US20150344537A1 - Non-Transgene Transfection for Therapeutic Purposes - Google Patents

Non-Transgene Transfection for Therapeutic Purposes Download PDF

Info

Publication number
US20150344537A1
US20150344537A1 US14/760,077 US201414760077A US2015344537A1 US 20150344537 A1 US20150344537 A1 US 20150344537A1 US 201414760077 A US201414760077 A US 201414760077A US 2015344537 A1 US2015344537 A1 US 2015344537A1
Authority
US
United States
Prior art keywords
cell
cells
mrna
polypeptide
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US14/760,077
Other languages
English (en)
Inventor
Mark C. Herzberg
Karen Farnie Ross
Brent R. Sorenson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Antibiotic Alternatives LLC
Original Assignee
Antibiotic Alternatives LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Antibiotic Alternatives LLC filed Critical Antibiotic Alternatives LLC
Priority to US14/760,077 priority Critical patent/US20150344537A1/en
Assigned to ANTIBIOTIC ALTERNATIVES LLC reassignment ANTIBIOTIC ALTERNATIVES LLC ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: HERZBERG, Mark C., ROSS, Karen Farnie, SORENSON, BRENT S.
Publication of US20150344537A1 publication Critical patent/US20150344537A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10Antimycotics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00Vectors comprising a special translation-regulating system
    • C12N2840/20Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the method includes introducing into an epithelial cell an mRNA encoding a polypeptide involved in suppressing cell proliferation and permitting the cell to express the polypeptide in an amount effective to decrease the likelihood that the cell proliferates in an anchorage-independent environment.
  • the polypeptide can include calprotectin (S100A8 complexed with S100A9; S100A8/A9), S100A8, or S100A9.
  • this disclosure describes a method of inhibiting infection of a cell.
  • the method includes introducing into a cell an mRNA encoding a polypeptide involved in innate immunity and permitting the cell to express the polypeptide in an amount effective to decrease the likelihood that the cell is infected by a pathogen.
  • the polypeptide can include cathelicin antimicrobial protein (CAMP), calprotectin, S100A8, S100A9, a ⁇ -defensin, S100A7, secretory leukocyte inhibitor, lipocalin 2, or lysozyme.
  • the mRNA can include a stabilizing moiety such as, for example, a 5′ cap or a 3′ extension.
  • the cell can be a mucosal epithelial cell.
  • composition that generally includes an mRNA that encodes a polypeptide and an in vivo delivery vehicle.
  • the polypeptide can suppress epithelial cell proliferation.
  • the polypeptide can include calprotectin, S100A8, or S100A9.
  • the polypeptide can be involved in innate immunity.
  • the polypeptide can include cathelicin antimicrobial protein (CAMP), calprotectin, S100A8, S100A9, a ⁇ -defensin, S100A7, secretory leukocyte inhibitor, lipocalin 2, or lysozyme.
  • CAMP cathelicin antimicrobial protein
  • the mRNA can include a stabilizing moiety such as, for example, a 5′ cap or a 3′ extension.
  • FIG. 1 CAMP protein expression by KB cells after transfection with ARCA-capped CAMP mRNA or CE capped CAMP mRNA.
  • A CAMP protein expression after KB cells were transfected with ARCA, CE cap0, or cap1-capped CAMP mRNA. Upper, representative Western blot. Lower, quantitative interpretation, with ARCA cap expression at eight hours set to 100. After analysis using Quantity One analysis as described in the Materials and Methods, protein expression after transfection with the several capping methods was presented relative to 100.
  • B CAMP protein expression over time after transfection with ARCA-capped CAMP.
  • FIG. 2 S100A8 and S100A9 protein expression by KB cells after transfection with ARCA-capped S100A8, S100A9, A8-IRES-A9, and A8-nIRES-A9 mRNA.
  • A S100A8 protein expression after KB cells were transfected with S100A8 mRNA as detected using Western blot (representative image shown) and quantitated as in FIG. 1 .
  • FIG. 3 CAMP and calprotectin mRNAs increase resistance to Listeria and Salmonella invasion.
  • Monolayers were transfected with mRNAs for (A) eight hours, (B) 24 hours, (C) 48 hours, and then incubated for two hours with L. monocytogenes ATCC 10403S at MOI 100:1 or S. typhimurium ATCC 14028 at MOI 1:1.
  • L. monocytogenes ATCC 10403S at MOI 100:1 or S. typhimurium ATCC 14028 at MOI 1:1.
  • After 24-hour or 48-hour transfection cells were split at eight hours and again 32 hours later, then incubated for another 16 hours.
  • Viable intracellular bacteria are reported as percentage mean ⁇ SD expressed relative to the CFUs in KB cells mock-transfected with vehicle (PBS), which is set to 100%. Error bars show the means ⁇ SD relative to the eight-hour vehicle control for three to six independent experiments. *p ⁇ 0.05.
  • FIG. 4 The mRNA delivery reduces cell viability without triggering apoptosis.
  • A Cell viability was determined using the MTT assay at the times indicated for three days after mRNA delivery of mRNA constructs to KB cells. PBS-mock-transfected cells were used as a control, with their viability set at 1. Each experiment was done in triplicate and repeated at least twice.
  • B Analysis of apoptotic cells using Western blots after mRNA delivery of mRNA constructs. Cells that were positively stained by annexin-V-FITC using flow cytometry were considered apoptotic. In panels A and B, error bars show the means ⁇ SD or three to six independent experiments. *p ⁇ 0.05.
  • C Western blot analysis for PARP cleavage after delivery of mRNA constructs. PBS-mock-transfected (vehicle) cells and untransfected cells were used as controls.
  • FIG. 5 Antimicrobial mRNAs persist for up to 32 hours in KB cells.
  • RNA was isolated using Trizol reagent (Life Technologies Corp., Carlsbad, Calif.) and RNeasy plus Mini-kits (Qiagen, Valencia, Calif.). Total RNA was reverse transcribed with Superscript III (Life Technologies Corp., Carlsbad, Calif.).
  • Quantitative Real-time Polymerase Chain Reaction was performed using PrimeTime pre-designed qRT-PCR assays (Hs.PT.42.1073747 for human CAMP, Hs.PT.42.3682141 for human S100A8, Hs.PT.42.3080635 for human S100A9, Hs.PT.45.227970.g for human ACTB; Integrated DNA Technologies, Coralville, Iowa).
  • the expression levels of CAMP, S100A8, S100A9 A8-IRES-A9 and A8-nIRES-A9 mRNA were normalized to ACTB ( ⁇ -actin) mRNA.
  • A CAMP mRNA transfection.
  • FIG. 7 Expression of S100A8 and S100A9 in human head and neck tissues and carcinoma cell lines.
  • the mRNA expression levels of S100A8 and S100A9 in (A) normal adjacent (NAT) and HNSCC tissues and (B) TR146 HNSCC and KB cells were measured by qRT-PCR and normalized to GAPDH; dotted line shown as a threshold for detection.
  • FIG. 8 S100A8/A9 suppressed anchorage-dependent and anchorage-independent growth of KB cells.
  • A Growth curves of KB-S100A8/A9 cells compared to KB-EGFP and KB wild-type control cells. Cells were grown on non-pyrogenic polystyrene tissue flasks in fresh MEM
  • FIG. 9 S100A8/A9 expression induced cell cycle and mitotic arrest at G2/M.
  • A Cell cycle analysis of KB, KB-EGFP and KB-S100A8/A9 cells post-synchrony. Cells cultured under standard conditions were serum-starved overnight, synchronized at G1/S with aphidicolin treatment and stimulated to re-enter cell cycle. Synchronized cells were stained with propidium iodide DNA staining solution and analyzed by flow cytometry for changes in DNA content following release from G1/S blockage.
  • B Mitotic analysis of synchronized cells stained with
  • D Percentage of mitotic cells post-synchrony, representing the mean of two independent repeat experiments. KB-S100A8/A9 cells showed fewer mitotic cells as shown by lower phospho-Histone H3 (Ser10) staining.
  • FIG. 10 S100A8/A9 modulates G2/M cell cycle checkpoint regulating molecules in SCC. Expression and phosphorylation (activation/inactivation) status of cell cycle regulators are shown by immunoblot analysis. Data shown are representative of multiple independent repeat experiments. Goat anti- ⁇ -actin polyclonal IgG was used to detect ⁇ -actin as protein loading control.
  • A Expression of G1/S regulating proteins, cyclin A, cyclin E, p21 and Rb, Chk2 and
  • FIG. 11 S100A8/A9 interaction with PP2A phosphatase increases activity.
  • IP co-immunoprecipitated
  • S100A8/A9 complex IP with 27E10 antibody
  • S100A9 subunit left panel
  • S100A9 used as S100A8/A9 complex marker protein
  • PP2A-A ⁇ / ⁇ subunit as detected by immunoblotting (IB).
  • IB immunoblotting
  • FIG. 12 Proposed S100A8/A9 (calprotectin)-mediated regulation of the G2/M cell cycle
  • FIG. 13 Stable expression of S100A8/A9 reduces floor-of-the-mouth tumor growth.
  • S100A8/A9 expressing KB carcinoma cells and sham transfected KB-cells expressing only EGFP were injected into the floor-of-the-mouth of separate groups of healthy mice as described in Example 3.
  • KB-EGFP cell tumors are histologically (stained with hematoxylin and eosin) more de-differentiated and have larger areas of necrosis than similarly sized KB-S100A8/A9 cell tumors. Data shown are from three individual experiments, with three mice per group.
  • FIG. 14 Stable shRNA knockdown of S100A8/A9 correlates with larger floor-of-the-mouth tumor growth.
  • TR146 buccal carcinoma cells were transfected with shRNA to stably knock down expression of endogenous S100A8 and S100A9. Knockdown resulted in approximately 70% less S100A8/A9 protein expression (A8A8c10 cells) than in sham-transfected cells (Neg3) (data not shown).
  • TR146 cells with shRNA knockdown of S100A8/A9 form orthotopic tumors that are 20% larger by day 17 (p ⁇ 0.2) than sham transfected (Neg3) cells. Data shown are from two individual experiments, with three mice per group.
  • FIG. 15 Effects of saliva concentration and treatment time on EGFP mRNA delivery into KB cells.
  • Cells were incubated at 37° C. with 10%, 50% or 90% saliva for (A) one minute, (B) three minutes, or (C) five minutes, washed three times with fresh medium, and then incubated with packaged, modified mRNA encoding EGFP.
  • Cells treated with 50% saliva but without mRNA delivery were used as control.
  • FIG. 16 EGFP mRNA delivery into KB cells: effects of wash frequency to reverse effects of saliva treatment. Cells were treated with 90% saliva for three minutes, washed for the indicated frequencies with fresh medium, followed by mRNA transfection.
  • compositions and methods that involve introducing an mRNA into a cell so that the cell expresses one or more polypeptides that can decrease the likelihood and/or extent to which the cell functions abnormally and/or is susceptible to infection by a pathogen.
  • the methods and compositions can provide therapy against conditions that result from infection including, for example, infectious diseases and certain neoplasms.
  • the polypeptide is expressed only as long as the mRNA can be translated in the target cells—i.e., expression is transient, not permanent. If the cells form a target tissue that is accessible, the mRNA can be re-introduced repeatedly for sustained therapeutic benefit.
  • Mucosal epithelia provide the first line of defense against the invasion of microbes. Oral and other mucosal epithelial cells confer protection against invading bacteria through a cell autonomous mechanism using two effector antimicrobial peptides (AMPs), calprotectin (S100A8/S100A9 heterodimer) in the cytosol and cathelicidin antimicrobial protein (CAMP) in endosomes.
  • AMPs effector antimicrobial peptides
  • CAMP cathelicidin antimicrobial protein
  • CAMP mRNA capped with anti-reverse cap analogue (ARCA) was more effective than the capping enzyme (CE) cap 0 or CE 1.
  • CAMP, S100A8, and S100A9 protein levels generally peaked at 16 hours after mRNA transfection. In contrast, cotransfection with S100A8/S100A9 resulted in maximal protein expression at 24 hours. After transfection with tandem mRNAs (A8-IRES-A9 and A8-nIRES-A9), S100A8 protein levels were maximal at 16 hours, whereas S100A9 peaked at 32 hours to 40 hours.
  • Human CAMP is a member of a large family of cationic antimicrobial peptides expressed in many species that have broad-spectrum activity against bacteria, fungi, and enveloped viruses and also show immunomodulatory effects (Zanetti, 2004 . J. Leukoc. Biol. 75: 39-48; Bucki et al., 2010 . Arch. Immunol. Ther. Exp . ( Warsz ). 58: 15-25; Strandberg et al., 2012 . Infect. Immun. 80: 3930-3938; Burton et al., 2009 . Nat. Prod. Rep. 26: 1572-1584).
  • human CAP-18 precursor encoded by CAMP is stored in neutrophil granules and epithelial cells until activated through cleavage by proteinase 3, a serine protease (Sorensen et al., 2001 . Blood 2001, 97: 3951-3959).
  • the 37-residue active peptide (LL-37) mediates a wide range of biological responses such as, for example, direct killing of microorganisms, chemotaxis and chemokine induction, regulation of inflammatory responses, and adjuvant, angiogenic, and wound healing effects (Nijnik et al., 2009. Curr. Opin. Hematol. 16: 41-47).
  • LL-37 appears to be directly antimicrobial in the phagolysosomes of neutrophils and macrophages and at sites of acute inflammation (Nijnik et al., 2009. Curr. Opin. Hematol. 16: 41-47), showing broad spectrum antimicrobial activity against Listeria monocytogenes (Turner et al., 1998. Antimicrob. Agents Chemother. 42: 2206-2214), Salmonella typhimurium (Larrick et al., 1995. Immunotechnology 1: 65-72), and Streptococcus group A, B and C (Dorschner et al., 2001 . J. Invest. Dermatol. 117: 91-97).
  • CAMP expression can be induced by 1,25-dihydroxyvitamin D3 (Wang et al., 2004. J. Immunol. 173: 2909-2912), pathogens (Midorikawa et al., 2003. Infect. Immun. 71: 3730-3739; Nijnik et al., 2009. Curr. Opin. Hematol. 16: 41-47) or lipopolysaccharide (LPS) (Nell et al., 2004. FEMS Immunol. Med. Microbiol. 42: 225-231).
  • CAMP/LL-37 production accompanies increased invasion and colonization of pathogens in epithelial cells in diseases such as, for example, morbus Kostmann and Papillon-Lefevre syndrome (Carlsson et al., 2006. J. Periodontol. 77: 744-751; de Haar et al., 2006. Infect. Immun. 74: 5284-5291), Crohn's disease (Schauber et al., 2006 . Mol. Nutr. Food Res. 50: 1006-1012) and atopic dermatitis (Ong et al., 2002. N. Engl. J. Med. 347: 1151-1160).
  • diseases such as, for example, morbus Kostmann and Papillon-Lefevre syndrome (Carlsson et al., 2006. J. Periodontol. 77: 744-751; de Haar et al., 2006. Infect. Immun. 74: 5284-5291), Crohn's disease (Scha
  • Calprotectin is a heterodimeric complex of calcium-binding proteins S100A8 (MRP8 or calgranulin A, 10.8 kDa) and S100A9 (MRP14 or calgranulin B, 13.2 kDa) (Champaiboon et al., 2009 . J. Biol. Chem. 284:7078-90).
  • S100A8 and S100A9 are members of the S100 family of proteins. Family members contain two EF-hand calcium-binding motifs and the proteins are involved in cell growth, cell differentiation, cell cycle progression, cell survival, protein phosphorylation, transcription, cancer development and inflammatory diseases (Donato, 2001. Int. J. Biochem. Cell Biol.
  • Calprotectin shows broad spectrum antimicrobial activity against mucosal and epidermal Candida albicans and bacteria including Capnocytophaga spumblea, Escherichia coli, Staphylococcus epidermis, Listeria monocytogenes, Salmonella typhimurium , and Porphyromonas gingivalis (Champaiboon et al., 2009 . J. Biol. Chem. 284:7078-90; Miyasaki et al., 1993. J. Dent. Res. 72: 517-523; Sohnle et al., 1991. J. Infect. Dis. 163: 187-192; Steinbakk et al., 1990.
  • Mucosal epithelial cells therefore, can protect against and suppress invasive pathogens mainly using two antimicrobial effector systems, CAMP/LL-37 largely in endosomes (Chamilos et al., 2012 . Blood 120: 3699-3707) and calprotectin (S100A8/S100A9) in the cytosol (Champaiboon et al., 2009 . J. Biol. Chem. 284:7078-90).
  • CAMP specific antimicrobial effector mRNAs
  • mRNA transfections for therapeutic purposes can replace or augment expression of proteins through systemic or ex vivo administration (Tavernier et al., 2011 . J. Control. Release. 150: 238-47). This approach avoids transfection with DNA and the attendant challenges including, for example, imprecise, mutagenic insertion into the host cells.
  • a view towards augmenting mucosal innate immunity we report the delivery of CAMP and S100A8/S100A9 mRNAs into human epithelial cells and the functional antibacterial effects of those transfections.
  • Capping at the 5′ end of mRNA enhances the stability of the expressed message.
  • An ARCA can cap at an efficacy up to 80% and the capping enzyme (CE) can increase capping efficiency to 100% (Zhao et al., 2010 . Cancer Res. 70: 9053-9061).
  • CE capping enzyme
  • To optimize the capping strategy we compared mMESSAGE mMACHINE® T7 Ultra (Life Technologies Corp., Carlsbad, Calif.), which generates ARCA-capped mRNA, with the mScriptTM RNA System (Cell Script Inc., Madison, Wis.), which uses capping enzyme (CE), and 2′-O-Methyltransferase capping enzyme to generate a cap 0 or cap 1.
  • CAMP mRNAs were synthesized using the different capping systems, delivered into KB cells and protein expression was detected by western blot analysis. At eight hours, 24 hours, and 48 hours after transfection with ARCA-capped mRNAs, KB cells expressed more CAMP protein than after transfection with CE cap 1, which was higher than CE cap 0 ( FIG. 1A ). CAMP protein levels peaked at about 16 hours and decreased by about 50% at 40 hours to 48 hours after ARCA capped mRNA delivery ( FIG. 1B ). ARCA capping was then used for all experiments. We also compared mRNA stability when expressed with 3′ extensions of 64A and 150A. There was little difference (data not shown) and we used 150A for all subsequent experiments.
  • KB cells natively express mRNA for CAMP, S100A8, and S100A9 below the level of detection (data not shown). Therefore, endogenous S100A8, S100A9, and CAMP mRNAs expressed in KB cells will contribute little to subsequent levels after transfection with ARCA-capped mRNAs.
  • an S100A8 ORF containing a Kozak sequence was cloned into pIRES MCS A and S100A9 was cloned into MCS B.
  • native IRES native IRES (nIRES) was constructed and inserted between S100A8 and S100A9 ORFs.
  • the CAMP mRNA level was approximately half that at four hours, indicating that the half-life in KB cells was between 12 hours and 16 hours ( FIG. 5A ).
  • co-transfection of S100A8 mRNAs resulted in mRNA half-lives of 12 hours to 16 hours
  • co-transfection of S100A9 mRNAs resulted in mRNA half-lives of eight hours to 12 hours ( FIG. 5B ).
  • the tandem mRNAs were transfected, the half-life of A8-IRES-A9 was 12 hours to 16 hours whereas the half-life of A8-nIRES-A9 mRNA was eight hours to 12 hours ( FIG. 6C , 6 D). The half-lives of these mRNAs were eight hours to 16 hours in KB cells.
  • FIG. 2A ARCA-capped mRNAs for S100A8 ( FIG. 2A ), S100A9 ( FIG. 2B ), and calprotectin (1:1 mol/mol S100A8+S100A9) ( FIG. 2C ) were compared for protein expression.
  • Expression of S100A8 protein alone was maximal at 16 hours and decreased by about half at about 28 hours ( FIG. 2A ), whereas S100A9 protein maximized at 16 hours and decreased to half at about 40 hours to 48 hours ( FIG. 2B ).
  • co-transfection of S100A8 and S100A9 mRNAs half the amount of each compared to transfections with either S100A8 or S100A9 appeared to increase the stability of each peptide.
  • each protein was expressed throughout the time course ( FIG. 2C , 2 D).
  • protein maximized at 24 hours and decreased by half at about 72 hours ( FIG. 2C ).
  • S100A9 protein also maximized at 24 hours and decreased to half at about 48 hours to 72 hours ( FIG. 2C ).
  • Co-transfection of S100A8 and S100A9 mRNA led to increased stability of each peptide suggesting that calprotectin heterodimer formation is preferred.
  • the TransIT-mRNA Delivery System Reduces Cell Viability without Triggering Apoptosis.
  • Cytolethality of these mRNAs delivered by TransIT-mRNA transfection reagent was analyzed by measuring cell viability using MTT assay and by quantifying apoptotic cells via flow cytometry and PARP-cleavage.
  • transfection of cells with vehicle, CAMP, S100A8/S100A9, A8-IRES-A9, or A8-nIRES-A9 mRNAs significantly reduced cell viability 48 hours and 72 hours later ( FIG. 4A ).
  • delivery of the vehicle, CAMP, S100A8/S100A9, A8-IRES-A9 or A8-nIRES-A9 mRNAs did not affect apoptosis ( FIG.
  • mRNA delivery has several advantages over DNA gene transfer techniques. Since mRNA does not integrate into the genome and the transfection remains transient, the pharmaceutical safety of mRNA transfection is greater than for DNA gene transfer therapy. With the goal of developing a therapeutic that augments mucosal immunity, we show for the first time the delivery of in vitro transcribed, capped, and polyadenylated mRNAs specifying antimicrobial protein into human epithelial cells and the corresponding functional effects.
  • Calprotectin the heterodimeric complex of S100A8 and S100A9, increases innate immunity of the cytoplasm of epithelial cells increasing resistance against invading bacteria including Listeria spp. and Salmonella spp.
  • Co-transfection with both the S100A8 and S100A9 mRNAs induced production of S100A8/A9 in the KB cells ( FIG. 6C ).
  • pIRES to construct a mammalian expression vector that allows high level expression of two genes from the same bicistronic mRNA transcript.
  • the vector contains the encephalomyocarditis virus (ECMV) internal ribosome entry site (IRES) flanked by two multiple cloning sites (MCS A and B) (Bochkov et al., 2006 . Biotechniques 41: 283-284, 286, 288).
  • the first cistron is translated by the cap-dependent scanning mechanism, whereas the second cistron is translated by the cap-independent IRES element initiation mechanism (Bochkov et al., 2006 . Biotechniques 41: 283-284, 286, 288).
  • pIRES contains a partially disabled IRES sequence that reduces the rate of translation of the gene cloned into MCS B in comparison to MCS A (Rees et al., 1996 .
  • S100A8 and S100A9 protein expression was more stable when co-transfected or when A8-IRES-A9 or A8-nIRES-A9 mRNAs were delivered ( FIG. 2D , 2 E).
  • the several constructs for S100A8/S100A9, A8-IRES-A9 and A8-nIRES-A9 mRNAs resulted in different kinetics of translation and it is apparent that the MCS B site insert proximal to pIRES ( FIG. 2D ) and nIRES ( FIG. 2E ) showed a delay.
  • the mRNAs in the MCS B site may be scanned and translation initiated by a low efficiency, cap-independent IRES mechanism in KB cells.
  • an mRNAs may be constructed to include one or more modified bases. Such modified mRNAs may exhibit increased stability and/or reduced potential for immune responses (Kormann et al, 2011 , Nat Biotechnol 29(2):154-157).
  • saliva contains high molecular mass mucins and many other proteins that could form a diffusion barrier at the surface of epithelial cells in the mouth.
  • saliva contains RNases, which could degrade the therapeutic mRNAs.
  • saliva-treated epithelium in vitro reversed the inhibition of the mRNA transfection approach.
  • washing mucosal epithelium and preventing re-exposure to saliva can help overcome the salivary barrier to transfection and increase transfection efficiency.
  • saliva is a representative model of mucosal fluids, particularly with respect to composition and viscosity.
  • the saliva wash results shown in FIG. 15 and FIG. 16 indicate that pretreatment of a mucosal surface by washing mucosal fluids from the surface can increase the transformation efficiency of other mucosal epithelia such as, for example, mucosal epithelia of the genitourinary system, eyes, or other squamous mucosae.
  • Calprotectin may be involved in growth regulation and tumorigenesis in HNSCC and other squamous cell carcinomas (SCCs).
  • S100A8/A9 is constitutively expressed in the cytoplasm of healthy squamous epithelial cells of the oral cavity and oropharynx (Ross et al., 2001 . Infect Immun 69: 3248-3254; Hitomi et al., 1998 . Arch Histol Cytol 61: 163-178).
  • S100A8 and S100A9 are members of the S100 family of proteins, which contain two canonical EF-hand calcium-binding motifs involved in calcium-dependent control of cell differentiation, cell cycle progression and growth (Itou et al., 2002 . J Mol Biol 316: 265-276), and are implicated in cancer development and other inflammatory diseases.
  • extracellular S100A8/A9 typically released from the cytoplasm of infiltrating polymorphonuclear leukocytes and macrophages (Hessian et al., 2001 .
  • S100A8/A9 appears to be cell-and tissue-specific and may be differentially regulated in different malignancies.
  • S100A8/A9 levels can be abnormally elevated in human primary tumors originating from tissues that do not normally express the protein, such as the skin (Gebhardt et al., 2002 . Oncogene 21: 4266-4276), breast (Arai et al., 2008 . Curr Cancer Drug Targets 8: 243-252; Moon et al., 2008 . Mol Cancer Res 6: 1544-1553), thyroid (Ito et al., 2009 . Anticancer Res 29: 4157-4161), liver (Nemeth et al., 2009 .
  • S100A8/A9 expression can decrease in human tumors of squamous epithelial cell origin that normally express the protein complex constitutively, such as head and neck (including oral, nasopharyngeal and oropharyngeal) (Melle et al., 2004. Cancer Res 64: 4099-4104; Gonzalez et al., 2003 . Arch Otolaryngol Head Neck Surg 129: 754-759; Fung et al., 2000. Life Sci 67: 923-936), esophageal (Kong et al., 2004. World J Gastroenterol 10: 1093-1097; Wang et al., 2004.
  • head and neck including oral, nasopharyngeal and oropharyngeal
  • S100A8/A9 functions as a growth regulating factor in SCCs.
  • G1/S and G2/M cell cycle checkpoints are dysregulated in carcinomas, leading to uncontrolled cell growth and proliferation.
  • Growth regulation by S100A8/A9 in KB cells was not found to be through G1, G1/S checkpoint or S phase. Instead, S100A8/A9 expression increases protein phosphatase 2A (PP2A) activity, apparently through protein-protein interaction, which appears to be involved in modulating and restoring G2/M checkpoint signaling and reduction of carcinoma growth.
  • P2A protein phosphatase 2A
  • PP2A is a serine and threonine (Ser/Thr) protein phosphatase known to regulate cell cycle checkpoint by targeting G2/M-specific Cdc25C for inactivation by dephosphorylation at Thr48, inhibiting the mitotic exit, and cell division (Forester et al., 2007 . Proc Natl Acad Sci USA 104: 19867-19872; Margolis et al., 2006 . Cell 127: 759-773). PP2A targets a broad spectrum of phosphoproteins and has also been shown to exert anti-tumor activities by inhibiting AKT and C-MYC in the cell survival and proliferation pathways and by inducing cell cycle arrest (Guenin et al., 2008.
  • PP2A When interacting with S100A8/A9 [B30], PP2A may be activated to exert regulatory roles in cell cycle progression at the G2/M checkpoint. S100A8/A9 and PP2A may therefore function as interacting partners to regulate mitosis and control cellular growth. Reduction in S100A8/A9 in carcinomas (in HNSSC for example) may lead to a diminished PP2A phosphatase activity and increased growth and tumorigenesis.
  • S100A8/A9 protein expression is reduced in HNSCC (Driemel et al., 2007 . Proteomics Clin Appl 1: 486-493; Roesch et al., 2005 . Eur J Cell Biol 84: 431-444).
  • qRT-PCR real-time quantitative reverse-transcription polymerase chain reaction
  • KB-S100A8/A9 cells are S100A8/A9-negative KB cells transfected to over-express S100A8/A9, whereas KB-EGFP cells are sham-transfected controls.
  • S100A8 and S100A9 mRNA and protein expression was barely detectable, whereas transfected KBS100A8/A9 and TR146 cells clearly showed S100A8 and S100A9 protein expression ( FIG. 7C , 7 D).
  • S100A8-specific and S100A9-specific stable shRNA transfection of TR146 cells reduced endogenous S100A8 and S100A9 proteins to barely detectable levels ( FIG. 7D ).
  • S100A8 and S100A9 protein levels appear to differ as shown by immunoblotting ( FIG. 7C , 7 D). Such differences may be real or reflect differences in the sensitivity of the primary antibodies used. Hence, the levels of S100A8 and S100A9 could not be directly compared to one another.
  • KB wild-type, KB-EGFP and KB-S100A8/A9 cells progressed through G1/S phase and entered G2/M phase at approximately the same rate as determined by PI-staining of DNA ( FIG. 9A , 9 C).
  • KB and KB-EGFP cells exited G2/M phase by 11 hours and the G2/M cell population returned to background levels by 13 hours postsynchrony.
  • KB-S100A8/A9 cells appeared to arrest in G2/M phase for at least three hours. Consistent with these observations, KB-S100A8/A9 cells showed fewer mitotic cells at nine hours post-synchrony and remained in metaphase longer than KB-EGFP cells ( FIG. 9B , 9 D).
  • FIG. 10B Cell Cycle 7: 1285-1300
  • S100A8/A9 expression increased phosphorylation of the G2/M-associated checkpoint kinase p-Chk1 (Ser345), phosphatase p-Cdc25C (Ser216) and p-Cdc2 (Thr14/Tyr15) in KB-S100A8/A9, but did not alter expression levels of these proteins ( FIG. 10B ).
  • S100A8/A9 also decreased the mitotic active form of p-Cdc25C (Thr48) ( FIG. 10B ).
  • S100A8/A9 a binding partner and modulator of activity of protein phosphatase 2A (PP2A), a known cell cycle regulator.
  • PP2A protein phosphatase 2A
  • PP2A-C catalytic activity is negatively regulated by phosphorylation at Tyr307 and C-terminal Leu309 methylation is essential for the overall phosphatase activity.
  • the PP2A-B 56 ⁇ isoform has been reported to control Cdc25C and G2/M cell cycle checkpoint activity (Guenin et al., 2008 . Int J Oncol 32: 49-57; Perrotti et al., 2008 . Cancer Metastasis Rev 27: 159-168).
  • S100A8/A9 binding to PP2A was confirmed by co-immunoprecipitation assay using antibodies against S100A8/A9 complex or PP2A.
  • PP2A co-immunoprecipitated with S100A8/A9 when captured with 27E10 antibody (specific for S100A8/A9 complex) ( FIG. 11A ).
  • S100A9 used as a marker for S100A8/A9 complex
  • S100A8/A9 expression in KB-S100A8/A9 cells did not affect PP2A subunit protein levels (subunits A ⁇ / ⁇ , B56 ⁇ and C ⁇ / ⁇ ) using immunoblotting analysis; phosphorylation of subunit C ⁇ / ⁇ (Tyr307), however, appeared reduced ( FIG. 11B ).
  • C-terminal methylation appeared unaffected by S100A8/A9 expression as identified by anti-methylated-PP2A-C (Leu309) antibody.
  • PP2A phosphatase activity was then determined by measuring the level of inorganic phosphate (Pi) release from a phosphopeptide substrate. For up to seven hours post-synchrony, PP2A phosphatase activity was approximately five-fold greater in the presence of S100A8/A9 compared to the absence (KB-EGFP cells) of S100A8/A9, decreasing by seven-fold at 12 hours postsynchrony.
  • okadaic acid showed similar levels of p-Cdc25C (Ser216) as KB and KB-EGFP cells, suggesting that S100A8/A9-mediated increase in p-Cdc25C (Ser216) phosphorylation was inhibited ( FIG. 11D ).
  • S100A8 and S100A9 in complex are thought to have a regulatory role in cell cycle progression.
  • S100A8/A9 functions as a negative regulator of cell division and growth in KB cells and in TR146 human carcinoma cells by inducing G2/M cell cycle arrest.
  • KB cells were used as an in vitro model for gain-of-function study since this carcinoma cell line lacks the expression of S100A8 and S100A9 at both mRNA and protein levels.
  • TR146 is a more differentiated HNSCC cell line with detectable S100A8/A9 expression compared to other lines available.
  • S100A8/A9 complex is markedly down-regulated at both mRNA and protein levels compared to normal mucosa (S100A8/A9 is generally not detectable in squamous carcinoma cells).
  • HNSCC show approximately 10-fold lower S100A8 and S100A9 gene expression than NAT.
  • S100A8/A9 levels in NAT may reflect field cancerization.
  • S100A8/A9 gene expression in mucosal tissues of cancer-free individuals may be even greater, decreased S100A8/A9 expression levels are clearly associated with carcinogenesis.
  • S100A8/A9 protein is found in the cytoplasm and appears to localize in the nucleus (The Human Protein Atlas database, accessible at www.proteinatlas.org) or perinuclear area (Champaiboon et al., 2009 . J Biol Chem 284: 7078-7090) depending on cell growth status.
  • S100A8/A9 localizes to the microtubule organizing centers at the poles of the mitotic spindles.
  • the G2/M checkpoint is under the control of the checkpoint kinases Chk1/2 (Agarwal et al., 2003 . Oncogene 22: 8271-8282; Taylor et al., 2001 . Oncogene 20: 1803-1815).
  • Chk1/2 inactivate protein phosphatase Cdc25, which is required for activation of cyclin B/cyclin-dependent kinase 1 (CDK1, also known as Cdc2) complex and entry into mitosis (Agarwal et al., 2003 . Oncogene 22: 8271-8282; Taylor et al., 2001. Oncogene 20: 1803-1815).
  • S100A8/A9 expression in KB-S100A8/A9 cells induced a marked increase in the levels of inhibitory p-Cdc25C (Ser216), Cdc25C/14-3-3 ⁇ complex, and p-Cdc2 (Thr14/Tyr15).
  • the level of mitotically active p-Cdc25C (Thr48) and cyclin B1 was greatly reduced in the presence of S100A8/A9.
  • S100A8/A9-induced inactivation of Cdc25C and cyclin B1/Cdc2 complex to negatively regulate the G2/M cell cycle progression is suggested to reduce carcinoma growth and may inhibit tumor formation.
  • S100A8/A9-expressing KB-S100A8/A9 and TR146 cells both showed significant reduction in growth and clonogenicity when compared to S100A8/A9-negative or S100A8/A9-knockdown cells.
  • S100A8/A9-dependent induction of G2/M checkpoint contributed significantly to the suppression of mitotic activity and growth of KB cells.
  • Expression of S100A8/A9 caused KB-S100A8/A9 cells to arrest and accumulate at G2/M, inhibiting progression into mitosis without affecting the rate of G1/S-to-G2/M transition.
  • this growth inhibiting effect of S100A8/A9 is consistent with a report in epidermal keratinocytes, where ectopic transient expression of S100A8/A9 suppressed cell division and proliferation (Voss et al., 2011 .
  • S100A8/A9 expression also had no apparent effect on the levels of G1/S-associated downstream regulator proteins and the percentages of S100A8/A9-positive and -negative cells in G1/S and S phase were similar following the release from synchrony. Although a defect in G1/S has not been rigorously excluded, S100A8/A9-mediated regulation of cell cycle is strongly suggested to affect G2/M.
  • the PP2A-C ⁇ / ⁇ subunit is the enzymatic active site of PP2A and its phosphatase activity is controlled by phosphorylation at Tyr307 and methylation at Leu309, which is also essential for the holoenzyme assembly.
  • expression of S100A8/A9 did not affect the protein level of PP2A-A ⁇ / ⁇ , PP2A-B56 ⁇ (a regulatory subunit known to signal targeting of Cdc25C) or PP2A-C ⁇ / ⁇ subunits.
  • Leu309 methylation levels of PP2A-C (methyl-PP2A-C) subunit were also similar in KB-S100A8/A9, KB-EGFP and wild-type control cells. These data suggest that S100A8/A9 has no regulatory effects on PP2A expression or the holoenzyme assembly in KB cells. The phosphorylation level of the Tyr307 inhibitory residue of PP2A-C, however, was reduced in KB-S100A8/A9 cells, suggesting increased phosphatase activity of the enzyme.
  • S100A8/A9 expression augmented pre-mitotic PP2A phosphatase activity in KB-S100A8/A9-transfected cells.
  • S100A8/A9 protein was preincubated with KB-EGFP cell lysate (lacking S100A8/A9), PP2A activity was modulated similarly.
  • S100A8/A9 appears to directly signal an increase in dephosphorylation and activation of PP2A.
  • Post-mitotic PP2A phosphatase activity was markedly suppressed by S100A8/A9 expression, suggesting biphasic, cell cycle-dependent regulation by S100A8/A9.
  • PP2A also plays a role in G1/S cell cycle arrest (Pitre et al., 2012 . Mol Biol Cell 23: 1243-1253; Hofstetter et al., 2012 . PLoS One 7: e30059), independent of the G2/M checkpoint signaling pathway.
  • S100A8/A9 did not alter G1 to S cell cycle progress, an S100A8/A9-independent inhibition of G1/S (pharmacologically by aphidicolin in this case) could have signaled PP2A activation.
  • PP2A phosphatase activity at G1/S was either dependent on or enhanced by S100A8/A9 expression in KB-S100A8/A9 cells and will be further investigated in our future studies.
  • PP2A and S100A8/A9 appeared to interact directly based on co-immunoprecipitation experiments, suggesting a possible mechanism of PP2A activation by the S100A8/A9 protein complex.
  • S100A8/A9 as a key signaling mediator in the induction of G2/M cell cycle checkpoint and mitotic arrest through a PP2Adependent pathway ( FIG. 12 ).
  • S100A8/A9 expression increases PP2A phosphatase activity, potentially through direct protein-protein interaction and dephosphorylation of the inhibitory residue Tyr307 of the catalytic subunit PP2A-C, increasing activation of PP2A.
  • Activated PP2A is hypothesized to target and dephosphorylate p-Cdc25C (Thr48), allowing Cdc25C to be phosphorylated by Chk1 at inhibitory residue Ser216 (Perry et al., 2007 . Cell division 2: 12).
  • the G2/M cell cycle checkpoint is dysregulated, resulting in increased phosphorylation of Thr48 of p-Cdc25C and accelerated cell growth.
  • S100A8/A9 activates the G2/M checkpoint through PP2A to induce mitotic arrest (and reduction in growth) by reducing the level of p-Cdc25C (Thr48) and by increasing the levels of p-Chk1 (Ser345) and p-Cdc25C (Ser216).
  • S100A8/A9 may therefore function as a tumor suppressor in squamous epithelial cells and reduced expression may serve as an indicator for disease progression.
  • S100A8/A9 in HNSCC and other SCCs may prove to be an effective therapeutic strategy.
  • intracellular S100A8/A9 reduces floor-of-mouth tumor (orthotopic) formation in mice.
  • Tumor cells suspended in MATRIGEL (BD Biosciences, San Jose, Calif.) were inoculated into the floor of the mouth of nu/nu mice using an established protocol (Henson B. et al., 2007 . J Oral Pathol Med. 36:363-370).
  • KB cells expressing S100A8/A9 produce 65% smaller (p ⁇ 0.02) orthotopic tumors by day 17 than control sham transfected KB cells (expressing EGFP) ( FIG. 13A ).
  • S100A8/A9 expression correlated with more discrete and less invasive tumors ( FIG.
  • TR146 buccal carcinoma cells formed floor-of-the-mount (orthotopic) tumors that were 20% larger than tumors formed after sham knockdown in TR146 cells ( FIG. 14 ).
  • S100A8/A9 by carcinoma cells in floor-of-the-mouth tumors (orthotopic) is inversely related to the size of the tumors that form.
  • S100A8/A9 can function as a tumor suppressor.
  • Methods that result in increased expression of S100A8/A9 can be used as therapeutic methods for certain cancers that involve neoplasias of epithelial cells such as, for example, head and neck cancers, including but not limited to tumors of the floor-of-the-mouth.
  • Such methods can include introducing into a cell one or more mRNA polynucleotides that encode components S100A8/A9 so that the cell increases production of S100A8/A9.
  • the method can include administering to the subject one or active agents that result in an increase in expression of S100A8/A9.
  • active agents include, for example, regulatory cytokines such as IL-1 ⁇ , IL-1 ⁇ with keratinocyte growth factor, IL-6, IL-8 with and without CXCL8, IL-22, TNF ⁇ , CXCL1, CXCL2, CXCL3, CCL20.
  • active agents also include compounds that upregulate S100A8/A9 such as, for example, phorbol myristate acetate.
  • this disclosure describes a method for decreasing the likelihood and/or severity of infection of mucosal epithelia by a pathogenic microbe.
  • the method generally involves introducing into a cell an mRNA encoding a polypeptide involved in innate immunity and permitting the cell to express the polypeptide in an amount effective to decrease the likelihood that the cell is infected by a pathogen.
  • this disclosure describes a method of decreasing the likelihood or extent of epithelial cell proliferation.
  • the method generally involves introducing into an epithelial cell an mRNA encoding a polypeptide involved in suppressing cell proliferation and permitting the cell to express the polypeptide in an amount effective to decrease the likelihood that the cell proliferates in an anchorage-independent environment.
  • the term “polypeptide” refers to a sequence of amino acid residues without regard to the length of the sequence. Therefore, the term “polypeptide” refers to any amino acid sequence having at least two amino acids and includes full-length proteins.
  • the method may be performed in vitro or in vivo.
  • the mRNA may be introduced into the cell by any suitable method.
  • introducing the mRNA in vivo one typically can introduce the mRNA into the cell with the aid of an in vivo delivery vehicle.
  • Exemplary in vivo delivery vehicles can include components such as, for example, TransIT-mRNA and TransIT-mRNA boost reagents (Mirus Bio LLC, Madison Wis.).
  • the cell may be, or be derived from, an epithelial cell such as, for example, a cell of the mucosal epithelium.
  • exemplary cells include carcinoma cells.
  • Exemplary cells further include cells of the oral mucosa, vaginal mucosa, genital mucosa, tonsil epithelium, oropharynx, nasopharynx, lungs, gastrointestinal mucosa, or mucosal epithelium surrounding the eye.
  • the methods may be used as therapy for conditions that include, for example, carcinoma, gingivitis, periodontitis, oral candidiasis, streptococcal sore throat, mucositis, bacterial bronchitis, bacterial pneumonia, vaginosis, other vaginal and cervicovaginal infections, vaginal yeast infections, gastrointestinal infections (e.g., Listeria and Salmonella GI infections), infections of the eye, mucosa and/or perimucosal infections.
  • the methods are equally amenable to introducing mRNA to mucosal and related epithelia to express transiently virtually any protein that may be of preventive or therapeutic value such as tumor suppressors or proteins to improve wound healing.
  • proteins that might improve healing of recalcitrant skin wounds, antagonize skin cancers such as basal cell carcinoma, squamous cell carcinoma and melanoma, prevent scarification and keloid formation, or reverse the angiogenic process in epidermal nevi could be expressed using mRNA transfections.
  • the cells can be, or be derived from any of the in vivo cell types identified immediately above.
  • the cells can be, or be derived from, any suitable epithelial cell line such as, for example, human KB cells (ATCC CCL-17).
  • the mRNA encodes a polypeptide involved in innate immunity.
  • exemplary polypeptides involved in innate immunity include, for example, cathelicin antimicrobial protein (CAMP), calprotectin, S100A8, S100A9, any ⁇ -defensin, ⁇ -defensin, S100A7, S100A12, secretory leukocyte inhibitor, lipocalin 2, and lysozyme.
  • CAMP cathelicin antimicrobial protein
  • calprotectin S100A8, S100A9
  • any ⁇ -defensin ⁇ -defensin
  • S100A7 secretory leukocyte inhibitor
  • lipocalin 2 secretory leukocyte inhibitor
  • lysozyme secretory leukocyte inhibitor
  • a CAMP mRNA may encode CAP-18, a precursor that is activated to LL-37 by proteinase 3, a serine protease.
  • mRNA cargoes can encode virtually any host polypeptide to introduce, replace, or augment any function.
  • the method can be used to decrease the likelihood and/or extent of infection by a pathogen.
  • the pathogen may be any pathogen for which the cell is a target of infection.
  • Exemplary pathogens include, for example, fungi such as, for example, Candida albicans, Acinetobacter baumannii, Aspergillus spp. (e.g., A. nidulans and A. fumigatus ), and bacteria such as, for example, Capnocytophaga sproda, Escherichia coli, Staphylococcus spp. (e.g., S. aureus and S. epidermis ), Streptococcus spp. (e.g., S.
  • the mRNA can include a stabilizing moiety that increases the half-life of the mRNA once the mRNA is introduced into the cell.
  • the stabilizing moiety can include a 5′ cap such as, for example, anti-reverse cap analogue (ARCA) or a 7-methylguanylate (m 7 G) cap.
  • the stabilizing moiety can include a 3′ poly(A) extension.
  • Exemplary poly(A) extensions can include any number of adenine residues.
  • a poly(A) extension can include 64 adenine residues or 150 adenine residues with little apparent difference in the half-life of the mRNAs. Stabilization can also involve using modified bases when synthesizing the mRNA constructs.
  • the method can further include permitting the pathogen to contact the cell into which the mRNA has been introduced.
  • the cell to which the mRNA is introduced may be a cell of a subject having or at risk of having a condition caused by infection by the pathogen.
  • a subject having a condition caused by infection by the pathogen refers to a subject exhibiting one or more symptoms or clinical signs of the condition.
  • Symptom refers to any subjective evidence of disease or of a patient's condition.
  • Sign or “clinical sign” refers to an objective physical finding relating to a particular condition capable of being found by one other than the patient.
  • the term “at risk” refers to a subject that may or may not actually possess the described risk.
  • a subject “at risk” of infectious condition is a subject present in an area where other individuals have been identified as having the infectious condition and/or is likely to be exposed to the infectious agent even if the subject has not yet manifested any detectable indication of infection by the microbe and regardless of whether the animal may harbor a subclinical amount of the microbe.
  • introduction of the mRNA can be performed before, during, or after the subject first exhibits a symptom or clinical sign of the condition or, in the case of infectious conditions, before, during, or after the subject first comes in contact with the infectious agent.
  • treatment initiated before the subject first exhibits a symptom or clinical sign associated with the condition may result in decreasing the decreasing the severity of symptoms and/or clinical signs of the condition, completely resolving the condition, and/or decreasing the likelihood of experiencing clinical evidence of the condition compared to an animal to which the composition is not administered.
  • the method includes administering an effective amount of the composition to a subject having, or at risk of having, a particular condition.
  • an “effective amount” is an amount effective to reduce, limit progression, ameliorate, or resolve, to any extent, the symptoms or clinical signs related to the condition.
  • a formulation containing the mRNA may be provided in any suitable form including but not limited to a solution, a suspension, an emulsion, a spray, an aerosol, or any form of mixture.
  • the composition may be delivered in formulation with any pharmaceutically acceptable excipient, carrier, or vehicle.
  • the formulation may further include one or more additives including such as, for example, an adjuvant or an inert carrier (e.g., a nanoparticle).
  • the amount of mRNA administered to a subject can vary depending on various factors including, but not limited to, the weight, physical condition, and/or age of the subject, the route of administration, the specific mRNA cargo, and/or the stability of the resulting protein expression.
  • the absolute amount of mRNA included in a given unit dosage form can vary widely, and depends upon factors such as the mRNA cargo, the therapeutic indication, the species, age, weight and/or physical condition of the subject, as well as the method of administration. Accordingly, it is not practical to set forth generally the amount that constitutes an amount of mRNA effective for all possible applications. Those of ordinary skill in the art, however, can readily determine the appropriate amount with due consideration of such factors.
  • mRNA may be administered, for example, in a single dose to multiple doses. Because the mRNA does not integrate into the genome of the subject, the therapeutic and/or prophylactic effect of introducing the mRNA into cells of the subject will naturally dissipate over time. Thus, a therapeutic or prophylactic regimen that involves introducing mRNA into a cell of a subject can include multiple treatments.
  • this disclosure describes a composition that includes an mRNA that encodes a polypeptide involved in innate immunity, as described herein, and an in vivo delivery vehicle.
  • the composition can have anti-tumor, antimicrobial, and/or antifungal activity and may, therefore, be an anti-tumor, antimicrobial, and/or antifungal agent.
  • mRNA described herein may be formulated in a composition along with a “carrier.”
  • carrier includes any solvent, dispersion medium, vehicle, coating, diluent, antibacterial, and/or antifungal agent, isotonic agent, absorption delaying agent, buffer, carrier solution, suspension, colloid, and the like.
  • carrier includes any solvent, dispersion medium, vehicle, coating, diluent, antibacterial, and/or antifungal agent, isotonic agent, absorption delaying agent, buffer, carrier solution, suspension, colloid, and the like.
  • the use of such media and/or agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions.
  • pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to an individual along with mRNA without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
  • the mRNA may be formulated into a pharmaceutical composition.
  • the pharmaceutical composition may be formulated in a variety of forms adapted to a preferred route of administration.
  • a composition can be administered via known routes including, for example, oral, parenteral (e.g., intradermal, transcutaneous, subcutaneous, etc.), or topical (e.g., intranasal, intrapulmonary, intramammary, intravaginal, intrauterine, intradermal, transcutaneous, rectally, etc.).
  • a composition can be administered to a mucosal surface, such as by administration to, for example, the vaginal, nasal, or respiratory mucosa (e.g., by spray or aerosol).
  • a composition also can be administered via a sustained or delayed release.
  • a formulation may be conveniently presented in unit dosage form and may be prepared by methods well known in the art of pharmacy.
  • Methods of preparing a composition with a pharmaceutically acceptable carrier include the step of bringing a vector containing the mRNA into association with a carrier that constitutes one or more accessory ingredients.
  • a formulation may be prepared by uniformly and/or intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product into the desired formulations.
  • the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
  • Human KB cells (American Type Culture Collection, ATCC CCL-17) were cultured in Modified Eagle's Medium (MEM, Mediatech Inc, Herndon, Va.) supplemented with 10% Fetal Bovine Serum (FBS) at 37° C. in a 5% CO 2 incubator.
  • MEM Modified Eagle's Medium
  • FBS Fetal Bovine Serum
  • L. monocytogenes ATCC 10403S and S. enterica serovar Typhimurium ( S. typhimurium ) ATCC 14028 were grown in brain heart infusion medium (DIFCO, BD Diagnostic Systems, Sparks, Md.) and on tryptic soy agar (DIFCO, BD Diagnostic Systems, Sparks, Md.) at 37° C.
  • Listeria and Salmonella cells were harvested from log phase and stationary phases, respectively, at an absorbance of 0.4-0.6 at 620 nm), and used to infect KB cells.
  • pGEM4Z.ss1bbz.2bgUTR.150A (provided by Prof. Carl H. June & Dr. Yangbing Zhao, University of Pennsylvania) were digested using NotI and HindIII to remove the insertion (Zhao et al., 2010 . Cancer Res. 70: 9053-9061.). Then open reading frames (ORFs) of EGFP (Primer pairs P1 & P2), human CAMP (Primer pairs P3 & P4), S100A8 (Primer pairs P5 & P6) and S100A9 (Primer pairs P7 & P8) containing Kozak sequence, were cloned into pGEM4Z.2bgUTR.150A (Table 1).
  • S100A8 ORFs containing Kozak sequences were cloned into the first multiple cloning site (MCS) of pIRES vector (Clontech Laboratories, Inc., Mountain View, Calif.) via Nhe I and XhoI (Primer pairs P11 & P12).
  • S100A9 ORFs containing Kozak sequence was cloned into the second MCS via XbaI and NotI (Primer pairs P13 & P14) (Table 1). Then A8-IRES-A9 fragments were amplified (Primer pairs P9 & P10) and also cloned into pGEM4Z. 2bgUTR.150A to generate plasmid pGEM4Z.A8-IRES-A9.2bgUTR.150A (Table 1).
  • Oligonucleotides Probes Name Fragments Oligonucleotidesequence (5′-3′) SEQ ID NO: Primers for fragments cloned into pGEM4Z. 2bgUTR.150A vector 1 P1 (sense) EGFP ATGGTGAGCAAGGG 2 P2 (antisense) TTACTTGTACAGCTCGTCCATGCCGAG 3 P3 (sense) CAMP CCTAAGCTTGCCACCATGAAGACCCAAAGGGATGGCC 4 P4 (antisense) CTAGGACTCTGTCCTGGGTACAAGATTCC 5 P5 (sense) S100A8 ATGTTGACCGAGCTGGAGAAAGCC 6 P6 (antisense) CTACTCTTTGTGGCTTTCTTCATGGC 7 P7 (sense) S100A9 ATGACTTGCAAAATGTCGCAGCTG 8 P8 (antisense) ATTTGCGGCCGCTTAGGGGGTGCCCTCCCC 9 P9 (sense) A8-IRES-
  • IRES in the pIRES vector is a partially disabled sequence (Rees et al., 1996 . Biotechniques 20: 102-110; Bochkov et al., 2006 . Biotechniques 41: 283-284, 286, 288 passim).
  • native IRES nIRES
  • pGEM4Z.A8-IRES-A9.2bgUTR.150A vectors were used as templates and amplified with the primer pair 5′-AAACGTCTAGGCCCCCCGAACC-3′/5′-TTTAACCTCGACTAAACACATGTAAAGCATGTGC-3′.
  • the products were purified and self-ligated to generate plasmids pGEM4Z.A8-IRES/mut1-A9.2bgUTR.150A.
  • the primer pair 5′-ACCATGACTTGCAAAATGTCGCAGCTG-3′/5′-ATTATCATCGTGTTTTTCAAAGGAAAACCAC-3′ were used to amplify using pGEM4Z.S100A8-IRES/mut1-S100A9.2bgUTR as templates, then fragments were purified and self-ligated to generate plasmids pGEM4Z.A8-nIRES-A9.2bgUTR.150A.
  • Templates were amplified from corresponding plasmid constructs and extracted from gels. Purified fragments were treated with 0.5% SDS and 100 ⁇ g/ml Protease K at 50° C. for 30 minutes and extracted with phenol:chloroform:isoamyl alcohol (25:24:1) and then with chloroform. After ethanol precipitation, templates were dissolved in 10 mM Tris-HCl and stored at ⁇ 80° C.
  • mRNAs were synthesized and then purified using a MEGAclear Kit (Life Technologies Corp., Carlsbad, Calif.) followed by ethanol precipitation.
  • Cells were extracted using Mammalian Cell-PE LBTM buffer (G-Biosciences, St. Louis, Mo.). The extracted proteins were separated by SDS-PAGE, transferred onto nitrocellulose membranes, and incubated with one of the following: rabbit anti- ⁇ -actin (DB070, Delta Biolabs, LLC, Gilory, Calif.), mouse anti-LL37 (sc-166770, Santa Cruz Biotechnolology, Inc., Santa Cruz, Calif.), mouse anti-S100A8 (sc-48352, Santa Cruz Biotechnolology, Inc., Santa Cruz, Calif.), rabbit anti-S100A9 (sc-20173, Santa Cruz Biotechnolology, Inc., Santa Cruz, Calif.), rabbit anti-PARP (#9542S, Cell signaling).
  • rabbit anti- ⁇ -actin DB070, Delta Biolabs, LLC, Gilory, Calif.
  • mouse anti-LL37 sc-166770, Santa Cruz Biotechnolology, Inc., Santa Cruz, Calif.
  • MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
  • transfected cells were evaluated for PARP cleavage using rabbit anti-PARP in Western blots as described above and by flow cytometry using the Annexin V-FITC Apoptosis Detection Kit (MBL International Corp, Watertown, Mass.) according to the manufacturer's recommendations.
  • MBL International Corp, Watertown, Mass. the Annexin V-FITC Apoptosis Detection Kit
  • cells were trypsinized, washed with 2.5% FBS in PBS, and incubated with Annexin V-FITC plus propidium iodide in binding buffer at room temperature for 5 min in the dark.
  • Quantitative Real-time Polymerase Chain Reaction was performed using PrimeTime pre-designed qRT-PCR assays (Hs.PT.42.1073747 for human CAMP, Hs.PT.42.3682141 for human S100A8, Hs.PT.42.3080635 for human S100A9, Hs.PT.45.227970.g for human ACTB; Integrated Device Technology, San Jose, Calif.).
  • the expression level of CAMP, S100A8, S100A9 A8-IRES-A9 and A8-nIRES-A9 mRNA was normalized to ACTB mRNA.
  • mice were incubated with mouse anti-calprotectin (mAb 27E10, sc-33714, Santa Cruz Biotechnolology, Inc., Santa Cruz, Calif.) or mouse anti-LL37 (sc-166770, Santa Cruz Biotechnolology, Inc., Santa Cruz, Calif.) for one hour, followed by Alexa Fluor 568-conjugated goat anti-mouse IgG or Alexa Fluor 488-conjugated goat anti-rabbit IgG (Life Technologies Corp., Carlsbad, Calif.) for one hour.
  • Alexa Fluor 568-conjugated goat anti-mouse IgG or Alexa Fluor 488-conjugated goat anti-rabbit IgG (Life Technologies Corp., Carlsbad, Calif.) for one hour.
  • EGFP mRNA transfection no antibody incubation was needed. Nuclei were stained with DAPI. Fluorescence images were captured using an epifluorescence microscope system. A8-IRES-A9 and A8-nIRE
  • the human carcinoma cell line KB (ATCC CCL-17), negative for S100A8/A9 expression, was cultured in Minimum Essential Medium (MEM).
  • MEM Minimum Essential Medium
  • TR146 expressing S100A8/A9 endogenously was cultured in Dulbecco's Modified Eagle's Medium/Ham's F-12 (DMEM/F-12).
  • TR146 cells were originally derived from a cervical lymph node metastasis of a well-differentiated buccal carcinoma (Rupniak et al., 1985 . J Natl Cancer Inst 75: 621-635) and was a gift from Dr. Reuben Lotan, University of Texas, M.D. Anderson Cancer Center, Houston, Tex. (Eicher et al., 1996 .
  • Carcinoma cells stably transfected to express S100A8/A9 (KB-S100A8/A9, formerly known as KB-MRP8/14) or sham control vector (KB-EGFP) were generated from KB cells as previously reported (Nisapakultorn et al., 2001 . Infect Immun 69: 4242-4247). Briefly, KB cells were co-transfected with the mammalian expression vector, pIRES-EGFP (Clontech, Palo Alto, Calif.), containing S100A8 (MRP8) or S100A9 (MRP14) subunit genes, and the selectable marker pSV2-neo (G418 sulfate-resistant marker gene).
  • the resulting cell line, KBS100A8/A9 expresses S100A8/A9 protein complex.
  • the KB-EGFP sham-transfection control was generated by co-transfection of insertless pIRES-EGFP and pSV2-neo. Both KBS100A8/A9 and KB-EGFP were maintained in 700 ⁇ g/ml G418 sulfate (GENETICIN, Mediatech Inc., Manassas, Va.).
  • Cytosolic S100A8/A9 expression in transfected cells was verified both by sandwich enzyme-linked immunosorbent assay (ELISA) and indirect immunofluorescence with anti-S100A8/A9 heterodimer-specific monoclonal antibody, 27E10 (Bachem, King of Prussia, Pa.). Co-immunoprecipitation was also performed to confirm protein complex formation.
  • ELISA sandwich enzyme-linked immunosorbent assay
  • 27E10 anti-S100A8/A9 heterodimer-specific monoclonal antibody
  • HNSCC human head and neck squamous cell carcinoma
  • T2N0M0 stage II
  • III T3N0M0
  • IVA T4N0M0
  • HNSCC tumor tissues from the three HNSCC patients and NAT which showed no evidence of tumor cells, were obtained with informed consent through a commercial tissue bank (ProteoGenex, Inc., Culver City, Calif.). Tumors and NATs were snap frozen within 30 minutes post-resection, sectioned and analyzed for neoplastic cells.
  • qRT-PCR real-time quantitative reverse-transcription polymerase chain reaction
  • TR146-shRNA-S100A8/A9KD S100A8/A9-knockdown clones
  • Some cells were transfected with pGE-1 control vector, containing scrambled shRNA, to produce a negative control for S100A8 and S100A9 gene silenced clones (TR146-shRNA-control). Clones that grew in the presence of 250 ⁇ g/ml G418 sulfate were selected. S100A8/A9 gene and protein expression was quantified by qRT-PCR and immunoblot.
  • tumor cells were cultured on non-pyrogenic polystyrene tissue culture flasks in complete medium (see above), harvested by trypsinization and counted by trypan blue exclusion. Counts were confirmed using a Vi-Cell cell viability analyzer (Beckman Coulter, Fullerton, Calif.).
  • Anchorage-independent growth was determined by enumerating cell colonies after growth in standard soft agar medium (0.25% agar in complete medium plated on top of 0.5% solid agar) for up to 2.5 weeks in 5% CO2 at 37° C.
  • KB, KB-EGFP and KB-S100A8/A9 cells were seeded at a density of 1 ⁇ 10 5 cells/ml and cultured in complete medium as described earlier.
  • cells at 70% confluency were serum starved overnight and then blocked with 3 ⁇ g/ml aphidicolin in complete medium for 12 hours.
  • synchronized cells were washed three times with Dulbecco's phosphate-buffered saline (DPBS) without calcium and magnesium to remove aphidicolin and cultured in fresh medium containing 10% FBS.
  • DPBS Dulbecco's phosphate-buffered saline
  • IP immunoprecipitation lysis
  • Protein samples were boiled in 1 ⁇ sample buffer (1% SDS in 31.25 mM Tris-HCl, pH 6.8 with 12.5% glycerol, 0.005% bromophenol blue and 2.5% betamercaptoethanol) for five minutes.
  • SDS-polyacrylamide gels were loaded with 50 to 100 ⁇ g total protein per well as indicated, transferred to PVDF or nitrocellulose membranes by a Bio-Rad (Bio-Rad Laboratories, Inc., Hercules, Calif.) semi-dry protein transfer apparatus, blocked overnight with 5% skim milk in TBS-T buffer (20 mM Tris-HCl pH 7.4, 137 mM NaCl, 0.1% Tween-20), and incubated with the primary antibody diluted at 1:1000 for 1 hour in blocking buffer at room temperature.
  • the blots were then washed three times for 5 minutes each with TBS-T and incubated for another one hour with horseradish peroxidase (HRP)-conjugated secondary antibody diluted at 1:3000 in blocking buffer.
  • HRP horseradish peroxidase
  • All antibodies to detect cell cycle regulators were purchased from Santa Cruz Biotechnology, Inc., (Santa Cruz, Calif.), except for phospho-PP2A-C (Tyr307) rabbit monoclonal antibody (Epitomics, Inc., Burlingame, Calif.).
  • Final washes were performed three times with TBS-T before the blots were incubated in ECL Western Blotting Detection substrate (Amersham Biosciences, Piscataway, N.J.). Chemiluminescent bands were documented and analyzed by exposing to Kodak XAR-5 X-ray film.
  • lysate protein from each cell line was incubated with Ezview Red Protein A Affinity Gel (protein-A gel, Sigma-Aldrich) to minimize non-specific binding (pre-clear).
  • the pre-cleared lysate was then mixed with 5 ⁇ g of capture antibody and the volume was adjusted to 1 ml with TBS.
  • the mixture was incubated at 4° C. with gentle rotation for one hour, followed by addition of 25 ⁇ l of protein-A gel and incubation for an additional hour at 4° C. with gentle rotation.
  • the protein-A-antibody-protein complex was then washed three times with cold immunoprecipitation lysis buffer and eluted from the protein-A gel with 1 ⁇ sample buffer (as above).
  • mice anti-14-3-3 ⁇ was used as co-IP capture antibody and rabbit anti-Cdc25C for immunoblot detection.
  • Mouse anti-S100A8/A9 antibody 27E10 or anti-S100A9 and goat anti-PP2A-A ⁇ antibody were used to co-immunoprecipitate S100A8/A9 and PP2A. All antibodies were purchased from Santa Cruz Biotechnology, Inc.
  • KB, KB-EGFP and KB-S100A8/A9 cells were seeded at a density of 3 ⁇ 10 5 cells/well and cultured in complete medium overnight as described above. Cultured cells were incubated with fresh media containing 10 nM okadaic acid (Sigma-Aldrich, St. Louis, Mo.) or vehicle control (DMSO) for 24 hours.
  • 10 nM okadaic acid Sigma-Aldrich, St. Louis, Mo.
  • DMSO vehicle control
  • Cells were harvested by washing twice with cold DPBS and lysed directly in the well on ice with phosphatase lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% sodium deoxycholate, 1% SDS, 1% Triton X-100, 1 mM Na 3 VO 4 , 2 mM NaF and 10% protease inhibitor).
  • Cell lysates were subjected to two freeze-thaw cycles at ⁇ 80° C., centrifuged at 4° C. and supernatants collected for protein quantification by BCA and immunoblotting.
  • Phosphatase activity was performed using the Immunoprecipitation Phosphatase Assay Kit (Cat#17-313, EMD Millipore, Billerica, Mass.). Synchronized cells were harvested, washed twice with DPBS, pelleted and resuspended in IP lysis buffer supplemented with fresh protease inhibitor cocktail as described above but without phosphatase inhibitors, Na 3 VO 4 and NaF. Fresh cell lysates were used in each reaction. PP2A phosphatase activity was measured following the manufacturer's protocol.
  • Epithelial cells stably transfected to express calprotectin (KB-S100A8/A9, formerly known as KB-MRP8/14) or sham-control vector (KB-EGFP) were generated from KB cells as previously reported (Nisapakultorn et al., 2001 . Infect. Immun. 69: 3692-3696). Briefly, KB cells were co-transfected with the mammalian expression vector, pIRES-EGFP (Clontech, Palo Alto, Calif.), containing S100A8 (MRP8) and S100A9 (MRP14) calprotectin subunit coding regions, and the selectable marker pSV2-neo (G418 sulfate-resistant marker).
  • the resulting cell line, KB-S100A8/A9 expresses the calprotectin complex.
  • the KB-EGFP sham-transfection control was generated by co-transfection of insert-less pIRES-EGFP and pSV2-neo.
  • Both KB-S100A8/A9 and KB-EGFP were maintained in 700 ⁇ g/ml G418 sulfate (GENETICIN, Mediatech Inc., Manassas, Va.) in MEM (CELLGRO, Mediatech, Inc., Manassas, Va.), supplemented with 10% fetal bovine serum (FBS) and maintained at 5% CO 2 at 37° C. Cells were maintained in MEM with 10% FBS without G418 (complete medium) for 2 days prior to all experiments.
  • G418 sulfate GENETICIN, Mediatech Inc., Manassas, Va.
  • MEM CELLGRO, Mediatech, Inc., Manass
  • TR146 cells are a buccal carcinoma cell line obtained from Dr. Reuben Lotan at the MD Anderson Cancer Center, Houston, Tex. Cells were cultured as above without G418. Some cells were stably transfected with shRNA to suppress expression and production of S100A8/A9 or with mock transfection control using standard methods.
  • mice 6- to 8-week old female strain 01N70 [Cr:NIH(S)-nu/nu Nude] mice were housed and fed food and water ad libitum in microisolator cages in specific-pathogen-free conditions using a 12-hour light-dark cycle. Animals were anesthetized using 5% isofluorane in O 2 2 L min ⁇ 1 .
  • KB (1 ⁇ 10 5 ) or TR146 (5 ⁇ 10 4 ) cells or transfected derivatives were suspended in 100 ⁇ l 1:1 Dulbecco's phosphate buffered saline (DPBS)/MATRIGEL (BD Biosciences, San Jose, Calif.) and injected orthotopically into the floor of the mouth.
  • DPBS Dulbecco's phosphate buffered saline
  • MATRIGEL BD Biosciences, San Jose, Calif.
  • mice were euthanized with CO 2 .
  • Oral tissues including tumors were collected, rinsed in DPBS, preserved in 10% formalin solution paraffin-embedded and stained with hematoxylin and eosin (Histoserv Inc, Germantown, Md.) for histological analysis.
  • Templates were amplified from pGEM4Z.2bgUTR.150A as described in Example 1, with addition of 25% 2-thiouridine, the addition of 25% 5-methylcytidine, and mRNAs were synthesized using the mMESSAGE mMACHINE T7 Ultra Kit (Ambion, Life Technologies Corp., Grand Island, N.Y.,) with ARCA capping. Cells were transfected using the TransIT-mRNA kit (Mirus Bio LLC, Madison, Wis.). Saliva was collected from three donors immediately before transfection experiments, pooled, centrifuged at 12,000 ⁇ g for five min to remove particulates, and the salivary supernatant was used for all experiments.
  • Saliva was diluted to show dose-response relationships, and incubated with the epithelial cell cultures for one minute, three minutes, or five minutes.
  • saliva-treated cells were washed to reverse the treatment.
  • cells were transfected with EGFP mRNA. 16 hours after mRNA transfection, cells were fixed with 4% paraformaldehyde for 10 minutes and nuclei were stained with DAPI. Fluorescent images were captured with an epifluorescence microscope. Results are shown in FIG. 15 and FIG. 16 .
  • Susceptibility to P. gingivalis -induced periodontitis is evaluated in wild-type C57BL/6 mice that are S100A8/A9 ⁇ / ⁇ , S100A8/A9 ⁇ / ⁇ mice with epithelial tissue-specific expression of human S100A8/A9, or S100A8/A9 ⁇ / ⁇ mice receiving topically applied S100A8/A9 mRNA transfections to the gingival epithelium.
  • mice are pre-treated with antibiotics and fed 4 ⁇ 10 9 CFU P. gingivalis in 2% carboxymethylcellulose or control L. murinus by oral gavage, six episodes, four days apart as previously described (Costalonga, et al., 2009 , J Periodontal Res 44:537-542).
  • L. murinus does not cause periodontal bone loss or inflammation.
  • P. gingivalis and L. murinus colonization is tested by sampling the oral cavity of mice before the first gavage and 50 days later.
  • mice C57BL/6J mice (The Jackson Laboratory, Bar Harbor, Me.) are inoculated by oral gavage with P. gingivalis ATCC 53977. All mice are housed in a specific pathogen free (SPF) AAALAC-accredited facility. Based on previous power calculations, 21 mice receiving each treatment or control (sham) are sufficient to detect with 90% power differences of 10-15% in the extent of bone destruction around teeth (when a was set at 0.05) between P. gingivalis ATCC 53977-infected and sham-infected mice.
  • SPPF pathogen free
  • Maxillae and mandibles are harvested at 0 and 50 days, dissected, and separated at the midline to obtain four specimens as described (Costalonga, et al., 2009 , J Periodontal Res 44:537-542). Seven of the 14 right hemimandibles and hemimaxillas from each experimental group or treatment are fixed in 4% paraformaldehyde and decalcified in 10% EDTA at a pH of 8 for one week. Specimens are embedded in paraffin as described (Sato, et al., 1986 , Am J Pathol 125:431-435) and stained with hematoxylin-eosin or frozen in OCT and processed for immunofluorescent identification of immune cells.
  • the other seven of 14 right hemimandibles and hemimaxillas are used to recover bacteria from the gingival epithelium by either stripping tissue from the bone or by treating the jaw with dispase to digest the epithelial layer from the connective tissues.
  • the jaw is homogenized in pre-reduced culture media. A portion is plated on blood agar in an anaerobic chamber, and CFUs are enumerated. An aliquot also is used to estimate the levels of P. gingivalis and L. murinus using qPCR on the homogenate.
  • hemimandibles and hemimaxillas are defleshed gently using a scalpel. Jaws are boiled in distilled water for 10 minutes, placed in 1 N NaOH for three hours to remove the remaining keratinized gingiva, and finally stained with 1% methylene blue for one minute. Defleshed hemimandibles and hemimaxillas are mounted lingual-side-up on a pliable mold and photographed at 40 ⁇ magnification under a stereomicroscope equipped with a digital camera as described (Costalonga, et al., 2009 , J Periodontal Res 44:537-542).
  • the lingual view of the hemimandibles and hemimaxillas are standardized so that the projected area between the distal edge of the buccal middle cusp and the distal edge of the lingual middle cusp is 10,000 ⁇ 500 pixels.
  • Photographed jaws are measured from the cementum-enamel junction (CEJ) of each of the three molar teeth to the alveolar bone crest using a standardized grid in Adobe Photoshop (Adobe Systems, Inc., San Jose, Calif.).
  • Alveolar bone level changes are measured indirectly as the number of pixels in the surface area of the visible root trunk as previously described (Costalonga, et al., 2009 , J Periodontal Res 44:537-542).
  • CT micro-computed tomography
  • the average of the bone area measurements in the four independent groups P. gingivalis -infected, L. murinus -infected control
  • the sensitivity of the measuring method allows detection of 10% changes in crestal bone levels with 90% power.
  • P. gingivalis or control L. murinus are used to infect wild-type C57BL/6 (murine S100A8/A9+/+) mice, S100A8/A9 ⁇ / ⁇ mice, and S100A8/A9 ⁇ / ⁇ mice rescued by knock-in with human epithelial-specific S100A8 and S100A9.
  • the null mutation for S100A8/A9 in mice of the C57BL/6 background are rescued using a system to introduce multiple genes into the mouse using transposon integratable multigene vectors (Moriarity et al., 2013 , Nucleic Acids Res 41:e92).
  • a system to introduce multiple genes into the mouse using transposon integratable multigene vectors (Moriarity et al., 2013 , Nucleic Acids Res 41:e92).
  • ROSA26 locus Rosulfite, P. 1999 , Nature Genetics 21:70-71) with the multigene vector containing the coding regions for S100A8 and S100A9 to knock-in with a K14 promoter.
  • the knock-in is only expressed in epithelial cells.
  • human S100A9 can permit translation of mouse S100A8 in the S100A8/A9 ⁇ / ⁇ mice because mouse S100A8 does not complex with human S100A9 to form hybrid heterodimers (Propper et al., 1999 , J Biol Chem 274:183-188).
  • mice The three strains of mice are compared for expression of periodontitis as described above using P. gingivalis as pathogen and L. murinus as commensal, non-pathogenic control.
  • Periodontitis is expressed similarly in wild-type C57BL/6 (murine S100A8/A9+/+) and human epithelial-specific knock-in (S100A8/A9 ⁇ / ⁇ background) strains.
  • the S100A8/A9 ⁇ / ⁇ mice show the greatest amount of alveolar bone loss.
  • Epithelia-specific S100A8/A9 is knocked into S100A8/A9 ⁇ / ⁇ ES cells using the integratable multigene vector (Moriarity et al., 2013 , Nucleic Acids Res 41:e92) targeting the ROSA26 locus.
  • a lox-stop-lox cassette is placed between a K14 promoter and the multigene vector containing human S100A8 and S100A9 coding regions.
  • Human S100A8/A9 forms as a complex spontaneously within epithelial cells (Champaiboon et al., 2009 , J Biol Chem 284:7078-7090)).
  • mice homozygous for Keratin14-CRE and the multigene (S100A8 and S100A9) cre conditional allele are crossed to generate experimental mice.
  • Successfully crossed mice express S100A8/A9 in epithelial tissues.
  • the mouse described herein as S100A8/A9 ⁇ / ⁇ is actually S100A9 ⁇ / ⁇ , expressing S100A8 mRNA but not S100A8 protein (Hobbs et al., 2003 , Mol Cell Biol 23:2564-2576; Manitz et al., 2003 , Mol Cell Biol 23:1034-1043).
  • the murine S100A8/A9 remains intact so that S100A8/A9 overexpression is solely from the floxed-in human proteins.
  • P. gingivalis infection of the epithelium and alveolar bone levels in P. gingivalis -infected, wild-type, S100A8/A9 ⁇ / ⁇ and human S100A8/A9 knock-in (S100A8/A9 ⁇ / ⁇ background) is measured at the start of the experiment and at 50 days after initial inoculation. Data are compared to L. murinus -infected (control) mice of each background to determine the role of S100A8/A9 in resistance to P. gingivalis infection.
  • the average of the bone area measurements is used as the dependent variable in an analysis of variance in the six independent groups ( P. gingivalis -infected, L. murinus -infected control) in C57BL/6 mice, S100A8/A9 ⁇ / ⁇ mice, and human S100A8/A9 rescued mice in the S100A8/A9 ⁇ / ⁇ background.
  • the sensitivity of the measuring method allows detection of 10% changes in crestal bone levels with 90% power.
  • the growth of bacteria generally in the epithelium and P. gingivalis and control L. murinus specifically in the presence and absence of S100A8/A9 are compared.
  • P. gingivalis or control L. murinus are used to infect wild-type (murine S100A8/A9+/+) mice, S100A8/A9 ⁇ / ⁇ mice, and S100A8/A9 ⁇ / ⁇ mice rescued by topical application of packaged human S100A8/A9 mRNA.
  • Epithelial cells can be transfected with mRNAs specific for S100A8 and S100A9 to express both proteins and form antimicrobial S100A8/A9 complex (Zou et al., 2013 , Infect Immun 81:3975-3983).
  • the transfection system is essentially topical.
  • Packaged mRNAs are added directly to the epithelial surface, the mRNA is taken up into the epithelial cells, new S100A8 and S100A9 proteins are co-expressed in the same cell and resistance to invading bacterial pathogens increases.
  • saliva is washed from the mouse oral epithelium to reduce the salivary barrier to uptake of the packaged mRNAs.
  • the epithelium is air dried prior to applying the packaged mRNAs directly to the tooth-gingival interface using a high intensity atomizer essentially as described for use in lungs (Kormann et al., 2011 , Nature Biotechnology 29:154-157; Mays et al., 2013 , J Clin Invest 123:1216-1228).
  • the atomizer is fitted with a narrow aperture needle to enable direction of the mRNA to the intended interface.
  • S100A8/A9 mRNA is applied to the gingiva one day before each application of P. gingivalis to minimize interference with either protocol. Mice in the three conditions are compared for expression of periodontitis as described above using P. gingivalis as pathogen and L. murinus as commensal, non-pathogenic control. Periodontitis is evident similarly in wild-type (murine S100A8/A9+/+) and S100A8/A9 ⁇ / ⁇ mice rescued by topical application of packaged human S100A8/A9 mRNA. The S100A8/A9 ⁇ / ⁇ mice show the greatest amount of alveolar bone loss.
  • the average of the bone area measurements is used as the dependent variable in an analysis of variance in the six independent groups ( P. gingivalis -infected, L. murinus -infected control) in wild-type (murine S100A8/A9+/+) mice, S100A8/A9 ⁇ / ⁇ mice, and S100A8/A9 ⁇ / ⁇ mice rescued by topical application of packaged human S100A8/A9 mRNA. Analyses are as described above.
  • a method comprising:
  • Embodiment 1 wherein the polypeptide comprises calprotectin, S100A8, or S100A9.
  • a method comprising:
  • Embodiment 3 wherein the polypeptide comprises cathelicin antimicrobial protein (CAMP), calprotectin, S100A8, S100A9, a ⁇ -defensin, S100A7, secretory leukocyte inhibitor, lipocalin 2, or lysozyme.
  • CAMP cathelicin antimicrobial protein
  • calprotectin S100A8, S100A9
  • a ⁇ -defensin S100A7
  • secretory leukocyte inhibitor lipocalin 2
  • lipocalin 2 or lysozyme
  • the bacterium comprises Capnocytophaga spumblea, Escherichia coli , a Staphylococcus spp., a Streptococcus spp., Listeria monocytogenes, Salmonella typhimurium, Borrelia burgdorferi, Porphyromonas gingivalis, Tannerella forsythia, Treponema denticola, Pseudomonas aeruginosa , a Chlamydia spp., a Neisseria spp., a Gardnerella spp., or a Trichomonas spp.
  • Embodiment 12 wherein the fungus comprises fungi Candida albicans, Acinetobacter baumannii , or an Aspergillus spp.
  • Embodiment 14 wherein the condition comprises a carcinoma.
  • a composition comprising:
  • composition of Embodiment 18 wherein the polypeptide comprises calprotectin, S100A8, or S100A9.
  • a composition comprising:
  • composition of Embodiment 21 wherein the polypeptide comprises cathelicin antimicrobial protein (CAMP), calprotectin, S100A8, S100A9, a ⁇ -defensin, S100A7, secretory leukocyte inhibitor, lipocalin 2, or lysozyme.
  • CAMP cathelicin antimicrobial protein
  • calprotectin S100A8, S100A9
  • a ⁇ -defensin S100A7
  • secretory leukocyte inhibitor secretory leukocyte inhibitor
  • lipocalin 2 or lysozyme.
  • composition of any one of Embodiments 18-22 wherein the mRNA comprises a stabilizing moiety is provided.
  • composition of Embodiment 23 wherein the stabilizing moiety comprises a 5′ cap.
  • composition of Embodiment 23 wherein the stabilizing moiety comprises a 3′ extension.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Immunology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
US14/760,077 2013-01-11 2014-01-10 Non-Transgene Transfection for Therapeutic Purposes Abandoned US20150344537A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/760,077 US20150344537A1 (en) 2013-01-11 2014-01-10 Non-Transgene Transfection for Therapeutic Purposes

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201361751504P 2013-01-11 2013-01-11
US14/760,077 US20150344537A1 (en) 2013-01-11 2014-01-10 Non-Transgene Transfection for Therapeutic Purposes
PCT/US2014/011041 WO2014110366A1 (en) 2013-01-11 2014-01-10 Therapeutic compositions and methods involving mrna transfection

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/011041 A-371-Of-International WO2014110366A1 (en) 2013-01-11 2014-01-10 Therapeutic compositions and methods involving mrna transfection

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/842,489 Division US11912744B2 (en) 2013-01-11 2020-04-07 Non-transgene transfection for therapeutic purposes

Publications (1)

Publication Number Publication Date
US20150344537A1 true US20150344537A1 (en) 2015-12-03

Family

ID=51167392

Family Applications (3)

Application Number Title Priority Date Filing Date
US14/760,077 Abandoned US20150344537A1 (en) 2013-01-11 2014-01-10 Non-Transgene Transfection for Therapeutic Purposes
US16/842,489 Active 2034-03-12 US11912744B2 (en) 2013-01-11 2020-04-07 Non-transgene transfection for therapeutic purposes
US18/427,711 Active US12448421B2 (en) 2013-01-11 2024-01-30 Non-transgene transfection for therapeutic purposes

Family Applications After (2)

Application Number Title Priority Date Filing Date
US16/842,489 Active 2034-03-12 US11912744B2 (en) 2013-01-11 2020-04-07 Non-transgene transfection for therapeutic purposes
US18/427,711 Active US12448421B2 (en) 2013-01-11 2024-01-30 Non-transgene transfection for therapeutic purposes

Country Status (13)

Country Link
US (3) US20150344537A1 (https=)
EP (2) EP2943226B1 (https=)
JP (4) JP2016511230A (https=)
KR (2) KR102119985B1 (https=)
CN (1) CN105473163A (https=)
AU (1) AU2014205298B2 (https=)
CA (2) CA2901409C (https=)
ES (1) ES2738315T3 (https=)
IL (2) IL239898B (https=)
NZ (1) NZ710495A (https=)
PL (1) PL2943226T3 (https=)
SG (2) SG11201505431XA (https=)
WO (1) WO2014110366A1 (https=)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150344537A1 (en) * 2013-01-11 2015-12-03 Mark C. Herzberg Non-Transgene Transfection for Therapeutic Purposes
US11253570B2 (en) 2016-11-07 2022-02-22 Medizinische Hochschule Hannover (Mhh) S100A8/S100A9-induced immunotolerance in newborn subjects
CN107841508A (zh) * 2017-11-29 2018-03-27 重庆市中医院 含抑铁素重组减毒沙门杆菌及构建方法、表达或递送载体
EP3553523A1 (en) * 2018-04-12 2019-10-16 Koninklijke Philips N.V. Diagnostics of mild or advanced periodontitis
EP3553525A1 (en) * 2018-04-12 2019-10-16 Koninklijke Philips N.V. Diagnostics of mild or advanced periodontitis
JP6891157B2 (ja) * 2018-11-15 2021-06-18 正生 池本 機能性ペプチド、それを用いた大腸炎用医薬およびデリバリー剤
CN114561381A (zh) * 2022-03-14 2022-05-31 桂林医学院 免疫mRNA及其制备方法和应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050095257A1 (en) * 2000-09-15 2005-05-05 Kwak Larry W. Defensin-antigen fusion proteins
US20090311224A1 (en) * 2005-02-28 2009-12-17 Eun-Kyoung Lee Therapeutic agent comprising lipocalin 2 against cancer metastasis, and methods of early diagnosis and inhibition of cancer metastasis using lipocalin 2
US20100266566A1 (en) * 2007-06-11 2010-10-21 Janssen-Heininger Yvonne M Treatments involving glutaredoxins and similar agents

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2797402B1 (fr) * 1999-07-15 2004-03-12 Biomerieux Stelhys Utilisation d'un polypeptide pour detecter, prevenir ou traiter un etat pathologique associe a une maladie degenerative, neurologique ou autoimmune
WO2001023002A1 (en) * 1999-09-30 2001-04-05 National Jewish Medical And Research Center Method for inhibition of pathogenic microorganisms
US7338936B2 (en) * 2000-11-28 2008-03-04 House Ear Institute Use of antimicrobial proteins and peptides for the treatment of otitis media and paranasal sinusitis
DE10121254A1 (de) * 2001-04-30 2002-11-07 Switch Biotech Ag MRP8/MRP14 Heterodimers oder seiner Einzelkomponenten alleine oder in Kombination zur Behandlung und/oder Prävention von Hauterkrankungen, Wunden und/oder Wundheilungsstörungen, die durch eine verringerte Menge an MRP8/MRP14 Heterodimeren gekennzeichnet sind
US20070123455A1 (en) * 2003-04-04 2007-05-31 Joel Palefsky Immunomodulatory agents for treatment of inflammatory diseases
DE10324997A1 (de) * 2003-06-03 2004-12-23 Switch Biotech Ag Mrp8/Mrp14 Inhibitoren und ihre Verwendung zur Prävention und/oder Behandlung von hypertrophen Narben und Keloiden
WO2005084180A2 (en) 2003-12-19 2005-09-15 University Of Cincinnati Polyamides and polyamide complexes for delivery of oligonucleotide decoys
WO2006085987A2 (en) * 2004-07-09 2006-08-17 University Of Iowa Research Foundation Rna interference in respiratory epitheial cells
WO2006078717A2 (en) * 2005-01-19 2006-07-27 Beth Israel Deaconess Medical Center Lipocalin 2 for the treatment, prevention, and management of cancer metastasis, angiogenesis, and fibrosis
US8501478B2 (en) 2006-06-15 2013-08-06 University Of Cincinnati Trehalose click polymers for delivery of biologically active molecules
US8916163B1 (en) * 2007-12-21 2014-12-23 Vanderbilt University Method for treating microbial infections
DE102010040153A1 (de) * 2010-09-02 2012-03-08 Robert Bosch Gesellschaft Für Medizinische Forschung Mbh Stoffkombination zur Behandlung von entzündlichen oder infektiösen Erkrankungen
EP2691101A2 (en) * 2011-03-31 2014-02-05 Moderna Therapeutics, Inc. Delivery and formulation of engineered nucleic acids
US10174081B2 (en) * 2011-04-21 2019-01-08 George Mason Research Foundation, Inc. Antimicrobial peptides and uses therefore
US20150344537A1 (en) * 2013-01-11 2015-12-03 Mark C. Herzberg Non-Transgene Transfection for Therapeutic Purposes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050095257A1 (en) * 2000-09-15 2005-05-05 Kwak Larry W. Defensin-antigen fusion proteins
US20090311224A1 (en) * 2005-02-28 2009-12-17 Eun-Kyoung Lee Therapeutic agent comprising lipocalin 2 against cancer metastasis, and methods of early diagnosis and inhibition of cancer metastasis using lipocalin 2
US20100266566A1 (en) * 2007-06-11 2010-10-21 Janssen-Heininger Yvonne M Treatments involving glutaredoxins and similar agents

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Angel M and Yanik M F. 2010. Innate immune suppression enables frequent transfection with RNA encoding reprogramming proteins. PloS ONE 5(7): pages 1-7 *
Hayashi et al, A method for stabilizing RNA for transfection that allows control of expression duration, Dev Dyn. 2010 July ; 239(7): 2034-2040 *

Also Published As

Publication number Publication date
JP2016511230A (ja) 2016-04-14
AU2014205298A1 (en) 2015-08-13
SG10201603946PA (en) 2016-07-28
US20200231640A1 (en) 2020-07-23
KR102056511B1 (ko) 2019-12-16
EP2943226B1 (en) 2019-03-13
IL239898A0 (en) 2015-08-31
US11912744B2 (en) 2024-02-27
IL239898B (en) 2018-10-31
JP2019031521A (ja) 2019-02-28
JP2021019644A (ja) 2021-02-18
KR20160031999A (ko) 2016-03-23
CA2901409C (en) 2022-06-07
WO2014110366A1 (en) 2014-07-17
IL262252B (en) 2020-06-30
ES2738315T3 (es) 2020-01-21
AU2014205298B2 (en) 2018-11-01
EP2943226A1 (en) 2015-11-18
JP6956059B2 (ja) 2021-10-27
CN105473163A (zh) 2016-04-06
EP3501551A1 (en) 2019-06-26
KR20180026811A (ko) 2018-03-13
SG11201505431XA (en) 2015-08-28
NZ710495A (en) 2019-10-25
KR102119985B1 (ko) 2020-06-05
US20240166701A1 (en) 2024-05-23
PL2943226T3 (pl) 2019-09-30
EP3501551C0 (en) 2023-06-07
IL262252A (en) 2018-11-29
CA3152721A1 (en) 2014-07-17
CA2901409A1 (en) 2014-07-17
US12448421B2 (en) 2025-10-21
JP6473729B2 (ja) 2019-02-20
EP2943226A4 (en) 2016-11-23
EP3501551B1 (en) 2023-06-07
JP2017052781A (ja) 2017-03-16
CA3152721C (en) 2025-11-18

Similar Documents

Publication Publication Date Title
US12448421B2 (en) Non-transgene transfection for therapeutic purposes
KR101501799B1 (ko) 세포의 자가소화작용 유도용 조성물
RU2718499C2 (ru) Способы и композиции для предупреждения или лечения злокачественной опухоли
JP2008525005A (ja) 新規の物質、および、それらの使用
KR102099366B1 (ko) 돼지생식기호흡기증후군 바이러스 Nsp1 단백질을 유효성분으로 포함하는 면역증강용 조성물
US20250154215A1 (en) Pharmaceutical composition for treating colitis or colorectal cancer comprising colon-targeted s100a8/a9-derived specific peptide
WO2025166631A1 (zh) Tmed10作为靶点在治疗炎症中的应用
US9885044B2 (en) Polynucleotides and methods for inhibiting cancer cells
Zou et al. Apigenin 7-glucoside reprograms tumor metabolism and enhances immunotherapy efficacy in colorectal cancer via DLX5
WO2024064879A2 (en) Interferon lambda (ifnl) inhibition in intestinal epithelial cells for treating inflammation

Legal Events

Date Code Title Description
AS Assignment

Owner name: ANTIBIOTIC ALTERNATIVES LLC, MINNESOTA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HERZBERG, MARK C.;ROSS, KAREN FARNIE;SORENSON, BRENT S.;SIGNING DATES FROM 20150714 TO 20150724;REEL/FRAME:036436/0608

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE AFTER FINAL ACTION FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION