WO1996028546A1 - Human tumor necrosis factor receptor - Google Patents

Human tumor necrosis factor receptor Download PDF

Info

Publication number
WO1996028546A1
WO1996028546A1 PCT/US1995/003216 US9503216W WO9628546A1 WO 1996028546 A1 WO1996028546 A1 WO 1996028546A1 US 9503216 W US9503216 W US 9503216W WO 9628546 A1 WO9628546 A1 WO 9628546A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
receptor
polynucleotide
tnf
dna
Prior art date
Application number
PCT/US1995/003216
Other languages
French (fr)
Inventor
John M. Greene
Robert D. Fleischmann
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to AU21599/95A priority Critical patent/AU2159995A/en
Priority to EP95914722A priority patent/EP0819168A4/en
Priority to JP8527539A priority patent/JPH11503007A/en
Priority to PCT/US1995/003216 priority patent/WO1996028546A1/en
Priority to ZA952587A priority patent/ZA952587B/en
Priority to US08/469,637 priority patent/US7094564B1/en
Priority to US08/718,737 priority patent/US8110659B1/en
Publication of WO1996028546A1 publication Critical patent/WO1996028546A1/en
Priority to CA002211003A priority patent/CA2211003A1/en
Priority to US09/526,437 priority patent/US7078493B1/en
Priority to JP2002066838A priority patent/JP2002320479A/en
Priority to US10/155,167 priority patent/US20030166097A1/en
Priority to US10/164,592 priority patent/US20020150989A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7151—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for tumor necrosis factor [TNF], for lymphotoxin [LT]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This invention relates to newly identified polynucleotides, polypeptide ⁇ encoded by such polynucleotides, the use of such polynucleotides and polypeptide ⁇ , as well as the production of such polynucleotides and polypeptide ⁇ .
  • the polypeptide of the present invention has been putatively identified as a Tumor Necrosis Factor receptor, and more particularly as a type 2 Tumor Necrosis Factor Receptor.
  • the polypeptide of the present ivention will hereinafter be referred to as "TNF receptor" .
  • the invention also relates to inhibiting the receptor.
  • TNF- ⁇ and ⁇ are related members of a broad class of polypeptide mediators, which includes the interferons, interleukin ⁇ and growth factors, collectively called cytokines (Beutler, B. and Cerami, A., Annu. Rev. Immunol., 7:625-655 (1989)).
  • Tumor necrosis factor (TNF- ⁇ and TNF-/3) was originally discovered as a result of its anti-tumor activity, however, now it is recognized as a pleiotropic cytokine playing important roles in a host of biological processes and pathologies.
  • TNF- ⁇ Tumor necrosis factor
  • TNF-/3 lymphotoxin- ⁇
  • LT-/3 ligands for the Fas receptor
  • CD30, CD27, CD40 and 4-1BB receptors have conserved C-terminal sequences and variable N-terminal sequence ⁇ which are often used as membrane anchors, with the exception of TNF-S.
  • TNF is produced by a number of cell types, including monocytes, fibroblast ⁇ , T cell ⁇ , natural killer (NK) cells and predominately by activated machrophage ⁇ .
  • TNF- ⁇ ha ⁇ been reported to have a role in the rapid necrosis of tumors, immunostimulation, autoimmune disease, graft rejection, producing an anti-viral response, septic shock, cerebral malaria, cytotoxicity, protection against deleterious effects of ionizing radiation produced during a course of chemotherapy, such as denaturation of enzymes, lipid peroxidation and DNA damage (Nata et al, J. Immunol. 136(7):2483 (1987)), growth regulation, vascular endothelium effects ' and metabolic effects.
  • TNF- ⁇ al ⁇ o triggers endothelial cells to secrete various factors, including PAI- 1, IL-1, GM-CSF and IL-6 to promote cell proliferation.
  • TNF- ⁇ up-regulates various cell adhesion molecules such as E-Selectin, ICAM-1 and VCAM-1.
  • TNF- ⁇ and the Fas ligand have also been shown to induce programmed cell death.
  • lymphotoxin al ⁇ o referred to as TNF-3
  • TNF-3 lymphotoxin
  • TNF-3 lymphotoxin
  • LT- ⁇ ha ⁇ many activitie ⁇ , including tumor necrosis, induction of an antiviral state, activation of polymorphonuclear leukocyte ⁇ , induction of cla ⁇ I major histocompatibility complex antigens on endothelial cells, induction of adhesion molecules on endothelium and growth hormone stimulation (Ruddle, N. and Homer, R. , Prog. Allergy, 40:162-182 (1988)).
  • TNF-R1 The first step in the induction of the various cellular responses mediated by TNF or LT is their binding to specific cell surface or soluble receptors.
  • TNF-R2 Two distinct TNF receptors of approximately 55-KDa (TNF-R1) and 75-KDa (TNF- R2) have been identified (Hohman, H.P. et al., J. Biol. Chem., 264:14927-14934 (1989)), and human and mouse cDNAs corresponding to both receptor types have been isolated and characterized (Loetscher, H. et al., Cell, 61:351 (1990)). Both TNF-R ⁇ share- the typical structure of cell surface receptors including extracellular, transmembrane and intracellular region ⁇ .
  • TNF-R1 and TNF-R2 share 28% identity and are characterized by four repeated cysteine-rich motifs with significant intersubunit sequence homology.
  • the majority of cell types and ti ⁇ ue ⁇ appear to expre ⁇ both TNF receptor ⁇ and both receptors are active in signal transduction, however, they are able to mediate distinct cellular responses.
  • TNF-R2 was shown to exclusively mediate human T cell proliferation by TNF as shown in PCT WO 94/09137.
  • TNF-R1 dependent response ⁇ include accumulation of C- FOS, IL-6, and mangane ⁇ e ⁇ uperoxide di ⁇ muta ⁇ e mRNA, pro ⁇ taglandin E2 synthe ⁇ i ⁇ , IL-2 receptor and MHC class I and II cell surface antigen expression, growth inhibition, and cytotoxicity.
  • TNF-R1 also triggers second messenger systems such as phospholipase A 2 , protein kinase C, pho ⁇ phatidylcholine- ⁇ pecific phospholipa ⁇ e C and sphingomyelina ⁇ e (Pfefferk et al . , Cell, 73:457-467 (1993)).
  • the receptor polypeptide of the present invention binds TNF, and in particular, TNF-jS. Further, the TNF receptor may also bind other ligands, including but not limited to Nerve Growth Factor, due to homology to a family of receptors and antigens which are involved in other critical biological processes.
  • This family shows highly conserved cysteine re ⁇ idue ⁇ and include ⁇ the low affinity NGF receptor, which plays an important role in the regulation of growth and differentiation of nerve cell ⁇ , the Fas receptor also called APO, a receptor which is involved is signalling for apoptosis and which, based on a study with mice deficient in its function, seems to play an important role in the etiology of a lupus-like disease, the TNF-R1, the B cell antigen CD40, and the T cell activation antigen CD27.
  • a novel mature polypeptide which is a putative TNF receptor, as well as fragments, analogs and derivatives thereof.
  • the polypeptide of the pre ⁇ ent invention i ⁇ of human origin.
  • nucleic acid molecules encoding the polypeptide of the present invention, including RNAs, DNAs, cDNAs, genomic DNA a ⁇ well as antisense analogs thereof and biologically active and diagnostically or therapeutically u ⁇ eful fragments thereof.
  • a process for producing such polypeptide ⁇ by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention, under conditions promoting expression of said protein and subsequent recovery of said protein.
  • a proce ⁇ for utilizing such polypeptide, or polynucleotide encoding such polypeptide to screen for receptor antagonists and/or agonists and/or receptor ligands.
  • nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the polypeptide of the present invention.
  • a process of using such agonists for treating conditions related to insufficient TNF receptor activity for example, to inhibit tumor growth, to stimulate human cellular proliferation, e.g., T-cell proliferation, to regulate the immune response and antiviral responses, to protect against the effects of ionizing radiation, to protect against chlamidiae infection, to regulate growth and to treat immunodeficiencies such as i ⁇ found in HIV.
  • a process of using such antagonists for treating conditions a ⁇ ociated with over- expression of the TNF receptor for example, for treating T- cell mediated autoimmune diseases such as AIDS, septic shock, cerebral malaria, graft rejection, cytotoxicity, cachexia, apoptosis and inflammation.
  • T- cell mediated autoimmune diseases such as AIDS, septic shock, cerebral malaria, graft rejection, cytotoxicity, cachexia, apoptosis and inflammation.
  • Figure 1 ⁇ how ⁇ the cDNA ⁇ equence and corre ⁇ ponding deduced amino acid ⁇ equence of the polypeptide of the pre ⁇ ent invention.
  • the initial 21 amino acids represent the putative leader ⁇ equence and are underlined.
  • the ⁇ tandard one-letter abbreviations for amino acids are used.
  • Sequencing was performed u ⁇ ing a 373 automated DNA ⁇ equencer (Applied Biosystems, Inc.). Sequencing accuracy is predicted to be greater than 97% accurate.
  • Figure 2 illustrates an amino acid sequence alignment of the polypeptide of the present invention (upper line) and the human type 2 TNF receptor (lower line).
  • gene or "cistron” means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequence ⁇ (introns) between individual coding segments (exons) .
  • an i ⁇ olated nucleic acid (polynucleotide) which encode ⁇ for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75899 on September 28, 1994.
  • a polynucleotide encoding a polypeptide of the present invention may be obtained from human pulmonary tissue, hippocampus and adult heart.
  • the polynucleotide of this invention was discovered in a cDNA library derived from human early passage fibroblasts (HSA 172 cell ⁇ ). It i ⁇ structurally related to the human TNF-R2 receptor. It contains an open reading frame encoding a protein of 390 amino acid residues of which approximately the first 21 amino acids residues are the putative leader ⁇ equence such that the mature protein comprises 369 amino acid ⁇ .
  • the protein exhibits the highest degree of homology to a human type 2 TNF receptor with 39% identity and 46% similarity over an 88 amino acid stretch.
  • Six conserved cyteine ⁇ present in modules of 40 residues in all TNF receptors are con ⁇ erved in this receptor.
  • the TNF receptor of the present invention is a ⁇ oluble receptor and i ⁇ secreted, however, it may also exist as a membrane bound receptor having a transmembrane region and an intra- and extracellular region.
  • the polypeptide of the pre ⁇ ent invention may bind TNF and lymphotoxin ligand ⁇ .
  • a polynucleotide which may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID No. 1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID No. 1) or the deposited cDNA.
  • the polynucleotide which encode ⁇ for the mature polypeptide of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the depo ⁇ ited cDNA may include: only the coding ⁇ equence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence ⁇ uch as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding ⁇ equence) and non-coding ⁇ equence, such as introns or non-coding sequence 5' and/or 3' of the coding ⁇ equence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well a ⁇ a polynucleotide which include ⁇ additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove de ⁇ cribed polynucleotide ⁇ which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non- naturally occurring variant of the polynucleotide.
  • the pre ⁇ ent invention include ⁇ polynucleotide ⁇ encoding the same mature polypeptide a ⁇ ⁇ hown in Figure 1 (SEQ ID No. 2) or the same mature polypeptide encoded by the cDNA of the deposited clone a ⁇ well a ⁇ variant ⁇ of such polynucleotide ⁇ which variant ⁇ encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone.
  • nucleotide variant ⁇ include deletion variant ⁇ , substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding ⁇ equence shown in Figure 1 (SEQ ID No. 1) or of the coding sequence of the deposited clone.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotide ⁇ , which doe ⁇ not ⁇ ub ⁇ tantially alter the function of the encoded polypeptide.
  • the present invention also includes polynucleotide ⁇ , wherein the coding ⁇ equence for the mature polypeptide may be fu ⁇ ed in the ⁇ ame reading frame to a polynucleotide sequence which aids in expres ⁇ ion and ⁇ ecretion of a polypeptide from a ho ⁇ t cell, for example, a leader ⁇ equence which function ⁇ a ⁇ a ⁇ ecretory ⁇ equence for controlling tran ⁇ port of a polypeptide from the cell.
  • the polypeptide having a leader sequence i ⁇ a preprotein may have the leader sequence cleaved by the ho ⁇ t cell to form the mature form of the polypeptide.
  • the polynucleotide ⁇ may al ⁇ o encode for a proprotein which i ⁇ the mature protein plus additional 5' amino acid residue ⁇ .
  • a mature protein having a pro ⁇ equence is a proprotein and is an inactive form of the protein. Once the prosequence i ⁇ cleaved an active mature protein remains. Thu ⁇ , for example, the polynucleotide of the pre ⁇ ent invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).
  • the polynucleotide ⁇ of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the pre ⁇ ent invention.
  • the marker sequence may be a hexa- hi ⁇ tidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial ho ⁇ t, or, for example, the marker ⁇ equence may be a hemagglutinin (HA) tag when a mammalian ho ⁇ t, e.g. COS-7 cell ⁇ , i ⁇ u ⁇ ed.
  • HA hemagglutinin
  • the HA tag corre ⁇ ponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al.. Cell, 37:767 (1984)).
  • the coding sequence may also be fused to a sequence which codes for a fu ⁇ ion protein ⁇ uch a ⁇ an IgG Fc fu ⁇ ion protein.
  • the pre ⁇ ent invention further relate ⁇ to polynucleotides which hybridize to the hereinabove-described sequence ⁇ if there i ⁇ at lea ⁇ t 50% and preferably 70% identity between the ⁇ equences.
  • the present invention particularly relate ⁇ to polynucleotide ⁇ which hybridize under ⁇ tringent condition ⁇ to the hereinabove-de ⁇ cribed polynucleotide ⁇ .
  • stringent conditions means hybridization will occur only if there i ⁇ at lea ⁇ t 95% and preferably at lea ⁇ t 97% identity between the ⁇ equences.
  • polypeptide ⁇ which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptide ⁇ which retain ⁇ ub ⁇ tantially the ⁇ a e biological function or activity a ⁇ the mature polypeptide encoded by the cDNA of Figure 1 (SEQ ID No. 1) or the deposited cDNA.
  • the deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organi ⁇ m ⁇ for purposes of Patent Procedure. These deposits are provided merely a ⁇ convenience to tho ⁇ e of ⁇ kill in the art and are not an admission that a deposit i ⁇ required under 35 U.S.C. ⁇ 112.
  • the ⁇ equence of the polynucleotide ⁇ contained in the depo ⁇ ited materials, as well as the amino acid sequence of the polypeptide ⁇ encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any de ⁇ cription of sequences herein.
  • a license may be required to make, use or sell the deposited materials, and no such license i ⁇ hereby granted.
  • the present invention further relates to a polypeptide which ha ⁇ the deduced amino acid ⁇ equence of Figure 1 (SEQ ID No. 2) or which ha ⁇ the amino acid ⁇ equence encoded by the depo ⁇ ited cDNA, a ⁇ well a ⁇ fragment ⁇ , analogs and derivatives of such polypeptide.
  • fragment when referring to the polypeptide of Figure 1 (SEQ ID No. 2) or that en ⁇ oded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as ⁇ uch polypeptide.
  • an analog include ⁇ a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or that encoded by the depo ⁇ ited cDNA may be (i) one in which one or more of the amino acid residues are ⁇ ub ⁇ tituted with a con ⁇ erved or non-conserved amino acid residue (preferably a con ⁇ erved amino acid re ⁇ idue) and ⁇ uch ⁇ ub ⁇ tituted amino acid re ⁇ idue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such a ⁇ a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as an IbG Fc fusion region peptide or leader or secretory sequence or a sequence which is
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material i ⁇ removed from its original environment (e.g., the natural environment if it is naturally occurring) .
  • a naturally- occurring polynucleotide or polypeptide present in a living animal is not i ⁇ olated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, i ⁇ isolated.
  • Such polynucleotide ⁇ could be part of a vector and/or ⁇ uch polynucleotide ⁇ or polypeptides could be part of a composition, and ⁇ till be i ⁇ olated in that ⁇ uch vector or compo ⁇ ition i ⁇ not part of it ⁇ natural environment.
  • the present invention al ⁇ o relate ⁇ to vector ⁇ which include polynucleotide ⁇ of the pre ⁇ ent invention, ho ⁇ t cell ⁇ which are genetically engineered with vector ⁇ of the invention and the production of polypeptide ⁇ of the invention by recombinant techniques.
  • Ho ⁇ t cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expre ⁇ ion vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media modified a ⁇ appropriate for activating promoter ⁇ , selecting transformant ⁇ or amplifying the nucleic acid sequences of the present invention.
  • the culture conditions, ⁇ uch a ⁇ temperature, pH and the like, are tho ⁇ e previou ⁇ ly u ⁇ ed with the ho ⁇ t cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotide ⁇ of the pre ⁇ ent invention may be employed for producing polypeptide ⁇ by recombinant technique ⁇ .
  • the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and ⁇ ynthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vector ⁇ derived from combinations of plasmid ⁇ and phage DNA, viral DNA such a ⁇ vaccinia, adenovirus, fowl pox virus, and pseudorabie ⁇ .
  • any other vector may be u ⁇ ed a ⁇ long a ⁇ it i ⁇ replicable and viable in the ho ⁇ t.
  • the appropriate DNA ⁇ equence may be in ⁇ erted into the vector by a variety of procedure ⁇ .
  • procedure ⁇ the DNA sequence i ⁇ inserted into an appropriate restriction endonuclease ⁇ ite( ⁇ ) by procedure ⁇ known in the art.
  • procedure ⁇ and other ⁇ are deemed to be within the ⁇ cope of those skilled in the art.
  • the DNA sequence in the expres ⁇ ion vector i ⁇ operatively linked to an appropriate expre ⁇ ion control sequence(s) (promoter) to direct mRNA ⁇ ynthesi ⁇ .
  • promoters there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda P L promoter and other promoter ⁇ known to control expres ⁇ ion of genes in prokaryotic or eukaryotic cells or their viru ⁇ e ⁇ .
  • the expres ⁇ ion vector al ⁇ o contain ⁇ a ribo ⁇ ome binding ⁇ ite for tran ⁇ lation initiation and a transcription terminator.
  • the vector may al ⁇ o include appropriate sequences for amplifying expres ⁇ ion.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resi ⁇ tance for eukaryotic cell culture, or such a ⁇ tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate DNA sequence a ⁇ hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate ho ⁇ t to permit the ho ⁇ t to expre ⁇ s the protein.
  • bacterial cell ⁇ ⁇ uch a ⁇ E. coli. Streptomyce ⁇ . Salmonella typhimurium; fungal cell ⁇ , ⁇ uch a ⁇ yeast; insect cells ⁇ uch a ⁇ Drosophila S2 and Spodoptera Sf9; animal cell ⁇ such as CHO, COS or Bowes melanoma; adenoviru ⁇ e ⁇ ; plant cells, etc.
  • bacterial cell ⁇ ⁇ uch a ⁇ E. coli. Streptomyce ⁇ . Salmonella typhimurium
  • fungal cell ⁇ ⁇ uch a ⁇ yeast
  • insect cells ⁇ uch a ⁇ Drosophila S2 and Spodoptera Sf9
  • animal cell ⁇ such as CHO, COS or Bowes melanoma
  • adenoviru ⁇ e ⁇ plant cells, etc.
  • the present invention al ⁇ o include ⁇ recombinant constructs comprising one or more of the sequences as broadly described above.
  • the construct ⁇ compri ⁇ e a vector, ⁇ uch a ⁇ a plasmid or viral vector, into which a ⁇ equence of the invention has been inserted, in a forward or reverse orientation.
  • the con ⁇ truct further compri ⁇ e ⁇ regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • suitable vector ⁇ and promoter ⁇ are known to those of ⁇ kill in the art, and are commercially available. The following vectors are provided by way of example.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, p ⁇ iX174, pblue ⁇ cript SK, pb ⁇ k ⁇ , pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia).
  • Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia).
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are pKK232-8 and pCM7.
  • Particular named bacterial promoter ⁇ include lad, lacZ, T3, T7, gpt, lambda P R P L and trp.
  • Eukaryotic promoter ⁇ include CMV immediate early, HSV thymidine kinase, early and late SV40, LTR ⁇ from retroviru ⁇ , and mouse metallothionein-I. Selection of the appropriate vector and promoter i ⁇ well within the level of ordinary ⁇ kill in the art.
  • the pre ⁇ ent invention relate ⁇ to ho ⁇ t cell ⁇ containing the above-de ⁇ cribed con ⁇ truct ⁇ .
  • the ho ⁇ t cell can be a higher eukaryotic cell, ⁇ uch a ⁇ a mammalian cell, or a lower eukaryotic cell, ⁇ uch a ⁇ a yea ⁇ t cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran-mediated transfection, or electroporation (Davis, L., Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986)) .
  • the construct ⁇ in ho ⁇ t cell ⁇ can be u ⁇ ed in a conventional manner to produce the gene product encoded by the recombinant ⁇ equence.
  • the polypeptide ⁇ of the invention can be ⁇ ynthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expre ⁇ ed in mammalian cell ⁇ , yea ⁇ t, bacteria, or other cell ⁇ under the control of appropriate promoter ⁇ .
  • Cell-free tran ⁇ lation ⁇ ystem ⁇ can also be employed to produce such proteins using RNAs derived from the DNA con ⁇ truct ⁇ of the pre ⁇ ent invention.
  • Appropriate cloning and expre ⁇ ion vector ⁇ for u ⁇ e with prokaryotic and eukaryotic ho ⁇ t ⁇ are de ⁇ cribed by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
  • Enhancers are cis-acting element ⁇ of DNA, u ⁇ ually about from 10 to 300 bp that act on a promoter to increase its tran ⁇ cription.
  • Example ⁇ including the SV40 enhancer on the late ⁇ ide of the replication origin bp 100 to 270, a cyto episcopoviru ⁇ early promoter enhancer, the polyoma enhancer on the late ⁇ ide of the replication origin, and adenoviru ⁇ enhancer ⁇ .
  • recombinant expre ⁇ sion vectors will include origin ⁇ of replication and selectable markers permitting tran ⁇ formation of the ho ⁇ t cell, e.g., the ampicillin re ⁇ istance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes ⁇ uch a ⁇ 3-pho ⁇ phoglycerate kinase (PGK), ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is as ⁇ embled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
  • the heterologous ⁇ equence can encode a fu ⁇ ion protein including an N-terminal identification peptide imparting desired characteristic ⁇ , e.g., ⁇ tabilization or simplified purification of expres ⁇ ed recombinant product.
  • U ⁇ eful expression vector ⁇ for bacterial use are constructed by inserting a structural DNA sequence encoding a de ⁇ ired protein together with ⁇ uitable tran ⁇ lation initiation and termination ⁇ ignal ⁇ in operable reading pha ⁇ e with a functional promoter.
  • the vector will compri ⁇ e one or more phenotypic ⁇ electable marker ⁇ and an origin of replication to ensure maintenance of the vector " and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic ho ⁇ t ⁇ for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various ⁇ pecie ⁇ within the genera Pseudomonas, Streptomyce ⁇ , and Staphylococcu ⁇ , although other ⁇ may al ⁇ o be employed a ⁇ a matter of choice.
  • u ⁇ eful expre ⁇ sion vectors for bacterial u ⁇ e can compri ⁇ e a ⁇ electable marker and bacterial origin of replication derived from commercially available pla ⁇ mid ⁇ compri ⁇ ing genetic element ⁇ of the well known cloning vector pBR322 (ATCC 37017).
  • Such commercial vector ⁇ include, for example, pKK223-3 (Pharmacia Fine Chemical ⁇ , Upp ⁇ ala, Sweden) and GEM1 (Promega Biotec, Madi ⁇ on, WI, USA).
  • the ⁇ e pBR322 "backbone" ⁇ ection ⁇ are combined with an appropriate promoter and the structural sequence to be expressed.
  • the ⁇ elected promoter i ⁇ induced by appropriate mean ⁇ e.g., temperature ⁇ hift or chemical induction
  • cell ⁇ are cultured for an additional period.
  • Cell ⁇ are typically harvested by centrifugation, disrupted by phy ⁇ ical or chemical mean ⁇ , and the resulting crude extract retained for further purification.
  • Microbial cell ⁇ employed in expre ⁇ ion of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or u ⁇ e of cell ly ⁇ ing agent ⁇ , ⁇ uch method ⁇ are well know to tho ⁇ e skilled in the art.
  • mammalian cell culture systems can also be employed to expres ⁇ recombinant protein.
  • mammalian expre ⁇ sion systems include the COS-7 lines of monkey kidney fibroblast ⁇ , de ⁇ cribed by Gluzman, Cell, 23:175 (1981), and other cell line ⁇ capable of expre ⁇ ing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell line ⁇ .
  • Mammalian expre ⁇ ion vector ⁇ will compri ⁇ e an origin of replication, a suitable promoter and enhancer, and also any neces ⁇ ary ribo ⁇ ome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed ⁇ equence ⁇ .
  • DNA ⁇ equence ⁇ derived from the SV40 ⁇ plice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • polypeptide of the present invention can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, a ⁇ nece ⁇ ary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification ⁇ tep ⁇ . *
  • polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic ho ⁇ t (for example, by bacterial, yeast, higher plant, in ⁇ ect and mammalian cell ⁇ in culture).
  • a prokaryotic or eukaryotic ho ⁇ t for example, by bacterial, yeast, higher plant, in ⁇ ect and mammalian cell ⁇ in culture.
  • the polypeptides of the pre ⁇ ent invention may be glyco ⁇ ylated or may be non-glyco ⁇ ylated.
  • Polypeptide ⁇ of the invention may al ⁇ o include an initial methionine amino acid re ⁇ idue.
  • the TNF receptor of the present invention was assayed for the ability to bind TNF- ⁇ and TNF-3, however, the pre ⁇ ent invention al ⁇ o contemplates the ability of the receptor to bind other TNF-like proteins.
  • Monoclonal antibodies specific to TNF- ⁇ and TNF-3 were prepared. These monoclonal antibodies were bound to TNF- ⁇ and TNF-3 and a control ELISA assay was performed to quantify the amount of monoclonal antibody present.
  • the TNF receptor was then bound to TNF- ⁇ and TNF-3 in the same way in which the monoclonal antibody was bound and another ELISA assay was performed.
  • the TNF receptor was found to bind to TNF - ⁇ just as strongly a ⁇ the monoclonal antibody, while it only bound TNF- ⁇ two-third ⁇ as strongly.
  • Fragments of the full length polynucleotide seqeunces of the pre ⁇ ent invention may be u ⁇ ed a ⁇ a hybridization probe for a cDNA library to isolate other genes which have a high sequence similarity to the polynucleotide sequence of the present invention or similar biological activity.
  • Probes of thi ⁇ type generally have at least 50 bases, although they may have a greater number of base ⁇ .
  • the probe may al ⁇ o be u ⁇ ed a ⁇ marker ⁇ to identify a cDNA clone corre ⁇ ponding to a full length transcript and a genomic clone or clones that contain the complete polynucleotide sequence of the present invention including regulatory and promotor regions, exons, and intron ⁇ /
  • Labeled oligonucleotide ⁇ having a ⁇ equence complementary to that of the gene of the pre ⁇ ent invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
  • This invention also provides a method of screening compounds to identify compounds which interact with the polypeptide of the pre ⁇ ent invention which compri ⁇ e ⁇ contacting a mammalian cell comprising an isolated DNA molecule encoding and expres ⁇ ing a the polypeptide of the present invention with a plurality of compounds, determining those which activate or block the activation of the receptor, and thereby identifying compounds which specifically interact with, and activate or block the activation of the polypeptide of the pre ⁇ ent invention.
  • This invention also contemplates the use of the polynucleotide of the present invention a ⁇ a diagnostic. For example, if a mutation i ⁇ pre ⁇ ent, conditions would result from a lack of TNF receptor activity.
  • Mutated genes can be detected by comparing the sequence of the defective gene with that of a normal one. Sub ⁇ equently one can verify that a mutant gene i ⁇ a ⁇ ociated with a disease condition or the susceptibility to a disea ⁇ e condition. That i ⁇ , a mutant gene which lead ⁇ to the underexpre ⁇ sion of the TNF receptor would be a ⁇ ociated with an inability of TNF to inhibit tumor growth.
  • Nucleic acids used for diagnosi ⁇ may be obtained from a patient's cell ⁇ which include, but are not limited' to, blood, urine, saliva and tissue biopsy.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al . , Nature, 324:163-166.(1986)) prior to analy ⁇ i ⁇ .
  • RNA or cDNA may al ⁇ o be used for the same purpose.
  • PCR primer ⁇ complementary to the nucleic acid of the in ⁇ tant invention can be u ⁇ ed to identify and analyze gene mutation ⁇ .
  • deletion ⁇ and insertions can be detected by a change in the size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA or alternatively, radiolabeled TNF receptor anti ⁇ en ⁇ e DNA sequences. Perfectly matched sequence ⁇ can be di ⁇ tingui ⁇ hed from mi ⁇ matched duplexe ⁇ by RNase A digestion or by differences in melting temperatures. Such a diagnostic would be particularly useful for prenatal or even neonatal testing.
  • Sequence differences between the reference gene and "mutants" may be revealed by the direct DNA sequencing method.
  • cloned DNA segments may be used a ⁇ probe ⁇ to detect specific DNA segment ⁇ .
  • the sen ⁇ itivity of thi ⁇ method is greatly enhanced when combined with PCR.
  • a sequencing primary used with double stranded PCR product or a single stranded template molecule generated by a modified PCR product.
  • the sequence determination i ⁇ performed by conventional procedure ⁇ with radiolabeled nucleotide ⁇ or by automatic ⁇ equencing procedure ⁇ with fluore ⁇ cent tag ⁇ .
  • Sequence changes at the specific locations may be revealed by nuclea ⁇ e protection a ⁇ say ⁇ , ⁇ uch a ⁇ RNa ⁇ e and SI protection or the chemical cleavage method (for example. Cotton et al . , PNAS, 85:4397-4401 (1985)).
  • the present invention further relates to a diagnostic assay which detects an altered level of a soluble form of the polypeptide of the present invention where an elevated level in a sample derived from a host i ⁇ indicative of certain diseases.
  • Assay ⁇ available to detect level ⁇ of ⁇ oluble receptor ⁇ are well known to tho ⁇ e of skill in the art, for example, radioimmunoassays, competitive-binding assay ⁇ .
  • Western blot analy ⁇ i ⁇ , and preferably an ELISA a ⁇ ay may be employed.
  • An ELISA a ⁇ ay initially comprises preparing an antibody specific to an antigen to the polypeptide of the present invention, preferably a monoclonal antibody.
  • a reporter antibody i ⁇ prepared again ⁇ t the monoclonal antibody.
  • a detectable reagent ⁇ uch a ⁇ radioactivity, fluore ⁇ cence or in thi ⁇ example a hor ⁇ eradish peroxidase enzyme.
  • a sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample.
  • any free protein binding ⁇ ite ⁇ on the di ⁇ h are then covered by incubating with a non-specific protein such a ⁇ bovine serum albumen.
  • a non-specific protein such as a ⁇ bovine serum albumen.
  • the monoclonal antibody i ⁇ incubated in the dish during which time the monoclonal antibodies attach to any proteins of the present invention which are attached to the polystyrene di ⁇ h. All unbound monoclonal antibody is washed out with buffer.
  • the reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to the polypeptide of the present invention. Unattached reporter antibody is then washed out.
  • Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of the protein of interest present in a given volume of patient sample when compared against a standard curve.
  • a competition assay may be employed wherein antibodies specific to the polypeptides of the present invention are attached to a solid support. Labeled TNF receptor polypeptides, and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity in the 'sample.
  • the soluble form of the receptor may also be employed to identify agonists and antagonists.
  • a thymocyte proliferation assay may be employed to identify both ligands and potential agonists and antagonists to the polypeptide of the present invention.
  • thymus cells are disaggregated from tissue and grown in culture medium.
  • Incorporation of DNA prescursor ⁇ such as 3 H- thymidine or 5-bromo-2' -deoxyuridine (BrdU) is monitored as a parameter for DNA synthesis and cellular proliferation.
  • Cells which have incorporated BrdU into DNA can be detected using a monoclonal antibody against BrdU and measured by an enzyme or fluorochrome-conjugated second antibody. The reaction is quantitated by fluorimetry or by spectrophotometry. Two control wells and an experimental well are set up.
  • TNF-3 i ⁇ added to all wells, while ⁇ oluble receptor ⁇ of the present invention are added to the experimental well.
  • a compound to be screened is added to the experimental well.
  • the agoni ⁇ t ⁇ the ability of the compound to enhance thi ⁇ interaction i ⁇ quantified.
  • a determination may be made whether a ligand not known to be capable of binding to the polypeptide of the pre ⁇ ent invention can bind thereto comprising contacting a mammalian cell comprising an isolated molecule encoding a polypeptide of the present invention with a ligand under conditions permitting binding of ligands known to bind thereto, detecting the presence of any bound ligand, and thereby determining whether ⁇ uch ligand ⁇ bind to a polypeptide of the pre ⁇ ent invention.
  • a soluble form of the receptor may utilized in the above assay where it is secreted in to the extra-cellular medium and contacted with ligands to determine which will bind to the soluble form of the receptor.
  • agoni ⁇ t and antagoni ⁇ t ⁇ creening procedures involve, providing appropriate cell ⁇ which expre ⁇ the receptor on the surface thereof.
  • a polynucleotide encoding a polypeptide of the present invention i ⁇ employed to tran ⁇ fect cell ⁇ to thereby expre ⁇ the polypeptide.
  • Such tran ⁇ fection may be accompli ⁇ hed by procedure ⁇ as hereinabove described.
  • such assay may be employed for screening for a receptor antagonist by contacting the cells which encode the polypeptide of the present invention with both the receptor ligand and a compound to be ⁇ creened. Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, i.e., inhibits activation of the receptor.
  • the screening may be employed for determining an agonist by contacting such cells with compound ⁇ to be ⁇ creened and determining whether ⁇ uch compound ⁇ generate a ⁇ ignal, i.e., activates the receptor.
  • Other screening techniques include the use of cell ⁇ which expre ⁇ the polypeptide of the present invention (for example, transfected CHO cells) in a sy ⁇ tem which mea ⁇ ure ⁇ extracellular pH change ⁇ cau ⁇ ed by receptor activation, for example, as described in Science, Volume 246, pages 181-296 (1989).
  • potential agonists or antagonists may be contacted with a cell which expres ⁇ e ⁇ the polypeptide of the present invention and a second messenger response, e.g., signal transduction may be measured to determine whether the potential antagonist or agonist i ⁇ effective.
  • a second messenger response e.g., signal transduction
  • Another ⁇ creening technique involve ⁇ expre ⁇ ing the receptor polypeptide wherein it i ⁇ linked to pho ⁇ pholipase C or D.
  • pho ⁇ pholipase C or D As representative examples of such cell ⁇ , there may be mentioned endothelial cell ⁇ , smooth muscle cells, embryonic kidney cells and the like.
  • the screening for an antagonist or agonist may be accomplished a ⁇ hereinabove de ⁇ cribed by detecting activation of the receptor or inhibition of activation of the receptor from the pho ⁇ pholipase second signal.
  • Antibodies may be utilized as both an agonist and antagonist depending on which part of the polypeptide of the present invention the antibody binds to.
  • the antibody in one instance can bind to the active site and block ligand access.
  • monoclonal antibodie ⁇ directed again ⁇ t certain TNF receptor ⁇ can act a ⁇ specific agoni ⁇ t ⁇ when binding to the extra-cellular domain of the receptor.
  • oligonucleotides which bind to the TNF receptor may also act as TNF receptor antagonists.
  • a potential TNF receptor antagonist may be a soluble form of the TNF receptor which contains the complete extra-cellular region of the TNF receptor and which binds to ligands to inhibit their biological activity.
  • Another potential TNF receptor antagonist is an antisense construct prepared using antisense technology. Antisense technology can be used to control gene expre ⁇ ion through triple-helix formation or anti ⁇ en ⁇ e DNA or RNA, both of which method ⁇ are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptides of the present invention, is u ⁇ ed to de ⁇ ign an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in tran ⁇ cription (triple helix -see Lee et al., Nucl. Acids Res., 3:173 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al. , Science, 251: 1360 (1991)), thereby preventing tran ⁇ cription and the production of TNF receptor .
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the TNF receptor polypeptide (antisen ⁇ e - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotide ⁇ a ⁇ Antisense Inhibitors of Gene Expre ⁇ ion, CRC Pre ⁇ , Boca Raton, FL (1988)).
  • the oligonucleotide ⁇ de ⁇ cribed above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of TNF receptor ⁇ .
  • TNF receptor antagoni ⁇ ts al ⁇ o include a ⁇ mall molecule which bind ⁇ to and occupie ⁇ the TNF receptor thereby making the receptor inaccessible to ligands which bind thereto ⁇ uch that normal biological activity i ⁇ prevented.
  • Example ⁇ of ⁇ mall molecule ⁇ include but are not limited to ⁇ mall peptide ⁇ or peptide-like molecule ⁇ .
  • the TNF receptor agonists may be employed to stimulate ligand activities, such as inhibition of tumor growth and necrosis of certain transplantable tumor ⁇ .
  • the agonists may also be employed to ⁇ timulate cellular differentiation, for example, T-cell, fibroblasts and haemopoietic cell differentiation.
  • Agonist ⁇ to the TNF receptor may also augment TNF's role in the ho ⁇ t's defense against microorganisms and prevent related diseases (infections ⁇ uch as that from L. monocytogene ⁇ ) and chlamidiae.
  • the agoni ⁇ t ⁇ may al ⁇ o be employed to protect against the deleterious effects of ionizing radiation produced during a course of radiotherapy, such as denaturation of enzymes, lipid peroxidation, and DNA damage.
  • the agonists may also be employed to mediate an anti ⁇ viral response, to regulate growth, to mediate the immune respon ⁇ e and to treat immunodeficiencies related to disea ⁇ e ⁇ such as HIV.
  • Antagonist ⁇ to the TNF receptor may be employed to treat autoimmune di ⁇ ea ⁇ e ⁇ , for example, graft versus host rejection and allograft rejection, and T-cell mediated autoimmune disea ⁇ e ⁇ ⁇ uch a ⁇ AIDS. It ha ⁇ been ⁇ hown that T-cell proliferation i ⁇ ⁇ timulated via a type 2 TNF receptor. Accordingly, antagonizing the receptor may prevent the proliferation of T-cell ⁇ and treat T-cell mediated autoimmune di ⁇ ea ⁇ e ⁇ .
  • the antagoni ⁇ t ⁇ may al ⁇ o be employed to prevent apopto ⁇ i ⁇ , which i ⁇ the ba ⁇ i ⁇ for disease ⁇ ⁇ uch as viral infection, rheumatoid arthritis, ⁇ y ⁇ temic lupu ⁇ erythematosu ⁇ , insulin-dependent diabetes mellitus, and graft rejection. Similarly, the antagoni ⁇ t ⁇ may be employed to prevent cytotoxicity.
  • the antagoni ⁇ t ⁇ to the TNF receptor may al ⁇ o be employed to treat B cell cancer ⁇ which are ⁇ timulated by TNF.
  • Antagoni ⁇ t ⁇ to the TNF receptor may also be employed to treat and/or prevent septic shock, which remain ⁇ a critical clinical condition.
  • Septic ⁇ hock results from an exaggerated host re ⁇ pon ⁇ e, mediated by protein factors ⁇ uch a ⁇ TNF and IL-1, rather than from a pathogen directly.
  • lipopoly ⁇ accharide ⁇ have been ⁇ hown to elicit the release of TNF leading to a ⁇ trong and transient increase of its serum concentration.
  • TNF causes shock and tissue injury when administered in excessive amounts.
  • antagoni ⁇ t ⁇ to the TNF receptor will block the action ⁇ of TNF and treat/prevent septic shock.
  • the ⁇ e antagoni ⁇ t ⁇ may al ⁇ o be employed to treat eningococcemia in children which correlate ⁇ with high serum level ⁇ of TNF.
  • TNF receptor antagoni ⁇ t ⁇ may al ⁇ o be employed to treat inflammation mediated by ligands to the receptor such as TNF.
  • the soluble TNF receptor and agonist ⁇ and antagoni ⁇ t ⁇ may be employed in combination with a suitable pharmaceutical carrier.
  • a suitable pharmaceutical carrier includes but i ⁇ not limited to saline, .buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • a carrier includes but i ⁇ not limited to saline, .buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the formulation should suit the mode of admini ⁇ tration.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compo ⁇ ition ⁇ of the invention.
  • Associated with ⁇ uch container( ⁇ ) can be a notice in the form pre ⁇ cribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflect ⁇ approval by the agency of manufacture, u ⁇ e or ⁇ ale for human admini ⁇ tration.
  • the ⁇ oluble form of the receptor and agoni ⁇ t ⁇ and antagoni ⁇ t ⁇ of the pre ⁇ ent invention may also be employed in conjunction with other therapeutic compound ⁇ .
  • the pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intrana ⁇ al or intradermal route ⁇ .
  • the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage i ⁇ from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the route ⁇ of administration, symptoms, etc.
  • TNF receptor and agonist ⁇ and antagoni ⁇ t ⁇ which are polypeptides may also be employed in accordance with the present invention by expres ⁇ ion of such polypeptides in vivo , which is often referred to a ⁇ "gene therapy.”
  • cell ⁇ from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo , with the engineered cell ⁇ then being provided to a patient to be treated with the polypeptide.
  • a polynucleotide DNA or RNA
  • cells may be engineered by procedure ⁇ known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
  • cell ⁇ may be engineered in vivo for expre ⁇ ion of a polypeptide in vivo by, for example, procedure ⁇ known in the art.
  • procedure ⁇ known in the art.
  • a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the pre ⁇ ent invention may be admini ⁇ tered to a patient for engineering cells in vivo and expression of the polypeptide in vivo .
  • the expression vehicle for engineering cells may be other than a retroviru ⁇ , for example, an adenoviru ⁇ which may be u ⁇ ed to engineer cell ⁇ in vivo after combination with a ⁇ uitable delivery vehicle.
  • the ⁇ equence ⁇ of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • there i ⁇ a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual ⁇ equence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those ⁇ equence ⁇ with genes as ⁇ ociated with di ⁇ ease.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region is used to rapidly select primer ⁇ that do not ⁇ pan more than one exon in the genomic DNA, thu ⁇ complicating the amplification proce ⁇ s. These primers are then used for PCR screening of somatic cell hybrid ⁇ .containing individual human chromo ⁇ ome ⁇ . Only tho ⁇ e hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
  • PCR mapping of somatic cell hybrid ⁇ is a rapid procedure for as ⁇ igning a particular DNA to a particular chromo ⁇ ome.
  • Other mapping strategies that can similarly be used to map to it ⁇ chromo ⁇ ome include in situ hybridization, pre ⁇ creening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromo ⁇ ome specific-cDNA libraries.
  • Fluore ⁇ cence in situ hybridization (FISH) of a cDNA clone to a metapha ⁇ e chromo ⁇ omal ⁇ pread can be u ⁇ ed to provide a preci ⁇ e chromo ⁇ omal location in one ⁇ tep.
  • Thi ⁇ technique can be u ⁇ ed with cDNA a ⁇ ⁇ hort a ⁇ 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. For example, 2,000 bp is good, 4,000 i ⁇ better, and more than 4,000 i ⁇ probably not necessary to get good result ⁇ a reasonable percentage of the time.
  • Verma et al. Human Chromosome ⁇ : a Manual of Ba ⁇ ic Technique ⁇ , Pergamon Press, New York (1988).
  • the physical po ⁇ ition of the ⁇ equence on the chromosome can be correlated with genetic map data.
  • genetic map data are found, for example, in V. McKu ⁇ ick, Mendelian Inheritance in Man (available on line through John ⁇ Hopkin ⁇ University Welch Medical Library).
  • the relationship between gene ⁇ and di ⁇ ea ⁇ e ⁇ that have been mapped to the ⁇ ame chromosomal region are then identified through linkage analysi ⁇ (coinheritance of phy ⁇ ically adjacent gene ⁇ ).
  • a cDNA precisely localized to a chromosomal region as ⁇ ociated with the di ⁇ ea ⁇ e could be one of between 50 and 500 potential causative genes. (This assumes 1 megaba ⁇ e mapping re ⁇ olution and one gene per 20 kb) .
  • the polypeptide ⁇ , their fragment ⁇ or other derivative ⁇ , or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragment ⁇ , or the product of an Fab expression library.
  • Various procedures known in the art may be used for the production of ⁇ uch antibodie ⁇ and fragment ⁇ .
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptide ⁇ itself. In thi ⁇ manner, even a sequence encoding only a fragment of the polypeptide ⁇ can be used to generate antibodies binding the whole native polypeptide ⁇ . Such antibodie ⁇ can then be u ⁇ ed to i ⁇ olate the polypeptide from tissue expressing that polypeptide.
  • any technique which provides antibodie ⁇ produced by continuou ⁇ cell line culture ⁇ can be u ⁇ ed.
  • Example ⁇ include the hybridoma technique (Kohler and Mil ⁇ tein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor ' ⁇ t al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodie ⁇ (Cole, et al., 1985, in Monoclonal Antibodie ⁇ and Cancer Therapy, Alan R. Li ⁇ , Inc., pp. 77-96).
  • Technique ⁇ de ⁇ cribed for the production of ⁇ ingle chain antibodie ⁇ (U.S. Patent 4,946,778) can be adapted to produce ⁇ ingle chain antibodie ⁇ to immunogenic polypeptide product ⁇ of thi ⁇ invention.
  • Al ⁇ o, tran ⁇ genic mice may be u ⁇ ed to expre ⁇ humanized antibodie ⁇ to immunogenic polypeptide product ⁇ of thi ⁇ invention.
  • Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedure ⁇ .
  • equivalent pla ⁇ mid ⁇ to tho ⁇ e described are known in the art and will be apparent to the ordinarily skilled artisan.
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a re ⁇ triction enzyme that act ⁇ only at certain ⁇ equence ⁇ in the DNA.
  • the variou ⁇ re ⁇ triction enzyme ⁇ u ⁇ ed herein are commercially available and their reaction condition ⁇ , cofactor ⁇ and other requirement ⁇ were u ⁇ ed a ⁇ would be known to the ordinarily ⁇ killed arti ⁇ an.
  • For analytical purposes typically 1 ⁇ g of plasmid or DNA fragment i ⁇ u ⁇ ed with about 2 unit ⁇ of enzyme in about 20 ⁇ l of buffer ⁇ olution.
  • DNA fragment ⁇ for plasmid construction, typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and sub ⁇ trate amount ⁇ for particular re ⁇ triction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 * C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction i ⁇ electrophore ⁇ ed directly on a polyacrylamide gel to i ⁇ olate the de ⁇ ired fragment.
  • Oligonucleotides refers to either a single ⁇ tranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thu ⁇ will not ligate to another oligonucleotide without adding a pho ⁇ phate with an ATP in the pre ⁇ ence of a kina ⁇ e. A ⁇ ynthetic oligonucleotide will ligate to a fragment that ha ⁇ not been dephosphorylated.
  • Ligase refers to the process of forming phosphodie ⁇ ter bonds between two double stranded nucleic acid fragment ⁇ (Maniatis, T., et al.. Id., p. 146). Unle ⁇ otherwise provided, ligation may be accomplished u ⁇ ing known buffer ⁇ and condition ⁇ with 10 unit ⁇ of T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
  • ligase T4 DNA ligase
  • tran ⁇ formation wa ⁇ performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).
  • the 5' oligonucleotide primer ha ⁇ the ⁇ equence 5' GCCAGAGOATCCGAAACGTTTCCTCCAAAGTAC 3' (SEQ ID No.
  • pQE-9 encode ⁇ antibiotic re ⁇ i ⁇ tance (Amp r ), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/0), a ribo ⁇ ome binding ⁇ ite (RBS), a 6- Hi ⁇ tag and re ⁇ triction enzyme ⁇ ite ⁇ .
  • pQE-9 is then digested with BamHI and Xbal.
  • the amplified sequence ⁇ are ligated into pQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS.
  • the ligation mixture i ⁇ then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J.
  • M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin re ⁇ istance (Kan r ) .
  • Transformant ⁇ are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysi ⁇ . Clone ⁇ containing the de ⁇ ired con ⁇ truct ⁇ are grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml).
  • the O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250.
  • the cell ⁇ are grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6.
  • IPTG "Isopropyl-B-D- thiogalacto pyrano ⁇ ide" i ⁇ then added to a final concentration of 1 mM. IPTG induce ⁇ by inactivating the lad repressor, clearing the P/0 leading to increased gene expres ⁇ ion.
  • Cell ⁇ are grown an extra 3 to 4 hour ⁇ . Cell ⁇ are then harvested by centrifugation. The cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl.
  • TNF receptor (0% pure) i ⁇ eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpo ⁇ e of renaturation adju ⁇ ted to 3 molar guanidine HCl, lOOmM ⁇ odium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in thi ⁇ solution for 12 hours the protein is dialyzed to 10 mmolar ⁇ odium phosphate.
  • Example 2 Clonin ⁇ and expre ⁇ sion of TNF receptor and extracellular
  • the 5' primer ha ⁇ the ⁇ equence 5' GCGCGGATCCATGAACAAGTTGCTGTGCTGC 3' (SEQ ID No. 5) and contain ⁇ a BamHI re ⁇ triction enzyme ⁇ ite (in bold) and which i ⁇ ju ⁇ t behind the first 21 nucleotide ⁇ of the TNF receptor gene (the initiation codon for tran ⁇ lation "ATG" i ⁇ underlined) .
  • the 3' primer ha ⁇ the ⁇ equence 5' GCGCTCTAGATTA CCTATCATTTCTAAAAATAAC 3' (SEQ ID No. 6) and 5' GCGCGGTACCTCAGTGGTTTGGGCTCCTCCC 3' (SEQ ID No. 7) and contain ⁇ the cleavage ⁇ ite for the re ⁇ triction endonuclease Xbal and 21 nucleotides complementary to the 3' non- translated sequence of the TNF receptor gene.
  • the amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean", BIO 101 Inc., La Jolla, Ca.). The fragments were then digested with the endonucleases BamHI and Xbal and then purified again on a 1% agaro ⁇ e gel. Thi ⁇ fragment i ⁇ designated F2.
  • the vector pRGl (modification of pVL941 vector, discu ⁇ ed below) wa ⁇ u ⁇ ed for the expre ⁇ ion of the TNF receptor protein ⁇ u ⁇ ing the baculovirus expres ⁇ ion system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vector ⁇ and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555).
  • This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosi ⁇ viru ⁇ (AcMNPV) followed by the recognition ⁇ ite ⁇ for the re ⁇ triction endonuclea ⁇ e ⁇ BamHI and Xbal.
  • the polyadenylation ⁇ ite of the ⁇ imian viru ⁇ (SV)40 wa ⁇ used for efficient polyadenylation.
  • the beta-galacto ⁇ idase gene from E.coli wa ⁇ in ⁇ erted in the same orientation a ⁇ the polyhedrin promoter followed by the polyadenylation ⁇ ignal of the polyhedrin gene.
  • the polyhedrin sequences were flanked at both sides by viral sequence ⁇ for the cell-mediated homologous recombination of cotransfected wild-type viral DNA.
  • Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
  • the plasmid wa ⁇ dige ⁇ ted with the restriction enzymes BamHI and Xbal.
  • the DNA wa ⁇ then i ⁇ olated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). Thi ⁇ vector DNA i ⁇ de ⁇ ignated V2.
  • Fragment F2 and the depho ⁇ phorylated pla ⁇ mid V2 were ligated with T4 DNA ligase.
  • E. coli HB101 cell ⁇ were then tran ⁇ formed and cell ⁇ identified that contained the plasmid (pBac TNF receptor) with the TNF receptor genes using the enzymes BamHI and Xbal.
  • the sequence of the cloned fragment was confirmed by DNA sequencing.
  • the plate was then incubated for 5 hour ⁇ at 27°C. After 5 hour ⁇ the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum wa ⁇ added. The plate wa ⁇ put back into an incubator and cultivation continued at 27°C for four days.
  • the viruses were added to the cells and blue stained plaques were picked with the tip ' of an Eppendorf pipette.
  • the agar containing the recombinant viru ⁇ es were then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
  • the agar wa ⁇ removed by a brief centrifugation and the ⁇ upernatant containing the recombinant baculoviru ⁇ e ⁇ wa ⁇ u ⁇ ed to infect Sf9 cell ⁇ seeded in 35 mm dishes.
  • the supematants of these culture dishe ⁇ were harve ⁇ ted and then ⁇ tored at 4°C.
  • Sf9 cell ⁇ were grown in Grace' ⁇ medium ⁇ upplemented with 10% heat-inactivated FBS.
  • the cell ⁇ were infected with the recombinant baculovirus V-TNF receptor at a multiplicity of infection (MOI) of 2.
  • MOI multiplicity of infection
  • the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologie ⁇ Inc., Gaither ⁇ burg).
  • the cell ⁇ are further incubated for 16 hour ⁇ before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
  • Example 3 Expre ⁇ sion of Recombinant TNF receptor in COS cells
  • expres ⁇ ion of plasmid, TNF receptor HA i ⁇ derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resi ⁇ tance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation ⁇ ite.
  • a DNA fragment encoding the entire TNF receptor precur ⁇ or and a HA tag fu ⁇ ed in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expre ⁇ ion i ⁇ directed under the CMV promoter.
  • the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previou ⁇ ly described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767).
  • the infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the DNA sequence encoding TNF receptor, ATCC # 75899, i ⁇ constructed by PCR using two primers: the 5' primer 5' GCCAGAGGATCCGCCACCATGAACAAGTTGCTGTGCTGC 3' (SEQ ID No. 8) contain ⁇ a BamHI ⁇ ite (bold) followed by 21 nucleotides of TNF receptor coding sequence starting from the initiation codon; the 3' sequence 5' CGGCTTCTAGAATCAAGCGTAGTCTGGGACG TCGTATGGGTACCTATCATTTCTAAAAAT 3' (SEQ ID No.
  • the PCR product contains complementary ⁇ equence ⁇ to an Xbal ⁇ ite (bold), translation stop codon, HA tag and the last 18 nucleotides of the TNF receptor coding sequence (not including the ⁇ top codon). Therefore, the PCR product contains a BamHI ⁇ ite, TNF receptor coding ⁇ equence followed by HA tag fu ⁇ ed in frame, a translation termination stop codon next to the HA tag, and an Xbal site.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp are digested with BamHI and Xbal restriction enzymes and ligated. The ligation mixture is transformed into E.
  • coli ⁇ train SURE (Stratagene Cloning Sy ⁇ tem ⁇ , La Jolla, CA) the tran ⁇ formed culture i ⁇ plated on ampicillin media plate ⁇ and re ⁇ i ⁇ tant colonie ⁇ are ⁇ elected. Pla ⁇ mid DNA is isolated from transformant ⁇ and examined by re ⁇ triction analy ⁇ i ⁇ for the pre ⁇ ence of the correct fragment. For expre ⁇ ion of the recombinant TNF receptor, COS cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniati ⁇ , Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)).
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • GTGTGCGCCC CTTGCCCTGA CCACTACTAC ACAGACAGCT GGCACACCAG TGACGAGTGT 240
  • CTATACTGCA GCCCCGTGTG CAAGGAGCTG CAGTACGTCA AGCAGGAGTG CAATCGCACC 300
  • Hi ⁇ A ⁇ p A ⁇ n lie Cy ⁇ Ser Gly A ⁇ n Ser Glu Ser Thr Gin Ly ⁇ Cy ⁇
  • Gly lie A ⁇ p Val Thr Leu Cy ⁇ Glu Glu Ala Phe Phe Arg Phe Ala
  • Leu Trp Arg lie Lys Asn Gly Asp Gin Asp Thr Leu Ly ⁇ Gly Leu
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:5:

Abstract

A human TNF receptor and DNA (RNA) encoding such receptor and a procedure for producing such receptor by recombinant techniques is disclosed. Also disclosed are methods for utilizing such receptor for screening for antagonists and agonists to the receptor and for ligands for the receptor. Also disclosed are methods for utilizing such agonists to inhibit the growth of tumors, to stimulate cellular differentiation, to mediate the immune response and anti-viral response, to regulate growth and provide resistance to certain infections. The use of the antagonists as a therapeutic to treat autoimmune diseases, inflammation, septic shock, to inhibit graft-host reactions, and to prevent apoptosis is also disclosed. Also disclosed are diagnostic methods for detecting mutations in the nucleic acid sequence encoding the receptor and for detecting altered levels of the soluble receptor in a sample derived from a host.

Description

HUMAN TUMOR NECROSIS FACTOR RECEPTOR
This invention relates to newly identified polynucleotides, polypeptideε encoded by such polynucleotides, the use of such polynucleotides and polypeptideε, as well as the production of such polynucleotides and polypeptideε. The polypeptide of the present invention has been putatively identified as a Tumor Necrosis Factor receptor, and more particularly as a type 2 Tumor Necrosis Factor Receptor. The polypeptide of the present ivention will hereinafter be referred to as "TNF receptor" . The invention also relates to inhibiting the receptor.
Human tumor necrosis factors α (TNF-α) and β (TNF-0 or lymphotoxin) are related members of a broad class of polypeptide mediators, which includes the interferons, interleukinε and growth factors, collectively called cytokines (Beutler, B. and Cerami, A., Annu. Rev. Immunol., 7:625-655 (1989)).
Tumor necrosis factor (TNF-α and TNF-/3) was originally discovered as a result of its anti-tumor activity, however, now it is recognized as a pleiotropic cytokine playing important roles in a host of biological processes and pathologies. To date, there are eight known members of the TNF-related cytokine family, TNF-α, TNF-/3 (lymphotoxin-α) , LT-/3, and ligands for the Fas receptor, CD30, CD27, CD40 and 4-1BB receptors. These proteinε have conserved C-terminal sequences and variable N-terminal sequenceε which are often used as membrane anchors, with the exception of TNF-S. Both TNF-α and TNF-3 function as homotrimers when they bind to TNF receptors.
TNF is produced by a number of cell types, including monocytes, fibroblastε, T cellε, natural killer (NK) cells and predominately by activated machrophageε. TNF-α haε been reported to have a role in the rapid necrosis of tumors, immunostimulation, autoimmune disease, graft rejection, producing an anti-viral response, septic shock, cerebral malaria, cytotoxicity, protection against deleterious effects of ionizing radiation produced during a course of chemotherapy, such as denaturation of enzymes, lipid peroxidation and DNA damage (Nata et al, J. Immunol. 136(7):2483 (1987)), growth regulation, vascular endothelium effects' and metabolic effects. TNF-α alεo triggers endothelial cells to secrete various factors, including PAI- 1, IL-1, GM-CSF and IL-6 to promote cell proliferation. In addition, TNF-α up-regulates various cell adhesion molecules such as E-Selectin, ICAM-1 and VCAM-1. TNF-α and the Fas ligand have also been shown to induce programmed cell death.
A related molecule, lymphotoxin (LT, alεo referred to as TNF-3), which is produced by activated lymphocytes shows a similar but not identical spectrum of biological activities aε TNF. Two different typeε of LT have been found, LT-α and LT-3. LT-α haε many activitieε, including tumor necrosis, induction of an antiviral state, activation of polymorphonuclear leukocyteε, induction of claεε I major histocompatibility complex antigens on endothelial cells, induction of adhesion molecules on endothelium and growth hormone stimulation (Ruddle, N. and Homer, R. , Prog. Allergy, 40:162-182 (1988)). The first step in the induction of the various cellular responses mediated by TNF or LT is their binding to specific cell surface or soluble receptors. Two distinct TNF receptors of approximately 55-KDa (TNF-R1) and 75-KDa (TNF- R2) have been identified (Hohman, H.P. et al., J. Biol. Chem., 264:14927-14934 (1989)), and human and mouse cDNAs corresponding to both receptor types have been isolated and characterized (Loetscher, H. et al., Cell, 61:351 (1990)). Both TNF-Rε share- the typical structure of cell surface receptors including extracellular, transmembrane and intracellular regionε.
Theεe moleculeε exiεt not only in cell bound for ε, but also in soluble forms, consisting of the cleaved extra¬ cellular domains of the intact receptors (Nophar et al . , EMBO Journal, 9 (10):3269-76 (1990)). The extracellular domains of TNF-R1 and TNF-R2 share 28% identity and are characterized by four repeated cysteine-rich motifs with significant intersubunit sequence homology. The majority of cell types and tiεεueε appear to expreεε both TNF receptorε and both receptors are active in signal transduction, however, they are able to mediate distinct cellular responses. Further, TNF-R2 was shown to exclusively mediate human T cell proliferation by TNF as shown in PCT WO 94/09137.
TNF-R1 dependent responseε include accumulation of C- FOS, IL-6, and manganeεe εuperoxide diεmutaεe mRNA, proεtaglandin E2 syntheεiε, IL-2 receptor and MHC class I and II cell surface antigen expression, growth inhibition, and cytotoxicity. TNF-R1 also triggers second messenger systems such as phospholipase A2, protein kinase C, phoεphatidylcholine-εpecific phospholipaεe C and sphingomyelinaεe (Pfefferk et al . , Cell, 73:457-467 (1993)).
The receptor polypeptide of the present invention binds TNF, and in particular, TNF-jS. Further, the TNF receptor may also bind other ligands, including but not limited to Nerve Growth Factor, due to homology to a family of receptors and antigens which are involved in other critical biological processes. This family shows highly conserved cysteine reεidueε and includeε the low affinity NGF receptor, which plays an important role in the regulation of growth and differentiation of nerve cellε, the Fas receptor also called APO, a receptor which is involved is signalling for apoptosis and which, based on a study with mice deficient in its function, seems to play an important role in the etiology of a lupus-like disease, the TNF-R1, the B cell antigen CD40, and the T cell activation antigen CD27.
In accordance with one aspect of the present invention, there is provided a novel mature polypeptide which is a putative TNF receptor, as well as fragments, analogs and derivatives thereof. The polypeptide of the preεent invention iε of human origin.
In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the polypeptide of the present invention, including RNAs, DNAs, cDNAs, genomic DNA aε well as antisense analogs thereof and biologically active and diagnostically or therapeutically uεeful fragments thereof.
In accordance with yet a further aspect of the present invention, there iε provided a process for producing such polypeptideε by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention, under conditions promoting expression of said protein and subsequent recovery of said protein.
In accordance with yet a further aspect of the preεent invention, there iε provided a proceεε for utilizing such polypeptide, or polynucleotide encoding such polypeptide to screen for receptor antagonists and/or agonists and/or receptor ligands. In accordance with yet a further aspect of the present invention, there are provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the polypeptide of the present invention.
In accordance with still another aεpect of the preεent invention, there iε provided a process of using such agonists for treating conditions related to insufficient TNF receptor activity, for example, to inhibit tumor growth, to stimulate human cellular proliferation, e.g., T-cell proliferation, to regulate the immune response and antiviral responses, to protect against the effects of ionizing radiation, to protect against chlamidiae infection, to regulate growth and to treat immunodeficiencies such as iε found in HIV.
In accordance with another aεpect of the present invention, there is provided a process of using such antagonists for treating conditions aεεociated with over- expression of the TNF receptor, for example, for treating T- cell mediated autoimmune diseases such as AIDS, septic shock, cerebral malaria, graft rejection, cytotoxicity, cachexia, apoptosis and inflammation.
These and other aεpects of the present invention should be apparent to those εkilled in the art from the teachingε herein.
The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.
Figure 1 εhowε the cDNA εequence and correεponding deduced amino acid εequence of the polypeptide of the preεent invention. The initial 21 amino acids represent the putative leader εequence and are underlined. The εtandard one-letter abbreviations for amino acids are used. Sequencing was performed uεing a 373 automated DNA εequencer (Applied Biosystems, Inc.). Sequencing accuracy is predicted to be greater than 97% accurate. Figure 2 illustrates an amino acid sequence alignment of the polypeptide of the present invention (upper line) and the human type 2 TNF receptor (lower line).
The term "gene" or "cistron" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequenceε (introns) between individual coding segments (exons) .
In accordance with an aspect of the present invention, there iε provided an iεolated nucleic acid (polynucleotide) which encodeε for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75899 on September 28, 1994.
A polynucleotide encoding a polypeptide of the present invention may be obtained from human pulmonary tissue, hippocampus and adult heart. The polynucleotide of this invention was discovered in a cDNA library derived from human early passage fibroblasts (HSA 172 cellε). It iε structurally related to the human TNF-R2 receptor. It contains an open reading frame encoding a protein of 390 amino acid residues of which approximately the first 21 amino acids residues are the putative leader εequence such that the mature protein comprises 369 amino acidε. The protein exhibits the highest degree of homology to a human type 2 TNF receptor with 39% identity and 46% similarity over an 88 amino acid stretch. Six conserved cyteineε present in modules of 40 residues in all TNF receptors are conεerved in this receptor.
The TNF receptor of the present invention is a εoluble receptor and iε secreted, however, it may also exist as a membrane bound receptor having a transmembrane region and an intra- and extracellular region. The polypeptide of the preεent invention may bind TNF and lymphotoxin ligandε. In accordance with an aspect of the present invention there is provided a polynucleotide which may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID No. 1) or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID No. 1) or the deposited cDNA.
The polynucleotide which encodeε for the mature polypeptide of Figure 1 (SEQ ID No. 2) or for the mature polypeptide encoded by the depoεited cDNA may include: only the coding εequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence εuch as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding εequence) and non-coding εequence, such as introns or non-coding sequence 5' and/or 3' of the coding εequence for the mature polypeptide.
Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well aε a polynucleotide which includeε additional coding and/or non-coding sequence.
The present invention further relates to variants of the hereinabove deεcribed polynucleotideε which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone. The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non- naturally occurring variant of the polynucleotide.
Thuε, the preεent invention includeε polynucleotideε encoding the same mature polypeptide aε εhown in Figure 1 (SEQ ID No. 2) or the same mature polypeptide encoded by the cDNA of the deposited clone aε well aε variantε of such polynucleotideε which variantε encode for a fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or the polypeptide encoded by the cDNA of the deposited clone. Such nucleotide variantε include deletion variantε, substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding εequence shown in Figure 1 (SEQ ID No. 1) or of the coding sequence of the deposited clone. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotideε, which doeε not εubεtantially alter the function of the encoded polypeptide.
The present invention also includes polynucleotideε, wherein the coding εequence for the mature polypeptide may be fuεed in the εame reading frame to a polynucleotide sequence which aids in expresεion and εecretion of a polypeptide from a hoεt cell, for example, a leader εequence which functionε aε a εecretory εequence for controlling tranεport of a polypeptide from the cell. The polypeptide having a leader sequence iε a preprotein and may have the leader sequence cleaved by the hoεt cell to form the mature form of the polypeptide. The polynucleotideε may alεo encode for a proprotein which iε the mature protein plus additional 5' amino acid residueε. A mature protein having a proεequence is a proprotein and is an inactive form of the protein. Once the prosequence iε cleaved an active mature protein remains. Thuε, for example, the polynucleotide of the preεent invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).
The polynucleotideε of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the preεent invention. The marker sequence may be a hexa- hiεtidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial hoεt, or, for example, the marker εequence may be a hemagglutinin (HA) tag when a mammalian hoεt, e.g. COS-7 cellε, iε uεed. The HA tag correεponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al.. Cell, 37:767 (1984)). The coding sequence may also be fused to a sequence which codes for a fuεion protein εuch aε an IgG Fc fuεion protein.
The preεent invention further relateε to polynucleotides which hybridize to the hereinabove-described sequenceε if there iε at leaεt 50% and preferably 70% identity between the εequences. The present invention particularly relateε to polynucleotideε which hybridize under εtringent conditionε to the hereinabove-deεcribed polynucleotideε. As herein used, the term "stringent conditions" means hybridization will occur only if there iε at leaεt 95% and preferably at leaεt 97% identity between the εequences. The polynucleotideε which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptideε which retain εubεtantially the εa e biological function or activity aε the mature polypeptide encoded by the cDNA of Figure 1 (SEQ ID No. 1) or the deposited cDNA.
The deposit(s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organiεmε for purposes of Patent Procedure. These deposits are provided merely aε convenience to thoεe of εkill in the art and are not an admission that a deposit iε required under 35 U.S.C. §112. The εequence of the polynucleotideε contained in the depoεited materials, as well as the amino acid sequence of the polypeptideε encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any deεcription of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license iε hereby granted.
The present invention further relates to a polypeptide which haε the deduced amino acid εequence of Figure 1 (SEQ ID No. 2) or which haε the amino acid εequence encoded by the depoεited cDNA, aε well aε fragmentε, analogs and derivatives of such polypeptide.
The terms "fragment," "derivative" and "analog" when referring to the polypeptide of Figure 1 (SEQ ID No. 2) or that enσoded by the deposited cDNA, means a polypeptide which retains essentially the same biological function or activity as εuch polypeptide. Thus, an analog includeε a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide of Figure 1 (SEQ ID No. 2) or that encoded by the depoεited cDNA may be (i) one in which one or more of the amino acid residues are εubεtituted with a conεerved or non-conserved amino acid residue (preferably a conεerved amino acid reεidue) and εuch εubεtituted amino acid reεidue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such aε a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as an IbG Fc fusion region peptide or leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of thoεe εkilled in the art from the teachingε herein.
The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The term "isolated" means that the material iε removed from its original environment (e.g., the natural environment if it is naturally occurring) . For example, a naturally- occurring polynucleotide or polypeptide present in a living animal is not iεolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, iε isolated. Such polynucleotideε could be part of a vector and/or εuch polynucleotideε or polypeptides could be part of a composition, and εtill be iεolated in that εuch vector or compoεition iε not part of itε natural environment.
The present invention alεo relateε to vectorε which include polynucleotideε of the preεent invention, hoεt cellε which are genetically engineered with vectorε of the invention and the production of polypeptideε of the invention by recombinant techniques.
Hoεt cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expreεεion vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified aε appropriate for activating promoterε, selecting transformantε or amplifying the nucleic acid sequences of the present invention. The culture conditions, εuch aε temperature, pH and the like, are thoεe previouεly uεed with the hoεt cell selected for expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotideε of the preεent invention may be employed for producing polypeptideε by recombinant techniqueε. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and εynthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectorε derived from combinations of plasmidε and phage DNA, viral DNA such aε vaccinia, adenovirus, fowl pox virus, and pseudorabieε. However, any other vector may be uεed aε long aε it iε replicable and viable in the hoεt.
The appropriate DNA εequence may be inεerted into the vector by a variety of procedureε. In general, the DNA sequence iε inserted into an appropriate restriction endonuclease εite(ε) by procedureε known in the art. Such procedureε and otherε are deemed to be within the εcope of those skilled in the art.
The DNA sequence in the expresεion vector iε operatively linked to an appropriate expreεεion control sequence(s) (promoter) to direct mRNA εynthesiε. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda PL promoter and other promoterε known to control expresεion of genes in prokaryotic or eukaryotic cells or their viruεeε. The expresεion vector alεo containε a riboεome binding εite for tranεlation initiation and a transcription terminator. The vector may alεo include appropriate sequences for amplifying expresεion.
In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resiεtance for eukaryotic cell culture, or such aε tetracycline or ampicillin resistance in E. coli.
The vector containing the appropriate DNA sequence aε hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate hoεt to permit the hoεt to expreεs the protein.
As repreεentative exampleε of appropriate hoεtε, there may be mentioned: bacterial cellε, εuch aε E. coli. Streptomyceε. Salmonella typhimurium; fungal cellε, εuch aε yeast; insect cells εuch aε Drosophila S2 and Spodoptera Sf9; animal cellε such as CHO, COS or Bowes melanoma; adenoviruεeε; plant cells, etc. The selection of an appropriate host iε deemed to be within the εcope of thoεe skilled in the art from the teachingε herein.
More particularly, the present invention alεo includeε recombinant constructs comprising one or more of the sequences as broadly described above. The constructε compriεe a vector, εuch aε a plasmid or viral vector, into which a εequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the conεtruct further compriεeε regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectorε and promoterε are known to those of εkill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, pεiX174, pblueεcript SK, pbεkε, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the hoεt. Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoterε include lad, lacZ, T3, T7, gpt, lambda PR PL and trp. Eukaryotic promoterε include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRε from retroviruε, and mouse metallothionein-I. Selection of the appropriate vector and promoter iε well within the level of ordinary εkill in the art.
In a further embodiment, the preεent invention relateε to hoεt cellε containing the above-deεcribed conεtructε. The hoεt cell can be a higher eukaryotic cell, εuch aε a mammalian cell, or a lower eukaryotic cell, εuch aε a yeaεt cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran-mediated transfection, or electroporation (Davis, L., Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986)) .
The constructε in hoεt cellε can be uεed in a conventional manner to produce the gene product encoded by the recombinant εequence. Alternatively, the polypeptideε of the invention can be εynthetically produced by conventional peptide synthesizers.
Mature proteins can be expreεεed in mammalian cellε, yeaεt, bacteria, or other cellε under the control of appropriate promoterε. Cell-free tranεlation εystemε can also be employed to produce such proteins using RNAs derived from the DNA conεtructε of the preεent invention. Appropriate cloning and expreεεion vectorε for uεe with prokaryotic and eukaryotic hoεtε are deεcribed by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference. Tranεcription of the DNA encoding the polypeptideε of the preεent invention by higher eukaryoteε iε increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elementε of DNA, uεually about from 10 to 300 bp that act on a promoter to increase its tranεcription. Exampleε including the SV40 enhancer on the late εide of the replication origin bp 100 to 270, a cyto egaloviruε early promoter enhancer, the polyoma enhancer on the late εide of the replication origin, and adenoviruε enhancerε.
Generally, recombinant expreεsion vectors will include originε of replication and selectable markers permitting tranεformation of the hoεt cell, e.g., the ampicillin reεistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes εuch aε 3-phoεphoglycerate kinase (PGK), α-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is asεembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous εequence can encode a fuεion protein including an N-terminal identification peptide imparting desired characteristicε, e.g., εtabilization or simplified purification of expresεed recombinant product.
Uεeful expression vectorε for bacterial use are constructed by inserting a structural DNA sequence encoding a deεired protein together with εuitable tranεlation initiation and termination εignalε in operable reading phaεe with a functional promoter. The vector will compriεe one or more phenotypic εelectable markerε and an origin of replication to ensure maintenance of the vector" and to, if desirable, provide amplification within the host. Suitable prokaryotic hoεtε for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various εpecieε within the genera Pseudomonas, Streptomyceε, and Staphylococcuε, although otherε may alεo be employed aε a matter of choice.
Aε a repreεentative but nonlimiting example, uεeful expreεsion vectors for bacterial uεe can compriεe a εelectable marker and bacterial origin of replication derived from commercially available plaεmidε compriεing genetic elementε of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectorε include, for example, pKK223-3 (Pharmacia Fine Chemicalε, Uppεala, Sweden) and GEM1 (Promega Biotec, Madiεon, WI, USA). Theεe pBR322 "backbone" εectionε are combined with an appropriate promoter and the structural sequence to be expressed.
Following transformation of a εuitable host strain and growth of the hoεt εtrain to an appropriate cell denεity, the εelected promoter iε induced by appropriate meanε (e.g., temperature εhift or chemical induction) and cellε are cultured for an additional period.
Cellε are typically harvested by centrifugation, disrupted by phyεical or chemical meanε, and the resulting crude extract retained for further purification.
Microbial cellε employed in expreεεion of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or uεe of cell lyεing agentε, εuch methodε are well know to thoεe skilled in the art.
Various mammalian cell culture systems can also be employed to expresε recombinant protein. Examples of mammalian expreεsion systems include the COS-7 lines of monkey kidney fibroblastε, deεcribed by Gluzman, Cell, 23:175 (1981), and other cell lineε capable of expreεεing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lineε. Mammalian expreεεion vectorε will compriεe an origin of replication, a suitable promoter and enhancer, and also any necesεary riboεome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed εequenceε. DNA εequenceε derived from the SV40 εplice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
The polypeptide of the present invention can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, aε neceεεary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification εtepε. *
The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic hoεt (for example, by bacterial, yeast, higher plant, inεect and mammalian cellε in culture). Depending upon the hoεt employed in a recombinant production procedure, the polypeptides of the preεent invention may be glycoεylated or may be non-glycoεylated. Polypeptideε of the invention may alεo include an initial methionine amino acid reεidue.
The TNF receptor of the present invention was assayed for the ability to bind TNF-α and TNF-3, however, the preεent invention alεo contemplates the ability of the receptor to bind other TNF-like proteins. Monoclonal antibodies specific to TNF-α and TNF-3 were prepared. These monoclonal antibodies were bound to TNF-α and TNF-3 and a control ELISA assay was performed to quantify the amount of monoclonal antibody present. The TNF receptor was then bound to TNF-α and TNF-3 in the same way in which the monoclonal antibody was bound and another ELISA assay was performed. The TNF receptor was found to bind to TNF -β just as strongly aε the monoclonal antibody, while it only bound TNF-α two-thirdε as strongly.
Fragments of the full length polynucleotide seqeunces of the preεent invention may be uεed aε a hybridization probe for a cDNA library to isolate other genes which have a high sequence similarity to the polynucleotide sequence of the present invention or similar biological activity. Probes of thiε type generally have at least 50 bases, although they may have a greater number of baseε. The probe may alεo be uεed aε markerε to identify a cDNA clone correεponding to a full length transcript and a genomic clone or clones that contain the complete polynucleotide sequence of the present invention including regulatory and promotor regions, exons, and intronε/ An example of a εcreen compriεeε iεolating the coding region of the gene of the preεent invention by using the known DNA sequence to syntheεize an oligonucleotide probe. Labeled oligonucleotideε having a εequence complementary to that of the gene of the preεent invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
This invention also provides a method of screening compounds to identify compounds which interact with the polypeptide of the preεent invention which compriεeε contacting a mammalian cell comprising an isolated DNA molecule encoding and expresεing a the polypeptide of the present invention with a plurality of compounds, determining those which activate or block the activation of the receptor, and thereby identifying compounds which specifically interact with, and activate or block the activation of the polypeptide of the preεent invention. This invention also contemplates the use of the polynucleotide of the present invention aε a diagnostic. For example, if a mutation iε preεent, conditions would result from a lack of TNF receptor activity. Further, mutations which enhance TNF receptor activity would lead to diseases associated with an over-expression of the receptor, e.g., endotoxic shock. Mutated genes can be detected by comparing the sequence of the defective gene with that of a normal one. Subεequently one can verify that a mutant gene iε aεεociated with a disease condition or the susceptibility to a diseaεe condition. That iε, a mutant gene which leadε to the underexpreεsion of the TNF receptor would be aεεociated with an inability of TNF to inhibit tumor growth.
Individualε carrying mutationε in the polynucleotide of the preεent invention may be detected at the DNA level by a variety of techniques. Nucleic acids used for diagnosiε may be obtained from a patient's cellε which include, but are not limited' to, blood, urine, saliva and tissue biopsy. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al . , Nature, 324:163-166.(1986)) prior to analyεiε. RNA or cDNA may alεo be used for the same purpose. Aε an example, PCR primerε complementary to the nucleic acid of the inεtant invention can be uεed to identify and analyze gene mutationε. For example, deletionε and insertions can be detected by a change in the size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA or alternatively, radiolabeled TNF receptor antiεenεe DNA sequences. Perfectly matched sequenceε can be diεtinguiεhed from miεmatched duplexeε by RNase A digestion or by differences in melting temperatures. Such a diagnostic would be particularly useful for prenatal or even neonatal testing.
Sequence differences between the reference gene and "mutants" may be revealed by the direct DNA sequencing method. In addition, cloned DNA segments may be used aε probeε to detect specific DNA segmentε. The senεitivity of thiε method is greatly enhanced when combined with PCR. For example, a sequencing primary used with double stranded PCR product or a single stranded template molecule generated by a modified PCR product. The sequence determination iε performed by conventional procedureε with radiolabeled nucleotideε or by automatic εequencing procedureε with fluoreεcent tagε. •
Sequence changes at the specific locations may be revealed by nucleaεe protection aεsayε, εuch aε RNaεe and SI protection or the chemical cleavage method (for example. Cotton et al . , PNAS, 85:4397-4401 (1985)).
The present invention further relates to a diagnostic assay which detects an altered level of a soluble form of the polypeptide of the present invention where an elevated level in a sample derived from a host iε indicative of certain diseases. Assayε available to detect levelε of εoluble receptorε are well known to thoεe of skill in the art, for example, radioimmunoassays, competitive-binding assayε. Western blot analyεiε, and preferably an ELISA aεεay may be employed.
An ELISA aεεay initially comprises preparing an antibody specific to an antigen to the polypeptide of the present invention, preferably a monoclonal antibody. In addition a reporter antibody iε prepared againεt the monoclonal antibody. To the reporter antibody iε attached a detectable reagent εuch aε radioactivity, fluoreεcence or in thiε example a horεeradish peroxidase enzyme. A sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding εiteε on the diεh are then covered by incubating with a non-specific protein such aε bovine serum albumen. Next, the monoclonal antibody iε incubated in the dish during which time the monoclonal antibodies attach to any proteins of the present invention which are attached to the polystyrene diεh. All unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to the polypeptide of the present invention. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of the protein of interest present in a given volume of patient sample when compared against a standard curve.
A competition assay may be employed wherein antibodies specific to the polypeptides of the present invention are attached to a solid support. Labeled TNF receptor polypeptides, and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity in the 'sample. The soluble form of the receptor may also be employed to identify agonists and antagonists.
A thymocyte proliferation assay may be employed to identify both ligands and potential agonists and antagonists to the polypeptide of the present invention. For example, thymus cells are disaggregated from tissue and grown in culture medium. Incorporation of DNA prescursorε such as 3H- thymidine or 5-bromo-2' -deoxyuridine (BrdU) is monitored as a parameter for DNA synthesis and cellular proliferation. Cells which have incorporated BrdU into DNA can be detected using a monoclonal antibody against BrdU and measured by an enzyme or fluorochrome-conjugated second antibody. The reaction is quantitated by fluorimetry or by spectrophotometry. Two control wells and an experimental well are set up. TNF-3 iε added to all wells, while εoluble receptorε of the present invention are added to the experimental well. Also added to the experimental well is a compound to be screened. The ability of the compound to be screened to inhibit the interaction of TNF-/3 with the receptor polypeptideβ of the present invention may then be quantified. In the case of the agoniεtε, the ability of the compound to enhance thiε interaction iε quantified.
A determination may be made whether a ligand not known to be capable of binding to the polypeptide of the preεent invention can bind thereto comprising contacting a mammalian cell comprising an isolated molecule encoding a polypeptide of the present invention with a ligand under conditions permitting binding of ligands known to bind thereto, detecting the presence of any bound ligand, and thereby determining whether εuch ligandε bind to a polypeptide of the preεent invention. Also, a soluble form of the receptor may utilized in the above assay where it is secreted in to the extra-cellular medium and contacted with ligands to determine which will bind to the soluble form of the receptor.
Other agoniεt and antagoniεt εcreening procedures involve, providing appropriate cellε which expreεε the receptor on the surface thereof. In particular, a polynucleotide encoding a polypeptide of the present invention iε employed to tranεfect cellε to thereby expreεε the polypeptide. Such tranεfection may be accompliεhed by procedureε as hereinabove described.
Thus, for example, such assay may be employed for screening for a receptor antagonist by contacting the cells which encode the polypeptide of the present invention with both the receptor ligand and a compound to be εcreened. Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, i.e., inhibits activation of the receptor.
The screening may be employed for determining an agonist by contacting such cells with compoundε to be εcreened and determining whether εuch compoundε generate a εignal, i.e., activates the receptor. Other screening techniques include the use of cellε which expreεε the polypeptide of the present invention (for example, transfected CHO cells) in a syεtem which meaεureε extracellular pH changeε cauεed by receptor activation, for example, as described in Science, Volume 246, pages 181-296 (1989). In another example, potential agonists or antagonists may be contacted with a cell which expresεeε the polypeptide of the present invention and a second messenger response, e.g., signal transduction may be measured to determine whether the potential antagonist or agonist iε effective.
Another εcreening technique involveε expreεεing the receptor polypeptide wherein it iε linked to phoεpholipase C or D. As representative examples of such cellε, there may be mentioned endothelial cellε, smooth muscle cells, embryonic kidney cells and the like. The screening for an antagonist or agonist may be accomplished aε hereinabove deεcribed by detecting activation of the receptor or inhibition of activation of the receptor from the phoεpholipase second signal.
Antibodies may be utilized as both an agonist and antagonist depending on which part of the polypeptide of the present invention the antibody binds to. The antibody in one instance can bind to the active site and block ligand access. However, it haε been obεerved that monoclonal antibodieε directed againεt certain TNF receptorε can act aε specific agoniεtε when binding to the extra-cellular domain of the receptor.
In addition to the antagonists identified above, oligonucleotides which bind to the TNF receptor may also act as TNF receptor antagonists. Alternatively, a potential TNF receptor antagonist may be a soluble form of the TNF receptor which contains the complete extra-cellular region of the TNF receptor and which binds to ligands to inhibit their biological activity. Another potential TNF receptor antagonist is an antisense construct prepared using antisense technology. Antisense technology can be used to control gene expreεεion through triple-helix formation or antiεenεe DNA or RNA, both of which methodε are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is uεed to deεign an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in tranεcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al. , Science, 251: 1360 (1991)), thereby preventing tranεcription and the production of TNF receptor . The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the TNF receptor polypeptide (antisenεe - Okano, J. Neurochem. , 56:560 (1991); Oligodeoxynucleotideε aε Antisense Inhibitors of Gene Expreεεion, CRC Preεε, Boca Raton, FL (1988)). The oligonucleotideε deεcribed above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of TNF receptorε.
TNF receptor antagoniεts alεo include a εmall molecule which bindε to and occupieε the TNF receptor thereby making the receptor inaccessible to ligands which bind thereto εuch that normal biological activity iε prevented. Exampleε of εmall moleculeε include but are not limited to εmall peptideε or peptide-like moleculeε.
The TNF receptor agonists may be employed to stimulate ligand activities, such as inhibition of tumor growth and necrosis of certain transplantable tumorε. The agonists may also be employed to εtimulate cellular differentiation, for example, T-cell, fibroblasts and haemopoietic cell differentiation. Agonistε to the TNF receptor may also augment TNF's role in the hoεt's defense against microorganisms and prevent related diseases (infections εuch as that from L. monocytogeneε) and chlamidiae. The agoniεtε may alεo be employed to protect against the deleterious effects of ionizing radiation produced during a course of radiotherapy, such as denaturation of enzymes, lipid peroxidation, and DNA damage.
The agonists may also be employed to mediate an anti¬ viral response, to regulate growth, to mediate the immune responεe and to treat immunodeficiencies related to diseaεeε such as HIV.
Antagonistε to the TNF receptor may be employed to treat autoimmune diεeaεeε, for example, graft versus host rejection and allograft rejection, and T-cell mediated autoimmune diseaεeε εuch aε AIDS. It haε been εhown that T-cell proliferation iε εtimulated via a type 2 TNF receptor. Accordingly, antagonizing the receptor may prevent the proliferation of T-cellε and treat T-cell mediated autoimmune diεeaεeε.
The antagoniεtε may alεo be employed to prevent apoptoεiε, which iε the baεiε for diseaseε εuch as viral infection, rheumatoid arthritis, εyεtemic lupuε erythematosuε, insulin-dependent diabetes mellitus, and graft rejection. Similarly, the antagoniεtε may be employed to prevent cytotoxicity.
The antagoniεtε to the TNF receptor may alεo be employed to treat B cell cancerε which are εtimulated by TNF.
Antagoniεtε to the TNF receptor may also be employed to treat and/or prevent septic shock, which remainε a critical clinical condition. Septic εhock results from an exaggerated host reεponεe, mediated by protein factors εuch aε TNF and IL-1, rather than from a pathogen directly. For example, lipopolyεaccharideε have been εhown to elicit the release of TNF leading to a εtrong and transient increase of its serum concentration. TNF causes shock and tissue injury when administered in excessive amounts. Accordingly, antagoniεtε to the TNF receptor will block the actionε of TNF and treat/prevent septic shock. Theεe antagoniεtε may alεo be employed to treat eningococcemia in children which correlateε with high serum levelε of TNF.
Among other diεorderε which may be treated by the antagonistε to TNF receptorε, there are included, inflammation which iε mediated by TNF receptor ligandε, and the bacterial infectionε cachexia and cerebral malaria. The TNF receptor antagoniεtε may alεo be employed to treat inflammation mediated by ligands to the receptor such as TNF.
The soluble TNF receptor and agonistε and antagoniεtε may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the soluble receptor or agonist or antagoniεt, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but iε not limited to saline, .buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of adminiεtration.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compoεitionε of the invention. Associated with εuch container(ε) can be a notice in the form preεcribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflectε approval by the agency of manufacture, uεe or εale for human adminiεtration. In addition, the εoluble form of the receptor and agoniεtε and antagoniεtε of the preεent invention may also be employed in conjunction with other therapeutic compoundε.
The pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranaεal or intradermal routeε. The pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 μg/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage iε from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routeε of administration, symptoms, etc.
The TNF receptor and agonistε and antagoniεtε which are polypeptides may also be employed in accordance with the present invention by expresεion of such polypeptides in vivo , which is often referred to aε "gene therapy."
Thuε, for example, cellε from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo , with the engineered cellε then being provided to a patient to be treated with the polypeptide. Such methods are well-known in the art. For example, cells may be engineered by procedureε known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
Similarly, cellε may be engineered in vivo for expreεεion of a polypeptide in vivo by, for example, procedureε known in the art. Aε known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the preεent invention may be adminiεtered to a patient for engineering cells in vivo and expression of the polypeptide in vivo . These and other methodε for adminiεtering a polypeptide of the preεent invention by εuch method should be apparent to thoεe skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineering cells may be other than a retroviruε, for example, an adenoviruε which may be uεed to engineer cellε in vivo after combination with a εuitable delivery vehicle. The εequenceε of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there iε a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual εequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those εequenceε with genes asεociated with diεease.
Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region is used to rapidly select primerε that do not εpan more than one exon in the genomic DNA, thuε complicating the amplification proceεs. These primers are then used for PCR screening of somatic cell hybridε .containing individual human chromoεomeε. Only thoεe hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybridε is a rapid procedure for asεigning a particular DNA to a particular chromoεome. Uεing the present invention with the same oligonucleotide primerε, εublocalization can be achieved with panelε of fragmentε from εpecific chromoεomeε or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to itε chromoεome include in situ hybridization, preεcreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromoεome specific-cDNA libraries.
Fluoreεcence in situ hybridization (FISH) of a cDNA clone to a metaphaεe chromoεomal εpread can be uεed to provide a preciεe chromoεomal location in one εtep. Thiε technique can be uεed with cDNA aε εhort aε 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. For example, 2,000 bp is good, 4,000 iε better, and more than 4,000 iε probably not necessary to get good resultε a reasonable percentage of the time. For a review of this technique, see Verma et al. , Human Chromosomeε: a Manual of Baεic Techniqueε, Pergamon Press, New York (1988).
Once a εequence haε been mapped to a preciεe chromosomal location, the physical poεition of the εequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKuεick, Mendelian Inheritance in Man (available on line through Johnε Hopkinε University Welch Medical Library). The relationship between geneε and diεeaεeε that have been mapped to the εame chromosomal region are then identified through linkage analysiε (coinheritance of phyεically adjacent geneε).
Next, it iε necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individualε. If a mutation iε observed in some or all of the affected individualε but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.
With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region asεociated with the diεeaεe could be one of between 50 and 500 potential causative genes. (This assumes 1 megabaεe mapping reεolution and one gene per 20 kb) .
The polypeptideε, their fragmentε or other derivativeε, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragmentε, or the product of an Fab expression library. Various procedures known in the art may be used for the production of εuch antibodieε and fragmentε.
Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptideε itself. In thiε manner, even a sequence encoding only a fragment of the polypeptideε can be used to generate antibodies binding the whole native polypeptideε. Such antibodieε can then be uεed to iεolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodieε produced by continuouε cell line cultureε can be uεed. Exampleε include the hybridoma technique (Kohler and Milεtein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor'βt al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodieε (Cole, et al., 1985, in Monoclonal Antibodieε and Cancer Therapy, Alan R. Liεε, Inc., pp. 77-96).
Techniqueε deεcribed for the production of εingle chain antibodieε (U.S. Patent 4,946,778) can be adapted to produce εingle chain antibodieε to immunogenic polypeptide productε of thiε invention. Alεo, tranεgenic mice may be uεed to expreεε humanized antibodieε to immunogenic polypeptide productε of thiε invention.
The preεent invention will be further deεcribed with reference to the following examples; however, it iε to be underεtood that the present invention iε not limited to εuch examples. All parts or amounts, unless otherwise specified, are by weight.
In order to facilitate understanding of the following exampleε certain frequently occurring methodε and/or ter ε will be deεcribed. "Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedureε. In addition, equivalent plaεmidε to thoεe described are known in the art and will be apparent to the ordinarily skilled artisan.
"Digestion" of DNA refers to catalytic cleavage of the DNA with a reεtriction enzyme that actε only at certain εequenceε in the DNA. The variouε reεtriction enzymeε uεed herein are commercially available and their reaction conditionε, cofactorε and other requirementε were uεed aε would be known to the ordinarily εkilled artiεan. For analytical purposes, typically 1 μg of plasmid or DNA fragment iε uεed with about 2 unitε of enzyme in about 20 μl of buffer εolution. For the purpose of isolating DNA fragmentε for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and subεtrate amountε for particular reεtriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37*C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction iε electrophoreεed directly on a polyacrylamide gel to iεolate the deεired fragment.
Size separation of the cleaved fragmentε iε performed using 8 percent polyacrylamide gel described by Goeddel, D. et al . , Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single εtranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thuε will not ligate to another oligonucleotide without adding a phoεphate with an ATP in the preεence of a kinaεe. A εynthetic oligonucleotide will ligate to a fragment that haε not been dephosphorylated.
"Ligation" refers to the process of forming phosphodieεter bonds between two double stranded nucleic acid fragmentε (Maniatis, T., et al.. Id., p. 146). Unleεε otherwise provided, ligation may be accomplished uεing known bufferε and conditionε with 10 unitε of T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amounts of the DNA fragments to be ligated.
Unlesε otherwise stated, tranεformation waε performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).
Example 1 Bacterial Expresεion and Purification of the TNF receptor
The DNA εequence encoding TNF receptor, ATCC # 75899, iε initially amplified uεing PCR oligonucleotide primerε corresponding to the 5' and 3' end sequenceε of the processed TNF receptor nucleic acid sequence (minus the signal peptide sequence). Additional nucleotides corresponding to TNF receptor gene are added to the 5' and 3' end sequenceε reεpectively. The 5' oligonucleotide primer haε the εequence 5' GCCAGAGOATCCGAAACGTTTCCTCCAAAGTAC 3' (SEQ ID No. 3) contains a BamHI restriction enzyme site (bold) followed by 21 nucleotideε of TNF receptor coding εequence εtarting from the preεumed initiation codon. The 3' εequence 5' CGGCTTCTAGAATTACCTATCATTTCTAAAAAT 3' (SEQ ID No. 4) containε complementary εequenceε to a Hind III site (bold) and iε followed by 18 nucleotideε of TNF receptor. The reεtriction enzyme sites correspond to the restriction enzyme siteε on the bacterial expresεion vector pQE-9 (Qiagen, Inc. Chatεworth, CA) . pQE-9 encodeε antibiotic reεiεtance (Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/0), a riboεome binding εite (RBS), a 6- Hiε tag and reεtriction enzyme εiteε. pQE-9 is then digested with BamHI and Xbal. The amplified sequenceε are ligated into pQE-9 and are inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture iε then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin reεistance (Kanr) . Transformantε are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysiε. Cloneε containing the deεired conεtructε are grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cellε are grown to an optical density 600 (O.D.600) of between 0.4 and 0.6. IPTG ( "Isopropyl-B-D- thiogalacto pyranoεide") iε then added to a final concentration of 1 mM. IPTG induceε by inactivating the lad repressor, clearing the P/0 leading to increased gene expresεion. Cellε are grown an extra 3 to 4 hourε. Cellε are then harvested by centrifugation. The cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl. After clarification, εolubilized TNF receptor is purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)). TNF receptor (90% pure) iε eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpoεe of renaturation adjuεted to 3 molar guanidine HCl, lOOmM εodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized) . After incubation in thiε solution for 12 hours the protein is dialyzed to 10 mmolar εodium phosphate. Example 2 Cloninσ and expreεsion of TNF receptor and extracellular
(soluble. TNF receptor using the baculovirus expresεion εyεtem
The DNA sequence encoding the full length TNF receptor protein, ATCC # 75899, was amplified using PCR oligonucleotide primers correεponding to the 5' and 3' εequenceε of the gene. The 5' primer haε the εequence 5' GCGCGGATCCATGAACAAGTTGCTGTGCTGC 3' (SEQ ID No. 5) and containε a BamHI reεtriction enzyme εite (in bold) and which iε juεt behind the first 21 nucleotideε of the TNF receptor gene (the initiation codon for tranεlation "ATG" iε underlined) .
The 3' primer haε the εequence 5' GCGCTCTAGATTA CCTATCATTTCTAAAAATAAC 3' (SEQ ID No. 6) and 5' GCGCGGTACCTCAGTGGTTTGGGCTCCTCCC 3' (SEQ ID No. 7) and containε the cleavage εite for the reεtriction endonuclease Xbal and 21 nucleotides complementary to the 3' non- translated sequence of the TNF receptor gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean", BIO 101 Inc., La Jolla, Ca.). The fragments were then digested with the endonucleases BamHI and Xbal and then purified again on a 1% agaroεe gel. Thiε fragment iε designated F2.
The vector pRGl (modification of pVL941 vector, discuεεed below) waε uεed for the expreεεion of the TNF receptor proteinε uεing the baculovirus expresεion system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovirus vectorε and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosiε viruε (AcMNPV) followed by the recognition εiteε for the reεtriction endonucleaεeε BamHI and Xbal. The polyadenylation εite of the εimian viruε (SV)40 waε used for efficient polyadenylation. For an easy selection of recombinant viruses the beta-galactoεidase gene from E.coli waε inεerted in the same orientation aε the polyhedrin promoter followed by the polyadenylation εignal of the polyhedrin gene. The polyhedrin sequences were flanked at both sides by viral sequenceε for the cell-mediated homologous recombination of cotransfected wild-type viral DNA. Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
The plasmid waε digeεted with the restriction enzymes BamHI and Xbal. The DNA waε then iεolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). Thiε vector DNA iε deεignated V2.
Fragment F2 and the dephoεphorylated plaεmid V2 were ligated with T4 DNA ligase. E. coli HB101 cellε were then tranεformed and cellε identified that contained the plasmid (pBac TNF receptor) with the TNF receptor genes using the enzymes BamHI and Xbal. The sequence of the cloned fragment was confirmed by DNA sequencing.
5 μg of the plaεmid pBac TNF receptor was cotranεfected with 1.0 μg of a commercially available linearized baculoviruε ("BaculoGoldτ" baculoviruε DNA", Pharmingen, San Diego, CA. ) using the lipofection method (Feigner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)). lμg of BaculoGold™ virus DNA and 5 μg of the plasmid pBac TNF receptorε were mixed in a εterile well of a microtiter plate containing 50 μl of serum free Grace's medium (Life Technologies Inc., Gaitherβburg, MD) . Afterwards 10 μl Lipofectin pluε 90 μl Grace'ε medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture waε added dropwiεe to the Sf9 inεect cellε (ATCC CRL 1711) seeded in a 35 mm tisεue culture plate with 1ml Grace' medium without serum. The plate was rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hourε at 27°C. After 5 hourε the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum waε added. The plate waε put back into an incubator and cultivation continued at 27°C for four days.
After four days the εupernatant waε collected and a plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologieε Inc., Gaitherεburg) waε uεed which allowε an easy isolation of blue εtained plaqueε. (A detailed description of a "plaque aεεay" can also be found in the user'ε guide for inεect cell culture and baculovirology diεtributed by Life Technologieε Inc., Gaitherεburg, page 9- 10).
Four dayε after the serial dilution, the viruses were added to the cells and blue stained plaques were picked with the tip' of an Eppendorf pipette. The agar containing the recombinant viruεes were then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar waε removed by a brief centrifugation and the εupernatant containing the recombinant baculoviruεeε waε uεed to infect Sf9 cellε seeded in 35 mm dishes. Four days later the supematants of these culture disheε were harveεted and then εtored at 4°C.
Sf9 cellε were grown in Grace'ε medium εupplemented with 10% heat-inactivated FBS. The cellε were infected with the recombinant baculovirus V-TNF receptor at a multiplicity of infection (MOI) of 2. Six hours later the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologieε Inc., Gaitherεburg). 42 hourε later 5 μCi of 35S-methionine and 5 μCi 35S cyεteine (Amerεham) were added. The cellε are further incubated for 16 hourε before they are harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography. Example 3 Expreεsion of Recombinant TNF receptor in COS cells
The expresεion of plasmid, TNF receptor HA iε derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resiεtance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation εite. A DNA fragment encoding the entire TNF receptor precurεor and a HA tag fuεed in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expreεεion iε directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previouεly described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plaεmid conεtruction εtrategy iε described aε follows:
The DNA sequence encoding TNF receptor, ATCC # 75899, iε constructed by PCR using two primers: the 5' primer 5' GCCAGAGGATCCGCCACCATGAACAAGTTGCTGTGCTGC 3' (SEQ ID No. 8) containε a BamHI εite (bold) followed by 21 nucleotides of TNF receptor coding sequence starting from the initiation codon; the 3' sequence 5' CGGCTTCTAGAATCAAGCGTAGTCTGGGACG TCGTATGGGTACCTATCATTTCTAAAAAT 3' (SEQ ID No. 9) contains complementary εequenceε to an Xbal εite (bold), translation stop codon, HA tag and the last 18 nucleotides of the TNF receptor coding sequence (not including the εtop codon). Therefore, the PCR product contains a BamHI εite, TNF receptor coding εequence followed by HA tag fuεed in frame, a translation termination stop codon next to the HA tag, and an Xbal site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with BamHI and Xbal restriction enzymes and ligated. The ligation mixture is transformed into E. coli εtrain SURE (Stratagene Cloning Syεtemε, La Jolla, CA) the tranεformed culture iε plated on ampicillin media plateε and reεiεtant colonieε are εelected. Plaεmid DNA is isolated from transformantε and examined by reεtriction analyεiε for the preεence of the correct fragment. For expreεεion of the recombinant TNF receptor, COS cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatiε, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expreεεion of the TNF receptor HA protein iε detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodieε: A Laboratory Manual, Cold Spring Harbor Laboratory Preεε, (1988)). Cellε are labelled for 8 hourε with 35S-cysteine two days poεt tranεfection. Culture media are then collected and cellε are lyεed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Triε, pH 7.5) (Wilεon, I. et al., Id. 37:767 (1984)). Both cell lyεate and culture media are precipitated with a HA εpecific monoclonal antibody. Proteinε precipitated are analyzed on 15% SDS-PAGE gelε.
Numerouε modificationε and variationε of the preεent invention are poεεible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.
SEQUENCE LISTING
(1) GENERAL INFORMATION: (i) APPLICANT: GREENE, ET AL.
(ii) TITLE OF INVENTION: Human Tumor Necroεiε Factor
Receptor
(iii) NUMBER OF SEQUENCES: 9
(iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: CARELLA, BYRNE, BAIN, GILFILLAN,
CECCHI, STEWART & OLSTEIN
(B) STREET: 6 BECKER FARM ROAD
(C) CITY: ROSELAND
(D) STATE: NEW JERSEY
(E) COUNTRY: USA
(F) ZIP: 07068
(v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH DISKETTE
(B) COMPUTER: IBM PS/2
(C) OPERATING SYSTEM: MS-DOS
(D) SOFTWARE: WORD PERFECT 5.1
(Vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE: Concurrently
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA
(A) APPLICATION NUMBER:
(B) FILING DATE: (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: FERRARO, GREGORY D.
(B) REGISTRATION NUMBER: 36,134
(C) REFERENCE/DOCKET NUMBER: 325800-266
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 201-994-1700
(B) TELEFAX: 201-994-1744
(2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 1173 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
ATGAACAAGT TGCTGTGCTG CGCGCTCGTG TTTCTGGACA TCTCCATTAA GTGGACCACC 60
CAGGAAACGT TTCCTCCAAA GTACCTTCAT TATGACGAAG AAACCTCTCA TCAGCTGTTG 120
TGTGACAAAT GTCCTCCTGG TACCTACCTA AAACAACACT GTACAGCAAA GTGGAAGACC 180
GTGTGCGCCC CTTGCCCTGA CCACTACTAC ACAGACAGCT GGCACACCAG TGACGAGTGT 240
CTATACTGCA GCCCCGTGTG CAAGGAGCTG CAGTACGTCA AGCAGGAGTG CAATCGCACC 300
CACAACCGCG TGTGCGAATG CAAGGAAGGG CGCTACCTTG AGATAGAGTT CTGCTTGAAA 360
CATAGGAGCT GCCCTCCTGG ATTTGGAGTG GTGCAAGCTG GAACCCCAGA GCGAAATACA 420
GTTTGCAAAA GATGTCCAGA TGGGTTCTTC TCAAATGAGA CGTCATCTAA AGCACCCTGT 480
AGAAAACACA CAAATTGCAG TGTCTTTGGT CTCCTGCTAA CTCAGAAAGG AAATGCAACA 540
CACGACAACA TATGTTCCGG AAACAGTGAA TCAACTCAAA AATGTGGAAT AGATGTTACC 600
CTGTGTGAGG AGGCATTCTT CAGGTTTGCT GTTCCTACAA AGTTTACGCC TAACTGGCTT 660
AGTGTCTTGG TAGACAATTT GCCTGGCACC AAAGTAAACG CAGAGAGTGT AGAGAGGATA 720
AAACGGCAAC ACAGCTCACA AGAACAGACT TTCCAGCTGC TGAAGTTATG GAAACATCAA 780
AACAAAGACC AAGATATAGT CAAGAAGATC ATCCAAGATA TTGACCTCTG TGAAAACAGC 840
GTGCAGCGGC ACATTGGACA TGCTAACCTC ACCTTCGAGC AGCTTCGTAG CTTGATGGAA 900
AGCTTACCGG GAAAGAAAGT GGGAGCAGAA GACATTGAAA AAACAATAAA GGCATGCAAA 960
CCCAGTGACC AGATCCTGAA GCTGCTCAGT TTGTGGCGAA TAAAAAATGG CGACCAAGAC 1020 ACCTTGAAGG GCCTAATGCA CGCACTAAAG CACTCAAAGA CGTACCACTT TCCCACAAAC 1080 TGTCACTCAG AGTCTAAAGA AGACCATCAG GTTCCTTCAC AGCTTCACAA TGTACAAATT 1140 GTATCAGAAG TTATTTTTAG AAATGATAGG TAA 11 3
(2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 390 AMINO ACIDS
(B) TYPE: AMINO ACID
(C) STRANDEDNESS:
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: PROTEIN
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Asn Lyε Leu Leu Cyε Cyε Ala Leu Val Phe Leu Aεp lie Ser
-20 -15 -10 lie Lyε Trp Thr Thr Gin Glu Thr Phe Pro Pro Lyε Tyr Leu Hiε
-5 1 5
Tyr Aεp Glu Glu Thr Ser Hiε Gin Leu Leu Cys Asp Lys Cys Pro
10 15 20
Pro Gly Thr Tyr Leu Lys Gin Hiε Cyε Thr Ala Lyε Trp Lyε Thr 25 30 35
Val Cys Ala Pro Cys Pro Asp His Tyr Tyr Thr Asp Ser Trp His
40 45 50
Thr Ser Asp Glu Cys Leu Tyr Cyε Ser Pro Val Cyε Lyε Glu Leu
55 60 65
Gin Tyr Val Lyε Gin Glu Cyε Aεn Arg Thr Hiε Aεn Arg Val Cyε
70 75 80
Glu Cyε Lyε Glu Gly Arg Tyr Leu Glu lie Glu Phe Cyε Leu Lyε
85 90 95
Hiε Arg Ser Cyε Pro Pro Gly Phe Gly Val Val Gin Ala Gly Thr 100 105 110
Pro Glu Arg Aεn Thr Val Cys Lys Arg Cyε Pro Aεp Gly Phe Phe 115 120 125 Ser Asn Glu Thr Ser Ser Lys Ala Pro Cyε Arg Lyε Hiε Thr Aεn
130 135 140
Cyε Ser Val Phe Gly Leu Leu Leu Thr Gin Lys Gly Aεn Ala Thr
145 150 155
Hiε Aεp Aεn lie Cyε Ser Gly Aεn Ser Glu Ser Thr Gin Lyε Cyε
160 165 170
Gly lie Aεp Val Thr Leu Cyε Glu Glu Ala Phe Phe Arg Phe Ala
175 180 185
Val Pro Thr Lyε Phe Thr Pro Aεn Trp Leu Ser Val Leu Val Aεp
190 195 200
Aεn Leu Pro Gly Thr Lyε Val Aεn Ala Glu Ser Val Glu Arg lie
205 210 215
Lyε Arg Gin Hiε Ser Ser Gin Glu Gin Thr Phe Gin Leu Leu Lys
220 225 230
Leu Trp Lys His Gin Asn Lyε Aεp Gin Aεp lie Val Lyε Lyε lie
235 240 245 lie Gin Aεp lie Aεp Leu Cyε Glu Aεn Ser Val Gin Arg Hiε lie
250 - 255 260
Gly Hiε Ala Asn Leu Thr Phe Glu Gin Leu Arg Ser Leu Met Glu
265 270 275
Ser Leu Pro Gly Lys Lys Val Gly Ala Glu Asp lie Glu Lys Thr
280 285 290 lie Lys Ala Cys Lys Pro Ser Asp Gin lie Leu Lys Leu Leu Ser
295 300 305
Leu Trp Arg lie Lys Asn Gly Asp Gin Asp Thr Leu Lyε Gly Leu
310 315 320
Met Hiε Ala Leu Lyε Hiε Ser Lys Thr Tyr Hiε Phe Pro Thr Aεn
325 330 335
Cys His Ser Glu Ser Lys Glu Asp His Gin Val Pro Ser Gin Leu
340 345 350
His Asn Val Gin He Val Ser Glu Val He Phe Arg Asn Asp Arg
355 360 365
(2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 33 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
GCCAGAGGAT CCGAAACGTT TCCTCCAAAG TAC 33
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 33 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
CGGCTTCTAG AATTACCTAT CATTTCTAAA AAT 33
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 31 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GCGCGGATCC ATGAACAAGT TGCTGTGCTG C 31
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 34 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
GCGCTCTAGA TTACCTATCA TTTCTAAAAA TAAC 34
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 31 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
GCGCGGTACC TCAGTGGTTT GGGCTCCTCC C 31
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS (A) LENGTH: 39 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
GCCAGAGGAT CCGCCACCAT GAACAAGTTG CTGTGCTGC 39
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS
(A) LENGTH: 60 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: Oligonucleotide
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
CGGCTTCTAG AATCAAGCGT AGTCTGGGAC GTCGTATGGG TACCTATCAT TTCTAAAAAT 60

Claims

WHAT IS CLAIMED IS:
1. An iεolated polynucleotide εelected from the group conεiεting of:
(a) a polynucleotide encoding the polypeptide having the deduced amino acid εequence of SEQ ID No. 2 or a fragment, analog or derivative of εaid polypeptide;
(b) a polynucleotide encoding the polypeptide having the amino acid εequence encoded by the cDNA contained in ATCC Deposit No. 75899 or a fragment, analog or derivative of said polypeptide.
2. The polynucleotide of Claim 1 wherein the polynucleotide is DNA.
3. The polynucleotide of Claim 1 wherein the polynucleotide iε RNA.
4. The polynucleotide of Claim 1 wherein the polynucleotide iε genomic DNA.
5. The polynucleotide of Claim 2 wherein εaid polynucleotide encodes the polypeptide having the deduced amino acid εequence of SEQ ID No. 2.
6. The polynucleotide of Claim 2 wherein εaid polynucleotide encodeε the polypeptide encoded by the cDNA of ATCC Depoεit No. 75899.
7. The polynucleotide of Claim 1 having the coding εequence of the polypeptide εhown in SEQ ID No. 2.
8. The polynucleotide of Claim 2 having the coding εequence of the polypeptide depoεited aε ATCC Depoεit No. 75899.
9. A vector containing the DNA of Claim 2.
10. A hoεt cell genetically engineered with the vector of Claim 9.
11. A proceεε for producing a polypeptide compriεing: expreεεing from the host cell of Claim 10 the polypeptide encoded by said DNA.
12. A proceεε for producing cellε capable of expreεsing a polypeptide comprising genetically engineering cells with the vector of Claim 9.
13. An isolated DNA hybridizable to the DNA of Claim 2 and encoding a polypeptide having TNF receptor activity.
14. A polypeptide εelected from the group conεiεting of (i) a polypeptide having the deduced amino acid εequence of SEQ ID No. 2 and fragments, analogs and derivatives thereof and (ii) a polypeptide encoded by the cDNA of ATCC Deposit No. 75899 and fragmentε, analogε and derivativeε of said polypeptide.
15. The polypeptide of Claim 14 wherein the polypeptide has the deduced amino acid sequence of SEQ ID No. 2.
16. An antibody against the polypeptide of claim 14.
17. A compound which activates the polypeptide of claim 14.
18. ' A compound which activates the polypeptide of claim 14.
19. A method for the treatment of a patient having need to activate a TNF receptor comprising: adminiεtering to the patient a therapeutically effective amount of the compound of claim 18.
20. A method for the treatment of a patient having need to inhibit a TNF receptor compriεing: adminiεtering to the patient a therapeutically effective amount of the compound of claim 17.
21. The method of claim 19 wherein said therapeutically effective amount of the compound is administered by providing to the patient DNA encoding said compound and expresεing εaid compound in vivo .
22. The method of claim 20 wherein εaid therapeutically effective amount of the compound iε adminiεtered by providing to the patient DNA encoding εaid compound and expreεεing said compound in vivo .
23. A method for identifying agonists and antagonistε to the polypeptide of claim 14 compriεing:
(a) combining TNF-receptor, a reaction mixture containing cellε which proliferate in response to a ligand known to bind to the TNF-receptor and a compound to be screened under conditions where the ligand binds to the TNF receptor polypeptide; and
(b) determining whether the compound inhibits or enhanceε the interaction of the TNF receptor and the ligand.
24. A proceεε for diagnoεing a diεeaεe or a εusceptibility to a disease related to an under-expression of the polypeptide of claim 14 compriεing: determining a mutation in the nucleic acid εequence encoding εaid polypeptide.
25. The polypeptide of Claim 14 wherein the polypeptide iε a εoluble fragment of the TNF receptor and iε capable of binding a ligand for the receptor.
26. A diagnoεtic proceεε compriεing: analyzing for the preεence of the polypeptide of claim 25 in a εample derived from a host.
27. A procesε for determining whether a ligand not known to be capable of binding to the polypeptide of claim 14 can bind thereto compriεing: contacting a mammalian cell which expreεses the receptor with a potential ligand; detecting the presence of the ligand which binds to the receptor; and determining whether the ligand binds to the receptor.
PCT/US1995/003216 1995-03-15 1995-03-15 Human tumor necrosis factor receptor WO1996028546A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
AU21599/95A AU2159995A (en) 1995-03-15 1995-03-15 Human tumor necrosis factor receptor
EP95914722A EP0819168A4 (en) 1995-03-15 1995-03-15 Human tumor necrosis factor receptor
JP8527539A JPH11503007A (en) 1995-03-15 1995-03-15 Human tumor necrosis factor receptor
PCT/US1995/003216 WO1996028546A1 (en) 1995-03-15 1995-03-15 Human tumor necrosis factor receptor
ZA952587A ZA952587B (en) 1995-03-15 1995-03-29 Human tumor necrosis factor receptor
US08/469,637 US7094564B1 (en) 1995-03-15 1995-06-06 Human tumor necrosis factor receptor
US08/718,737 US8110659B1 (en) 1995-03-15 1996-09-18 Human tumor necrosis factor receptor-like genes
CA002211003A CA2211003A1 (en) 1995-03-15 1997-09-19 Human tumor necrosis factor receptor
US09/526,437 US7078493B1 (en) 1995-03-15 2000-03-15 Antibodies to human tumor necrosis factor receptor-like genes
JP2002066838A JP2002320479A (en) 1995-03-15 2002-03-12 Human tumor necrosis factor receptor
US10/155,167 US20030166097A1 (en) 1995-03-15 2002-05-28 Human tumor necrosis factor receptor
US10/164,592 US20020150989A1 (en) 1995-03-15 2002-06-10 Human tumor necrosis factor receptor

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
PCT/US1995/003216 WO1996028546A1 (en) 1995-03-15 1995-03-15 Human tumor necrosis factor receptor
ZA952587A ZA952587B (en) 1995-03-15 1995-03-29 Human tumor necrosis factor receptor
CA002211003A CA2211003A1 (en) 1995-03-15 1997-09-19 Human tumor necrosis factor receptor
JP2002066838A JP2002320479A (en) 1995-03-15 2002-03-12 Human tumor necrosis factor receptor

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US08/469,637 Continuation US7094564B1 (en) 1995-03-15 1995-06-06 Human tumor necrosis factor receptor
US08/469,637 Continuation-In-Part US7094564B1 (en) 1995-03-15 1995-06-06 Human tumor necrosis factor receptor

Publications (1)

Publication Number Publication Date
WO1996028546A1 true WO1996028546A1 (en) 1996-09-19

Family

ID=31721537

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1995/003216 WO1996028546A1 (en) 1995-03-15 1995-03-15 Human tumor necrosis factor receptor

Country Status (4)

Country Link
JP (1) JP2002320479A (en)
CA (1) CA2211003A1 (en)
WO (1) WO1996028546A1 (en)
ZA (1) ZA952587B (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2312899A (en) * 1995-12-22 1997-11-12 Amgen Inc Osteoprotegerin
EP0816380A1 (en) * 1995-02-20 1998-01-07 Snow Brand Milk Products Co., Ltd. Novel protein and methods for the production of the same
EP0861850A1 (en) * 1997-02-04 1998-09-02 Smithkline Beecham Corporation Tumor necrosis related receptor, TR4
EP0897114A2 (en) * 1997-08-13 1999-02-17 Smithkline Beecham Corporation A method of identifying agonist and antagonists for tumor necrosis related receptors TR1 and TR2
EP0960196A1 (en) * 1996-10-04 1999-12-01 Immunex Corporation Novel receptor that causes cell death
EP0961832A1 (en) * 1996-09-18 1999-12-08 Human Genome Sciences, Inc. Human tumor necrosis factor receptor-like genes
US6015938A (en) * 1995-12-22 2000-01-18 Amgen Inc. Osteoprotegerin
US6297022B1 (en) 1997-10-08 2001-10-02 Smithkline Beecham Corporation Method of identifying agonists and antagonists for tumor necrosis related receptor TR1
US6693175B2 (en) 1997-09-24 2004-02-17 Sankyo Co., Ltd. Method for diagnosing bone dysbolism
US6919434B1 (en) 1995-02-20 2005-07-19 Sankyo Co., Ltd. Monoclonal antibodies that bind OCIF
US7078493B1 (en) 1995-03-15 2006-07-18 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor-like genes
US7192718B2 (en) 1997-04-15 2007-03-20 Sankyo Co. Ltd Methods for identifying a substance which specifically binds to an osteoclastogenesis inhibitory factor-binding molecule and modulates the biological activity thereof
US7411050B2 (en) 1996-12-23 2008-08-12 Immunex Corporation Monoclonal blocking antibody to human RANKL
EP1992636A2 (en) 1999-11-12 2008-11-19 Amgen Inc. Process for correction of a disulfide misfold in Fc molecules
EP2087908A1 (en) 2001-06-26 2009-08-12 Amgen, Inc. Antibodies to opgl
US7632922B1 (en) 1995-12-22 2009-12-15 Amgen, Inc. Osteoprotegerin
US7718776B2 (en) 2002-04-05 2010-05-18 Amgen Inc. Human anti-OPGL neutralizing antibodies as selective OPGL pathway inhibitors
US7807795B2 (en) 1997-04-16 2010-10-05 Amgen Inc. Antibodies to osteoprotegerin binding proteins
US7923008B2 (en) 1997-04-16 2011-04-12 Amgen Inc. Methods for decreasing osteoclast formation or bone resorption using an antibody to osteoprotegerin binding protein
US8110659B1 (en) 1995-03-15 2012-02-07 Human Genome Sciences, Inc. Human tumor necrosis factor receptor-like genes

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4050593B2 (en) 2002-11-01 2008-02-20 日本特殊陶業株式会社 Gas sensor element and gas sensor using the same

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CELL, Vol. 68, issued 07 February 1992, H. DURKOP et al., "Molecular Cloning and Expression of a New Member of the Nerve Growth Factor Receptor Family that is Characteristic for Hodgkin's Disease", pages 421-427. *
DNA AND CELL BIOLOGY, Vol. 9, No. 10, issued 1990, A. HIMMLER et al., "Molecular Cloning and Expression of Human and Rat Tumor Necrosis Factor Receptor Chain (p60) and its Soluble Derivative, Tumor Necrosis Factor-Binding Protein", pages 705-715. *
EUR. J. BIOCHEM., Vol. 220, issued April 1994, X. VAN OSTADE et al., "Human Tumor Necrosis Factor Mutants with Preferential Binding to and Activity on Either the R55 or R75 Receptor", pages 771-779. *
J. IMMUNOL., Vol. 147, No. 9, issued 01 November 1991, D. CAMERINI et al., "The T Cell Activation Antigen CD27 is a Member of the Nerve Growth Factor/Tumor Necrosis Factor Receptor Gene Family", pages 3165-3169. *
See also references of EP0819168A4 *

Cited By (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6855808B2 (en) 1995-02-20 2005-02-15 Sankyo Co., Ltd. Proteins and methods for producing the proteins
EP0816380A1 (en) * 1995-02-20 1998-01-07 Snow Brand Milk Products Co., Ltd. Novel protein and methods for the production of the same
EP0816380A4 (en) * 1995-02-20 1998-11-18 Snow Brand Milk Products Co Ltd Novel protein and methods for the production of the same
US7468268B2 (en) 1995-02-20 2008-12-23 Daiichi Sankyo Co., Ltd. Nucleic acid molecules encoding osteoclastogenesis inhibitory factor proteins
US7276344B2 (en) 1995-02-20 2007-10-02 Sankyo Co., Ltd. Methods for using the osteoclastogenesis inhibitory factor (OCIF) protein
US7205397B2 (en) 1995-02-20 2007-04-17 Sankyo, Co., Ltd. Proteins and methods for producing the proteins
US7125686B1 (en) 1995-02-20 2006-10-24 Sankyo Co., Ltd. Proteins and methods for producing the proteins
US6919434B1 (en) 1995-02-20 2005-07-19 Sankyo Co., Ltd. Monoclonal antibodies that bind OCIF
EP1528103A1 (en) * 1995-02-20 2005-05-04 Sankyo Co., Ltd. 'Osteoclast-inhibitory factor' (OCIF) derived proteins and methods for producing the proteins
US8110659B1 (en) 1995-03-15 2012-02-07 Human Genome Sciences, Inc. Human tumor necrosis factor receptor-like genes
US7078493B1 (en) 1995-03-15 2006-07-18 Human Genome Sciences, Inc. Antibodies to human tumor necrosis factor receptor-like genes
US6284740B1 (en) 1995-12-22 2001-09-04 Amgen Inc. Osteoprotegerin
US6015938A (en) * 1995-12-22 2000-01-18 Amgen Inc. Osteoprotegerin
GB2312899A (en) * 1995-12-22 1997-11-12 Amgen Inc Osteoprotegerin
US6284728B1 (en) 1995-12-22 2001-09-04 Amgen Inc. Osteoprotegerin
US6288032B1 (en) 1995-12-22 2001-09-11 Amgen Inc. Osteoprotegerin
US6284485B1 (en) 1995-12-22 2001-09-04 Amgen Inc. Nucleic acids encoding osteoprotegerin
JP4657388B2 (en) * 1995-12-22 2011-03-23 アムジエン・インコーポレーテツド Osteoprotegerin
US6369027B1 (en) 1995-12-22 2002-04-09 Amgen Inc. Osteoprotegerin
EP1990415A1 (en) * 1995-12-22 2008-11-12 Amgen Inc. Osteoprotegerin
JPH11503616A (en) * 1995-12-22 1999-03-30 アムジエン・インコーポレーテツド Osteoprotegerin
US6613544B1 (en) 1995-12-22 2003-09-02 Amgen Inc. Osteoprotegerin
GB2312899B (en) * 1995-12-22 1999-05-05 Amgen Inc Osteoprotegerin
EP2332974A3 (en) * 1995-12-22 2012-01-11 Amgen, Inc Osteoprotegerin
US7632922B1 (en) 1995-12-22 2009-12-15 Amgen, Inc. Osteoprotegerin
EP0961832A1 (en) * 1996-09-18 1999-12-08 Human Genome Sciences, Inc. Human tumor necrosis factor receptor-like genes
EP0961832A4 (en) * 1996-09-18 2003-02-26 Human Genome Sciences Inc Human tumor necrosis factor receptor-like genes
EP0960196A4 (en) * 1996-10-04 2002-10-29 Immunex Corp Novel receptor that causes cell death
EP0960196A1 (en) * 1996-10-04 1999-12-01 Immunex Corporation Novel receptor that causes cell death
US7932375B2 (en) 1996-12-23 2011-04-26 Immunex Corporation Kits for detecting rank nucleic acids
US7744886B2 (en) 1996-12-23 2010-06-29 Immunex Corporation Methods for interfering with rank signaling
US8715683B2 (en) 1996-12-23 2014-05-06 Immunex Corporation RANK ligand polypeptides
US7411050B2 (en) 1996-12-23 2008-08-12 Immunex Corporation Monoclonal blocking antibody to human RANKL
US8377690B2 (en) 1996-12-23 2013-02-19 Immunex Corporation Cells and methods for producing blocking antibodies to human RANKL
EP0861850A1 (en) * 1997-02-04 1998-09-02 Smithkline Beecham Corporation Tumor necrosis related receptor, TR4
US5885800A (en) * 1997-02-04 1999-03-23 Smithkline Beecham Corporation DNA encoding tumor necrosis related receptor, TR4
US7449185B2 (en) 1997-04-15 2008-11-11 Daiichi Sankyo Company, Limited Antibodies to OCIF-binding molecules
US7527790B2 (en) 1997-04-15 2009-05-05 Daiichi Sankyo Company, Limited Methods of reducing bone absorption comprising administering an antibody that binds OBM
US7192718B2 (en) 1997-04-15 2007-03-20 Sankyo Co. Ltd Methods for identifying a substance which specifically binds to an osteoclastogenesis inhibitory factor-binding molecule and modulates the biological activity thereof
US7807795B2 (en) 1997-04-16 2010-10-05 Amgen Inc. Antibodies to osteoprotegerin binding proteins
US7923008B2 (en) 1997-04-16 2011-04-12 Amgen Inc. Methods for decreasing osteoclast formation or bone resorption using an antibody to osteoprotegerin binding protein
US6346388B1 (en) 1997-08-13 2002-02-12 Smithkline Beecham Corporation Method of identifying agonist and antagonists for tumor necrosis related receptors TR1 and TR2
EP0897114A2 (en) * 1997-08-13 1999-02-17 Smithkline Beecham Corporation A method of identifying agonist and antagonists for tumor necrosis related receptors TR1 and TR2
EP0897114A3 (en) * 1997-08-13 2000-04-26 Smithkline Beecham Corporation A method of identifying agonist and antagonists for tumor necrosis related receptors TR1 and TR2
US6998242B2 (en) 1997-09-24 2006-02-14 Sankyo Co., Ltd. Method of diagnosing metabolic bone diseases
US6693175B2 (en) 1997-09-24 2004-02-17 Sankyo Co., Ltd. Method for diagnosing bone dysbolism
US6297022B1 (en) 1997-10-08 2001-10-02 Smithkline Beecham Corporation Method of identifying agonists and antagonists for tumor necrosis related receptor TR1
EP1992636A2 (en) 1999-11-12 2008-11-19 Amgen Inc. Process for correction of a disulfide misfold in Fc molecules
EP2087908A1 (en) 2001-06-26 2009-08-12 Amgen, Inc. Antibodies to opgl
EP3492100A1 (en) 2001-06-26 2019-06-05 Amgen Inc. Antibodies to opgl
US8367063B2 (en) 2002-04-05 2013-02-05 Amgen, Inc. Human anti-OPGL neutralizing antibodies as selective OPGL pathway inhibitors
US7718776B2 (en) 2002-04-05 2010-05-18 Amgen Inc. Human anti-OPGL neutralizing antibodies as selective OPGL pathway inhibitors
US8455629B2 (en) 2002-04-05 2013-06-04 Amgen Inc. Human anti-OPGL neutralizing antibodies as selective OPGL pathway inhibitors

Also Published As

Publication number Publication date
ZA952587B (en) 1996-11-27
CA2211003A1 (en) 1999-03-19
JP2002320479A (en) 2002-11-05

Similar Documents

Publication Publication Date Title
EP0822984A1 (en) Human tumor necrosis factor receptors
CA2203655C (en) Tumor necrosis factor-gamma
WO1996028546A1 (en) Human tumor necrosis factor receptor
WO1996039515A9 (en) Human vascular endothelial growth factor 2
WO1995017092A1 (en) MACROPHAGE INFLAMMATORY PROTEINS-3, -4 AND -1¿η?
WO1996039515A1 (en) Human vascular endothelial growth factor 2
EP0828751A1 (en) Human neuropeptide receptor
WO1996034891A1 (en) Human chemokine beta-8, chemokine beta-1 and macrophage inflammatory protein-4
WO1996005856A1 (en) Human chemokine polypeptides
US7094564B1 (en) Human tumor necrosis factor receptor
EP0815137A1 (en) Human g-protein chemokine receptor hdgnr10
WO1996030406A1 (en) Human g-protein coupled receptors
WO1996006169A1 (en) Human chemokine beta-9
EP0811059A1 (en) Human chemokine beta-11 and human chemokine alpha-1
WO1996016087A1 (en) G-protein coupled receptor
WO1997002280A1 (en) Breast specific genes and proteins
WO1996039507A1 (en) Fibroblast growth factor 11
US20030166097A1 (en) Human tumor necrosis factor receptor
WO1996003415A1 (en) Human potassium channel 1 and 2 proteins
EP0835264A1 (en) Human g-protein receptor hcegh45
WO1996017931A1 (en) Human vascular ibp-like growth factor
EP0819168A1 (en) Human tumor necrosis factor receptor
AU684539C (en) Macrophage inflammatory proteins-3, -4 and -1 Gamma
WO1997017358A1 (en) Mammary transforming protein
CA2215383A1 (en) Human tumor necrosis factor receptor

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 08469637

Country of ref document: US

AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA CN JP KR MX NZ US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2215383

Country of ref document: CA

Ref country code: CA

Ref document number: 2215383

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 1996 527539

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 1995914722

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1995914722

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1995914722

Country of ref document: EP