQ ID NO:2 and also include portions of ⁇ uch polypeptide ⁇ with ⁇ uch portion of the polypeptide generally containing at least 30 amino acid ⁇ and more preferably at least 50 amino acids.
  • Fragments or portions of the polypeptide ⁇ of the pre ⁇ ent invention may be employed for producing the corre ⁇ ponding full-length polypeptide by peptide ⁇ ynthe ⁇ i ⁇ ; therefore, the fragment ⁇ may be employed a ⁇ intermediate ⁇ for producing the full-length polypeptides. Fragments or portions of the polynucleotide ⁇ of the pre ⁇ ent invention may be u ⁇ ed to ⁇ ynthe ⁇ ize full-length polynucleotide ⁇ of the pre ⁇ ent invention.
  • the pre ⁇ ent invention al ⁇ o relate ⁇ to vector ⁇ which include polynucleotide ⁇ of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant technique ⁇ .
  • Ho ⁇ t cell ⁇ are genetically engineered (tran ⁇ duced or tran ⁇ formed or tran ⁇ fected) with the vector ⁇ of thi ⁇ invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cell ⁇ can be cultured in conventional nutrient media modified a ⁇ appropriate for activating promoter ⁇ , ⁇ electing tran ⁇ formant ⁇ or amplifying the VEGF2 gene ⁇ of the pre ⁇ ent invention.
  • the culture conditions ⁇ uch a ⁇ temperature, pH and the like, are tho ⁇ e previou ⁇ ly u ⁇ ed with the ho ⁇ t cell ⁇ elected for expre ⁇ ion, and will be apparent to the ordinarily ⁇ killed artisan.
  • the polynucleotide ⁇ of the pre ⁇ ent invention may be employed for producing polypeptide ⁇ by recombinant technique ⁇ . Thu ⁇ , for example, the polynucleotide may be included in any one of a variety of expression vectors for expre ⁇ ing a polypeptide.
  • Such vector ⁇ include chromo ⁇ omal, nonchromosomal and synthetic DNA sequence ⁇ , e.g., derivative ⁇ of SV40; bacterial pla ⁇ mid ⁇ ; phage DNA; baculoviru ⁇ ; yea ⁇ t pla ⁇ mid ⁇ ; vector ⁇ derived from combination ⁇ of plasmids and phage DNA, viral DNA ⁇ uch a ⁇ vaccinia, adenoviru ⁇ , fowl pox viru ⁇ , and p ⁇ eudorabie ⁇ .
  • any other vector may be used as long a ⁇ it i ⁇ replicable and viable in the ho ⁇ t.
  • the appropriate DNA ⁇ equence may be in ⁇ erted into the vector by a variety of procedure ⁇ .
  • the DNA ⁇ equence i ⁇ in ⁇ erted into an appropriate re ⁇ triction endonuclea ⁇ e ⁇ ite( ⁇ ) by procedure ⁇ known in the art.
  • procedure ⁇ and other ⁇ are deemed to be within the scope of those ⁇ killed in the art.
  • the DNA ⁇ equence in the expre ⁇ ion vector i ⁇ operatively linked to an appropriate expre ⁇ ion control ⁇ equence( ⁇ ) (promoter) to direct mRNA synthesis.
  • ⁇ uch promoter ⁇ there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoter ⁇ known to control expre ⁇ ion of gene ⁇ in prokaryotic or eukaryotic cell ⁇ or their viru ⁇ e ⁇ .
  • the expre ⁇ ion vector al ⁇ o contain ⁇ a ribo ⁇ ome binding ⁇ ite for tran ⁇ lation initiation and a tran ⁇ cription terminator.
  • the vector may al ⁇ o include appropriate ⁇ equence ⁇ for amplifying expre ⁇ ion.
  • the expre ⁇ ion vector ⁇ preferably contain one or more ⁇ electable marker gene ⁇ to provide a phenotypic trait for ⁇ election of tran ⁇ formed ho ⁇ t cells such as dihydrofolate reductase or neomycin resistance foreukaryotic cell culture, or such as tetracycline or ampicillin resi ⁇ tance in E. coli.
  • a phenotypic trait for ⁇ election of tran ⁇ formed ho ⁇ t cells such as dihydrofolate reductase or neomycin resistance foreukaryotic cell culture, or such as tetracycline or ampicillin resi ⁇ tance in E. coli.
  • the vector containing the appropriate DNA sequence a ⁇ hereinabove described, as well as an appropriate promoter or control ⁇ equence, may be employed to tran ⁇ form an appropriate ho ⁇ t to permit the ho ⁇ t to expre ⁇ the protein.
  • a ⁇ representative examples of appropriate host ⁇ there may be mentioned: bacterial cell ⁇ , such a ⁇ E. coli. Streptomyce ⁇ _ Salmonella typhimurium; fungal cell ⁇ , ⁇ uch a ⁇ yea ⁇ t; in ⁇ ect cell ⁇ ⁇ uch a ⁇ Dro ⁇ ophila S2 and Spodoptera Sf9; animal cell ⁇ ⁇ uch a ⁇ CHO, COS or Bowe ⁇ melanoma; adenoviru ⁇ e ⁇ ; plant cell ⁇ , etc.
  • the ⁇ election of an appropriate ho ⁇ t i ⁇ deemed to be within the ⁇ cope of those ⁇ killed in the art from the teaching ⁇ herein.
  • the pre ⁇ ent invention al ⁇ o includes recombinant construct ⁇ comprising one or more of the sequence ⁇ a ⁇ broadly de ⁇ cribed above.
  • the con ⁇ truct ⁇ compri ⁇ e a vector, ⁇ uch a ⁇ a pla ⁇ mid or viral vector, into which a ⁇ equence of the invention ha ⁇ been in ⁇ erted, in a forward or rever ⁇ e orientation.
  • the con ⁇ truct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • a promoter operably linked to the sequence.
  • Large numbers of ⁇ uitable vector ⁇ and promoter ⁇ are known to tho ⁇ e of ⁇ kill in the art, and are commercially available.
  • the following vector ⁇ are provided by way of example.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phage ⁇ cript, p ⁇ iX174, pBlue ⁇ cript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia) .
  • Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
  • any other pla ⁇ mid or vector may be u ⁇ ed a ⁇ long a ⁇ they are replicable and viable in the ho ⁇ t.
  • Promoter region ⁇ can be ⁇ elected from any de ⁇ ired gene u ⁇ ing CAT (chloramphenicol' tran ⁇ fera ⁇ e) vectors or other vectors with selectable marker ⁇ .
  • Two appropriate vector ⁇ are pKK232-8 and pCM7.
  • Particular named bacterial promoter ⁇ include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoter ⁇ include CMV immediate early, HSV thymidine kina ⁇ e, early and late SV40, LTR ⁇ from retroviru ⁇ , and mou ⁇ e metallothionein-I. Selection of the appropriate vector and promoter i ⁇ well within the level of ordinary ⁇ kill in the art.
  • the pre ⁇ ent invention relate ⁇ to host cells containing the above-de ⁇ cribed con ⁇ truct ⁇ .
  • the ho ⁇ t cell can be a higher eukaryotic cell, ⁇ uch a ⁇ a mammalian cell, or a lower eukaryotic cell, ⁇ uch a ⁇ a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the ho ⁇ t cell can be effected by calcium pho ⁇ phate transfection, DEAE- Dextran mediated transfection, or electroporation. (Davis, L., Dibner, M. , Battey, I., Ba ⁇ ic Method ⁇ in Molecular Biology, (1986) ) .
  • the con ⁇ truct ⁇ in ho ⁇ t cell ⁇ can be u ⁇ ed in a conventional manner to produce the gene product encoded by the recombinant ⁇ equence.
  • the polypeptide ⁇ of the invention can be ⁇ ynthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expres ⁇ ed in mammalian cell ⁇ , yea ⁇ t, bacteria, or other cell ⁇ under the control of appropriate promoter ⁇ .
  • Cell-free tran ⁇ lation ⁇ y ⁇ tem ⁇ can al ⁇ o be employed to produce ⁇ uch protein ⁇ u ⁇ ing RNA ⁇ derived from the DNA con ⁇ truct ⁇ of the present invention.
  • Appropriate cloning and expres ⁇ ion vector ⁇ for use with prokaryotic and eukaryotic ho ⁇ ts are de ⁇ cribed by Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the di ⁇ clo ⁇ ure of which i ⁇ hereby incorporated by reference.
  • Enhancer ⁇ are ci ⁇ -acting element ⁇ of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegaloviru ⁇ early promoter enhancer, the polyoma enhancer on the late ⁇ ide of the replication origin, and adenoviru ⁇ enhancer ⁇ .
  • recombinant expre ⁇ ion vector ⁇ will include origin ⁇ of replication and ⁇ electable marker ⁇ permitting tran ⁇ formation of the host cell, e.g., the ampicillin reai ⁇ tance gene of E. coli and S. cerevi ⁇ iae TRPl gene, and a promoter derived from a highly-expressed gene to direct tran ⁇ cription of a down ⁇ tream ⁇ tructural sequence.
  • PGK 3-pho ⁇ phoglycerate kina ⁇ e
  • the heterologou ⁇ ⁇ equence can encode a fu ⁇ ion protein including an N-terminal identification peptide imparting de ⁇ ired characteri ⁇ tic ⁇ , e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expre ⁇ ion vector ⁇ for bacterial u ⁇ e are con ⁇ tructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic ⁇ electable marker ⁇ and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic ho ⁇ ts for transformation include E. coli. Bacillus subtili ⁇ . Salmonella tvphimurium and various specie ⁇ within the genera Pseudomonas, Streptomyces, and Staphylococcu ⁇ , although other ⁇ may also be employed as a matter of choice.
  • u ⁇ eful expre ⁇ ion vector ⁇ for bacterial u ⁇ e can compri ⁇ e a ⁇ electable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017) .
  • cloning vector pBR322 ATCC 37017
  • Such commercial vector ⁇ include, for example, pKK223-3 (Pharmacia Fine Chemical ⁇ , Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA) .
  • pBR322 "backbone" ⁇ ection ⁇ are combined with an appropriate promoter and the ⁇ tructural ⁇ equence to be expre ⁇ ed.
  • the ⁇ elected promoter i ⁇ induced by appropriate mean ⁇ e.g., temperature ⁇ hift or chemical induction
  • cell ⁇ are cultured for an additional period.
  • Cell ⁇ are typically harve ⁇ ted by centrifugation, di ⁇ rupted by phy ⁇ ical or chemical mean ⁇ , and the re ⁇ ulting crude extract retained for further purification.
  • Microbial cells employed in expres ⁇ ion of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical di ⁇ ruption, or u ⁇ e of cell ly ⁇ ing agent ⁇ , ⁇ uch method ⁇ are well know to tho ⁇ e ⁇ killed in the art.
  • Variou ⁇ mammalian cell culture systems can also be employed to expres ⁇ recombinant protein.
  • Example ⁇ of mammalian expre ⁇ ion ⁇ ystems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981) , and other cell line ⁇ capable of expre ⁇ ing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell line ⁇ .
  • Mammalian expre ⁇ ion vector ⁇ will compri ⁇ e an origin of replication, a suitable promoter and enhancer, and also any neces ⁇ ary ' ribo ⁇ ome binding ⁇ ite ⁇ , polyadenylation ⁇ ite, ⁇ plice donor and acceptor ⁇ ite ⁇ , tran ⁇ criptional termination ⁇ equence ⁇ , and 5' flanking nontran ⁇ cribed ⁇ equence ⁇ .
  • DNA sequence ⁇ derived from the SV40 ⁇ plice, and polyadenylation site ⁇ may be used to provide the required nontranscribed genetic elements.
  • the polypeptides can be recovered and purified from recombinant cell culture ⁇ by method ⁇ including ammonium ⁇ ulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, pho ⁇ phocellulo ⁇ e chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography.
  • Protein refolding step ⁇ can be u ⁇ ed, a ⁇ necessary, in completing configuration of the mature protein.
  • HPLC high performance liquid chromatography
  • the polypeptide ⁇ of the pre ⁇ ent invention may be a naturally purified product, or a product of chemical ⁇ ynthetic procedure ⁇ , or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) .
  • a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture
  • the polypeptide ⁇ of the pre ⁇ ent invention may be glyco ⁇ ylated or may be non-glyco ⁇ ylated.
  • Polypeptide ⁇ of the invention may also include an initial methionine amino acid residue.
  • VEGF2 polypeptide of SEQ ID No. 2 minus the initial 46 amino acid ⁇ , i ⁇ a potent mitogen for va ⁇ cular endothelial cell ⁇ and ⁇ timulate ⁇ their growth and proliferation.
  • the re ⁇ ult ⁇ of a Northern blot analy ⁇ i ⁇ performed for the VEGF2 nucleic acid ⁇ equence encoding thi ⁇ polypeptide wherein 20 ⁇ g of RNA from ⁇ everal human ti ⁇ ue ⁇ were probed with "P-VEGF2, illu ⁇ trate ⁇ that thi ⁇ protein i ⁇ actively expre ⁇ ed in the heart and lung which i ⁇ further evidence of mitogenic activity.
  • VEGF2 may " be employed " to promote angiogene ⁇ i ⁇ , for example, to ⁇ timulate the growth of transplanted tis ⁇ ue where coronary bypa ⁇ ⁇ urgery is performed.
  • VEGF2 may also be employed to promote wound healing, particularly to re-vascularize damaged ti ⁇ ue ⁇ or ⁇ timulate collateral blood flow during ischemia and where new capillary angiogenesi ⁇ i ⁇ de ⁇ ired.
  • VEGF2 may be employed to treat full-thickne ⁇ wound ⁇ ⁇ uch a ⁇ dermal ulcer ⁇ , including pressure sore ⁇ , venou ⁇ ulcers, and diabetic ulcer ⁇ .
  • VEGF2 may be employed to treat full-thickne ⁇ burn ⁇ and injurie ⁇ where a akin graft or flap i ⁇ u ⁇ ed to repair ⁇ uch burn ⁇ and injurie ⁇ .
  • VEGF2 may al ⁇ o be employed for use in plastic surgery, for example, for the repair of lacerations from trauma and cut ⁇ in a ⁇ ociation with ⁇ urgery.
  • VEGF2 may be employed to induce the growth of damaged bone, periodontium or ligament tis ⁇ ue.
  • VEGF2 may al ⁇ o be employed for regenerating supporting tis ⁇ ue ⁇ of the teeth, including cementum and periodontal ligament, that have been damaged by di ⁇ ea ⁇ e and trauma.
  • VEGF2 may be employed in a ⁇ ociation with ⁇ urgery and following the repair of cut ⁇ . It may al ⁇ o be employed for the treatment of abdominal wounds where there i ⁇ a high risk of infection.
  • VEGF2 may be employed for the promotion of endothelialization in vascular graft ⁇ urgery.
  • VEGF2 can be applied to the surface of the graft or at the junction to promote the growth of va ⁇ cular endothelial cell ⁇ .
  • VEGF2 may also be employed to repair damage of myocardial tis ⁇ ue a ⁇ a re ⁇ ult of myocardial infarction.
  • VEGF2 may al ⁇ o be employed to repair the cardiac va ⁇ cular sy ⁇ tem after ischemia.
  • VEGF2 may also be employed to treat damaged vascular tis ⁇ ue a ⁇ a re ⁇ ult of coronary artery di ⁇ ea ⁇ e and peripheral and CNS va ⁇ cular di ⁇ ea ⁇ e.
  • VEGF2 may al ⁇ o be employed to coat artificial: pro ⁇ the ⁇ e ⁇ or natural organs which are to be tran ⁇ planted in the body to minimize rejection of the tran ⁇ planted material and to ⁇ timulate vascularization of the transplanted material ⁇ .
  • VEGF2 may al ⁇ o be employed for va ⁇ cular ti ⁇ sue repair, for example, that occurring during arteriosclero ⁇ i ⁇ and required following balloon angiopla ⁇ ty where va ⁇ cular ti ⁇ ue ⁇ are damaged.
  • VEGF2 nucleic acid ⁇ equence ⁇ and VEGF2 polypeptide ⁇ may al ⁇ o be employed for in vitro purpo ⁇ e ⁇ related to ⁇ cientific re ⁇ earch, synthe ⁇ i ⁇ of DNA and manufacture of DNA vector ⁇ , and for the production of diagno ⁇ tic ⁇ and therapeutic ⁇ to treat human di ⁇ ea ⁇ e.
  • VEGF2 may be employed for in vitro culturing of va ⁇ cular endothelial cell ⁇ , where it is added to the conditional medium in a concentration from 10 pg/ml to 10 ng/ml.
  • Fragments of the full length VEGF2 gene may be u ⁇ ed a ⁇ a hybridization probe for a cDNA library to i ⁇ olate other gene ⁇ which have a high ⁇ equence ⁇ imilarity to the gene or ⁇ imilar biological activity.
  • Probe ⁇ of thi ⁇ type generally have at lea ⁇ t 50 ba ⁇ e pair ⁇ , although they may have a greater number of ba ⁇ e ⁇ .
  • the probe may al ⁇ o be u ⁇ ed to identify a cDNA clone corre ⁇ ponding to a full length tran ⁇ cript and a genomic clone or clone ⁇ that contain the complete VEGF2 gene including regulatory and promotor region ⁇ , exon ⁇ , and intron ⁇ .
  • a ⁇ creen compri ⁇ e ⁇ i ⁇ olating the coding region of the VEGF2 gene by u ⁇ ing the known DNA ⁇ equence to ⁇ ynthe ⁇ ize an oligonucleotide probe.
  • Labeled oligonucleotides having a ⁇ equence complementary to that of the gene of the pre ⁇ ent invention are used to ⁇ creen a library of human cDNA, genomic DNA or mRNA to determine which member ⁇ of the library the probe hybridize ⁇ to.
  • Thi ⁇ invention provide ⁇ method ⁇ for identification of VEGF2 receptor ⁇ .
  • the gene encoding the receptor can be identified by numerous method ⁇ known to tho ⁇ e of ⁇ kill in the art, for example, ligand panning and FACS ⁇ orting (Coligan, et al., Current Protocol ⁇ in Immun. , 1(2), Chapter 5, (1991) ) .
  • expre ⁇ ion cloning i ⁇ employed wherein polyadenylated RNA is prepared from a cell respon ⁇ ive to VEGF2, and a cDNA library created from thi ⁇ RNA i ⁇ divided into pool ⁇ and u ⁇ ed to tran ⁇ fect COS cell ⁇ or other cell ⁇ that are not re ⁇ pon ⁇ ive to VEGF2.
  • VEGF2 can be labeled by a variety of mean ⁇ including iodination or inclu ⁇ ion of a recognition ⁇ ite for a ⁇ ite- ⁇ pecific protein kinase. Following fixation and incubation, the slide ⁇ are subjected to autoradiographic analy ⁇ i ⁇ . Po ⁇ itive pool ⁇ are identified and ⁇ ub-pool ⁇ are prepared and retran ⁇ fected u ⁇ ing an iterative ⁇ ub-pooling and re ⁇ creening proces ⁇ , eventually yielding a ⁇ ingle clone that encode ⁇ the putative receptor.
  • labeled VEGF2 can be photoaffinity linked with cell membrane or extract preparation ⁇ that expre ⁇ the receptor molecule.
  • the labeled complex containing VEGF2 i ⁇ then exci ⁇ ed, re ⁇ olved into peptide fragment ⁇ , and ⁇ ubjected to protein micro ⁇ equencing.
  • the amino acid ⁇ equence obtained from micro ⁇ equencing would be u ⁇ ed to de ⁇ ign a ⁇ et of degenerate oligonucleotide probe ⁇ to ⁇ creen a cDNA library to identify the gene encoding the putative receptor.
  • Thi ⁇ invention i ⁇ al ⁇ o related to a method of ⁇ creening compound ⁇ to identify tho ⁇ e which are VEGF2 agoni ⁇ t ⁇ or antagonist ⁇ .
  • An example of such a method takes advantage of the ability of VEGF2 to significantly stimulate the proliferation of human endothelial cells in the pre ⁇ ence of the comitogen Con A.
  • Endothelial cell ⁇ are obtained and cultured in 96-well flat-bottomed culture plate ⁇ (Co ⁇ tar, Cambridge, MA) in a reaction mixture ⁇ upplemented with Con-A (Calbiochem, La Jolla, CA) .
  • Con-A, polypeptide ⁇ of the pre ⁇ ent invention and the compound to be screened " are added.
  • VEGF2 antagonists may be detected by combining VEGF2 and a potential antagoni ⁇ t with membrane-bound VEGF2 receptor ⁇ or recombinant receptors under appropriate conditions for a competitive inhibition as ⁇ ay.
  • VEGF2 can be labeled, ⁇ uch a ⁇ by radioactivity, ⁇ uch that the number of VEGF2 molecule ⁇ bound to the receptor can determine the effectivene ⁇ of the potential antagoni ⁇ t.
  • the re ⁇ pon ⁇ e of a known ⁇ econd me ⁇ enger ⁇ y ⁇ tem following interaction of VEGF2 and receptor would be mea ⁇ ured and compared in the pre ⁇ ence or absence of the compound.
  • ⁇ econd me ⁇ enger systems include but are not limited to, cAMP guanylate cyclase, ion channel ⁇ or pho ⁇ phoino ⁇ itide hydroly ⁇ i ⁇ .
  • a mammalian cell or membrane preparation expre ⁇ ing the VEGF2 receptor i ⁇ incubated with labeled VEGF2 in the pre ⁇ ence of the compound. The ability of the compound to enhance or block thi ⁇ interaction could then be mea ⁇ ured.
  • Potential VEGF2 antagoni ⁇ t ⁇ include an antibody, or in some ca ⁇ e ⁇ , an oligonucleotide, which bind to the polypeptide and effectively eliminate VEGF2 function.
  • a potential antagoni ⁇ t may be a clo ⁇ ely related protein which bind ⁇ to VEGF2 receptor ⁇ , however, they are inactive form ⁇ of the polypeptide and thereby prevent the action of VEGF2.
  • Example ⁇ of the ⁇ e antagonist ⁇ include a negative dominant mutant of the VEGF2 polypeptide, for example, one chain of the hetero-dimeric form of VEGF2 may be dominant and may be mutated ⁇ uch that biological activity i ⁇ not retained.
  • An example of a negative dominant mutant include ⁇ truncated ver ⁇ ion ⁇ of a dimeric VEGF2 which i ⁇ capable of interacting with another dimer to form wild type VEGF2, however, the resulting homo-dimer is inactive and fail ⁇ to exhibit characteri ⁇ tic VEGF activity.
  • Anti ⁇ en ⁇ e technology can be u ⁇ ed to control gene expre ⁇ ion through triple-helix formation or anti ⁇ en ⁇ e DNA or RNA, both of which method ⁇ are ba ⁇ ed on binding of a polynucleotide to DNA or RNA.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the VEGF2 polypeptide (Anti ⁇ en ⁇ e - Okano, J.
  • oligonucleotide ⁇ de ⁇ cribed above can also be delivered to cell ⁇ ⁇ uch that the anti ⁇ en ⁇ e RNA or DNA may be expressed in vivo to inhibit production of VEGF2.
  • Potential VEGF2 antagonists also include small molecules which bind to and occupy the active ⁇ ite of the polypeptide thereby making the catalytic ⁇ ite inacce ⁇ ible to ⁇ ub ⁇ trate such that normal biological activity i ⁇ prevented.
  • Example ⁇ of ⁇ mall molecule ⁇ include but are not limited to ⁇ mall peptide ⁇ or peptide-like molecule ⁇ .
  • the antagoni ⁇ t ⁇ may be employed to treat limit angiogene ⁇ i ⁇ necessary for solid tumor metasta ⁇ i ⁇ .
  • VEGF2 i ⁇ found to be expressed at moderate levels in at least two breast tumor cell lines which i ⁇ indicative of the role of VEGF2 polypeptide ⁇ in the malignant phenotype.
  • Glioma ⁇ are al ⁇ o a type of neopla ⁇ ia which may be treated with the antagoni ⁇ t ⁇ of the present invention.
  • the antagonist ⁇ may al ⁇ o be u ⁇ ed to treat chronic inflammation cau ⁇ ed by increa ⁇ ed va ⁇ cular permeability.
  • the antagoni ⁇ t ⁇ may al ⁇ o be employed to treat retinopathy a ⁇ ociated with diabete ⁇ , rheumatoid arthritis and psoriasi ⁇ .
  • the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., a ⁇ hereinafter de ⁇ cribed.
  • the VEGF2 polypeptide ⁇ and agonists and antagonist ⁇ may be employed in combination with a ⁇ uitable pharmaceutical carrier.
  • a ⁇ uitable pharmaceutical carrier Such compo ⁇ ition ⁇ compri ⁇ e a therapeutically effective amount of the polypeptide or agoni ⁇ t or antagoni ⁇ t, and a pharmaceutically acceptable carrier or excipient.
  • a carrier include ⁇ but i ⁇ not limited to ⁇ aline, buffered ⁇ aline, dextro ⁇ e, water, glycerol, ethanol, and combination ⁇ thereof.
  • the formulation should suit the mode of administration.
  • the invention al ⁇ o provide ⁇ a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compo ⁇ ition ⁇ of the invention.
  • a ⁇ ociated with ⁇ uch container( ⁇ ) can be a notice in the form pre ⁇ cribed by a governmental agency regulating the manufacture, u ⁇ e or ⁇ ale of pharmaceuticals or biological product ⁇ , which notice reflect ⁇ approval by the agency of manufacture, use or ⁇ ale for human admini ⁇ tration.
  • the pharmaceutical compo ⁇ ition ⁇ may be employed in conjunction with other therapeutic compound ⁇ .
  • the pharmaceutical compo ⁇ ition ⁇ may be admini ⁇ tered in a convenient manner ⁇ uch a ⁇ by the topical, intravenou ⁇ , intraperitoneal, intramu ⁇ cular, intratumor, ⁇ ubcutaneou ⁇ , intranasal or intradermal routes.
  • the pharmaceutical compo ⁇ ition ⁇ are administered in an amount which i ⁇ effective for treating and/or prophylaxi ⁇ of the ⁇ pecific indication.
  • the pharmaceutical compo ⁇ ition ⁇ are administered in an amount of at lea ⁇ t about 10 ⁇ g/kg body weight and in mo ⁇ t ca ⁇ e ⁇ they will be admini ⁇ tered in an amount not in exce ⁇ of about 8 mg/Kg body weight per day.
  • mo ⁇ t ca ⁇ e ⁇ the do ⁇ age i ⁇ from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of admini ⁇ tration, symptoms, etc.
  • VEGF2 polypeptide ⁇ , and agoni ⁇ t ⁇ or antagoni ⁇ t ⁇ which are polypeptide ⁇ may al ⁇ o be employed in accordance with the pre ⁇ ent invention by expre ⁇ ion of ⁇ uch polypeptide in vivo, which i ⁇ often referred to a ⁇ "gene therapy.”
  • cell ⁇ ⁇ uch a ⁇ bone marrow cell ⁇ may be engineered with a polynucleotide (DNA or RNA) encoding for the polypeptide ex vivo, the engineered cell ⁇ are then provided to a patient to be treated with the polypeptide.
  • a polynucleotide DNA or RNA
  • Such method ⁇ are well-known in the art.
  • cell ⁇ may be engineered by procedure ⁇ known in the art by u ⁇ e of a retroviral particle containing RNA encoding the polypeptide of the pre ⁇ ent invention.
  • cell ⁇ may be engineered in vivo for expre ⁇ ion of a polypeptide in vivo, for example, by procedure ⁇ known in the art.
  • a ⁇ known in the art ⁇ a producer cell for producing a retroviral particle containing RNA encoding a polypeptide of the pre ⁇ ent invention may be admini ⁇ tered to a patient for engineering cell ⁇ in vivo and expre ⁇ ion of the polypeptide in vivo.
  • the ⁇ e and other method ⁇ for admini ⁇ tering a polypeptide of the pre ⁇ ent invention by such methods should be apparent to those skilled in the art from the teachings of the present invention.
  • the expres ⁇ ion vehicle for engineering cell ⁇ may be other than a retroviral particle, for example, an adenoviru ⁇ , which may be u ⁇ ed to engineer cell ⁇ in vivo after combination with a ⁇ uitable delivery vehicle.
  • a retroviral particle for example, an adenoviru ⁇ , which may be u ⁇ ed to engineer cell ⁇ in vivo after combination with a ⁇ uitable delivery vehicle.
  • Retroviru ⁇ e ⁇ from which the retroviral pla ⁇ mid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Viru ⁇ , ⁇ pleen necro ⁇ i ⁇ viru ⁇ , retroviru ⁇ e ⁇ ⁇ uch a ⁇ Rou ⁇ Sarcoma Viru ⁇ , Harvey Sarcoma Viru ⁇ , avian leuko ⁇ i ⁇ viru ⁇ , gibbon ape leukemia viru ⁇ , human immunodeficiency viru ⁇ , adenoviru ⁇ , Myeloproliferative Sarcoma Viru ⁇ , and mammary tumor viru ⁇ .
  • the retroviral pla ⁇ mid vector i ⁇ derived from Moloney Murine Leukemia Viru ⁇ .
  • the vector include ⁇ one or more promoter ⁇ .
  • Suitable promoter ⁇ which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegaloviru ⁇ (CMV) promoter de ⁇ cribed in Miller, et al., Biotechnique ⁇ . Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoter ⁇ ⁇ uch a ⁇ eukaryotic cellular promoter ⁇ including, but not limited to, the hi ⁇ tone, pol III, and /8-actin promoter ⁇ ) .
  • CMV human cytomegaloviru ⁇
  • viral promoter ⁇ which may be employed include, but are not limited to, adenoviru ⁇ promoter ⁇ , thymidine kinase (TK) promoters, and B19 parvoviru ⁇ promoter ⁇ .
  • TK thymidine kinase
  • B19 parvoviru ⁇ promoter ⁇ The ⁇ election of a ⁇ uitable promoter will be apparent to those ⁇ killed in the art from the teaching ⁇ contained herein.
  • Suitable promoter ⁇ which may be employed include, but are not limited to, adenoviral promoter ⁇ , ⁇ uch a ⁇ the adenoviral major late promoter; or hetorologou ⁇ promoter ⁇ , ⁇ uch a ⁇ the cytomegaloviru ⁇ (CMV) promoter; the re ⁇ piratory ⁇ yncytial viru ⁇ (RSV) promoter; inducible promoter ⁇ , ⁇ uch a ⁇ the MMT promoter, the metallothionein promoter,- heat ⁇ hock promoter ⁇ ; the albumin promoter; the ApoAI promoter; human globin promoter ⁇ ; viral thymidine kina ⁇ e promoter ⁇ , ⁇ uch a ⁇ the Herpe ⁇ Simplex thymidine kina ⁇ e promoter,- retroviral LTR ⁇ (including the modified retroviral
  • the retroviral plasmid vector is employed to transduce packaging cell line ⁇ to form producer cell line ⁇ .
  • Example ⁇ of packaging cell ⁇ which may be tran ⁇ fected include, but are not limited to, the PE501, PA317, , ⁇ -AM, PA12, T19-14X, VT-19-17-H2, ⁇ CRE, ⁇ CRIP , GP+E-86, GP+envAml2, and DAN cell line ⁇ a ⁇ de ⁇ cribed in Miller, Human Gene Therapy. Vol. l, pg ⁇ . 5-14 (1990), which i ⁇ incorporated herein by reference in it ⁇ entirety.
  • the vector may tran ⁇ duce the packaging cell ⁇ through any mean ⁇ known in the art.
  • Such mean ⁇ include, but are not limited to, electroporation, the u ⁇ e of lipo ⁇ ome ⁇ , and CaP0 4 precipitation.
  • the retroviral pla ⁇ mid vector may be encap ⁇ ulated into a lipo ⁇ ome, or coupled to a lipid, and then admini ⁇ tered to a ho ⁇ t.
  • the producer cell line generate ⁇ infectiou ⁇ retroviral vector particle ⁇ which include the nucleic acid ⁇ equence( ⁇ ) encoding the polypeptide ⁇ .
  • retroviral vector particle ⁇ then may be employed, to tran ⁇ duce eukaryotic cell ⁇ , either in vitro or in vivo.
  • the tran ⁇ duced eukaryotic cell ⁇ will express the nucleic acid sequence( ⁇ ) encoding the polypeptide.
  • Eukaryotic cell ⁇ which may be tran ⁇ duced include, but are not limited to, embryonic Btem cell ⁇ , embryonic carcinoma cell ⁇ , a ⁇ well a ⁇ hematopoietic ⁇ tem cell ⁇ , hepatocytes, fibroblast ⁇ , myobla ⁇ t ⁇ , keratinocyte ⁇ , endothelial cell ⁇ , and bronchial epithelial cell ⁇ .
  • Thi ⁇ invention i ⁇ al ⁇ o related to the u ⁇ e of the VEGF2 gene a ⁇ part of a diagno ⁇ tic a ⁇ ay for detecting di ⁇ ea ⁇ e ⁇ or ⁇ u ⁇ ceptibility to diseases related to the presence of mutations in VEGF2 nucleic acid sequence ⁇ .
  • RNA or cDNA may also be used for the same purpose.
  • PCR primer ⁇ complementary to the nucleic acid encoding VEGF2 can be used to identify and analyze VEGF2 mutation ⁇ .
  • deletion ⁇ and in ⁇ ertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutation ⁇ can be identified by hybridizing amplified DNA. to radiolabeled VEGF2 RNA or alternatively, radiolabeled VEGF2 anti ⁇ ense DNA sequence ⁇ . Perfectly matched ⁇ equence ⁇ can be di ⁇ tingui ⁇ hed from mi ⁇ matched duplexe ⁇ by RNa ⁇ e A dige ⁇ tion or by difference ⁇ in melting temperature ⁇ .
  • DNA ⁇ equence difference ⁇ may be achieved by detection of alteration in electrophoretic mobility of DNA fragment ⁇ in gel ⁇ with or without denaturing agent ⁇ .
  • Small ⁇ equence deletion ⁇ and in ⁇ ertion ⁇ can be vi ⁇ ualized by high re ⁇ olution gel electrophore ⁇ i ⁇ .
  • DNA fragment ⁇ of different ⁇ equence ⁇ may be di ⁇ tingui ⁇ hed on denaturing formamide gradient gel ⁇ in which the mobilitie ⁇ of different DNA fragment ⁇ are retarded in the gel at different po ⁇ ition ⁇ according to their ⁇ pecific melting or partial melting temperature ⁇ ( ⁇ ee, e'.g., Myer ⁇ et alT, Science, 230:1242 (1985)).
  • Sequence changes at ⁇ pecific location ⁇ may al ⁇ o be revealed by nuclea ⁇ e protection a ⁇ ay ⁇ , ⁇ uch a ⁇ RNa ⁇ e and SI protection or the chemical cleavage method (e.g., Cotton et al . , PNAS, USA, 85:4397-4401 (1985)).
  • the detection of a ⁇ pecific DNA ⁇ equence may be achieved by method ⁇ ⁇ uch a ⁇ hybridization, RNa ⁇ e protection, chemical cleavage, direct DNA ⁇ equencing or the u ⁇ e of re ⁇ triction enzyme ⁇ , (e.g., Re ⁇ triction Fragment Length Polymorphi ⁇ m ⁇ (RFLP) ) and Southern blotting of genomic DNA.
  • RFLP Re ⁇ triction Fragment Length Polymorphi ⁇ m ⁇
  • mutations can also be detected by in situ analy ⁇ i .
  • the pre ⁇ ent invention al ⁇ o relate ⁇ to a diagno ⁇ tic a ⁇ ay for detecting altered level ⁇ of VEGF2 protein in variou ⁇ ti ⁇ ue ⁇ ⁇ ince an over-expres ⁇ ion of the protein ⁇ compared to normal control ti ⁇ ue ⁇ ample ⁇ may detect the pre ⁇ ence of a di ⁇ ea ⁇ e or ⁇ u ⁇ ceptibility to a di ⁇ ea ⁇ e, for example, abnormal cellular differentiation.
  • a ⁇ ay ⁇ u ⁇ ed to detect level ⁇ of VEGF2 protein in a ⁇ ample derived from a ho ⁇ t are well-known to tho ⁇ e of ⁇ kill in the art and include radioimmunoa ⁇ ay ⁇ , competitive-binding a ⁇ ay ⁇ , We ⁇ tern Blot analy ⁇ i ⁇ , ELISA a ⁇ ay ⁇ and " ⁇ andwich" a ⁇ ay.
  • An ELISA a ⁇ ay Coldigan, et al., Current Protocol ⁇ in Immunology, 1(2), Chapter 6, (1991) ) initially compri ⁇ e ⁇ preparing an antibody ⁇ pecific to the VEGF2 antigen, preferably a monoclonal antibody.
  • a reporter antibody i ⁇ prepared again ⁇ t the monoclonal antibody.
  • a detectable reagent such as radioactivity, fluorescence or, in thi ⁇ example, a hor ⁇ eradi ⁇ h peroxida ⁇ e enzyme.
  • a ⁇ ample i ⁇ removed from a ho ⁇ t and incubated on a ⁇ olid ⁇ upport, e.g. a poly ⁇ tyrene di ⁇ h, that bind ⁇ the protein ⁇ in the sample. Any free protein binding ⁇ ite ⁇ on the di ⁇ h are then covered by incubating with a non- ⁇ pecific ⁇ protein, ⁇ uch a ⁇ , ⁇ jovine ⁇ erum albumen.
  • the monoclonal antibody i ⁇ incubated in the di ⁇ h during which time the monoclonal antibodie ⁇ attach to any VEGF2 protein ⁇ attached to the poly ⁇ tyrene di ⁇ h. All unbound monoclonal antibody i ⁇ wa ⁇ hed out with buffer. The reporter antibody linked to horseradi ⁇ h peroxidase i ⁇ placed in the di ⁇ h resulting in binding of the reporter antibody to any monoclonal antibody bound to VEGF2. Unattached reporter antibody i ⁇ then washed out.
  • Peroxida ⁇ e substrate ⁇ are then added to the di ⁇ h and the amount of color developed in a given time period i ⁇ a mea ⁇ urement of the amount of VEGF2 protein pre ⁇ ent in a given volume of patient ⁇ ample when compared again ⁇ t a ⁇ tandard curve.
  • a competition a ⁇ ay may be employed wherein antibodie ⁇ ⁇ pecific to VEGF2 are attached to a ⁇ olid ⁇ upport.
  • Polypeptide ⁇ of the present invention are then labeled, for example, by radioactivity, and a sample derived from the host are pas ⁇ ed over the ⁇ olid ⁇ upport and the amount of label detected, for example by liquid ⁇ cintillation chromatography, can be correlated to a quantity of VEGF2 in the ⁇ ample.
  • VEGF2 i ⁇ passed over a ⁇ olid ⁇ upport and binds to antibody attached to a ⁇ olid ⁇ upport.
  • a ⁇ econd antibody i ⁇ then bound to the VEGF2.
  • a third antibody which i ⁇ labeled and ⁇ pecific to the ⁇ econd antibody i ⁇ then pa ⁇ ed over the ⁇ olid ⁇ upport and bind ⁇ to the ⁇ econd antibody and an amount can then be quantified.
  • the ⁇ equence ⁇ of the present invention are also valuable for chromosome identification.
  • the sequence is ⁇ pecifically targeted to and can hybridize with a particular location on an individual human chromo ⁇ ome.
  • Few chromo ⁇ ome marking reagents based on actual sequence data (repeat polymorphism' ⁇ ) are pre ⁇ ently available for marking chromo ⁇ omal location.
  • the mapping of DNA ⁇ to" hromo ⁇ ome ⁇ according to the pre ⁇ ent invention i ⁇ an important first ⁇ tep in correlating tho ⁇ e ⁇ equence ⁇ with gene ⁇ a ⁇ ociated with di ⁇ ea ⁇ e.
  • ⁇ equence ⁇ can be mapped to chromo ⁇ ome ⁇ by preparing PCR primer ⁇ (preferably 15-25 bp) from the cDNA.
  • the ⁇ e primer ⁇ are then u ⁇ ed for PCR ⁇ creening of ⁇ omatic cell hybrid ⁇ containing individual human chromo ⁇ ome ⁇ . Only those hybrid ⁇ containing the human gene corre ⁇ ponding to the primer will yield an amplified fragment.
  • PCR mapping of somatic cell hybrid ⁇ i ⁇ a rapid procedure for assigning a particular DNA to a particular chromo ⁇ ome.
  • mapping ⁇ trategie ⁇ that can ⁇ imilarly be u ⁇ ed to map to it ⁇ chr ⁇ mo ⁇ ome include in situ hybridization, pre ⁇ creening with labeled flow- ⁇ orted chromo ⁇ ome ⁇ and pre ⁇ election by hybridization to con ⁇ truct chromo ⁇ ome ⁇ pecific-cDNA librarie ⁇ .
  • Fluore ⁇ cence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a preci ⁇ e chromo ⁇ omal location in one ⁇ tep.
  • Thi ⁇ technique can be u ⁇ ed with cDNA a ⁇ ⁇ hort a ⁇ 50 or 60 ba ⁇ e ⁇ .
  • thi ⁇ technique ⁇ ee Verma et al . , Human Chromo ⁇ ome ⁇ : a Manual of Ba ⁇ ic Technique ⁇ . Pergamon Pre ⁇ , New York (1988) .
  • the phy ⁇ ical po ⁇ ition of the ⁇ equence on the chromo ⁇ ome can be correlated with genetic map data.
  • genetic map data are found, for example, in V. McKu ⁇ ick, Mendelian Inheritance in Man (available "on line through Johns Hopkins University Welch Medical Library) .
  • the relationship between gene ⁇ and di ⁇ ea ⁇ e ⁇ that have been mapped to the ⁇ ame chromo ⁇ omal region are then identified through linkage analy ⁇ i ⁇ (coinheritance of phy ⁇ ically adjacent gene ⁇ ) .
  • a cDNA precisely localized to a chromo ⁇ omal region associated with the disea ⁇ e could be one of between 50 and 500 potential cau ⁇ ative gene ⁇ . (Thi ⁇ assume ⁇ 1 megabase mapping resolution and one gene per 20 kb) .
  • the polypeptide ⁇ , their fragment ⁇ or other derivative ⁇ , or analog ⁇ thereof, or cell ⁇ expre ⁇ ing them can be u ⁇ ed a ⁇ an immunogen to produce antibodie ⁇ thereto.
  • the ⁇ e antibodie ⁇ can be, for example, polyclonal or monoclonal antibodie ⁇ .
  • the pre ⁇ ent invention al ⁇ o include ⁇ chimeric, single chain, and humanized antibodies, as well as Fab fragment ⁇ , or the product of an Fab expre ⁇ ion library. Variou ⁇ procedure ⁇ known in the art may be u ⁇ ed for the production of ⁇ uch antibodie ⁇ and fragment ⁇ .
  • Antibodie ⁇ generated again ⁇ t the polypeptide corre ⁇ ponding to a sequence of the present invention can be obtained by direct injection of the polypeptide into an animal or by administering the polypeptide to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptide itself. In this manner, even a sequence encoding only a fragment of the polypeptide can be used to generate antibodies binding the whole native polypeptide. Such antibodie ⁇ can then be used to i ⁇ olate the ⁇ polypeptide from ti ⁇ ue expre ⁇ ing that polypeptide. For preparation of monoclonal antibodie ⁇ , any technique which provide ⁇ antibodie ⁇ produced by continuou ⁇ cell line culture ⁇ can be u ⁇ ed.
  • Example ⁇ include the hybridoma technique (Kohler and Mil ⁇ tein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al . , 1983, Immunology Today 4 : 12 ) , and the EBV-hybridoma technique to produce human monoclonal antibodie ⁇ (Cole, et al., 1985, in Monoclonal Antibodie ⁇ and Cancer Therapy, Alan R. Li ⁇ , Inc., pp. 77-96) .
  • Technique ⁇ de ⁇ cribed for the production of ⁇ ingle chain antibodie ⁇ U.S.
  • Patent 4,946,778 can be adapted to produce ⁇ ingle chain antibodie ⁇ to immunogenic polypeptide product ⁇ of thi ⁇ invention.
  • Al ⁇ o, tran ⁇ genic mice may be u ⁇ ed to expre ⁇ humanized antibodie ⁇ to immunogenic polypeptide product ⁇ of thi ⁇ invention.
  • the pre ⁇ ent invention will be further de ⁇ cribed with reference to the following example ⁇ ; however, it i ⁇ to be under ⁇ tood that the pre ⁇ ent invention i ⁇ not limited to ⁇ uch example ⁇ . All part ⁇ or amount ⁇ , unle ⁇ otherwi ⁇ e ⁇ pecified, are by weight.
  • “Plasmid ⁇ ” are de ⁇ ignated by a lower ca ⁇ e p preceded and/or followed by capital letter ⁇ and/or numbers.
  • the ⁇ tarting pla ⁇ mid ⁇ herein are either commercially available, publicly available on an unre ⁇ tricted ba ⁇ i ⁇ , or can be constructed from available plasmid ⁇ in accord with published procedures.
  • equivalent plasmid ⁇ to those described are known in the art and will be apparent to the ordinarily skilled artisan.
  • “Digestion” of DNA refer ⁇ to catalytic cleavage of the DNA with a re ⁇ triction enfeyme that act ⁇ only ⁇ at certain ⁇ equence ⁇ in the DNA.
  • the variou ⁇ re ⁇ triction enzyme ⁇ u ⁇ ed herein are commercially available and their reaction conditions, cofactor ⁇ and other requirement ⁇ were u ⁇ ed a ⁇ would be known to the ordinarily skilled arti ⁇ an.
  • analytical purpo ⁇ e ⁇ typically l ⁇ g of plasmid or DNA fragment i ⁇ u ⁇ ed with about 2 unit ⁇ of enzyme in about 20 ⁇ l of buffer ⁇ olution.
  • i ⁇ olating DNA fragment ⁇ for pla ⁇ mid con ⁇ truction typically 5 to 50 ⁇ g of DNA are dige ⁇ ted with 20 to 250 unit ⁇ of enzyme in a larger volume.
  • Appropriate buffer ⁇ and ⁇ ub ⁇ trate amount ⁇ for particular re ⁇ triction enzyme ⁇ are ⁇ pecified by the manufacturer.
  • Incubation time ⁇ of about 1 hour at 37°C are ordinarily u ⁇ ed, but may vary in accordance with the supplier' ⁇ instruction ⁇ .
  • Oligonucleotide ⁇ refer ⁇ to either a ⁇ ingle ⁇ tranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthe ⁇ ized. Such ⁇ ynthetic oligonucleotide ⁇ have no 5' pho ⁇ phate and thu ⁇ will not ligate to another oligonucleotide without adding a pho ⁇ phate with an ATP in the pre ⁇ ence of a kina ⁇ e. A ⁇ ynthetic oligonucleotide will ligate to a fragment that ha ⁇ not been depho ⁇ phorylated.
  • Ligase refers ⁇ to the proce ⁇ of forming phosphodie ⁇ ter bond ⁇ between two double ⁇ tranded nucleic acid fragment ⁇ (Maniati ⁇ , T. , et al . , Id., p. 146). Unle ⁇ otherwi ⁇ e provided, ligation may be accompli ⁇ hed u ⁇ ing known buffer ⁇ and condition ⁇ with 10 unit ⁇ of T4 DNA ligase ("ligase") per 0.5 ⁇ g of approximately equimolar amount ⁇ of the DNA fragment ⁇ to be ligated.
  • ligase T4 DNA ligase
  • Example 1 Expre ⁇ ion pattern of VEGF2 in human ti ⁇ ue ⁇ and brea ⁇ t cancer cell line ⁇
  • Northern blot analy ⁇ i ⁇ wa ⁇ carried out to examine the level ⁇ of expre ⁇ ion of the VEGF2 gene in human ti ⁇ ue ⁇ and human brea ⁇ t cancer cell line ⁇ .
  • Total cellular RNA samples were isolated with RNAzolTM B sy ⁇ tem (Biotecx Laboratorie ⁇ , Inc.). About 10 ⁇ g of total RNA i ⁇ olated from each brea ⁇ t tis ⁇ ue and cell line ⁇ pecified wa ⁇ ⁇ eparated on 1% agaro ⁇ e gel and blotted onto a nylon filter, (Molecular Cloning, Sambrook Frit ⁇ ch, and Maniatis, Cold Spring Harbor Press, 1989) .
  • the labeling reaction was done according to the Stratagene Cloning System ⁇ , Inc., Prime-It kit with 50 ng DNA fragment.
  • the labeled DNA wa ⁇ purified with a Select-G-50 column from 5 Prime -- 3 Prime, Inc, Boulder, CO, USA.
  • the filter wa ⁇ then hybridized with radioactively labeled full length VEGF2 gene at 1,000,000 cpm/ml in 0.5 M NaP0 4 and 7 % SDS overnight at 65°C. After wa ⁇ hing twice at room temperature and twice at 60°C with 0.5 X SSC, 0.1 % SDS, the filters were then exposed at -70°C overnight with an intensifying screen. A message of 1.6 Kd was observed in 2 breast cancer cell lines.
  • the 5' primer ha ⁇ the ⁇ equence TGT AAT ACG ACT CAC TAT AGG GAT CCC GCC ATG GAG GCC ACG GCT TAT GC (SEQ ID NO:4) and contains a BamHI restriction enzyme site (in bold) and 17 nucleotide nucleotide sequence complementary to the 5' sequence of VEGF2 (nt. 150-166) .
  • the 3' primer has the sequence GATC TCT AGA TTA GCT CAT TTG TGG TCT (SEQ ID NO:5) and contains the cleavage site for the restriction enzyme Xbal and 18 nucleotide ⁇ complementary to the 3' ⁇ equence of VEGF2, including the ⁇ top codon and 15 nt ⁇ equence before ⁇ top codon.
  • the amplified ⁇ equence ⁇ were i ⁇ olated from a 1% agaro ⁇ e gel u ⁇ ing a commercially available kit ("Geneclean," BIO 101, Inc. , La Jolla, CA) .
  • the fragment wa ⁇ then dige ⁇ ted with the endonuclea ⁇ e BamHI and Xbal and then purified again on a 1% agarose gel.
  • VEGF2 cDNA was cloned in frame with the signal sequence of baculoviru ⁇ gp67 gene and wa ⁇ located at the 3' end of the ⁇ ignal ⁇ equence in the vector. Thi ⁇ i ⁇ de ⁇ ignated pAcGP67A-VEGF2.
  • VEGF2 with the ⁇ ignal ⁇ equence of gp67 gene to the pRGl vector for expre ⁇ ion VEGF2 with the ⁇ ignal ⁇ equence and ⁇ ome up ⁇ tream ⁇ equence were exci ⁇ ed from the pAcGP67A-VEGF2 pla ⁇ mid at the Xho re ⁇ triction endonuclea ⁇ e ⁇ ite located up ⁇ tream of the VEGF2 cDNA and at the Xbal re ⁇ triction endonuclea ⁇ e ⁇ ite by Xhol and Xbal re ⁇ triction enzyme.
  • the PRGl vector (modification of pVL941 vector) i ⁇ u ⁇ ed for the expression of the VEGF2 protein using the baculoviru ⁇ expression sy ⁇ tem (for review ⁇ ee: Summer ⁇ , M.D. and Smith, G.E. 1987, A manual of method ⁇ for baculoviru ⁇ vector ⁇ and in ⁇ ect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555) .
  • This expres ⁇ ion vector contains the strong polyhedrin promoter of the Autographa califomica nuclear polyhedrosi ⁇ vir ⁇ i ⁇ (AcMNPV) followed by the recognition ⁇ ite ⁇ for the re ⁇ triction endonuclea ⁇ e ⁇ BamHI, Smal, Xbal, Bglll and Asp718.
  • the ⁇ equence between Xhol and BamHI i ⁇ the same a ⁇ that in PAcGp67A ( ⁇ tatic on tape) vector.
  • SV ⁇ imian viru ⁇
  • the polyhedrin ⁇ equence ⁇ are flanked at both ⁇ ide ⁇ by viral ⁇ equence ⁇ for the cell-mediated homologou ⁇ recombination of cotran ⁇ fected wild-type viral DNA.
  • baculoviru ⁇ vector ⁇ could be u ⁇ ed in place of pRGl ⁇ uch a ⁇ pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summer ⁇ , M.D. , Virology, 170:31-39).
  • Fragment F2 and the depho ⁇ phorylated pla ⁇ mid V2 were ligated with T4 DNA ligase.
  • E.coli HBlOl cells were then tran ⁇ formed and bacteria identified that contained the plasmid (pBac gp67-VEGF2) with the VEGF2 gene using the enzymes BamHI and Xbal.
  • the sequence of the cloned fragment wa ⁇ confirmed by DNA sequencing.
  • the tran ⁇ fection mixture wa ⁇ added dropwi ⁇ e to the Sf9 in ⁇ ect cell ⁇ (ATCC CRL 1711) ⁇ eeded in a 35 mm ti ⁇ ue culture plate with 1 ml Grace' ⁇ medium without ⁇ erum.
  • the plate wa ⁇ rocked back and forth to mix the newly added solution.
  • the plate wa ⁇ then incubated for 5 hour ⁇ at 27°C.
  • the tran ⁇ fection ⁇ olution wa ⁇ removed from the plate and 1 ml of Grace's in ⁇ ect medium ⁇ upplemented with 10% fetal calf ⁇ erum wa ⁇ added. The plate was put back into an incubator and cultivation continued at 27°C for four day ⁇ .
  • the virus wa ⁇ added to the cell ⁇ , blue ⁇ tained plaque ⁇ were picked with the tip of an Eppendorf pipette.
  • the agar containing the recombinant viru ⁇ e ⁇ wa ⁇ then re ⁇ u ⁇ pended in an Eppendorf tube containing 200 ⁇ l of Grace' ⁇ medium.
  • the agar wa ⁇ removed by a brief centrifugation and the supernatant containing the recombinant baculoviru ⁇ wa ⁇ u ⁇ ed to infect Sf9 cell ⁇ ⁇ eeded in 35 mm di ⁇ he ⁇ .
  • the supernatant ⁇ of the ⁇ e culture di ⁇ he ⁇ were harve ⁇ ted and then ⁇ tored at 4°C.
  • Sf9 cell ⁇ were grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells were infected with the recombinant baculovirus V-gp67-VEGF2 at a multiplicity of infection (MOD of 1.
  • MOD multiplicity of infection
  • the mediumrwa ⁇ removed and replaced with SF900 II medium minus methionine and cy ⁇ teine (Life Technologie ⁇ Inc., Gaither ⁇ burg). 42 hour ⁇ later 5 ⁇ Ci of 35 S-methionine and 5 ⁇ Ci 35 S cy ⁇ teine (Amersham) were added.
  • the cells were further incubated for 16 hour ⁇ before they were harve ⁇ ted by centrifugation and the labelled protein ⁇ vi ⁇ ualized by SDS-PAGE and autoradiography.
  • Protein from the medium and cytopla ⁇ m of the Sf9 cells was analyzed by SDS-PAGE under reducing and non-reducing conditions. See Figure 4.
  • the medium wa ⁇ dialyzed again ⁇ t 50 mM MES, pH 5.8.
  • Precpitate ⁇ were obtained after dialy ⁇ i ⁇ and resuspended in 100 mM NaCitrate, pH 5.0.
  • the resuspended precipitate wa ⁇ analyzed again by SDS-PAGE and was stained with Coomassie Brilliant Blue. See Figure 5.
  • the medium ⁇ upernatant was also diluted 1:10 in 50 mM MES, pH 5.8 and applied to an SP-650M column (1.0 x 6.6 cm, Toyopearl) at a flow rate of 1 ml/min. Protein was eluted with step gradients at 200, 300 and 500 mM NaCl. The VEGF2 wa ⁇ obtained u ⁇ ing the elution at 500 mM. The eluate wa ⁇ analyzed by SDS-PAGE in the presence or absence of reducing agent, ⁇ -mercaptoethanol and ⁇ tained by Coomma ⁇ sie Brilliant Blue. See Figure 6.
  • VEGF2-HA The expression of plasmid, VEGF2-HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin re ⁇ istance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, an SV40 intron and polyadenylation ⁇ ite.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein as previou ⁇ ly de ⁇ cribed (I. Wil ⁇ on, H. Ni an, R. Heighten, A Cheren ⁇ on, M. Connolly, and R. Lerner, 1984, Cell 37:767, (1984)).
  • the infu ⁇ ion of HA tag to the target protein allow ⁇ ea ⁇ y detection of the recombinant protein with an antibody that recognize ⁇ the HA epitope.
  • the 5' primer CGC GGA TCC ATG ACT GTA CTC TAC CCA
  • SEQ ID NO:6
  • the PCR product contain ⁇ a BamHI ⁇ ite, coding sequence followed by an Xhol restriction endonuclea ⁇ e ⁇ ite and HA tag fu ⁇ ed in frame, a tran ⁇ lation termination ⁇ top codon next to the HA tag, and an Xbal ⁇ ite.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp were digested with BamHI and Xbal restriction enzyme and ligated.
  • the ligation mixture was transformed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, CA 92037) the transformed culture wa ⁇ plated on ampicillin media plate ⁇ and resistant colonies were selected.
  • COS cell ⁇ were tran ⁇ fected with the expre ⁇ sion vector by DEAE-DEXTRAN method (J. Sambrook, E. Frit ⁇ ch, T. Maniati ⁇ , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Pres ⁇ , (1989)).
  • the expre ⁇ ion of the VEGF2-HA protein wa ⁇ detected by radiolabelling and immunoprecipitation method E. Harlow, D. Lane, Antibodie ⁇ : A Laboratory Manual, Cold Spring Harbor Laboratory Pre ⁇ , (1988)).
  • 'Cell ⁇ were labelled-for 8 hour ⁇ with 35 S-cy ⁇ teine two day ⁇ post transfection.
  • Culture media wa ⁇ then collected and cell ⁇ were ly ⁇ ed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tri ⁇ , pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)). Both cell ly ⁇ ate and culture media were precipitated with an HA ⁇ pecific monoclonal antibody. Protein ⁇ precipitated were analyzed on 15% SDS-PAGE gel ⁇ .
  • Example 4 The effect of partially-purified VEGF2 protein on the growth of va ⁇ cular endothelial cell ⁇
  • human umbilical vein endothelial cell ⁇ (HUVEC) were ⁇ eeded at 2-5xl0 4 cell ⁇ /35 mm di ⁇ h den ⁇ ity in M199 medium containing 4% fetal bovine ⁇ erum (FBS) , 16 unit ⁇ /ml heparin, and 50 unit ⁇ /ml endothelial cell growth ⁇ upplement ⁇ (ECGS, Biotechnique, Inc.) .
  • FBS fetal bovine ⁇ erum
  • 16 unit ⁇ /ml heparin 16 unit ⁇ /ml heparin
  • 50 unit ⁇ /ml endothelial cell growth ⁇ upplement ⁇ (ECGS, Biotechnique, Inc.)
  • the medium wa ⁇ replaced with M199 containing 10% FBS, 8 unit ⁇ /ml heparin.
  • Example 5 The effect of purified VEGF2 protein on the growth of va ⁇ cular endothelial cell ⁇
  • human umbilical vein endothelial cell ⁇ (HUVEC) were ⁇ eeded at 2-5 x 10* cell ⁇ /35 mm di ⁇ h den ⁇ ity in M199 medium containing 4% fetal bovine ⁇ erum (FBS) , 16 unit ⁇ /ml heparin, 50 unit ⁇ /ml endothelial cell growth ⁇ upplement ⁇ (ECGS, Biotechnique, Inc.).
  • FBS fetal bovine ⁇ erum
  • the medium wa ⁇ replaced with M199 containing 10% FBS, 8 unit ⁇ /ml heparin.
  • Purified VEGF2 protein of SEQ ID No. 2 minu ⁇ initial 45 amino acid re ⁇ idue ⁇ wa ⁇ added to the medium at thi ⁇ point.
  • the medium wa ⁇ replaced with fre ⁇ h "" medium and ⁇ upplement ⁇ .
  • cell number wa ⁇ determined with a Coulter Counter (See Figure 9) .
  • Fibrobla ⁇ t ⁇ are obtained from a subject by skin biopsy.
  • the resulting tis ⁇ ue i ⁇ placed in ti ⁇ ue-culture medium and ⁇ eparated into ⁇ mall piece ⁇ .
  • Small chunk ⁇ of the ti ⁇ ue are placed on a wet ⁇ urface of a ti ⁇ sue culture flask, approximately ten piece ⁇ are placed in each fla ⁇ k.
  • the fla ⁇ k i ⁇ turned up ⁇ ide down, clo ⁇ ed tight and left at room temperature over night.
  • the fla ⁇ k i ⁇ After 24 hour ⁇ at room temperature, the fla ⁇ k i ⁇ inverted and the chunk ⁇ of ti ⁇ ue remain fixed to the bottom of the fla ⁇ k and fre ⁇ h media (e.g., Ham' ⁇ F12 media, with 10% FBS, penicillin and streptomycin, is added. Thi ⁇ i ⁇ then incubated at 37°C for approximately one week. At thi ⁇ time, fre ⁇ h media i ⁇ added and ⁇ ub ⁇ equently changed every ⁇ everal day ⁇ . After an additional two week ⁇ in culture, a monolayer of fibrobla ⁇ t ⁇ emerge. The monolayer i ⁇ tryp ⁇ inized and ⁇ caled into larger flasks. pMV-7 (Kirschmeier, P.T.
  • fre ⁇ h media e.g., Ham' ⁇ F12 media, with 10% FBS, penicillin and streptomycin
  • the cDNA encoding a polypeptide of the pre ⁇ ent invention i ⁇ amplified u ⁇ ing PCR primer ⁇ which corre ⁇ pond to the 5' and 3' end ⁇ equence ⁇ re ⁇ pectively.
  • the 5' primer containing an EcoRI ⁇ ite and the 3' primer further include ⁇ a Hindlll ⁇ ite.
  • Equal quantitie ⁇ of the Moloney murine ⁇ arcoma viru ⁇ linear backbone and the amplified EcoRI and Hindlll fragment are added together, in the pre ⁇ ence of T4 DNA liga ⁇ e.
  • the re ⁇ ulting mixture i ⁇ maintained under condition ⁇ appropriate for ligation of the two fragment ⁇ .
  • the amphotropic pA317 or GP+aml2 packaging cell ⁇ are grown in ti ⁇ ue culture to confluent den ⁇ ity in Dulbecco' ⁇ Modified Eagle ⁇ Medium (DMEM) with 10% calf ⁇ erum (CS) , penicillin and ⁇ treptomycin.
  • DMEM Dulbecco' ⁇ Modified Eagle ⁇ Medium
  • CS calf ⁇ erum
  • penicillin and ⁇ treptomycin The MSV vector containing the gene i ⁇ then added to the media and the packaging cell ⁇ are tran ⁇ duced with the vector.
  • the packaging cell ⁇ now produce infectiou ⁇ viral particle ⁇ containing the gene (the packaging cell ⁇ are now referred to a ⁇ producer cells) .
  • Fresh media is added to the transduced producer cells, and sub ⁇ equently, the media i ⁇ harve ⁇ ted from a 10 cm plate of confluent producer cell ⁇ .
  • the ⁇ pent media containing the infectiou ⁇ viral particle ⁇ , i ⁇ filtered through a millipore filter to remove detached producer cell ⁇ and thi ⁇ media i ⁇ then u ⁇ ed to infect fibrobla ⁇ t cell ⁇ .
  • Media i ⁇ removed from a ⁇ ub-confluent plate of fibrobla ⁇ t ⁇ and quickly replaced with the media from the producer cell ⁇ .
  • Thi ⁇ media i ⁇ removed and replaced with fre ⁇ h media. If the titer of viru ⁇ i ⁇ high, then virtually all fibrobla ⁇ t ⁇ will be infected and no ⁇ election i ⁇ required. If the titer i ⁇ very low, then it i ⁇ nece ⁇ ary to u ⁇ e a retroviral vector that ha ⁇ a ⁇ electable marker, ⁇ uch a ⁇ neo or hi ⁇ .
  • the engineered fibrobla ⁇ t ⁇ are then injected into the ho ⁇ t, either alone or after having been grown to confluence on cytodex 3 microcarrier bead ⁇ .
  • the fibrobla ⁇ t ⁇ now produce the protein product.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • GTCCTTCCAC CATGCACTCG CTGGGCTTCT TCTCTGTGGC GTG TCTCTG CTCGCCGCTG 60 CGCTGCTCCC GGGTCCTCGC GAGGCGCCCG CCGCCGCCGC CGCCTTCGAG TCCGGACTCG 120 ACCTCTCGGA CGCGGAGCCC GACGCGGGCGAGGCCACGGC TTATGCAAGC AAAGATCTGG 180 AGGAGCAGTT ACGGTCTGTG TCCAGTGTAG ATGAACTCAT GACTGTACTC TACCCAGAAT 240 ATTGGAAAAT GTACAAGTGT CAGCTAAGGA AAGGAGGCTG GCAACATAAC AGAGAACAGG 300 CCAACCTCAA CTCAAGGACA GAAGAGACTA TAAAAAA TCG TGCAGCACAT TATAATACAG 360 AGATCTTGAA AAGTATTGAT AATGAGTGGA GAAAGACTCA ATGCATGCCA CGGGAGGTGT 420 GTATAGATGT GGGGAAGGAG TTTGGAGTCGACAAACA
  • 165 170 175 lie Arg Arg Ser Leu Pro Ala Thr Leu Pro Gin Cys Gin Ala Ala Asn
  • MOLECULE TYPE PEPTIDE
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:3: Pro Xaa Cys Val Xaa Xaa Xaa Arg Cys Xaa Gly Cy ⁇ Cy ⁇ A ⁇ n
  • MOLECULE TYPE oligonucleotide
  • MOLECULE TYPE oligonucleotide
  • MOLECULE TYPE oligonucleotide
  • MOLECULE TYPE PROTEIN
  • Xi SEQUENCE DESCRIPTION: SEQ ID NO:10: Met Asn Phe Leu Leu Ser Trp Val Hi ⁇ Trp Ser Leu Ala Leu Leu

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Toxicology (AREA)
  • Biomedical Technology (AREA)
  • Rheumatology (AREA)
  • Dermatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Diabetes (AREA)
  • Wood Science & Technology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • General Engineering & Computer Science (AREA)
  • Vascular Medicine (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Emergency Medicine (AREA)
  • Neurology (AREA)
  • Oncology (AREA)
PCT/US1996/009001 1995-06-06 1996-06-06 Human vascular endothelial growth factor 2 Ceased WO1996039515A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
KR1019970709003A KR100511692B1 (ko) 1995-06-06 1996-06-06 사람혈관내피성장인자2및이를포함하는약제학적조성물
AU60467/96A AU714484B2 (en) 1995-06-06 1996-06-06 Human vascular endothelial growth factor 2
EP96918130A EP0837934B1 (en) 1995-06-06 1996-06-06 Human vascular endothelial growth factor 2
CA002224093A CA2224093C (en) 1995-06-06 1996-06-06 Human vascular endothelial growth factor 2
JP9501427A JPH11513883A (ja) 1995-06-06 1996-06-06 ヒト血管内皮増殖因子2
DE69636752T DE69636752T2 (de) 1995-06-06 1996-06-06 Menschlicher wachstumsfaktor 2, spezifisch für vaskuläre endothelzellen
MXPA/A/1997/009243A MXPA97009243A (en) 1995-06-06 1997-11-28 Human vascular endothelial growth factor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US08/465,968 1995-06-06
US08/465,968 US6608182B1 (en) 1994-03-08 1995-06-06 Human vascular endothelial growth factor 2

Publications (2)

Publication Number Publication Date
WO1996039515A1 true WO1996039515A1 (en) 1996-12-12
WO1996039515A9 WO1996039515A9 (en) 1997-02-06

Family

ID=23849909

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1996/009001 Ceased WO1996039515A1 (en) 1995-06-06 1996-06-06 Human vascular endothelial growth factor 2

Country Status (10)

Country Link
US (3) US6608182B1 (enExample)
EP (1) EP0837934B1 (enExample)
JP (3) JPH11513883A (enExample)
KR (1) KR100511692B1 (enExample)
CN (2) CN1552855A (enExample)
AT (1) ATE347595T1 (enExample)
AU (1) AU714484B2 (enExample)
CA (1) CA2224093C (enExample)
DE (1) DE69636752T2 (enExample)
WO (1) WO1996039515A1 (enExample)

Cited By (51)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998033917A1 (en) * 1994-11-14 1998-08-06 The Ludwig Institute For Cancer Research Vascular endothelial growth factor c (vegf-c) protein and gene, mutants thereof, and uses thereof
US6040157A (en) * 1994-03-08 2000-03-21 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US6130071A (en) * 1997-02-05 2000-10-10 Helsinki University Licensing, Ltd. Vascular endothelial growth factor C (VEGF-C) ΔCys156 protein and gene, and uses thereof
US6221839B1 (en) 1994-11-14 2001-04-24 Helsinki University Licensing Ltd. Oy FIt4 ligand and methods of use
US6245530B1 (en) 1995-08-01 2001-06-12 Ludwig Institute For Cancer Research Receptor ligand
EP1017421A4 (en) * 1997-03-07 2001-06-27 Wistar Inst METHOD AND COMPOSITIONS FOR TREATING TISSUE DEFECTS AND INDUCING HYPERVASCULARITY IN MAMMALIAN TISSUES
WO2002011769A1 (en) * 2000-08-04 2002-02-14 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US6361946B1 (en) 1997-02-05 2002-03-26 Licentia Ltd Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof
US6403088B1 (en) 1995-08-01 2002-06-11 Helsinki University Licensing, Ltd. Antibodies reactive with VEGF-C, a ligand for the Flt4 receptor tyrosine kinase (VEGFR-3)
US6451764B1 (en) 1995-09-08 2002-09-17 Genentech, Inc. VEGF-related protein
EP1062319A4 (en) * 1998-03-13 2003-04-23 Human Genome Sciences Inc VASCULAR ENDOTHELIAL GROWTH FACTOR 2
US6608182B1 (en) 1994-03-08 2003-08-19 Human Genome Sciences, Inc. Human vascular endothelial growth factor 2
US6635743B1 (en) 1996-03-22 2003-10-21 Human Genome Sciences, Inc. Apoptosis inducing molecule II and methods of use
US6645933B1 (en) 1995-08-01 2003-11-11 Helsinki University Licensing Ltd. Oy Receptor ligand VEGF-C
US6676937B1 (en) 1998-03-09 2004-01-13 Caritas St. Elizabeth's Medical Center Of Boston Inc. Compositions and methods for modulating vascularization
US6713061B1 (en) 1996-03-12 2004-03-30 Human Genome Sciences, Inc. Death domain containing receptors
US6734285B2 (en) 1994-03-08 2004-05-11 Human Genome Sciences, Inc. Vascular endothelial growth factor 2 proteins and compositions
US6759513B2 (en) 1996-03-12 2004-07-06 Human Genome Sciences, Inc. Death domain containing receptors
US6783953B1 (en) 1998-12-22 2004-08-31 Janssen Pharmaceutica N.V. Vascular endothelial growth factor-X
US6818220B1 (en) 1994-11-14 2004-11-16 Licentia Ltd. Vascular endothelial growth factor C (VEGF-C) protein and gene mutants thereof, and uses thereof
US6824777B1 (en) 1992-10-09 2004-11-30 Licentia Ltd. Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US6958147B1 (en) 1998-10-26 2005-10-25 Licentia Ltd Use of VEGF-C to prevent restenosis
US6994989B1 (en) 1995-11-08 2006-02-07 Immunex Corp. FLK-1 binding proteins
US7026462B2 (en) 2000-12-07 2006-04-11 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US7067317B2 (en) 2000-12-07 2006-06-27 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US7109308B1 (en) 1994-03-08 2006-09-19 Human Genome Sciences, Inc. Antibodies to human vascular endothelial growth factor 2
US7125714B2 (en) 1997-02-05 2006-10-24 Licentia Ltd. Progenitor cell materials and methods
US7153827B1 (en) 1994-03-08 2006-12-26 Human Genome Sciences, Inc. Vascular endothelial growth factor 2 and methods of use
US7186688B1 (en) 1994-03-08 2007-03-06 Human Genome Sciences, Inc. Methods of stimulating angiogenesis in a patient by administering vascular endothelial growth factor 2
US7208582B2 (en) 2001-04-13 2007-04-24 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US7217570B2 (en) 2001-08-23 2007-05-15 The Wistar Institute Of Anatomy And Biology Organotypic intestinal culture and methods of use thereof
US7223724B1 (en) 1999-02-08 2007-05-29 Human Genome Sciences, Inc. Use of vascular endothelial growth factor to treat photoreceptor cells
US7227005B1 (en) 1994-03-08 2007-06-05 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US7329740B2 (en) 1995-11-08 2008-02-12 Immunex Corporation Flk-1 binding protein
US7357927B2 (en) 1996-03-12 2008-04-15 Human Genome Sciences, Inc. Death domain containing receptors
US7358085B2 (en) 2005-02-28 2008-04-15 Sangamo Biosciences, Inc. Anti-angiogenic methods and compositions
US7402312B2 (en) 2001-04-13 2008-07-22 Human Genome Sciences, Inc. Antibodies to vascular endothelial growth factor 2 (VEGF-2)
US7423125B2 (en) 1995-08-01 2008-09-09 Vegenics Limited Antibodies to VEGF-C
US7429646B1 (en) 1995-06-05 2008-09-30 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor-like 2
EP1997829A1 (en) 2001-12-21 2008-12-03 Human Genome Sciences, Inc. Albumin fusion proteins
US7498417B2 (en) 1994-03-08 2009-03-03 Human Genome Sciences, Inc. Antibodies to vascular endothelial growth factor 2 and methods of using same
WO2009082485A1 (en) 2007-12-26 2009-07-02 Vaccinex, Inc. Anti-c35 antibody combination therapies and methods
US7563882B2 (en) 2002-06-10 2009-07-21 University Of Rochester Polynucleotides encoding antibodies that bind to the C35 polypeptide
US7597886B2 (en) 1994-11-07 2009-10-06 Human Genome Sciences, Inc. Tumor necrosis factor-gamma
EP2206720A1 (en) 2000-04-12 2010-07-14 Human Genome Sciences, Inc. Albumin fusion proteins
US7829536B2 (en) 1999-03-26 2010-11-09 Vegenics Limited Method of treating lymphedema comprising administering VEGF-D
US7964190B2 (en) 1996-03-22 2011-06-21 Human Genome Sciences, Inc. Methods and compositions for decreasing T-cell activity
EP2357192A1 (en) 1999-02-26 2011-08-17 Human Genome Sciences, Inc. Human endokine alpha and methods of use
US8444957B2 (en) 1998-10-09 2013-05-21 Vegenics Pty Limited Methods of screening for neoplastic disease states
US8940695B2 (en) 2001-01-19 2015-01-27 Vegenics Pty Limited Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US9745558B2 (en) 2013-02-18 2017-08-29 Vegenics Pty Limited VEGFR-3 ligand binding molecules and uses thereof

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU755708B2 (en) * 1995-08-01 2002-12-19 Vegenics Limited Receptor ligand VEGF-C
AU2003201371B2 (en) * 1995-08-01 2007-03-01 Helsinki University Licensing Ltd. Oy Receptor Ligand VEGF-C
US20060171907A1 (en) * 1996-11-21 2006-08-03 The Procter & Gamble Company Oral care compositions providing enhanced whitening and stain prevention
US6764820B2 (en) * 1999-03-26 2004-07-20 Ludwig Institute For Cancer Research Screening for lymphatic disorders involving the FLT4 receptor tyrosine kinase (VEGFR-3)
US6965010B2 (en) * 2000-02-25 2005-11-15 Licentia, Ltd. Materials and methods involving hybrid vascular endothelial growth factor DNAs and proteins
US7291597B2 (en) * 2000-04-06 2007-11-06 Franco Wayne P Growth factor therapy mobilization of stem cells into the peripheral blood
US7288521B2 (en) * 2000-04-06 2007-10-30 Franco Wayne P Growth factor therapy mobilization of stem cells into the peripheral blood
US7611711B2 (en) * 2001-01-17 2009-11-03 Vegenics Limited VEGFR-3 inhibitor materials and methods
AU2002252631A1 (en) * 2001-04-13 2002-10-28 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US20050232921A1 (en) * 2001-04-13 2005-10-20 Rosen Craig A Vascular endothelial growth factor 2
CN1555488A (zh) * 2001-07-12 2004-12-15 路德维格癌症研究院 淋巴管内皮细胞物质及方法
US20040214766A1 (en) * 2001-10-01 2004-10-28 Kari Alitalo VEGF-C or VEGF-D materials and methods for treatment of neuropathologies
US20030113324A1 (en) * 2001-10-01 2003-06-19 Kari Alitalo Neuropilin/VEGF-C/VEGFR-3 materials and methods
US20040120950A1 (en) * 2002-12-20 2004-06-24 Kari Alitalo Modulation of VEGF-C/VEGFR-3 interactions in the treatment of rheumatoid arthritis
US20040248796A1 (en) * 2003-02-04 2004-12-09 Kari Alitalo VEGF-B and PDGF modulation of stem cells
WO2005016963A2 (en) * 2003-06-12 2005-02-24 Ludwig Institute For Cancer Research Heparin binding veger-3 ligands
EP1635860A2 (en) * 2003-06-12 2006-03-22 Ludwig Institute For Cancer Research Use of vegf-c or vegf-d in reconstructive surgery
US7597884B2 (en) 2004-08-09 2009-10-06 Alios Biopharma, Inc. Hyperglycosylated polypeptide variants and methods of use
US20090035346A1 (en) * 2005-06-21 2009-02-05 Pervasis Therpeutics, Inc. Methods and Compositions for Enhancing Vascular Access
US20110172293A1 (en) 2008-07-08 2011-07-14 Fish Jason E Methods and Compositions for Modulating Angiogenesis
CN108339154A (zh) * 2017-01-25 2018-07-31 中国科学院遗传与发育生物学研究所 一种诱导颅脑损伤组织再生的功能生物材料及其应用
CN111303271B (zh) * 2020-02-19 2022-02-01 西安交通大学医学院第一附属医院 一种用于治疗肺纤维化的血小板源性生长因子重组疫苗及其应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0476983A1 (en) * 1990-09-21 1992-03-25 Merck & Co. Inc. Vascular endothelial cell growth factor II
US5219739A (en) * 1989-07-27 1993-06-15 Scios Nova Inc. DNA sequences encoding bVEGF120 and hVEGF121 and methods for the production of bovine and human vascular endothelial cell growth factors, bVEGF120 and hVEGF121
US5326695A (en) * 1992-05-15 1994-07-05 Ludwig Institute For Cancer Research Platelet derived growth factor agonists

Family Cites Families (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0186084B1 (en) 1984-12-24 1991-09-04 Merck & Co. Inc. Brain-derived growth factor
US5073492A (en) * 1987-01-09 1991-12-17 The Johns Hopkins University Synergistic composition for endothelial cell growth
JPS6438100A (en) 1987-07-31 1989-02-08 Toray Industries Vascular endothelial cell growth factor
JPH02117698A (ja) 1988-10-27 1990-05-02 Toray Ind Inc 血管内皮細胞成長因子
US5240848A (en) 1988-11-21 1993-08-31 Monsanto Company Dna sequences encoding human vascular permeability factor having 189 amino acids
US5693622A (en) 1989-03-21 1997-12-02 Vical Incorporated Expression of exogenous polynucleotide sequences cardiac muscle of a mammal
EP0399816B1 (en) 1989-05-24 1995-12-20 Merck & Co. Inc. Purification and characterization of a glioma-derived growth factor
US5194596A (en) * 1989-07-27 1993-03-16 California Biotechnology Inc. Production of vascular endothelial cell growth factor
WO1992014748A1 (en) 1991-02-22 1992-09-03 American Cyanamid Company Identification of a novel human receptor tyrosine kinase gene
DE69229454T2 (de) 1991-03-28 2000-01-05 Merck & Co., Inc. Untereinheit-C des vaskulären endothelialen Zellwachstumsfaktors
US5185438A (en) 1991-04-02 1993-02-09 The Trustees Of Princeton University Nucleic acids encoding hencatoporetic stem cell receptor flk-2
US5234908A (en) 1991-04-12 1993-08-10 Creative Biomolecules, Inc. Method of treating gastrointestinal ulcers with platelet derived growth factor
US5661133B1 (en) 1991-11-12 1999-06-01 Univ Michigan Collateral blood vessel formation in cardiac muscle by injecting a dna sequence encoding an angiogenic protein
US5861301A (en) 1992-02-20 1999-01-19 American Cayanamid Company Recombinant kinase insert domain containing receptor and gene encoding same
US5776755A (en) * 1992-10-09 1998-07-07 Helsinki University Licensing, Ltd. FLT4, a receptor tyrosine kinase
AU694097B2 (en) 1992-11-18 1998-07-16 Arch Development Corporation Adenovirus-mediated gene transfer to cardiac and vascular smooth muscle
US5922572A (en) 1994-01-25 1999-07-13 Human Genome Sciences, Inc. Polynucleotides encoding haemopoietic maturation factor
US5817485A (en) 1994-03-08 1998-10-06 Human Genome Sciences, Inc. Nucleic acids and cells for recombinant production of fibroblast growth factor-10
US5633147A (en) 1994-03-08 1997-05-27 Human Genome Sciences, Inc. Transforming growth factor αH1
ATE309360T1 (de) 1994-03-08 2005-11-15 Human Genome Sciences Inc Vaskularer endothelialer wachstumsfaktor 2
US5932540A (en) 1994-03-08 1999-08-03 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US6608182B1 (en) 1994-03-08 2003-08-19 Human Genome Sciences, Inc. Human vascular endothelial growth factor 2
US6040157A (en) 1994-03-08 2000-03-21 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
AU708903B2 (en) 1994-08-23 1999-08-12 Human Genome Sciences, Inc. Human chemokine polypeptides
US5652225A (en) 1994-10-04 1997-07-29 St. Elizabeth's Medical Center Of Boston, Inc. Methods and products for nucleic acid delivery
US6245530B1 (en) * 1995-08-01 2001-06-12 Ludwig Institute For Cancer Research Receptor ligand
US6130071A (en) * 1997-02-05 2000-10-10 Helsinki University Licensing, Ltd. Vascular endothelial growth factor C (VEGF-C) ΔCys156 protein and gene, and uses thereof
US6221839B1 (en) * 1994-11-14 2001-04-24 Helsinki University Licensing Ltd. Oy FIt4 ligand and methods of use
WO1998033917A1 (en) 1994-11-14 1998-08-06 The Ludwig Institute For Cancer Research Vascular endothelial growth factor c (vegf-c) protein and gene, mutants thereof, and uses thereof
US6403088B1 (en) * 1995-08-01 2002-06-11 Helsinki University Licensing, Ltd. Antibodies reactive with VEGF-C, a ligand for the Flt4 receptor tyrosine kinase (VEGFR-3)
US6645933B1 (en) * 1995-08-01 2003-11-11 Helsinki University Licensing Ltd. Oy Receptor ligand VEGF-C
US5792453A (en) 1995-02-28 1998-08-11 The Regents Of The University Of California Gene transfer-mediated angiogenesis therapy
US5928939A (en) 1995-03-01 1999-07-27 Ludwig Institute For Cancer Research Vascular endothelial growth factor-b and dna coding therefor
US5607918A (en) 1995-03-01 1997-03-04 Ludwig Institute For Cancer Research Vascular endothelial growth factor-B and DNA coding therefor
ATE483733T1 (de) 1995-06-14 2010-10-15 Univ California Hochaffine humane antikörper gegen tumorantigene
US6361946B1 (en) 1997-02-05 2002-03-26 Licentia Ltd Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof
WO1997008320A1 (en) 1995-08-18 1997-03-06 Morphosys Gesellschaft Für Proteinoptimierung Mbh Protein/(poly)peptide libraries
ATE242809T1 (de) 1995-09-08 2003-06-15 Genentech Inc Vegf-verwandtes protein
US6121246A (en) 1995-10-20 2000-09-19 St. Elizabeth's Medical Center Of Boston, Inc. Method for treating ischemic tissue
WO1997017442A1 (en) 1995-11-08 1997-05-15 Immunex Corporation Flk-1 binding protein
US5641750A (en) 1995-11-29 1997-06-24 Amgen Inc. Methods for treating photoreceptors using glial cell line-derived neurotrophic factor (GDNF) protein product
JP2000517174A (ja) 1996-08-13 2000-12-26 ヒューマン・ジェノム・サイエンシズ・インコーポレイテッド ケラチノサイト増殖因子―2(kgf―2または線維芽細胞増殖因子―12、fgf―12)
CA2263890C (en) 1996-08-23 2013-05-14 Ludwig Institute For Cancer Research Recombinant vascular endothelial cell growth factor d (vegf-d)
WO1998024811A2 (en) 1996-12-06 1998-06-11 Zymogenetics, Inc. Vascular endothelial growth factor
AU6691098A (en) 1997-03-07 1998-09-22 Wistar Institute Of Anatomy & Biology, The Method and compositions for healing tissue defects and inducing hypervascularityin mammalian tissue
CN1260835A (zh) 1997-04-25 2000-07-19 科莱特诺医疗公司 截短的vegf相关蛋白质
AU745965B2 (en) 1997-06-06 2002-04-11 Asat Ag Applied Science & Technology Anti-GPIIb/IIIa recombinant antibodies
AU8536998A (en) 1997-06-10 1998-12-30 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. Regulatory sequences involved in hypoxia regulated gene expression and uses thereof
NZ501990A (en) 1997-07-08 2002-09-27 Viventia Biotech Inc Compositions containing antigen-binding fragments that recognise the antigen recognised by a recombinant 4B5 antibody
WO1999008522A1 (en) 1997-08-15 1999-02-25 Ludwig Institute For Cancer Research Stimulation, modulation and/or inhibition of endothelial proteolytic activity and/or angiogenic activity
GB9722131D0 (en) 1997-10-20 1997-12-17 Medical Res Council Method
JP2001520875A (ja) 1997-10-27 2001-11-06 メルク エンド カムパニー インコーポレーテッド 血管新生の刺激のための遺伝子治療
EP1062319A4 (en) 1998-03-13 2003-04-23 Human Genome Sciences Inc VASCULAR ENDOTHELIAL GROWTH FACTOR 2
CA2361615A1 (en) 1999-02-08 2000-08-10 Human Genome Sciences, Inc. The use of vascular endothelial growth factor 2 antagonist in the treatment of an injury to or disorder of an eye
DE10027695A1 (de) 1999-05-27 2001-04-19 Max Delbrueck Centrum Vakzine gegen konformationsabhängige Antigene sowie gegen Antigene, die keine oder nicht ausschließlich Proteine oder Peptide sind
CA2376018A1 (en) 1999-06-03 2000-12-14 Human Genome Sciences, Inc. Angiogenic proteins and uses thereof
MXPA02007449A (es) 2000-02-03 2003-04-14 Millennium Pharm Inc Anticuerpos anti-ccr2 humanizados y metodos para el uso de los mismos.
TWI373343B (en) 2000-02-10 2012-10-01 Abbott Gmbh & Co Kg Antibodies that bind human interleukin-18 and methods of making and using
CN1211126C (zh) 2000-08-04 2005-07-20 人体基因组科学有限公司 血管内皮生长因子2
WO2002083704A1 (en) 2001-04-13 2002-10-24 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
AU2002252631A1 (en) 2001-04-13 2002-10-28 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US20030170786A1 (en) 2001-04-13 2003-09-11 Rosen Craig A. Vascular endothelial growth factor 2
AU2002313770A1 (en) 2002-04-12 2003-12-02 Human Genome Sciences, Inc. Vascular endothelial growth factor 2

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5219739A (en) * 1989-07-27 1993-06-15 Scios Nova Inc. DNA sequences encoding bVEGF120 and hVEGF121 and methods for the production of bovine and human vascular endothelial cell growth factors, bVEGF120 and hVEGF121
EP0476983A1 (en) * 1990-09-21 1992-03-25 Merck & Co. Inc. Vascular endothelial cell growth factor II
US5326695A (en) * 1992-05-15 1994-07-05 Ludwig Institute For Cancer Research Platelet derived growth factor agonists

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, Volume 165, Number 3, issued 29 December 1989, TISCHER et al., "Vascular Endothelial Growth Factor: A New Member of the Platelet-Derived Growth Factor Gene Family", pages 1198-1206. *

Cited By (110)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7829091B2 (en) 1992-10-09 2010-11-09 Vegenics Limited Therapy targeting FLT4 (VEGER-3) expressed in blood vessels
US7034105B2 (en) 1992-10-09 2006-04-25 Licentia, Ltd. FLT4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US6824777B1 (en) 1992-10-09 2004-11-30 Licentia Ltd. Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US6734285B2 (en) 1994-03-08 2004-05-11 Human Genome Sciences, Inc. Vascular endothelial growth factor 2 proteins and compositions
US7153827B1 (en) 1994-03-08 2006-12-26 Human Genome Sciences, Inc. Vascular endothelial growth factor 2 and methods of use
US6040157A (en) * 1994-03-08 2000-03-21 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US7115392B2 (en) 1994-03-08 2006-10-03 Human Genome Sciences, Inc. Polynucleotides encoding human vascular endothelial growth factor 2
US7439333B2 (en) 1994-03-08 2008-10-21 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US7498417B2 (en) 1994-03-08 2009-03-03 Human Genome Sciences, Inc. Antibodies to vascular endothelial growth factor 2 and methods of using same
US7576189B2 (en) 1994-03-08 2009-08-18 Human Genome Sciences, Inc. Antibodies to human vascular endothelial growth factor 2 and methods of using the same
US7227005B1 (en) 1994-03-08 2007-06-05 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US7109308B1 (en) 1994-03-08 2006-09-19 Human Genome Sciences, Inc. Antibodies to human vascular endothelial growth factor 2
US7186688B1 (en) 1994-03-08 2007-03-06 Human Genome Sciences, Inc. Methods of stimulating angiogenesis in a patient by administering vascular endothelial growth factor 2
US6608182B1 (en) 1994-03-08 2003-08-19 Human Genome Sciences, Inc. Human vascular endothelial growth factor 2
US7153942B2 (en) 1994-03-08 2006-12-26 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US7597886B2 (en) 1994-11-07 2009-10-06 Human Genome Sciences, Inc. Tumor necrosis factor-gamma
US6221839B1 (en) 1994-11-14 2001-04-24 Helsinki University Licensing Ltd. Oy FIt4 ligand and methods of use
US6818220B1 (en) 1994-11-14 2004-11-16 Licentia Ltd. Vascular endothelial growth factor C (VEGF-C) protein and gene mutants thereof, and uses thereof
WO1998033917A1 (en) * 1994-11-14 1998-08-06 The Ludwig Institute For Cancer Research Vascular endothelial growth factor c (vegf-c) protein and gene, mutants thereof, and uses thereof
US7429646B1 (en) 1995-06-05 2008-09-30 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor-like 2
US7807412B2 (en) 1995-08-01 2010-10-05 Vegenies Limited VEGF-C ΔR226ΔR227 mutants and uses thereof
US8637262B2 (en) 1995-08-01 2014-01-28 Vegenics Pty Limited Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof
US6645933B1 (en) 1995-08-01 2003-11-11 Helsinki University Licensing Ltd. Oy Receptor ligand VEGF-C
US6730658B1 (en) 1995-08-01 2004-05-04 Helsinki University Licensing, Ltd. Stimulation of lymphatic growth with an FLT4 ligand
US6403088B1 (en) 1995-08-01 2002-06-11 Helsinki University Licensing, Ltd. Antibodies reactive with VEGF-C, a ligand for the Flt4 receptor tyrosine kinase (VEGFR-3)
US6245530B1 (en) 1995-08-01 2001-06-12 Ludwig Institute For Cancer Research Receptor ligand
US7794756B1 (en) 1995-08-01 2010-09-14 Vegenics Limited Methods of using antibodies to VEGF-C
US7709270B2 (en) 1995-08-01 2010-05-04 Vegenics Ltd. Vascular endothelial growth factor C (VEGF-C) protein diagnostic
US7727761B2 (en) 1995-08-01 2010-06-01 Vegenics Limited Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof
US8282931B2 (en) 1995-08-01 2012-10-09 Vegenics Pty Limited Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof
US7423125B2 (en) 1995-08-01 2008-09-09 Vegenics Limited Antibodies to VEGF-C
US7629145B2 (en) 1995-09-08 2009-12-08 Genentech, Inc. VEGF-related protein
JP2010068806A (ja) * 1995-09-08 2010-04-02 Genentech Inc Vegf−関連タンパク質
US6576608B1 (en) 1995-09-08 2003-06-10 Genentech, Inc. Methods of using VEGF-related protein
US6451764B1 (en) 1995-09-08 2002-09-17 Genentech, Inc. VEGF-related protein
US6994989B1 (en) 1995-11-08 2006-02-07 Immunex Corp. FLK-1 binding proteins
US7329740B2 (en) 1995-11-08 2008-02-12 Immunex Corporation Flk-1 binding protein
US7357927B2 (en) 1996-03-12 2008-04-15 Human Genome Sciences, Inc. Death domain containing receptors
US7708996B2 (en) 1996-03-12 2010-05-04 Human Genome Sciences, Inc. DR3 antibodies
US8105589B2 (en) 1996-03-12 2012-01-31 Human Genome Sciences, Inc. Use of DR3 antibodies in the treatment of inflammatory disease
US6713061B1 (en) 1996-03-12 2004-03-30 Human Genome Sciences, Inc. Death domain containing receptors
US6759513B2 (en) 1996-03-12 2004-07-06 Human Genome Sciences, Inc. Death domain containing receptors
US7964190B2 (en) 1996-03-22 2011-06-21 Human Genome Sciences, Inc. Methods and compositions for decreasing T-cell activity
US6635743B1 (en) 1996-03-22 2003-10-21 Human Genome Sciences, Inc. Apoptosis inducing molecule II and methods of use
US7125714B2 (en) 1997-02-05 2006-10-24 Licentia Ltd. Progenitor cell materials and methods
AU748369B2 (en) * 1997-02-05 2002-06-06 Vegenics Limited Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof,and uses thereof
US6361946B1 (en) 1997-02-05 2002-03-26 Licentia Ltd Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof, and uses thereof
US6130071A (en) * 1997-02-05 2000-10-10 Helsinki University Licensing, Ltd. Vascular endothelial growth factor C (VEGF-C) ΔCys156 protein and gene, and uses thereof
AU748369C (en) * 1997-02-05 2003-03-20 Vegenics Limited Vascular endothelial growth factor C (VEGF-C) protein and gene, mutants thereof,and uses thereof
US6486133B1 (en) * 1997-03-07 2002-11-26 The Wistar Institute Of Anatomy And Biology Methods for inducing localized vascular development and enhancing the repair of a wound in the mammamian dermis
EP1017421A4 (en) * 1997-03-07 2001-06-27 Wistar Inst METHOD AND COMPOSITIONS FOR TREATING TISSUE DEFECTS AND INDUCING HYPERVASCULARITY IN MAMMALIAN TISSUES
US6676937B1 (en) 1998-03-09 2004-01-13 Caritas St. Elizabeth's Medical Center Of Boston Inc. Compositions and methods for modulating vascularization
EP1062319A4 (en) * 1998-03-13 2003-04-23 Human Genome Sciences Inc VASCULAR ENDOTHELIAL GROWTH FACTOR 2
US8444957B2 (en) 1998-10-09 2013-05-21 Vegenics Pty Limited Methods of screening for neoplastic disease states
US8455453B2 (en) 1998-10-26 2013-06-04 Vegenics Pty Ltd Use of VEGF-D gene to prevent restenosis
US6958147B1 (en) 1998-10-26 2005-10-25 Licentia Ltd Use of VEGF-C to prevent restenosis
US6783953B1 (en) 1998-12-22 2004-08-31 Janssen Pharmaceutica N.V. Vascular endothelial growth factor-X
US7179890B2 (en) 1998-12-22 2007-02-20 Janssen Pharmaceutica.N.V. Vascular endothelial growth factor-x
US7524501B2 (en) 1999-02-08 2009-04-28 Human Genome Sciences, Inc. Methods of treating an injury to, or disorder of, the eye involving photoreceptor proliferation by administering VEGF2 antibodies
US7223724B1 (en) 1999-02-08 2007-05-29 Human Genome Sciences, Inc. Use of vascular endothelial growth factor to treat photoreceptor cells
EP2357192A1 (en) 1999-02-26 2011-08-17 Human Genome Sciences, Inc. Human endokine alpha and methods of use
US7829536B2 (en) 1999-03-26 2010-11-09 Vegenics Limited Method of treating lymphedema comprising administering VEGF-D
US8357669B2 (en) 1999-03-26 2013-01-22 Vegenics Pty Limited Method of treatment for lymphedema comprising administering a polynucleotide encoding VEGF-D
EP2206720A1 (en) 2000-04-12 2010-07-14 Human Genome Sciences, Inc. Albumin fusion proteins
EP2236152A1 (en) 2000-04-12 2010-10-06 Human Genome Sciences, Inc. Albumin fusion proteins
EP2295456A1 (en) 2000-04-12 2011-03-16 Human Genome Sciences, Inc. Albumin fusion proteins
EP2357008A1 (en) 2000-04-12 2011-08-17 Human Genome Sciences, Inc. Albumin fusion proteins
EP2213743A1 (en) 2000-04-12 2010-08-04 Human Genome Sciences, Inc. Albumin fusion proteins
EP2216409A1 (en) 2000-04-12 2010-08-11 Human Genome Sciences, Inc. Albumin fusion proteins
EP2275557A1 (en) 2000-04-12 2011-01-19 Human Genome Sciences, Inc. Albumin fusion proteins
EP2267026A1 (en) 2000-04-12 2010-12-29 Human Genome Sciences, Inc. Albumin fusion proteins
EP2298355A2 (en) 2000-04-12 2011-03-23 Human Genome Sciences, Inc. Albumin fusion proteins
EP2311872A1 (en) 2000-04-12 2011-04-20 Human Genome Sciences, Inc. Albumin fusion proteins
WO2002011769A1 (en) * 2000-08-04 2002-02-14 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US7273751B2 (en) 2000-08-04 2007-09-25 Human Genome Science, Inc. Vascular endothelial growth factor-2
US7560440B2 (en) 2000-12-07 2009-07-14 Sangamo Bioschiences, Inc. Regulation of angiogenesis with zinc finger proteins
US8071564B2 (en) 2000-12-07 2011-12-06 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US7067317B2 (en) 2000-12-07 2006-06-27 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US7605140B2 (en) 2000-12-07 2009-10-20 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US7026462B2 (en) 2000-12-07 2006-04-11 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US8940695B2 (en) 2001-01-19 2015-01-27 Vegenics Pty Limited Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US9260526B2 (en) 2001-01-19 2016-02-16 Vegenics Pty Limited Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US7402312B2 (en) 2001-04-13 2008-07-22 Human Genome Sciences, Inc. Antibodies to vascular endothelial growth factor 2 (VEGF-2)
US8206708B2 (en) 2001-04-13 2012-06-26 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US8216569B2 (en) 2001-04-13 2012-07-10 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US7850963B2 (en) 2001-04-13 2010-12-14 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US7208582B2 (en) 2001-04-13 2007-04-24 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US9403905B2 (en) 2001-04-13 2016-08-02 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US8784809B2 (en) 2001-04-13 2014-07-22 Human Genome Sciences, Inc. Vascular endothelial growth factor 2
US7217570B2 (en) 2001-08-23 2007-05-15 The Wistar Institute Of Anatomy And Biology Organotypic intestinal culture and methods of use thereof
EP2277910A1 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Albumin fusion proteins
EP2990417A1 (en) 2001-12-21 2016-03-02 Human Genome Sciences, Inc. Albumin insulin fusion protein
EP1997829A1 (en) 2001-12-21 2008-12-03 Human Genome Sciences, Inc. Albumin fusion proteins
EP2277889A2 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Fusion proteins of albumin and interferon beta
EP2277888A2 (en) 2001-12-21 2011-01-26 Human Genome Sciences, Inc. Fusion proteins of albumin and erythropoietin
EP2261250A1 (en) 2001-12-21 2010-12-15 Human Genome Sciences, Inc. Albumin fusion proteins
US7750125B2 (en) 2002-06-10 2010-07-06 University Of Rochester Antibodies that bind to the C35 polypeptide
US7563882B2 (en) 2002-06-10 2009-07-21 University Of Rochester Polynucleotides encoding antibodies that bind to the C35 polypeptide
US7879990B2 (en) 2002-06-10 2011-02-01 University Of Rochester Polynucleotides encoding antibodies that bind to the C35 polypeptide
US7968688B2 (en) 2002-06-10 2011-06-28 University Of Rochester Antibodies that bind to the C35 polypeptide
US7795209B2 (en) 2005-02-28 2010-09-14 Sangamo Biosciences, Inc. Anti-angiogenic methods and compositions
US7732196B2 (en) 2005-02-28 2010-06-08 Sangamo Biosciences, Inc. Anti-angiogenic methods and compositions
US7893022B2 (en) 2005-02-28 2011-02-22 Sangamo Biosciences, Inc. Anti-angiogenic methods and compositions
EP2314614A1 (en) 2005-02-28 2011-04-27 Sangamo BioSciences, Inc. Anti-angiogenic methods and compositions
US8012946B1 (en) 2005-02-28 2011-09-06 Sangamo Biosciences, Inc. Anti-angiogenic methods and compositions
US7358085B2 (en) 2005-02-28 2008-04-15 Sangamo Biosciences, Inc. Anti-angiogenic methods and compositions
WO2009082485A1 (en) 2007-12-26 2009-07-02 Vaccinex, Inc. Anti-c35 antibody combination therapies and methods
US9745558B2 (en) 2013-02-18 2017-08-29 Vegenics Pty Limited VEGFR-3 ligand binding molecules and uses thereof
US10494617B2 (en) 2013-02-18 2019-12-03 Vegenics Pty Limited Ligand binding molecules and uses thereof
US11866739B2 (en) 2013-02-18 2024-01-09 Vegenics Pty Limited Ligand binding molecules and uses thereof

Also Published As

Publication number Publication date
KR100511692B1 (ko) 2005-12-27
EP0837934B1 (en) 2006-12-06
US6608182B1 (en) 2003-08-19
AU714484B2 (en) 2000-01-06
DE69636752T2 (de) 2007-10-11
DE69636752D1 (de) 2007-01-18
US20100143360A1 (en) 2010-06-10
KR19990022522A (ko) 1999-03-25
CN1552855A (zh) 2004-12-08
ATE347595T1 (de) 2006-12-15
JP2000069982A (ja) 2000-03-07
AU6046796A (en) 1996-12-24
MX9709243A (es) 1998-03-31
JPH11513883A (ja) 1999-11-30
CA2224093A1 (en) 1996-12-12
EP0837934A4 (en) 2000-11-02
JP2007244388A (ja) 2007-09-27
EP0837934A1 (en) 1998-04-29
US7115392B2 (en) 2006-10-03
CA2224093C (en) 2003-03-25
US20020120123A1 (en) 2002-08-29
CN1186518A (zh) 1998-07-01

Similar Documents

Publication Publication Date Title
WO1996039515A1 (en) Human vascular endothelial growth factor 2
WO1996039515A9 (en) Human vascular endothelial growth factor 2
AU696764C (en) Vascular endothelial growth factor 2
WO1996039486A1 (en) Human ccn-like growth factor
EP0871672A1 (en) Human chemokine beta-8, chemokine beta-1 and macrophage inflammatory protein-4
EP0822984A1 (en) Human tumor necrosis factor receptors
EP0750628A1 (en) Fibroblast growth factor-10
EP0815137A1 (en) Human g-protein chemokine receptor hdgnr10
WO1996028546A1 (en) Human tumor necrosis factor receptor
EP0804562A1 (en) Connective tissue growth factor-2
EP0799311A1 (en) Human chemokine beta-9
WO1997034998A1 (en) Human cytokine polypeptide
US7576189B2 (en) Antibodies to human vascular endothelial growth factor 2 and methods of using the same
WO1996039507A1 (en) Fibroblast growth factor 11
EP0759980A1 (en) Interleukin-6 splice variant
EP0796325A1 (en) Human vascular ibp-like growth factor
EP0835264A1 (en) Human g-protein receptor hcegh45
WO1996039497A1 (en) Transforming growth factor alpha hi
WO1997017358A1 (en) Mammary transforming protein
WO1997032993A1 (en) Chemotactic cytokine iii
WO1997035870A1 (en) Growth factor htter36
WO1997027747A1 (en) Cytostatin i
EP0819168A1 (en) Human tumor necrosis factor receptor
AU2005200574A1 (en) Human Vascular Endothelial Factor 2
AU1951100A (en) Human vascular endothelial growth factor 2

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 96194405.6

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AL AU BG BR BY CA CN CZ EE FI GE IL JP KG KP KR KZ LT LV MD MN MX NO NZ PL RO RU SG SI SK TJ TM TR UA US UZ VN

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

COP Corrected version of pamphlet

Free format text: PAGES 1/11-11/11,DRAWINGS,REPLACED BY NEW PAGES 1/12-12/12;AFTER RECTIFICATION OF OBVIOUS ERRORS AS AUTHORIZED BY THE INTERNATIONAL SEARCHING AUTHORITY

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 1997 501427

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: PA/a/1997/009243

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 1019970709003

Country of ref document: KR

ENP Entry into the national phase

Ref document number: 2224093

Country of ref document: CA

Ref document number: 2224093

Country of ref document: CA

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1996918130

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1996918130

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1019970709003

Country of ref document: KR

WWR Wipo information: refused in national office

Ref document number: 1019970709003

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: 1996918130

Country of ref document: EP