Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
  • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
  • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
  • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
  • C12N9/6424—Serine endopeptidases (3.4.21)
  • C12N9/6456—Plasminogen activators
  • C12N9/6459—Plasminogen activators t-plasminogen activator (3.4.21.68), i.e. tPA
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
  • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
  • C12Y304/21—Serine endopeptidases (3.4.21)
  • C12Y304/21069—Protein C activated (3.4.21.69)
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• t-PA Human tissue plasminogen activator
• t-PA Human tissue plasminogen activator
• Plasmin dissolves ⁇ ibrin, which is the main component of the protein matrix of clotted blood.
• t-PA has a high affinity for fibrin and is also activated by fibrin (see Fibrinolysis 2 (1988), 133-142). At t-PA there is therefore a large, medi. interest in interest.
• Urokinase or streptokinase is the stimulability of its catalytic activity by fibrin (see J. Biol. Chem. 257 (1982), 2912-2919; Biochem. Biophys. Acta 755 (1983) 531-533).
• t-PA (amino acid sequence see Vehar et al., Bio / Technology 2 (1984) 1051-1057) consists in its single-chain form of a heavy chain (H chain) and a light chain (L chain) , which are held together by a disulfide bridge.
• the two-chain form arises from a single-chain precursor form by specific cleavage with plasmin or other proteases between amino acids (AS) 275 and 276.
• the 32,000 Dalton heavy L chain contains the enzymatically active region which has homologies to other serine proteases such as urokinase or plasmin (Proc. Natl. Acad. Sci. USA 81 (1984), 5335-5339).
• the domains on the 39,000 Dalton H chain are the finger domain (F) with homology to fibonectin (AS 1-49), the growth factor domain (G) with homology to mouse and human epidermal growth factor (AS 50-87 ) and two Kringel domains Kl (AS 88-175) and K2 (AS 176-262) with homology to the Krin ⁇ structures in plasminogen.
• F finger domain
• G growth factor domain
• Kl K5
• K2 K2
• the object of the invention is to provide a t-PA mutant which has a greater plasminogen-cleaving activity than t-PA and whose catalytic activity can also be stimulated by fibrin or fibrinogen.
• the object is achieved according to the invention by producing a recombinant DNA which codes for a protein with the domains GK1L of t-PA, the sequences coding for the domains K2 and F or the sequences derived therefrom in the context of the degeneration of the genetic code, ie correspondingly the exact exon / intron boundaries on the t-PA gene are completely deleted.
• the recombinant DNA according to the invention thus lacks the nucleotides 715 to 972 and 199 to 339 of the t-PA cDNA (numbering according to Nature 301, (1983), 214-221).
• the invention also relates to a method for producing recombinant DNA according to the invention from a DNA sequence coding for t-PA or for a t-PA mutant which contains more than the domains G, Kl and L for deleting those sequences, which do not code for the domains G, Kl and L, while adhering to the exact exon / intron limits on the t-PA gene.
• a method is particularly preferred in which the deletion of the DNA coding for the domains K2 and F takes place by directed mutagenesis.
• the invention also relates to a recombinant vector which contains one or more copies of the recombinant DNA according to the invention.
• a preferred embodiment is a vector which is suitable for the expression of the recombinant DNA in eukaryotic cells.
• a particularly preferred embodiment of the invention is a eukaryotic vector with the GKIL gene, which contains the early SV40 promoter and a mouse dhfr gene. Most preferred, however, is the plasmid pSV-GKLL according to the invention.
• the invention furthermore relates to a cell line which has been transformed with the recombinant DNA according to the invention or a vector according to the invention.
• a eukaryotic cell line is particularly preferred, and a CHO-dhfr " cell line (for example ECACC 88072103) which contains a recombinant DNA or a vector according to the invention is most preferred.
• the invention also relates to a protein with fibrinolytic properties, which consists of the amino acid sequences of the domains G, Kl and L of t-PA in this order and is optionally glycosylated.
• the invention also includes a method for producing a protein with fibrinolytic properties, wherein a recombinant DNA or a recombinant vector according to the invention is expressed in suitable host cells and the expression product is obtained from the culture medium or by disruption of the host cells.
• a method is preferred in which the protein according to the invention is obtained from eukaryotic host cells, preferably CHO dhfr "host cells, in glycosylated form.
• a supernatant has CHO dhfr" cells which are transformed with the plasmid pSV-GKlL according to the invention and GKIL secrete a higher catalytic activity than a supernatant from cells which are transformed with a corresponding expression vector pSV-FGKlK2L on which the wild-type t-PA gene is located.
• a method is particularly preferred in which host cells are used which are cultivated in a medium containing aprotinin.
• both the activity and the extent of the stimulation by fibrin are higher in the supernatant of host cells whose culture medium contains aprotinin.
• the invention relates to a fibrinolytic agent which contains a protein according to the invention.
• the deletion mutant FGKlL was produced from t-PA cDNA by deleting the Kringel 2 domain with directed mutagenesis according to the method from Bio / Technology 2 (1984), 636-639.
• PePA 133 production see EP-A 0242836 on which the t-PA nucleotide sequence 190-1809 is located served as the starting plas id.
• Mutagenesis primer 1 (5 'GCCTGCTCTGAGTCCACCTGCGGC3') was used to remove nucleotides 715 to 972 (exons VIII and IX) (according to the numbering of the t-PA cDNA in Nature 301 (1983), 214) -221).
• a plasmid p7745 which codes for the deletion mutant FGKlL, was then isolated and sequenced by colony hybridization with the mutagenesis primer 1. Reconstitution of the t-PA signal sequence was necessary for later expression in eukaryotic cells.
• the FGKlL cDNA was provided with the leader sequence and the 3'UT (3 'untranslated region), corresponding to the original cDNA sequence.
• plasmid p7.1, DSM 4719 which in the polylinker of pUC12 the 5'UT (5 'untranslated region) up to position 77, the leader sequence and the N-terminal sequence from t-PA up to and including nucleotide position 208, cleaved with PstI and Hind III (approx. 2.7 kb).
• fragments containing t-PA cDNA sequences were isolated: from p7745 a Pst I / Hae II fragment comprising nucleotide positions 209 to 421 and a Hae II / EcoRI fragment with nucleotide positions 421 to 1273, wherein nucleotide positions 715 to 972 are deleted by the mutagenesis and an Eco RI / Hind III fragment with nucleotide positions 1274-2165 from pePA 98.1 (see EP-A 0 242 836 for production).
• the fragments were ligated and transformed into E. coli, DSM 3689. Plasmid-carrying transformants were selected by adding 50 ⁇ g / ml ampicillin in the nutrient medium. The correct plasmid, designated pePA 159, was verified by restriction enzyme analysis. The FGKlL c-DNA could be isolated from this plasmid as an Xbal-HindIII fragment (with signal sequence but without its own polyadenylation site). This fragment contains seven nucleotides 5 'untranslated region (5'UT) and the 3' untranslated region (3'UT) up to the BglII site at position 2160 (Nature 301 (1983) 214-221).
• Mutagenesis primer 2 (5'GATCTTACCAATGCAGCGAGC3 ') was used to delete the finger domain F (exon IV) from FGKlL. Nucleotides 199 to 339 on the t-PA cDNA were removed by directed mutagenesis. A plasmid with the recombinant DNA with the domain composition GKIL was isolated and sequenced by colony hybridization with mutagenesis primer 2.
• the procedure was as follows: The filters with immobilized DNA were 4 hours at 65 ° C in 0.2% SDS, 1.0% ' Sarkosyl ", 4x SET (0.6 mmol / l NaCl, 0.2 mol / 1 Tris-HCl, pH 8.0, 4 mmol / 1 EDTA) and 4x Denhardts solution (0.08% Ficoll R , 0.08% polyvinylpyrrolidone, 0.08% bovine serum albumin) prehybridized.
• the hybridization was carried out for 12 hours at 46 ° C. in 0.2% SDS, 1.0% Sarkosyl ", 4x SET, 4x Denhardts and with 5-10 6 cpm kinased mutagenesis primer per filter.
• the filters were 3 x 5 minutes at room temperature, then washed 1 x 10 minutes at 37 ° C and 1 x 5 minutes at 50 ° C in 4x SET, 0.2% SDS.
• t-PA cDNA and GKIL cDNA were inserted into the only Ba HI site of plasmid pKCR (Proc.Natl.Acad.Sci. USA 78 (1981), 1527-1531) as Xbal-HindIII fragments, from which the plasmids pKCR-FGKlK2L and pKCR-GK1L resulted.
• the ends of the fragments were filled in with Polymerase I Klenow fragment.
• Both c-DNAs contained seven authentic nucleotides at the 5 'end and their own polyadenylation sites were missing. Both plasmids conferred bacterial resistance to the antibiotic ampicillin (Amp).
• both c-DNAs is driven by the SV40 early promoter.
• the c-DNA in the plasmid is followed by the large intron of rabbit-ß-globin and polyadenylation sites of rabbit-ß-globin and SV40.
• pKCR-FGKlK2L and pKCR-GKlL were linearized by partial cleavage with Sall and then cut with AatII and the overhanging ends were degraded with nucleus S1.
• the fragment mentioned was isolated from a low-melting agarose gel and ligated into the filled-in single EcoRI site of pAdD26SV (A) (J. Mol.Biol. 159 (1982) 601-621.).
• pAdD26SV contains an expression cassette for mouse DHFR-c-DNA, which is driven by the major late-pro otor 'of adenovirus 2 (AMLP), the SV40 origin of replication and gives bacteria resistance to the antibiotic tetracycline.
• AMLP major late-pro otor 'of adenovirus 2
• the orientation of the expression cassette for t-PA in the resulting plasmids pSV-FGKlK2L and pSV-GKlL was checked by restriction analysis.
• Fig. 1 shows schematically the production of the plasmid pSV-GKlL and the position of the individual elements on the plasmid.
• CHO dhfr "cells (ECACC 88072103) were transformed with the recombinant vectors pSV-FGKlK2L and pSV-GKlL (Proc. Natl. Acad. Sci. USA 76 (1979), 4350-4354).
• Calcium phosphate precipitates with 20 ⁇ g pSV-FGKlK2L or pSV-GKlL in a volume of 4 ml (Virology 5_2 . (1973), 456-467) 1 ml of the precipitate was added to 3 ⁇ 10 5 to 1 ⁇ 10 6 cells in 10 ml medium.
• the cells were incubated for 8-16 hours, then the medium was removed, the cells with 10 ml of TBS (25 mmol / 1 Tris-HCl, pH 7.4, 137 mmol / 1 NaCl, 5 mmol / 1 KC1, 0.6 mmol / 1 NaH 2 P0 4 and then incubated in a suitable medium.
• TBS 25 mmol / 1 Tris-HCl, pH 7.4, 137 mmol / 1 NaCl, 5 mmol / 1 KC1, 0.6 mmol / 1 NaH 2 P0 4
• CHO-dhfr "cells (ECACC 88072103) were converted 48 hours after transfection 1:10 and then grown in a selection medium (J.Mol.Biol.
• Resistant cells became a gradually increasing metho- exposed to the trexate concentration (300 nmol / 1, 500 nmol / 1, 1 ⁇ mol / 1 and 5 ⁇ mol / 1). Clones were isolated by limiting dilution and the best t-PA producers selected.
• CHO cells that showed constitutive secretion of wild-type t-PA or GKIL were grown in DMEM medium (Dulbecco's modified Eagle Medium) supplemented with 10% fetal calf serum in the presence and absence of aprotinin (50 ⁇ g / ml) .
• the supernatants were adjusted to 0.3 mol / l arginine, pH 7.5, with HC1 and applied to an ETI-Sepharose column (J. Biol. Chem. 259 (1984) 11635-11638).
• the proteins were eluted with 20 mmol / 1 citrate buffer, pH 2.5 and then dialyzed against 20 mmol / 1 Tris-HCl, pH 7.5.
• the membrane filters were then treated with a 1: 1000 dilution of a peroxidase-conjugated goat antibody against human t-PA for one hour at room temperature in TBS + 0.5% bovine serum albumin. To make the immune complexes visible, the filters were washed with TBS with a 1: 1 solution of 2.5 mmol / 1 tetramethylbenzidine and 4.5 mmol / 1 sodium dioctyl sulfosuccinate in methanol, and 0.005% hydrogen peroxide in 0.1 mol / 1 citric acid buffer, pH 5, incubated.
• the rainbow mix (Amersham) was used as a marker for the polyacrylamide gel electrophoresis, which contains the following proteins: myosin, 200 kD, phosphorylase (b), 92.5 kD, bovine serum albumin, 69 kD, ovalbumin, 46 kD, carbonic anhydrase , 30 kD, trypsin inhibitor, 21.5 kD and lysozyme, 14 kD.
• the culture supernatant of cells containing the plasmid pSV-GKlL expressing GKIL when treated with antibodies against t-PA, results in an immunoreactive band of approximately 50,000 daltons (corresponding to the single-chain form of GKIL), a band of approximately 31,000 daltons (corresponding to the L chain) and a band of approximately 19,000 daltons (corresponding to the H chain).
• the proportion of two-chain molecules decreases compared to the single-chain molecules if the cell medium contains the protease inhibitor aprotinin.
• t-PA has a band of 65,000 to 68,000 Daltons (corresponding to the single-chain form) and 2 bands of 34,000 and 31,000 Daltons (corresponding to the H and L chains).
• t-PA and GKIL were enriched from the supernatants of CHO cells as described in Example 2.
• the CHO cells that secrete t-PA or GKIL were grown in the presence or absence of aprotinin (50 ⁇ g / ml).
• aprotinin 50 ⁇ g / ml
• the supernatants diluted 1: 250, which resulted in a negligibly low inhibitor concentration.
• the plasminogen-cleaving activity was determined by an indirect spectrophotometric test (Thromb. Haemostasis 48 (1982), 266-269).
• t-PA converts plasminogen into the active serine protease plasmin, which hydrolyzes a binding of a chromogenic substrate, the absorption of which was measured at 405 nm for a period of up to 3 hours.
• tosylated Gly-Pro-Lys-p-nitroanilide Chromozym® PL was used as the chromogenic substrate.
• the tests were carried out at 25 ° C in 0.1 mol / 1 Tris-HCl, pH 7.5, 0.15 mol / 1 Tween 80 and 0.13 ⁇ mol / 1 plasminogen and 0.30 mmol / 1 chro-enzyme ®PL performed in the absence or presence of fibrinogen cleaved with CNBr (120 ⁇ g / ml).
• the absorbance at 405 nm was determined as a measure of the release of p-nitrophenol from the chromogenic substrate and recorded as a function of the incubation period. The results are shown in FIG. 2.
• t-PA isolated from aprotinin-free supernatants
• activity of t-PA isolated from aprotinin-containing supernatants
• activity of GKIL isolated from aprotinin containing supernatants
• activity of GKIL isolated from supernatants without aprotinin
• ⁇ CNBr shows the presence or absence of CNBr-treated fibrinogen fragments in the test. (+) or (-) indicates whether the protein has been purified from aproinin-containing or aprotinin-free tissue culture supernatants.
• the catalytic activity of GKIL is stimulated in the presence of fibriogen
• the catalytic activity of a supernatant from cells that express GKIL with and without fibrinogen is significantly higher than that of a supernatant from cells that express wild-type t-PA.
• the activity of GKIL is higher in the presence of fibrinogen and lower without fibrinogen than without aprotinin.

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Life Sciences & Earth Sciences (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Genetics & Genomics (AREA)
• General Health & Medical Sciences (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• Biochemistry (AREA)
• Medicinal Chemistry (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• Microbiology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Diabetes (AREA)
• Public Health (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Hematology (AREA)
• Animal Behavior & Ethology (AREA)
• Pharmacology & Pharmacy (AREA)
• Veterinary Medicine (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Enzymes And Modification Thereof (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Peptides Or Proteins (AREA)
• Oscillators With Electromechanical Resonators (AREA)
• Transition And Organic Metals Composition Catalysts For Addition Polymerization (AREA)
• Curing Cements, Concrete, And Artificial Stone (AREA)

Priority Applications (2)

Applications Claiming Priority (2)

Publications (2)

Family

ID=6387718

Family Applications (1)

Country Status (6)

Families Citing this family (1)

Family Cites Families (1)

• 1989
  • 1989-08-23 DE DE3927865A patent/DE3927865A1/de not_active Withdrawn
• 1990
  • 1990-08-22 JP JP2511463A patent/JPH04500010A/ja active Granted
  • 1990-08-22 WO PCT/EP1990/001401 patent/WO1991002798A2/de active IP Right Grant
  • 1990-08-22 US US07/671,776 patent/US5223422A/en not_active Expired - Fee Related
  • 1990-08-22 AT AT90912217T patent/ATE120236T1/de not_active IP Right Cessation
  • 1990-08-22 EP EP90912217A patent/EP0440763B1/de not_active Expired - Lifetime
  • 1990-08-22 DE DE59008764T patent/DE59008764D1/de not_active Expired - Fee Related

Also Published As

Similar Documents

Legal Events