WO1996037620A2 - Verfahren zur gewinnung von acyloinen, dafür geeignete pyruvat-decarboxylase sowie deren herstellung und dna-sequenz des für diese kodierenden pdc-gens - Google Patents

Verfahren zur gewinnung von acyloinen, dafür geeignete pyruvat-decarboxylase sowie deren herstellung und dna-sequenz des für diese kodierenden pdc-gens Download PDF

Info

Publication number
WO1996037620A2
WO1996037620A2 PCT/DE1996/000928 DE9600928W WO9637620A2 WO 1996037620 A2 WO1996037620 A2 WO 1996037620A2 DE 9600928 W DE9600928 W DE 9600928W WO 9637620 A2 WO9637620 A2 WO 9637620A2
Authority
WO
WIPO (PCT)
Prior art keywords
codon
pdc
amino acid
dna sequence
acid residue
Prior art date
Application number
PCT/DE1996/000928
Other languages
English (en)
French (fr)
Other versions
WO1996037620A3 (de
Inventor
Heike Bruhn
Martina Pohl
Katrin Mesch
Maria-Regina Kula
Original Assignee
Forschungszentrum Jülich GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Forschungszentrum Jülich GmbH filed Critical Forschungszentrum Jülich GmbH
Priority to EP96919594A priority Critical patent/EP0828841A2/de
Priority to JP8535270A priority patent/JPH11505710A/ja
Priority to AU58102/96A priority patent/AU714414B2/en
Priority to BR9608798A priority patent/BR9608798A/pt
Publication of WO1996037620A2 publication Critical patent/WO1996037620A2/de
Publication of WO1996037620A3 publication Critical patent/WO1996037620A3/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
    • C12P7/26—Ketones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C49/00—Ketones; Ketenes; Dimeric ketenes; Ketonic chelates
    • C07C49/20—Unsaturated compounds containing keto groups bound to acyclic carbon atoms
    • C07C49/24—Unsaturated compounds containing keto groups bound to acyclic carbon atoms containing hydroxy groups
    • C07C49/245—Unsaturated compounds containing keto groups bound to acyclic carbon atoms containing hydroxy groups containing six-membered aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)

Definitions

  • the invention relates to a process for the production of acyloin by enzymatic conversion of ⁇ -ketocarboxylic acids and / or aldehydes in the presence of pyruvate decarboxylase (PDC) and it includes a PDC suitable therefor and its production and the gene coding therefor.
  • PDC pyruvate decarboxylase
  • Acyloins or ⁇ -hydroxyketones are compounds with an optically active carbon atom that play a significant role in the synthesis of more complex compounds, such as, in particular, the (R) - (-) -phenylacetylcarbinol
  • PAC which is of great economic interest for the production of ephedrine.
  • R enantiomer is of interest, which is formed by fermentative conversion of pyruvate in the presence of benzaldehyde by means of Saccharomyces cerevisiae (DE-PS 548 459 from 1932).
  • the pyruvate decarboxylase (PDC) isolated from the yeast also leads to considerable proportions of the 2-hydroxypropiophenone isomeric to PAC in this reaction.
  • Such an enzymatic conversion also takes place starting from an aldehyde instead of ⁇ -ketocarboxylic acids, and the aldehyde formed by the decarbooxylation can also act as a "cosubstrate" in the condensation reaction with the formation of homoacyloins
  • the PDC from Zymomonas mobilis has also been isolated.
  • the process of the type mentioned at the outset is essentially characterized in that an enzyme is used as the PDC in which the tryptophan residue in the substrate channel leading to the active center is replaced by a sterically smaller amino acid residue.
  • a sterically smaller amino acid residue is in particular a simple, in particular aliphatic, amino acid, such as specifically alanine, glycine,
  • the genetically modified new PDC is obtained by replacing the codon TGG coding for tryptophan at position 392 in position 1174-1176 of the DNA sequence of the PDC gene from Z. mobilis in itself known manner and expression of the PDC in a producer organism, such as in particular E. coli, from which the PDC is isolated.
  • the targeted mutation occurs e.g. B. using the polymerase chain reaction using the primers specified on page 9.
  • the construction of the expression vector pBTac2 for the mutated PDC was carried out starting from the E. coli expression vector pPDC of the wild-type enzyme.
  • the mutated PDC are obtained after harvesting and disruption of the cells from the crude extract in a manner known per se by chromatographic methods.
  • An analogous optimization can generally be achieved with thiamine-diphosphate-dependent enzymes, which have an access limitation - be it steric or due to charge influences - in the substrate channel leading to the active center:
  • an analogous modification of the DNA sequence of the coding for the enzyme Gene by replacing the codon coding for the access limitation with a codon coding for an amino acid residue which removes the access limitation, a significant increase in the synthesis capacity of the enzyme is achieved.
  • linear and / or branched ⁇ -ketocarboxylic acids can be used as the substrate and aromatic, cyclic, longer-chain and / or branched aldehydes can be used as the substrate and / or cosubstrate.
  • aromatic, cyclic, longer-chain and / or branched aldehydes can be used as the substrate and / or cosubstrate.
  • aldehydes examples include benzaldehyde, cyclohexanaldehyde, furfural, cinnamaldehyde, crotonaldehyde, pyruvate, 2-ketobutyric acid, 2-ketopentanoic acid, 2-keto-4-methyllhexanoic acid,
  • Fig. 1 The reaction scheme of the PDC for the example
  • Fig. 2 A construction scheme for the formation of the expression vector containing the PDC from Z. mobilis pPDC and
  • FIG. 3 A diagram for a production of PAC according to FIG. 1, which is optimized by trapping acetaldehyde by means of alcohol dehydrogenase.
  • the vector pBTac2 (Boehringer, Mannheim) was chosen for the expression of the PDC from Zymomonas mobilis.
  • the transcription of the foreign gene is under the control of the strong tac promoter, a hybrid of trp and lacUV promoters with 11-fold and 3-fold efficiency parent promoters.
  • the operator sequence and ribosome binding region come from the lacZ gene.
  • the transcription is thus regulated by the lac repressor of an overexpressing (laciQ) bacterial strain and can be induced by isopropyl- ⁇ -D-thiogalactoside (IPTG).
  • the vector contains a single recognition sequence of the restriction endonuclease EcoRI, followed by the initiation codon ATG and then further restriction recognition sequences (sites), so that this vector is universal for expression both for gene sequences with and without its own
  • Initiation codon can be used.
  • the multiple cloning site is followed by the strong ribosomal RNA transcription terminators rrnB to ensure controlled termination of the transcription.
  • the vector pZY134B (G. Sprenger, Inst. Biotechnologie 2, KFA-Jülich) was available as the starting material for cloning the PDC gene from Zymomonas mobilis (ATCC 29191). This plasmid contains a 3.2 kb DNA fragment from Zymomonas mobilis with the complete PDC gene including non-coding regions (FIG. 2). In order to enable the coding sequence to be ligated into the expression vector, it was necessary to introduce a new restriction recognition sequence in the 5 'direction of the initiation codon.
  • PCR polymerase, chain reaction
  • the required EcoRI restriction site was introduced in the 5 'direction of the initiation codon of the PDC gene by connecting the recognition sequence of the enzyme to the 5' end of the primer complementary to the gene during oligonucleotide synthesis. Since some endonucleases show a strongly reduced activity for the restriction of terminal sequences, four further bases were added upstream to the ECoRI site.
  • the Taq polymerase most commonly used for PCR has no 3'-5 'exonuclease activity (proof-reading).
  • the sequence it synthesizes is therefore subject to a statistical error rate. Even if this with the choice of suitable reaction conditions 1 / 100,000 can be kept very low, this necessitates the sequencing of each fragment to ensure the integrity of the synthesis. Therefore, not the entire coding region of the PDC gene (1712 bp), but a smaller fragment (890 bp) from the 5'-terminus to a single restriction site (EcoRV) was chosen for the amplification (FIG. 2).
  • the PCR product was digested with the corresponding restriction endonucleases EcoRI and EcoRV.
  • the missing second part of the PDC gene was obtained from the plasmid pZY134B by restriction with ECoRV and BamHI, the resulting fragment (1.2 kb) at the 3 'end still containing about 350 bp untranslated sequence of the PDC gene. Both fragments were separated by preparative agarose gel electrophoresis, isolated and ligated in the EcoRI and BamHI linearized, isolated pBTac2 (4.6 kb). The cloning was carried out in E. coli JM 109, a strain overexpressing the lac repressor.
  • the PDC gene from Z. mobilis in the E. coli expression vector pPDC was available as a starting point (see FIG. 2). DNA isolation was carried out according to standard methods (J. Sambroch, E.F. Fritsch, T. Maniatis, Molecular Cloning (1989) Sping Harbor Laboratory Press). The plasmid pPDC served as a template for the synthesis of the two overlapping individual fragments.
  • the primers J. Sambroch, E.F. Fritsch, T. Maniatis, Molecular Cloning (1989) Sping Harbor Laboratory Press.
  • Tm 2 * (A + T) + 3 * (C + G)
  • the fragments were separated electrophoretically, isolated, precipitated for concentration with ethanol and taken up again in Tris-HCl buffer, 10 mM, pH 7.4.
  • the numbering refers to the 1st (5 ') nucleotide of the PDC sequence
  • the mutated bases are underlined.
  • this primer is complementary to the vector sequence at the 3 'end following the PDC sequence
  • PDC-W392A An enzyme according to the invention (PDC-W392A) was obtained by expression of the modified DNA in E. coli cells.
  • the mutated enzyme (mutant) PDC-W392A was expressed according to the following procedure and purified from the cell extract:
  • the E. coli cells carrying the expression plasmid for the mutant PDC-W392A were fermented for selection in LB medium including 100 ⁇ g / ml ampicillin.
  • the medium was inoculated with pre-cultures in the stationary growth phase in a ratio of 1:50 and at 37 ° C and
  • the expression was carried out as described above in an 8 liter fermenter. A pH value of 7.0 and an air flow of 10 l / h were set. The stirring speed was 200 rpm. To avoid excess
  • Foaming was added to polypropylene glycol as needed.
  • the cells were harvested after 3 hours of expression by chilled continuous centrifugation.
  • the digestion was carried out by grinding with glass beads.
  • the digestion was carried out in Eppendorf vessels in a Retsch mill or ice-cooled in the Disintegrator S (maximum volume 80 ml). The grinding took place over 10 minutes with maximum performance.
  • the suspension was centrifuged, the glass beads washed with buffer and the combined centrifugates filtered (1 ⁇ m).
  • the PDC mutants were purified by column chromatography as follows: 1. Anion exchange chromatography
  • the crude extract (approx. 110 ml, approx. 1.0-1.5 g protein) was applied to a Q-Sepharose Fast Flow (Pharmacia)
  • the combined fractions were adjusted to an ammonium sulfate content of 50% saturation by adding a volume of saturated ammonium sulfate solution.
  • the hydrophobic interaction chromatography was carried out on Butyl Sepharose (Pharmacia) (column 5 * 8 cm) at a flow rate of 2 ml / min.
  • the material was equilibrated before loading with 40% ammonium sulfate in 50mM Mes / KOH, 2mM MgCl 2 , 0.1mM ThDP.
  • the enzyme eluted in the same buffer with a falling ammonium sulfate gradient (40-0%) at 24%.
  • the target fractions were again identified using an activity test and pooled (approx. 160 ml).
  • the determination of the enzymatic activity was carried out in the coupled enzymatic test, the NADH oxidation being monitored photometrically by the auxiliary enzyme alcohol dehydrogenase from yeast (EC 1.1.1.1).
  • the reaction mixture contained 16.9 mM pyruvate, 0.18 mM NADH and 10 U ADH in 50 mM Mes / KOH, pH 6.5, 20 mM MgSO 4 , 1.5 mM ThDP.
  • One enzyme unit PDC (1 U) corresponds to the amount of enzyme that catalyzes the conversion of 1 ⁇ mol substrate in one minute at 30 ° C.
  • the enzyme activity is calculated according to:
  • Chiral acyloins can be obtained starting from an ⁇ -ketocarboxylic acid or an aldehyde as substrate and a further aldehyde as cosubstrate by means of PDC or PDC mutants.
  • PAC synthesis starting from pyruvate and benzaldehyde The synthesis mixture contained 40 mM pyruvate, 70 mM benzaldehyde and 10 U / ml PDC-W392A in Mes / KOH buffer, 50 mM, pH 6.5, 20 mM MgSO 4 , 1.5 mM ThDP. The reaction was carried out for one hour at 37 ° C and the resulting PAC (6.2 mM) was detected by HPLC.
  • PAC synthesis approach contained 40 mM acetaldehyde instead of pyruvate. Otherwise the procedure was as described above. After one hour, 3.7 mM PAC had developed.
  • the enzymatic conversion was carried out according to FIG. 3.
  • the use of alcohol dehydrogenase (ADH) from yeast (EC 1.1.1.1) enables the continuous removal of acetaldehyde and the inactivation of the PDC-W392A which is caused thereby.
  • the formate dehydrogenase (FDH) from Candida boidinii (EC 1.2.1.2) is used to regenerate NADH.
  • the enzymatic PAC synthesis was carried out in 20 ml of Mes / KOH buffer, 50 mM, pH 6.5, 20 mM MgSO 4 , 1.5 mM ThDP.
  • reaction products were separated using preparative reversed-phase HPLC.
  • Elution was carried out under isocratic conditions with acetic acid / acetonitrile 0.5% / 12.5% (v / v) at a flow rate of 1.5 ml / min. Under these conditions, the elution times were: PAC, 4.77 min and 2-hydroxypropiophenone, 5.41 min.
  • the enantiomer as R - (-) - PAC was assigned using polarimetry using a standard from PAC production (Knoll AG).
  • the enantiomer ratio of PAC was determined by chiral gas chromatography to be >> 98%.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Die Erfindung bezieht sich auf ein Verfahren zur Gewinnung einer Pyruvat-decarboxylase durch Isolierung aus einem Produzenten-Organismus. Die Pyruvat-decarboxylase ist zur Bildung von (R)-(-)-Phenylacetylcarbinol (I) in » 95 % Enantiomereneinheit mit einem Produktverhältnis von I zu 2-Hydroxypropiophenon von » 95 % befähigt. Außerdem besitzt die Pyruvat-decarboxylase eine spezifische Aktivität bezüglich der Phenylacetylcarbinolbildung von > 1U/mg. Ziel der Erfindung ist, eine Pyruvat-decarboxylase mit verbesserter Synthesekapazität bezüglich der Bildung von (R)-(-)-Phenylacetylcarbinol zu erhalten. Das zu diesem Zweck entwickelte erfindungsgemäße Verfahren zeichnet sich dadurch aus, daß man einen Produzenten-Organismus mit einem für Pyruvat-decarboxylase kodierenden Gen aus Zymomonas mobilis verwendet, in dessen DNA-Sequenz das für den Tryptophanrest kodierende Kodon TGG an der Position 1174-1176 durch ein Kodon ersetzt ist, das für einen Aminosäurerest mit verminderter Raumerfüllung kodiert.

Description

B e s c h r e i b u n g
Verfahren zur Gewinnung von Acyloinen, dafür geeignete Pyruvat-decarboxylase sowie deren Herstellung und DNA- Sequenz des für diese kodierenden PDC-Gens
Die Erfindung bezieht sich auf ein Verfahren zur Gewinnung von Acyloinen durch enzymatische Umwandlung von α- Ketocarbonsäuren und/oder Aldehyden in Gegenwart von Pyruvat-decarboxylase (PDC) und sie umfaßt eine dafür geeignete PDC sowie deren Herstellung und das für diese kodierende Gen.
Acyloine bzw. α-Hydroxyketone sind Verbindungen mit einem optisch aktiven C-Atom, die in der Synthese von komplexeren Verbindungen eine erhebliche Rolle spielen, wie insbesondere das (R) - (-) -Phenylacetylcarbinol
(PAC), das für die Produktion von Ephedrin wirtschaftlich von großem Interessse ist. Hier interessiert das R-Enantiomere, das durch fermentative Umwandlung von Pyruvat in Gegenwart von Benzaldehyd mittels Saccharomyces cerevisiae gebildet wird (DE-PS 548 459 von 1932).
Bei dieser Synthese von PAC mittels Hefezellen werden auf Grund der Mehrzahl von in der Hefe vorhandenen En zymen zahlreiche Nebenprodukte gebildet, und das Zellwachstum wird durch die Anwesenheit von Benzaldehyd inhibiert.
Auch die aus der Hefe isolierte Pyruvat-decarboxylase (PDC) führt bei dieser Umsetzung zu erheblichen Anteilen des zu PAC isomeren 2-Hydroxypropiophenons.
Die thiamindiphosphat- und Mg2+-abhängige PDC (E.C.
4.1.1.1) ist weit verbreitet und wird in vielen Pflanzen, Hefen und Pilzen und in einigen Bakterien gefunden. Sie katalysiert die nicht-oxidative Decarboxylierung von Pyruvat zu Acetaldehyd und als Nebenreaktion erfolgt eine Acyloinkondensation unter Bildung von α- Hydroxyketonen, wie aus Fig. 1 ersichtlich ist.
Eine solche enzymatische Umsetzung erfolgt auch ausgehend von einem Aldehyd an Stelle von α-Ketocarbonsäuren, und an der Kondensationsreaktion kann auch der durch die Decarbooxylierung gebildete Aldehyd als „Cosubstrat" unter Bildung von Homoacyloinen
R-CHOH-CO-R' mit R = R' teilnehmen.
Isoliert wurde auch bereits die PDC aus Zymomonas mobilis. Ein Vergleich einer aus Hefe isolierten PDC mit
PDC aus Zymomonas mobilis bzgl. der Bildung von PAC unter vergleichbaren Bedingungen zeigte jedoch eine deut lieh geringere Synthesekapazität der PDC aus Zymomonas mobilis (S. Bringer-Meyer u. H. Sahm, Biocatalysis 1 (1988) S. 321-331).
Es wurde nun überraschend festgellt, daß durch gezielte gentechnologische Abwandlung des PDC-Gens von Z. mobilis eine PDC mit verbesserter Synthesekapazität bzgl. der Bildung von PAC erhalten werden kann, die sich zudem durch eine hohe Selektivität zur Bildung von PAC im Vergleich zu 2-Hydroxypropiophenon auszeichnet.
Das erfindungsgemäße Verfahren der eingangs genannten Art ist im wesentlichen dadurch gekennzeichnet, daß man als PDC ein Enzym verwendet, bei dem der Tryptophanrest im zum aktiven Zentrum hinführenden Substratkanal durch einen sterisch kleineren Aminosäurerest ersetzt ist.
Bei einem sterisch kleineren Aminosäurerest handelt es sich insbesondere um eine einfache, insbesondere aliphatische Aminosäure, wie speziell Alanin, Glycin,
Phenylalanin, Leucin, Isoleucin, Arginin oder Histidin oder auch Serin und Threonin.
Man erhält die gentechnologisch abgewandelte neue PDC durch Austausch des für Tryptophan an der Stelle 392 kodierenden Kodons TGG in der Position 1174-1176 der DNA-Sequenz des PDC-Gens aus Z. mobilis in an sich be kannter Weise und Expression der PDC in einem Produzenten-Organismus, wie insbesondere E. coli, aus dem die PDC isoliert wird. Die gezielte Mutation erfolgt z. B. mit Hilfe der Polymerase-Kettenreaktion unter Verwendüng der auf Seite 9 angegebenen Primer. Die Konstruktion des Expressionsvektors pBTac2 für die mutierte PDC wurde ausgehend vom E. coli-Expressionsvektor pPDC des Wildtypenzyms durchgeführt.
Die Gewinnung der mutierten PDC erfolgt nach Ernte und Aufschluß der Zellen aus dem Rohextrakt in an sich bekannter Weise durch chromatographische Methoden.
Durch die erfindungsgemäße Abwandlung der PDC wird ihre PAC-Synthesekapazität um den Faktor 4 verbessert. Diese Verbesserung resultiert aus der gezielten Abschwächung bzw. Beseitigung der Zugangslimitierung im zum aktiven Zentrum des Enzyms hinführenden Substratkanal, wodurch der Zugang voluminöser Sustratmoleküle zum aktiven Zentrum und der Abgang des gebildeten Produkts erleichtert wird.
Eine analoge Optimierung ist generell bei thiamin- diphosphat-abhängigen Enzymen zu erreichen, die eine Zugangslimitierung - sei es sterischer oder durch Ladungseinflüsse bedingter Art - im zum aktiven Zentrum führenden Substratkanal aufweisen: Durch analoge Abwandlung der DNA-Sequenz des für das Enzym kodierenden Gens, und zwar durch Austausch des für die Zugangslimitierung kodierenden Kodons durch ein Kodon, das für einen die Zugangslimitierung beseitigenden Aminosäurerest kodiert, erreicht man eine deutliche Steigerung der Synthesekapazität des Enzyms.
Die gemäß der den Ausgangspunkt der Erfindung bildenden Zielsetzung so erhaltene PDC ist für die PAC-Synthese von erheblichem Interesse, da mit ihr eine hohe optisehe Reinheit des R-(-)-Isomeren (»98%) und ein PAC erhalten werden kann, das nur zu wenigen Prozenten
(2-3%) von 2-Hydroxy-propiophenon begleitet wird. Die Gewinnung und Isolierung des Enzyms aus dem geernteten Mikroorganismus ist auf relativ einfache Weise (im Vergleich zur Hefe) möglich.
Bei der enzymatischen Acyloinkondensation mittels PDC können als Substrat lineare und/oder verzweigte α- Ketocarbonsäuren und als Substrat und/oder Cosubstrat aromatische, cyclische, längerkettige und/oder verzweigte Aldehyde eingesetzt werden. Als Beispiel können hier Benzaldehyd, Cyclohexanaldehyd, Furfurol, Zimtaldehyd, Krotonaldehyd, Pyruvat, 2-Ketobuttersäure, 2-Ketopentansäure, 2-Keto-4-methyllhexansäure,
2-Keto-4-methylpentansäure, 2 Keto-4,4-dimethylhexansäure, 3-Phenyl-2-keto-propansäure genannt werden. Weitere Besonderheiten der Erfindung ergeben sich aus den Patentansprüchen und der nachfolgenden Beschreibung von Ausführungsdetails. Dabei wird Bezug genommen auf die angefügten Zeichnungen; es sind im einzelnen:
Fig. 1: Das Reaktionsschema der PDC für das Beispiel
Pyruvat und Benzaldehyd als Substrat und Cosubstrat mit dem Hauptweg der Decarboxylierung und der Carboligase-Nebenreaktion mit der Bildung von PAC;
Fig 2: Ein Konstruktionsschema für die Bildung des die PDC aus Z. mobilis enthaltenden Expressionsvektors pPDC und
Fig. 3: Ein Schema für eine durch Abfangen von Acetaldehyd mittels Alkoholdehydrogenase optimierte Produktion von PAC gemäß Fig. 1.
Beispiel
1. Herstellung des PDC-Mutante PDC-W392A
1.1 Konstruktion des Expressionsvektors pPDC
Für die Expression der PDC aus Zymomonas mobilis wurde der Vektor pBTac2 (Boehringer, Mannheim) gewählt. Die Transkription des Fremdgens steht unter der Kontrolle des starken tac-Promotors, einem Hybrid aus trp- und lacUV-Promotor mit der 11-fachen bzw. 3-fachen Effizi enz der parentalen Promotoren. Die Operatorsequenz und Ribosomenbindungsregion entstammen dem lacZ-Gen. Die Regulation der Transkription erfolgt somit durch den lac-Repressor eines überexpremierenden (laciQ) Bakteerienstammes und ist durch Isopropyl-β-D-thiogalactosid (IPTG) induzierbar. Der Vektor enthält eine einzelne Erkennungssequenz der Restriktionssendonuklease EcoRl, gefolgt von dem Initiationskodon ATG und anschließend weiteren Restriktionserkennungssequenzen (sites), so daß dieser Vektor universell zur Expression sowohl für Gensequenzen mit als auch ohne eigenem
Initiationskodon eingesetzt werden kann.
Der multiplen Klonierungsstelle folgen die starken ribosomalen RNA Transkriptionsterminatoren rrnB, um den kontrollierten Abbruch der Transkription zu gewährleisten. Als Ausgangsmaterial zur Klonierung des PDC-Gens aus Zymomonas mobilis (ATCC 29191) stand der Vektor pZY134B (G. Sprenger, Inst f. Biotechnologie 2, KFA- Jülich) zur Verfügung. Dieses Plasmid beinhaltet ein 3.2 kb großes DNA-Fragment aus Zymomonas mobilis mit dem vollständigen PDC-Gen inklusive nichtkodierender Regionen (Fig. 2). Um eine Ligation der kodierenden Sequenz in den Expressionsvektor zu ermöglichen, war es erforderlich, in 5'-Richtung des Initiationskodons eine neue Restriktionserkennungssequenz einzuführen. Den optimalen Abstand des Initiationskodons von der Shine- Dalgarno-Sequenz des Vektors gewährleistet die Ligation des Gens in die EcoRI-site des pBTac2-Vektors. Eine elegante und einfache Methode, eine DNA-Sequenz zu modifizieren, bietet die Polymerase, Kettenrektion (PCR). Wiederholte Zyklen von Hitzedenaturierung des DNA- Doppelstrangs und enzymatische Synthese durch eine thermostabile DNA-Polymerase ermöglichen die exponentieile Amplifizierung definierter DNA-Fragmente. Die Größe und Identität der Produkte wird durch die Startpunkte (Primer) der Synthese bedingt. Enthalten die Primer eine Modifikation der ursprünglichen Sequenz, etwa Mutationen, Deletionen oder auch zusätzliche Basen
(Insertionen), werden diese folglich auch im synthetischen Fragment vorhanden sein.
Mit dieser Methode wurde die benötigte EcoRI-Restriktionssite in 5'-Richtung des Initiationskodons des PDC- Gens eingeführt, indem während der Oligonukleotidsynthese am 5'-Endn des zum Gen komplementären Primers die Erkennungssequenz des Enzyms angeschlossen wurde. Da einige Endonukleasen eine stark verminderte Aktivität für die Restriktion endständiger Sequenzen zeigen, wurden vier weitere Basen stromaufwärts an die ECoRI-site angefügt.
Die zur PCR meist verwendete Taq-Polymerase besitzt keine 3'-5'-Exonukleaseaktivität (proof-reading). Die von ihr synthetisierte Sequenz ist folglich mit einer statistischen Fehlerrate behaftet. Auch wenn diese durch die Wahl geeigneter Reaktionsbedingungen mit 1/100.000 sehr gering gehalten werden kann, bedingt dies die Notwendigkeit der Sequenzierung eines jeden Fragments, um die Integrität der Synthese sicherzustellen. Daher wurde nicht die gesamte kodierende Region des PDC-Gens (1712 bp), sondern ein kleineres Fragment (890 bp) vom 5'-Terminus bis zu einer einzelnen Restriktionssite (EcoRV) zur Amplifikation gewählt (Fig. 2).
Das PCR-Produkt wurde mit den entsprechenden Restrikti- onsendonukleasen EcoRI und EcoRV verdaut.
Der fehlende zweite Teil des PDC-Gens wurde durch Restriktion mit ECoRV und BamHI aus dem Plasmid pZY134B gewonnen, wobei das so entstehende Fragment (1.2 kb) am 3'-Ende noch ca 350 bp nicht-translatierte Sequenz des PDC-Gens enthält. Beide Fragmente wurden durch präparative Agarosegelektrophorese separiert, isoliert und in den EcoRI und BamHI linearisierten, isolierten pBTac2 (4.6kb) ligiert. Die Klonierung erfolgte in E. coli JM 109, einem den lac-Repressor überexpremierenden Stamm.
1.2 Molekularbiologische Arbeiten
Für die Gewinnung einer durch Tryptophan/Alanin-
Austausch mutierten PDC an der Position 392 wurde zunächst das beim Wildtyp-Enzym vorhandene Kodon TGG (Tryptophan) gegen GCG (Alanin) ausgetauscht (Austausch der Position 1174-1176 des Gens der Pyruvatdecarboxylase aus Zymomonas mobilis). Die Einführung der gezielten Mutation erfolgte mit Hilfe der von Ho et al. beschriebenen Polymerasekettenrektion gestützten Methode (S. N. Ho, H.D. Hunt, R.M. Horton, J.K. Pullen, L.R. Pease, Gene 77 (1989) S. 51).
Als Ausgangspunkt stand das PDC-Gen aus Z. mobilis im E. coli-Expressionsvektor pPDC zur Verfügung (s. Fig. 2). Die DNA-Isolierung erfolgte nach Standardmethoden ( J. Sambroch, E.F. Fritsch, T. Maniatis, Molecular Cloning (1989) Sping Harbor Laboratory Press) Als Templat zur Synthese der beiden überlappenden Einzelfragmente diente das Plasmid pPDC. Die Primer
(Primerseguenzen gemäß Anhang) wurden mit einer Konzentration von 0.2-0.4 nM eingesetzt. Die Reaktion wurde mit Taq-Polymerase (Biomasters, Köln) im von Hersteller angegebenen Reaktionspuffer, zuzüglich 1.5 mM MgCl2 und je 0.2 mM der Nukleotide im „Robo-Cycler" (Stratgene) mit folgendem Temperaturprogramm durchgeführt: 2.5 Minuten 94°C zur Denaturierung, anschließend 30 Zyklen mit einer 1.5-minütigen Denaturierung bei 94°C, 1.2 Minuten Annealing bei 48°C und 2 Minuten Extension bei 72°C, gefolgt von 10 Minuten bei 72°C zur Vervollständigung der Reaktion. Die Annealing-Temperatur variierte zwischen 48°C und 56ºC, je nach theoetischem Schmelz punkt der verwendeten Primer. Der Schmelzpunkt der Oligonukleotide wurde anhand folgender Formel berechnet:
Tm = 2 * (A+T) + 3 * (C+G)
Die Fragmente wurden elektrophoretisch separiert, isoliert, zur Konzentrierung mit Ethanol präzipitiert und in Tris-HCl-Puffer, 10 mM, pH 7.4, wieder aufgenommen.
In der zweiten kombinierten PCR wurden je ca. 50-100 ng der überlappenden Fragmente als Template eingesetzt. Die weiteren Reaktionsbedingungen waren identisch zu ersten Reaktion. Die Wahl der Annealingtemperatur richtete sich nach der Schmelztemperatur der resultierenden Überlappungsregion der Fragmente. Die weiteren Manipulationen (Restriktion, Isolierung, Ligation) zum Ersatz der Wildtyp-DNA im Expressionsvektor pPDC durch die mutierten Fragmente erfolgten nach Standardmethoden
(J. Sambrock, E.F. Fritsch, T. Maniatis, Molecular Cloning (1989) Spring Harbor Laboratory Press).
Sequenzen der verwendeten Primer
Die Numerierung bezieht sich auf das 1. (5')-Nukleotid der PDC-Sequenz
s=sense, as=anti-sense
Die mutierten Basen sind unterstrichen.
Primer zur Synthese des 5'-Einzelfragmentes • PDC867S
CTACTCCACCACTGGTTGGACG
• PDC1186as
GAGGATTGAAGGAGAGTCACC Primer zur Synthese des 3'-Einzelfragmentes
• PDC1159s
GAAACCGGTGACTCTGCGTTCAATGC
• PBTAC453as
ATCTTCTCTCATCCGCCAAACA
(dieser Primer ist komplementär zur Vektorsequenz am 3'-Ende anschließend an die PDC-Sequenz)
Primer zur Synthese des Fusionsfragmentes • PDC867s
CTACTCCACCACTGGTTGGAGG
• PBTAC453as
ATCTTCTCTATCCGCCAAACA
(dieser Primer ist komplementär zur Vektorsequenz am
3'-Ende anschließend an die PDC-Sequenz)
Figure imgf000016_0001
1.2 Expression und Reinigung
Durch Expression der modifizierten DNA in E. coli- Zellen wurde ein erfindungsgemäßes Enzym (PDC-W392A) erhalten. Das mutierte Enzym (Mutante) PDC-W392A wurde gemäß folgender Prozedur exprimiert und aus dem Zellextrakt aufgereinigt:
Die das Expressionsplasmid für die Mutante PDC-W392A tragenden E.coli-Zellen wurden in LB-Medium inklusive 100 μg/ml Ampicillin zur Selektion fermentiert. Das Medium wurde mit Vorkulturen in der stationären Wachstumsphase im Verhältnis 1:50 angeimpft und bei 37°C und
220 rpm inkubiert.
Die Induktion der Expression erfolgte bei einer OD600 von 0.6 durch Zugabe von 1 mM IPTG. Die PDC-Mutante wurde unter diesen Bedingungen mit 20% des löslichen Proteins in E. coli überexpremiert.
Zur Produktion ausreichender Enzymmengen wurde die Expression wie oben beschrieben im 8-Liter-Fermenter durchgeführt. Es wurde ein ph-Wert von 7.0 sowie ein Luftstrom von 10 l/h eingestellt. Die Rührgeschwindigkeit betrug 200 rpm. Zur Vermeidung überschüssiger
Schaumbildung wurde nach Bedarf Polypropylenglycol zugesetzt. Die Zellen wurden nach 3-stündiger Expression durch gekühlte kontinuierliche Zentrifugation geerntet. Der Aufschluß erfolgte durch Vermählen mit Glasperlen. Hierzu wurde eine 30%ige Zellsuspension in Mes/KOH- Puffer, 50 mM, pH 6.5, inklusive 5mM MgCl2 und 0,1 mM ThDP hergestellt und mit einem doppelten Volumen an Glasperlen (d = 0,3 mm) versetzt. Abhängig vom zu bearbeitenden Volumen wurde der Aufschluß in Eppendorfgefäßen in einer Retsch-Mühle oder eisgekühlt im Disintegrator S (Maximalvolumen 80 ml) durchgeführt. Die Vermahlung erfolgte über 10 Minuten mit maximaler Leistung. Die Suspension wurde zentrifugiert, die Glasperlen mit Puffer gewaschen und die vereinigten Zentrifugate filtriert (1μm). Die Aufreinigung der PDC-Mutanten erfolgte säulenchromatographisch wie folgt: 1. Anionenaustauschchromatographie
Der Rohextrakt (ca. 110 ml, ca. 1.0-1.5 g Protein) wurde auf eine Q-Sepharose Fast Flow (Pharmacia)
(2.6 * 9.5 cm) mit einer Flußrate von 5 ml/min unter Verwendung einer FPLC-Anlage der Fa. Pharmacia. Das Enzym eluierte durch Anlegen eines linearen NaCl- Gradienten (von 0 - 200 mM) in 10 mM Mes/KOH, pH 6.5, 2 mM MgCl2, 0.1mM ThDP, bei 100 mM NaCl. Die das Zielprotein enthaltenden Fraktionen wurden durch Aktivitätstest (s. unten) identifiziert. 2. Hydrophobe Interaktionschromatographie (HIC)
Die vereinigten Fraktionen wurden auf einen Ammoniumsulfatgehalt von 50%-Sättigung durch Zugabe eines Volums gesättigter Ammoniumsulfatlösung eingestellt. Die hydrophobe Interaktionschromatographie wurde an Buthylsepharose (Pharmacia) (Säule 5 * 8 cm) mit einer Flußrate von 2 ml/ min durchgeführt. Das Material wurde vor dem Beladen mit 40% Ammoniumsulfat in 50 mM Mes/KOH, 2 mM MgCl2, 0,1 mM ThDP äqulibriert. Das Enzym eluierte im selben buffer mit einem fallenden Ammoniumsulfatgradienten (40-0%) bei 24%. Die Zielfraktionen wurden wiederum mittels Aktivitätstest identifiziert und vereinigt (ca. 160 ml).
3. Entsalzung über Sephadex G25 und Umpuffern auf 50 mM Mes/KOH, 2 mM MgCl2, 0.1 mM ThDP. Die Flußrate betrug 20 ml/min. Anschließend wurde lyophilisiert.
1.3 Aktivitätstest (Decarboxylierungsreaktion)
Die Bestimmung der enzymatischen Aktivität wurde im gekoppelten enzymatischen Test durchgeführt, wobei photometrisch die NADH-Oxidation durch das Hilfsenzym Alkohol-dehydrogenase aus Hefe (E.C. 1.1.1.1) verfolgt wird. Der Reaktionsansatz enthielt 16.9 mM Pyruvat, 0.18 mM NADH und 10 U ADH in 50 mM Mes/KOH, pH 6.5, 20 mM MgSO4, 1.5 mM ThDP. Eine Enzymeinheit PDC (1 U) entspricht der Enzymmenge, die die Umsetzung von 1μmol Substrat in einer Minute bei 30°C katalysiert. Die Enzymaktivität berechnet sich nach:
Figure imgf000020_0001
ε (NADH) = 6.3 1 * mMol-1 * cm-1
V = Gesamtvolumen
v = Probenvolumen
d = Schichtdicke der Küvette (1 cm)
ΔE/min = Extinktionsabnähme pro Minute
f = Verdünnungsfaktor der Probe
2. Einsatz von PDC-W392 A zur PAC-Synthese
Die Gewinnung chiraler Acyloine kann ausgehend von einer α-Ketocarbonsäure bzw. einem Aldehyd als Substrat und einem weiteren Aldehyd als Cosubstrat mittels PDC oder PDC-Mutanten erfolgen.
Beispielhaft seien die folgenden Anwendungen genannt:
PAC-Synthese ausgehend von Pyruvat und Benzaldehyd Der Syntheseansatz enthielt 40 mM Pyruvat, 70 mM Benzaldehyd und 10 U/ml PDC-W392A in Mes/KOH-Puffer, 50 mM, pH 6.5, 20 mM MgSO4, 1.5 mM ThDP.Die Reaktion wurde eine Stunde bei 37°C durchgeführt und das entstandene PAC (6.2 mM) mittels HPLC detektiert.
PAC-Synthese ausgehend von Acetaldehyd und Benzaldehyd
PAC-Syntheseansatz enthielt anstelle von Pyruvat 40 mM Acetaldehyd. Ansonsten wurde wie oben beschrieben verfahren. Nach einer Stunde waren 3.7 mM PAC entstanden.
PAC-Synthese mit PDC-W392A im gekoppelten 3-Enzymsystem
Die enzymatische Umsetzung erfolgte gemäß Fig. 3. Der Einsatz der Alkohol-dehydrogenase (ADH) aus Hefe (E.C. 1.1.1.1) ermöglicht die kontinuierliche Entfernung von Acetaldehyd und die dadurch bedingte Inaktivierung der PDC-W392A. Die Formiatdehydrogenase (FDH) aus Candida boidinii (E.C. 1.2.1.2) dient zur Regeneration von NADH. Die enzymatische PAC-Synthese wurde in 20 ml Mes/KOH-Puffer, 50 mM, PH 6.5, 20 mM MgSO4, 1.5 mM ThDP, durchgeführt.
Der Anssatz enthielt:
1.3 U/ml PDC-W392A, 2 U/ml ADH, 2.5 U/ml FDH. Die anfängliche Pyruvalkonzentration betrug 70 mM. Ferner enthielt der Ansatz 2 mM NADH und 200 mM Formiat. Nach 120 min wurden erneut 0.7 ml einer 2.1 M Pyruvatlösung und 0,125 ml einer 8 M Natriumformiatlösung zugegeben. Die durch die enzymatische Umsetzung resultierende pH- Erhöhung wurde mit Ameisensäure gegentitriert. Nach 7 Stunden waren 6.8 mM PAC entstanden.
Aufarbeiten und Analytik der enzymatischen Reaktionsprodukte:
Die Auftrennung der Reaktionsprodukte erfolgte mittels präparativer reversed-phase HPLC. Als stationäre Phase wurde eine C8-MOS Hypersil-Säule, 250 x 4,6 mm, verwendet. Die Elution erfolgte unter isokratischen Bedingungen mit Essigsäure/Acetonitril 0,5 %/12,5 % (v/v) mit einer Flußrate von 1,5 ml/min. Die Elutionszeiten betrugen unter diesen Bedingungen: PAC, 4.77 min und 2- Hydroxypropiophenon, 5.41 min. Die Zuordnung des entstandenen Enantiomeren als R-(-)-PAC erfolgte mittels Polarimetrie anhand eines Standards aus der PAC-Produktion (Knoll AG).
Das Enantiomerenverhältnis von PAC wurde mittels chiraler Gaschromatographie zu >> 98 % bestimmt.

Claims

P a t e n t a n s p r ü c h e
1. Verfahren zur Gewinnung einer zur Bildung von (R) - (-)-Phenylacetylcarbinol (I) in >95% Enantiomerenrein- heit mit einem Produktverhältnis von I zu 2- Hydroxypropiophenon von >95% befähigten Pyruvatdecarboxylase (PDC) mit einer spezifischen Aktivität bzgl. der Phenylacetylcarbinolbildung von >lU/mg durch Isolierung aus einem Produzenten-Organismus,
d a d u r c h g e k e n n z e i c h n e t,
daß man einen Produzenten-Organismus mit einem für PDC kodierenden Gen aus Zymomonas mobilis verwendet, in dessen DNA-Sequenz das für den Tryptophanrest kodierende Kodon TGG an der Position 1174-1176 durch ein Kodon ersetzt ist, das für einen Aminosäurerest mit verminderter Raumerfüllung kodiert.
2. Verfahren nach Anspruch 1
d a d u r c h g e k e n n z e i c h n e t,
daß das Kodon TGG durch ein Kodon ersetzt ist, das für einen einfach Aminosäurerest kodiert.
3. Verfahren nach Anspruch 2 ,
d a d u r c h g e k e n n z e i c h n e t
daß das Kodon TGG durch ein Kodon ersetzt ist, das für einen aliphatischen Aminosäurerest kodiert.
4. Verfahren nach Anspruch 3,
d a d u r c h g e k e n n z e i c h n e t,
daß das Kodon TGG durch ein Kodon ersetzt ist, das für einen Alaninrest kodiert.
5. Pyruvat-decarboxylase befähigt zur Umwandlung von Pyruvat in Gegenwart von Benzaldehyd in (R)-(-)- Phenylacetylcarbinol in >95% Enantiomerenreinheit mit einem Produktverhältnis von I zu 2-Hydroxypropiophenon von >95% mit einer spezifischen Aktivität bzgl. der Produktbildung von >1U/mg, erhältlich nach einem der Ansprüche 1 bis 3, deren Tryptophanrest in Position 392 durch einen Aminosäurerest minderer Größe ersetzt ist.
6. Pyruvat-decarboxylase nach Anspruch 5
g e k e n n z e i c h n e t d u r c h
einen den Tryptophanrest an der Position 392 ersetzenden Alaninrest.
7. Verfahren zur enzymatischen Gewinnung von Acyloinen durch enzymatische Acyloinkondensation von α- Ketocarbonsäuren und/oder Aldehyden in Gegenwart von PDC,
d a d u r c h g e k e n n z e i c h n e t,
daß man als PDC ein Enzym nach Anspruch 5 oder 6 verwendet.
8. Verfahren nach Anspruch 7,
d a d u r c h g e k e n n z e i c h n e t, daß man die Acyloinkondensation ausgehend von α- Ketocarbonsäure unter gleichzeitiger Reduktion von überschüssigem durch Decarboxylierung gebildeten Aldehyd mittels Alkohol-dehydrogenase und NADH durchführt.
9. Verfahren nach Anspruch 8,
d a d u r c h g e k e n n z e i c h n e t,
daß das bei der Umsetzung gebildete NAD in situ durch Formiat-dehydrogenase zu NADH regeneriert wird.
10. DNA-Sequenz des Gens für thiamindiphosphat- abhängiges Enzym mit einer Zugangslimitierung im zum aktiven Zentrum führenden Substratkanal
d a d u r c h g e k e n n z e i c h n e t
daß an der Stelle des für die Zugangslimitierung kodierenden Kodons ein Kodon eingeführt ist, das für einen die Zuganglimitierung beseitigenden Aminosäurerest kodiert
11. DNA-Sequenz nach Anspruch 10,
g e k e n n z e i c h n e t d u r c h
die DNA-Sequenz des PDC-Gens von Zymomonas mobilis mit einem, für einen Aminosäurerest minderer Größe kodierendes Kodon an der Position 1174-1176.
12. DNA-Sequenz nach Anspruch 11,
g e k e n n z e i c h n e t d u r c h
ein für einen Rest einer aliphatischen Aminosäure kodierendes Kodon an der Position 1174-1176.
13. DNA-Sequenz nach Anspruch 12,
g e k e n n z e i c h n e t d u r c h
ein für einen Alaninrest kodierendes Kodon an der Position 1174-1176.
PCT/DE1996/000928 1995-05-26 1996-05-22 Verfahren zur gewinnung von acyloinen, dafür geeignete pyruvat-decarboxylase sowie deren herstellung und dna-sequenz des für diese kodierenden pdc-gens WO1996037620A2 (de)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP96919594A EP0828841A2 (de) 1995-05-26 1996-05-22 Verfahren zur gewinnung von acyloinen, dafür geeignete pyruvat-decarboxylase sowie deren herstellung und dna-sequenz des für diese kodierenden pdc-gens
JP8535270A JPH11505710A (ja) 1995-05-26 1996-05-22 アシロインの生成方法、これに適するピルビン酸−デカルボキシラーゼ並びにその産生方法及びこの酵素をコードするｐｄｃ−遺伝子のｄｎａ−配列
AU58102/96A AU714414B2 (en) 1995-05-26 1996-05-22 Process for obtaining acyloins, pyruvate decarboxylases suitable therefor and their production and DNA sequences of the PDC gene coding them
BR9608798A BR9608798A (pt) 1995-05-26 1996-05-22 Processo para obter aciloínas piruvato descarboxilases adequadas para as mesmas tal fim e sua produção e sequências de dna do gene de pdc que as codificam

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DE19518809 1995-05-26
DE19518809.8 1995-06-29
DE19523269A DE19523269C2 (de) 1995-05-26 1995-06-29 Verfahren zur Gewinnung von Acyloinen, dafür geeignete Pyruvat-decarboxylase sowie deren Herstellung und DNA-Sequenz des für diese kodierenden PDC-Gens
DE19523269.0 1995-06-29

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08/976,852 Continuation-In-Part US6004789A (en) 1995-05-26 1997-11-24 Process for obtaining acyloins, pyruvate decarboxylases suitable therefor and their production and DNA sequence of the PDC gene coding them

Publications (2)

Publication Number Publication Date
WO1996037620A2 true WO1996037620A2 (de) 1996-11-28
WO1996037620A3 WO1996037620A3 (de) 1997-02-06

Family

ID=26015375

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE1996/000928 WO1996037620A2 (de) 1995-05-26 1996-05-22 Verfahren zur gewinnung von acyloinen, dafür geeignete pyruvat-decarboxylase sowie deren herstellung und dna-sequenz des für diese kodierenden pdc-gens

Country Status (12)

Country Link
US (1) US6004789A (de)
EP (1) EP0828841A2 (de)
JP (1) JPH11505710A (de)
KR (1) KR19990021965A (de)
CN (1) CN1192244A (de)
AU (1) AU714414B2 (de)
BR (1) BR9608798A (de)
CA (1) CA2222493A1 (de)
CZ (1) CZ287619B6 (de)
DE (1) DE19523269C2 (de)
IN (2) IN186507B (de)
WO (1) WO1996037620A2 (de)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999009195A1 (de) * 1997-08-20 1999-02-25 Basf Aktiengesellschaft Verfahren zur herstellung von enantiomerenreinen phenylacetylcarbinolen aus acetaldehyd und benzaldehyd in gegenwart von pyruvatdecarboxylase aus zymomonas
WO2003020942A2 (en) * 2001-09-01 2003-03-13 Basf Aktiengesellschaft Process for production of r-phenylacetylcarbinol by an enzymatic process in a two-phase system
WO2003020921A2 (de) * 2001-08-31 2003-03-13 Basf Aktiengesellschaft Pyruvatdecarboxylase-mutante, deren herstellung und verwendung
EP1527164A2 (de) * 2001-05-04 2005-05-04 University Of Florida Research Foundation, Inc. Klonierung und sequenzierung von pyruvat-carboxylase (pdc)-genen aus bakterien und verwendungen dafür

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19918935A1 (de) * 1999-04-27 2000-11-02 Forschungszentrum Juelich Gmbh Stereoselektive Synthese von 2-Hydroxyketonen
IL147823A (en) 2002-01-24 2008-06-05 Univ Ben Gurion Process for the preparation of alpha-hydroxy aromatic chiral ketones using acetohydroxyacide synthase
DE10313971A1 (de) * 2003-03-27 2004-10-21 Degussa Ag Gekoppeltes cofaktorabhängiges enzymatisches Reaktionssystem
DE102014013644A1 (de) * 2014-09-16 2016-03-17 Forschungszentrum Jülich GmbH Lyase und für die Lyase kodierende DNA, die DNA enthaltende Vektoren, sowie Verfahren zur asymmetrischen Synthese von (S)-Phenylacetylcarbinol
CN107630049B (zh) * 2017-04-01 2018-09-21 武汉茵茂特生物技术有限公司 麻黄碱的生物制备方法

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE548459C (de) * 1930-04-09 1932-04-13 Gustav Hildebrandt Dr Verfahren zur Herstellung von 1-1-Phenyl-2-methylaminopropan-1-ol

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BIOCATALYSIS, Bd. 9, 1994, Seiten 1-30, XP000610933 CROUT DHG ET AL: "Application of hydrolytic and decarboxylating enzymes in biotransformations" *
BIOCHEM J, MAY 15 1994, 300 ( PT 1) P7-13, ENGLAND, XP000607055 CANDY JM ET AL: "Investigation of the cofactor-binding site of Zymomonas mobilis pyruvate decarboxylase by site-directed mutagenesis." *
EUR J BIOCHEM, DEC 1 1995, 234 (2) P650-5, GERMANY, XP000607025 BRUHN H ET AL: "The replacement of Trp392 by alanine influences the decarboxylase/carboligase activity and stability of pyruvate decarboxylase from Zymomonas mobilis." *
EUR J BIOCHEM, SEP 1 1994, 224 (2) P651-61, GERMANY, XP000607136 POHL M ET AL: "Reversible dissociation and unfolding of pyruvate decarboxylase from Zymomonas mobilis." *
FEBS LETTERS, Bd. 296, 1992, AMSTERDAM NL, Seiten 95-98, XP000608119 DIEFENBACH RJ ET AL: "Effects of substitution of aspartate-440 and tryptophan-487 in the thiamin diphophate binding region of pyruvate decarboxylase from Zymomonas mobilis" *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999009195A1 (de) * 1997-08-20 1999-02-25 Basf Aktiengesellschaft Verfahren zur herstellung von enantiomerenreinen phenylacetylcarbinolen aus acetaldehyd und benzaldehyd in gegenwart von pyruvatdecarboxylase aus zymomonas
EP1527164A2 (de) * 2001-05-04 2005-05-04 University Of Florida Research Foundation, Inc. Klonierung und sequenzierung von pyruvat-carboxylase (pdc)-genen aus bakterien und verwendungen dafür
EP1527164A4 (de) * 2001-05-04 2006-02-01 Univ Florida Klonierung und sequenzierung von pyruvat-carboxylase (pdc)-genen aus bakterien und verwendungen dafür
AU2002353763B2 (en) * 2001-05-04 2007-01-04 University Of Florida Research Foundation, Inc Cloning and sequencing of pyruvate decarboxylase (PDC) genes from bacteria and uses therefor
US7326551B2 (en) 2001-05-04 2008-02-05 University Of Florida Research Foundation, Inc. Cloning and sequencing of pyruvate decarboxylase (PDC) genes from bacteria and uses therefor
WO2003020921A2 (de) * 2001-08-31 2003-03-13 Basf Aktiengesellschaft Pyruvatdecarboxylase-mutante, deren herstellung und verwendung
WO2003020921A3 (de) * 2001-08-31 2003-10-16 Basf Ag Pyruvatdecarboxylase-mutante, deren herstellung und verwendung
US7189545B2 (en) 2001-08-31 2007-03-13 Basf Aktiengesellschaft Production and use of pyruvate decarboxylase
WO2003020942A2 (en) * 2001-09-01 2003-03-13 Basf Aktiengesellschaft Process for production of r-phenylacetylcarbinol by an enzymatic process in a two-phase system
WO2003020942A3 (en) * 2001-09-01 2003-12-04 Basf Ag Process for production of r-phenylacetylcarbinol by an enzymatic process in a two-phase system
US7074966B2 (en) 2001-09-01 2006-07-11 Basf Aktiengesellschaft Process for production of R-phenylacetylcarbinol by an enzymatic process in a two-phase system

Also Published As

Publication number Publication date
AU714414B2 (en) 2000-01-06
IN186507B (de) 2001-09-22
KR19990021965A (ko) 1999-03-25
EP0828841A2 (de) 1998-03-18
WO1996037620A3 (de) 1997-02-06
CZ369197A3 (cs) 1998-02-18
CA2222493A1 (en) 1996-11-28
DE19523269C2 (de) 2000-05-31
CN1192244A (zh) 1998-09-02
IN189539B (de) 2003-03-22
AU5810296A (en) 1996-12-11
DE19523269A1 (de) 1996-11-28
US6004789A (en) 1999-12-21
JPH11505710A (ja) 1999-05-25
BR9608798A (pt) 1999-02-17
CZ287619B6 (en) 2001-01-17

Similar Documents

Publication Publication Date Title
EP0827543B1 (de) Herstellung von 1,3-propandiol aus glycerol mit rekombinanten diol-dehydratase exprimierenden bakterien
DE69434148T2 (de) Alkoholdehydrogenase, dafür kodierende DNA, Herstellung und Verfahren zur Herstellung von optisch aktiven Alkoholen
EP2313489B1 (de) Herstellungsverfahren
DE112010004851T5 (de) Verfahren und rekombinante Mikroorganismen für die Herstellung von Cadaverin
EP2428575A1 (de) Oxidoreduktasen zur stereoselektiven Reduktion von Ketoverbindungen
EP2511376B1 (de) Verfahren zur industriellen herstellung von (s)-1,1,1-trifluor-2-propanol
EP0828841A2 (de) Verfahren zur gewinnung von acyloinen, dafür geeignete pyruvat-decarboxylase sowie deren herstellung und dna-sequenz des für diese kodierenden pdc-gens
WO2007014544A2 (de) Stereoselektive synthese von chiralen diolen
CN111454918B (zh) 一种烯醇还原酶突变体及其在制备(r)-香茅醛中的应用
WO2017220059A1 (de) Verfahren zur herstellung von d-xylonat und coryneformes bakterium
DE60202227T2 (de) Neue Enon Reduktasen isoliert aus Kluyveromyces lactis, Methoden zu deren Herstellung und Methoden zur selektiven Reduzierung von Kohlenstoff-Kohlenstoff Doppelbindungen von Alpha, Beta-ungesättigten Ketonen unter Verwendung der Reduktasen
EP1425392B1 (de) Pyruvatdecarboxylase-mutante, deren herstellung und verwendung
DE102017210944B4 (de) Alkoholdehydrogenasen und Verfahren zur stereoselektiven Reduktion von Carbonylverbindungen
DE10247147A1 (de) Verfahren sowie Mikroorganismus zur Herstellung von D-Mannitol
DE102013104418A1 (de) Biokatalytisches Verfahren für die Herstellung von (R)-3-Chinuclidinol
EP1499728A2 (de) Für eine mannitol-2-dehydrogenase codierende nukleotidsequenz sowie verfahren zur herstellung von d-mannitol
DE10220234B4 (de) Verfahren sowie Mikroorganismen zur mikrobiellen Herstellung von Pyruvat aus Kohlenhydraten sowie Alkoholen
DE60126767T2 (de) Neuartige (r)-2-hydroxy-3-phenylpropionat (d-phenyllaktat) dehydrogenase und für diese kodierendes gen
EP4317442A1 (de) Rekombinanter mikroorganismus zur herstellung von 2,3-butandiol mit reduzierter nebenproduktproduktion und verfahren zur herstellung von 2,3-butandiol unter verwendung davon
EP2193194B1 (de) Verfahren zur herstellung von 2-methyl-1,2-dihydroxypropan
DE102007045092A1 (de) Enzymsystem mit der Aktivität einer Monooxygenase und Verfahren zur Oxidation von Methylgruppen in aliphatischen Kohlenwasserstoffen

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 96195936.3

Country of ref document: CN

AK Designated states

Kind code of ref document: A2

Designated state(s): AU BR CA CN CZ JP KR SG US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

AK Designated states

Kind code of ref document: A3

Designated state(s): AU BR CA CN CZ JP KR SG US

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: PV1997-3691

Country of ref document: CZ

WWE Wipo information: entry into national phase

Ref document number: 1996919594

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 08976852

Country of ref document: US

ENP Entry into the national phase

Ref document number: 1996 535270

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1019970708440

Country of ref document: KR

ENP Entry into the national phase

Ref document number: 2222493

Country of ref document: CA

Ref document number: 2222493

Country of ref document: CA

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: PV1997-3691

Country of ref document: CZ

WWP Wipo information: published in national office

Ref document number: 1996919594

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 1019970708440

Country of ref document: KR

WWG Wipo information: grant in national office

Ref document number: PV1997-3691

Country of ref document: CZ

WWW Wipo information: withdrawn in national office

Ref document number: 1996919594

Country of ref document: EP

WWR Wipo information: refused in national office

Ref document number: 1019970708440

Country of ref document: KR