US20120107817A1 - Probe for Detection of Polymorphism in EGFR Gene, Amplification Primer, and Use Thereof - Google Patents

Probe for Detection of Polymorphism in EGFR Gene, Amplification Primer, and Use Thereof Download PDF

Info

Publication number
US20120107817A1
US20120107817A1 US13/285,883 US201113285883A US2012107817A1 US 20120107817 A1 US20120107817 A1 US 20120107817A1 US 201113285883 A US201113285883 A US 201113285883A US 2012107817 A1 US2012107817 A1 US 2012107817A1
Authority
US
United States
Prior art keywords
nucleotide
oligonucleotide
nucleotides
sequence
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US13/285,883
Other languages
English (en)
Inventor
Aki Iguchi
Moeko Ijuin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Arkray Inc
Original Assignee
Arkray Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Arkray Inc filed Critical Arkray Inc
Assigned to ARKRAY, INC., reassignment ARKRAY, INC., ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: IGUCHI, Aki, Ijuin, Moeko
Publication of US20120107817A1 publication Critical patent/US20120107817A1/en
Priority to US14/165,530 priority Critical patent/US9359647B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • a computer readable text file entitled “SequenceListing.txt,” created on or about Oct. 26, 2011 with a file size of about 19 kb contains the sequence listing for this application and is hereby incorporated by reference in its entirety.
  • the present invention relates to a probe configured to detect a polymorphism in an EGFR gene, an amplification primer, and the use thereof.
  • Epidermal growth factor receptor is the tyrosine kinase receptor for epidermal growth factor (EGF).
  • EGFR is associated with a high frequency of expression in many solid tumors, and overexpression is known to be related to the malignancy or prognosis of a cancer.
  • gefitinib or the like that is an EGFR tyrosine kinase inhibitor (EGFR-TKI) is used as a therapeutic agent for cancers.
  • EGFR-TKI EGFR tyrosine kinase inhibitor
  • a patient may exhibit an improvement in the effect of gefitinib in shrinking a tumor, or resistance to gefitinib may preclude a therapeutic effect.
  • the relationship between the sensitivity to this type of therapeutic agent and EGFR mutations has been elucidated. (PLoS Medicine, 2005, Vol. 2, No. 3, p. 225-235, and Journal of Clinical Oncology, 2005, Vol. 23, No. 11, p. 2513-2520).
  • mutations are known to include a substitution mutation at position 790 and position 858 in EGFR, and a deletion mutation at exon 19 in the EGFR gene (PLoS Medicine, 2005, Vol. 2, No. 3, p. 225-235, and Journal of Clinical Oncology, 2005, Vol. 23, No. 11, p. 2513-2520).
  • the mutation at position 790 is a mutation in which threonine (T) that is the amino acid at position 790 in EGFR is substituted by methionine (M).
  • T threonine
  • M methionine
  • the cytosine (c) nucleotide at position 347 is substituted by thymin (t).
  • the mutation at position 858 is a mutation in which leucine (L) that is the amino acid at position 858 in EGFR is substituted by arginine (R).
  • L leucine
  • R arginine
  • the thymin (t) nucleotide at position 261 is substituted by guanine (g).
  • the deletion mutation at exon 19 in the EGFR gene is a mutation in which several continuous nucleotides or more than ten continuous nucleotides are deleted in exon 19, and in the partial sequence of the EGFR gene illustrated in SEQ ID NO: 2, for example, any of the nucleotides at positions 112-164 are deleted. Therefore in the EGFR gene, there is the possibility of more effective and patient-specific cancer therapy if the presence or absence of a mutation (polymorphism) is detected to thereby evaluate sensitivity to gefitinib prior to therapy.
  • PCR-RFLP PCR restriction fragment length polymorphism
  • Tm analysis melting curve analysis
  • a Tm value (evaluation reference value) can be obtained in advance in relation to the hybridization product of the sequence of interest including the gene polymorphism that is the target of detection and the complementary probe, and the Tm value (measurement value) of the target single-stranded DNA from a detection sample and the probe is measured.
  • the measurement value is the same as the evaluation reference value, it is determined that the target polymorphism is present in the target DNA.
  • the measurement value is lower than the evaluation reference value, it is determined that the target polymorphism is not present in the target DNA.
  • a melting curve may be obtained by performing the Tm analysis described herein.
  • the melting curve may have a horizontal axis showing the temperature (° C.) during measurement, and a vertical axis showing the change in the fluorescent intensity.
  • Tm value is the temperature (dissociation temperature: Tm) at which double-stranded nucleic acid dissociates, and generally is defined as the temperature at which the absorbance at 260 nm reaches 50% of the total increase in absorbance. That is to say, when a solution containing double-stranded nucleic acid, for example double-stranded DNA, is heated, the absorbance at 260 nm increases. The increase results from the breakage of hydrogen bonds between the strands in the double-stranded DNA resulting from the heating and the dissociation into single-stranded DNA (DNA melting).
  • the absorbance When all double-stranded DNA dissociates to form single-stranded DNA, the absorbance exhibits approximately a 1.5 increase of the absorbance when commencing heating (absorbance when only double-stranded DNA is present). In this manner, completion of melting can be determined.
  • the Tm value is set based on this phenomenon.
  • a detection method using this type of Tm analysis determines at least a one-nucleotide difference on the basis of the Tm value, and therefore when there is a plurality of genetic polymorphisms, the analysis of a single sample is extremely labor-intensive.
  • the detection of polymorphisms in an EGFR gene is important in relation to the selection of a method of treatment for a disease. Therefore, it is an object of the present invention to provide a polymorphism-detection probe configured to enable determination of a polymorphism comprising a one-nucleotide difference in a simple manner and with superior reliability, and to a method of detection of a polymorphism.
  • the probe according to some embodiments of the present invention is a labeled probe comprising at least one oligonucleotide selected from the group consisting of oligonucleotides P1, P3, P5-P7, and P15 to P18.
  • oligonucleotide comprising a sequence at least about 85% identical to a complementary nucleotide sequence of 11 to 50 nucleotides to nucleotides 251 to 261 of SEQ ID NO: 1;
  • P3 An oligonucleotide comprising a sequence at least about 85% identical to a complementary nucleotide sequence of 5 to 50 nucleotides to nucleotides 257 to 261 of SEQ ID NO: 1;
  • oligonucleotide comprising a sequence at least about 85% identical to a nucleotide sequence of 9 to 50 nucleotides comprising nucleotides 104 to 112 of SEQ ID NO: 2;
  • oligonucleotide comprising a sequence at least about 85% identical to a nucleotide sequence of 16 to 50 nucleotides comprising nucleotides 104 to 119 of SEQ ID NO: 2;
  • oligonucleotide comprising a sequence at least about 85% identical to a nucleotide sequence of 10 to 50 nucleotides comprising nucleotides 136 to 145 of SEQ ID NO: 3;
  • oligonucleotide comprising a sequence at least about 85% identical to a complementary nucleotide sequence of 6 to 50 nucleotides to nucleotides 259 to 264 of SEQ ID NO: 1;
  • oligonucleotide comprising a sequence at least about 85% identical to a complementary nucleotide sequence of 5 to 50 nucleotides to nucleotides 258 to 262 of SEQ ID NO: 1;
  • oligonucleotide comprising a sequence at least about 85% identical to a nucleotide sequence of 16 to 50 nucleotides comprising nucleotides 249 to 264 of SEQ ID NO: 1;
  • oligonucleotide comprising a sequence at least about 85% identical to a nucleotide sequence of 8 to 50 nucleotides comprising nucleotides 257 to 264 of SEQ ID NO: 1.
  • the oligonucleotide P1 is an oligonucleotide comprising a complementary nucleotide sequence of 11 to 50 nucleotides to nucleotides 251 to 261 of SEQ ID NO: 1;
  • the oligonucleotide P3 is an oligonucleotide comprising a complementary nucleotide sequence of 5 to 50 nucleotides to nucleotides 257 to 261 of SEQ ID NO: 1;
  • the oligonucleotide P5 is an oligonucleotide comprising a nucleotide sequence of 9 to 50 nucleotides comprising nucleotides 104 to 112 of SEQ ID NO: 2;
  • the oligonucleotide P6 is an oligonucleotide comprising a nucleotide sequence of 16 to 50 nucleotides comprising nucleotides 104 to 119 of SEQ ID NO: 2;
  • the oligonucleotide P7 is an oligonucleotide comprising a nucleotide sequence of 10 to 50 nucleotides comprising nucleotides 136 to 145 of SEQ ID NO: 3;
  • the oligonucleotide P15 is an oligonucleotide comprising a complementary nucleotide sequence of 6 to 50 nucleotides to nucleotides 259 to 264 of SEQ ID NO: 1;
  • the oligonucleotide P16 is an oligonucleotide comprising a complementary nucleotide sequence of 5 to 50 nucleotides to nucleotides 258 to 262 of SEQ ID NO: 1;
  • the oligonucleotide P17 is an oligonucleotide comprising a nucleotide sequence of 16 to 50 nucleotides comprising nucleotides 249 to 264 of SEQ ID NO: 1;
  • the oligonucleotide P18 is an oligonucleotide comprising a nucleotide sequence of 8 to 50 nucleotides comprising nucleotides 257 to 264 of SEQ ID NO: 1.
  • the method of detecting a polymorphism according to some embodiments of the present invention is a method of detecting a polymorphism in an EGFR gene in a sample using the probe according to the present invention, comprising
  • the melting temperature of the probe from the melting curve, wherein the melting temperature indicates the presence of the polymorphism in the EGFR gene.
  • a determination method is a method configured to determine efficacy of EGFR-TKI or a resistance to EGFR-TKI and is characterized by including a step of detecting a polymorphism in an EGFR gene using the method of the present invention and a step of determining efficacy or a resistance to EGFR-TKI based on the presence or absence of the polymorphism.
  • a kit according to some embodiments of the present invention is a reagent kit for detecting a polymorphism in an EGFR gene and includes the probe according to the present invention.
  • a primer according to some embodiments of the present invention is a primer comprising or consisting of a sequence selected from the group consisting of oligonucleotides P8 to P13.
  • P10 An oligonucleotide of 10 to 50 nucleotides complementary to nucleotides 290 to 299 of SEQ ID NO: 1, and in which the 3′ terminal is the nucleotide C complementary to the nucleotide G at position 290.
  • P11 An oligonucleotide of 10 to 50 nucleotides homologous to nucleotides 86 to 95 of SEQ ID NO: 2, and in which the 3′ terminal is the nucleotide G at position 95.
  • P12 An oligonucleotide of 10 to 50 nucleotides homologous to nucleotides 64 to 73 of SEQ ID NO: 2, and in which the 3′ terminal is the nucleotide C at position 73.
  • the method for detecting a polymorphism according to some embodiments of the present invention enables simple and highly reliable determination of a polymorphism in an EGFR gene by use of the probe for detecting a polymorphism according to the present invention. More specifically, even when the target polymorphism coexists in a mutant EGFR gene and a wild-type EGFR gene in a sample, the wild-type and mutant polymorphisms can be determined in a simple manner and with high reliability. Furthermore, the primer according to the present invention enables specific amplification of the domain including the polymorphism in the EGFR gene.
  • the polymorphism in the EGFR gene can be amplified and determined in a simple manner with high reliability, the detection results for example can be reflected in the selection of a regime of treatment for a disease as described above. For example, the efficacy of or resistance to EGFR-TKI of gefitinib and the like can be determined. Furthermore, the present invention enables application to the detection of a polymorphism in an EGFR gene in diverse areas including biochemistry in addition to medical fields.
  • FIG. 1 are the graphs illustrating the results of Tm analysis of a reaction solution according to example 1 of the present invention.
  • FIG. 2 are the graphs illustrating the results of Tm analysis of a reaction solution according to example 2 of the present invention.
  • FIG. 3 are the graphs illustrating the results of Tm analysis of a reaction solution according to example 4 of the present invention.
  • FIG. 4 are the graphs illustrating the results of Tm analysis of a reaction solution according to an example 5-1 of the present invention.
  • FIG. 5 are the graphs illustrating the results of Tm analysis of a reaction solution according to an example 5-2 of the present invention.
  • FIG. 6 are the graphs illustrating the results of Tm analysis of a reaction solution according to an example 5-3 of the present invention.
  • FIG. 7 are the graphs illustrating the results of Tm analysis of a reaction solution according to comparative example 1.
  • FIG. 8 are the graphs illustrating the results of Tm analysis of a reaction solution according to comparative example 2.
  • FIG. 9 are the graphs illustrating the results of Tm analysis of a reaction solution according to an example 3-1 of the present invention.
  • FIG. 10 are the graphs illustrating the results of Tm analysis of a reaction solution according to an example 3-2 of the present invention.
  • FIG. 11 are the graphs illustrating the results of Tm analysis of a reaction solution according to an example 3-3 of the present invention.
  • FIG. 12 are the graphs illustrating the results of Tm analysis of a reaction solution according to comparative example 3.
  • a polymorphism of a gene means a diversity at one or a plurality of gene loci generated for example by mutation.
  • the mutation includes for example, a substitution, deletion, insertion, or addition mutation.
  • the EGFR gene includes the partial sequence of SEQ ID NOs: 1, 2 and 21 that have been registered respectively as illustrated below in relation to the following GenBank Accession Numbers.
  • a polymorphism being the target of detection in an EGFR gene includes the following polymorphisms for example.
  • polymorphism 858 of EGFR exon 21 The polymorphism in SEQ ID NO: 1 is hereinafter termed “polymorphism 858 of EGFR exon 21,” the polymorphism in SEQ ID NO: 2 is hereinafter termed the “EGFR exon 19 polymorphism”, and the polymorphism in SEQ ID NO: 21 is hereinafter termed “EGFR 790 polymorphism.”
  • the polymorphisms are respective present in wild and mutant variant. In each polymorphism the wild-type EGFR gene is termed the wild-type gene and the mutant-type EGFR gene is termed the mutant-type gene.
  • the polymorphism in nucleotide (k) at position 261 in SEQ ID NO: 1 is thymin (t) in the wild-type, and guanine (g) in the mutant-type.
  • the amino acid at position 858 in EGFR in the wild-type is leucine (L), and the amino acid at position 858 in EGFR in the mutant-type is arginine (R).
  • the expression “EGFR exon 21 L858R” means a mutation at exon 21 in the EGFR gene, and that the mutation on the codon 858 is a mutation of the amino acid from leucine to arginine.
  • the expression “mutant-type of EGFR exon 21” means “EGFR exon 21 L858R.”
  • the nucleotide sequence in the EGFR exon 21 in the present invention means the nucleotide sequence in positions 4848624-4849033 of GenBank Accession No. NT — 033968.
  • the EGFR exon 21 L858R mutation denotes the mutation from thymin (T) to guanine (G) of the nucleotide at position 4848884 shown in GenBank Accession No. NT — 033968.
  • the polymorphism in the nucleotides at positions 104 to 164 in SEQ ID NO: 2 for example is the polymorphism as illustrated in Table 1 below (reference is made to Journal of Clinical Oncology, 2005, Vol. 23, No. 11, p. 2513-2520).
  • the polymorphism 1 is a wild variant.
  • the nucleotide sequence of polymorphism 1 below corresponds to the oligonucleotide at positions 104 to 164 in SEQ ID NO: 2.
  • the polymorphisms 2 to 18 are a mutant variant (exon 19 deletion mutation) in which at least one nucleotide is deleted in the domain of positions 112 to 164 in SEQ ID NO: 2.
  • polymorphisms 2 to 17 are a mutant variant in which at least one nucleotide is deleted in the domain of positions 122 to 132 in SEQ ID NO: 2, and more specifically, in which a plurality of nucleotides are deleted in the domain of positions 112 to 140.
  • the polymorphism 18 is a mutant variant in which the nucleotides at positions 137 to 151 in SEQ ID NO: 2 are deleted.
  • the symbol “-” means that the nucleotide at the position corresponding to polymorphism 1 is deleted.
  • the nucleotide (y) in the wild-type variant at position 347 of SEQ ID NO: 21 is cytosine (c), and in this case, the amino acid at position 790 in EGFR is threonine (T).
  • the mutant-type variant is thymin (t), and in this case, the amino acid at position 790 in EGFR is methionine (M).
  • the polymorphism in the EGFR gene is the above type of mutant-type variant, it is possible to determine for example a possibility of resistance to EGFR-TKI of gefitinib or the like.
  • a sequence having sequence identity is a sequence for example, at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a specific sequence.
  • the identity may be at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%.
  • the sequence having sequence identity may be a sequence configured from the specific nucleotide sequence described above (the sequence having 100% sequence identity) or a sequence in which substitution, deletion, insertion, and/or addition of at least one nucleotide is applied to the specific nucleotide sequence (the sequence having sequence identity of at least 80% and less than 100%, for example) (hereinafter, the same applies).
  • identity is a measure of the identity of nucleotide sequences or amino acid sequences (e.g. sequences of the probes and primers described herein) compared to a reference nucleotide or amino acid sequence. In general, the sequences are aligned so that the highest order match is obtained. “Identity” per se has an art-recognized meaning and can be calculated using well known techniques.
  • Identity or percent identity at the nucleotide or amino acid sequence level can be determined by BLAST (Basic Local Alignment Search Tool) analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn, and tblastx (Altschul et al. (1997), Nucleic Acids Res. 25, 3389-3402, and Karlin et al. (1990), Proc. Natl. Acad. Sci. USA 87, 2264-2268, both fully incorporated by reference), which are tailored for sequence similarity searching.
  • BLAST Basic Local Alignment Search Tool
  • the approach used by the BLAST program is to first consider similar segments, with and without gaps, between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified, and finally to summarize only those matches which satisfy a preselected threshold of significance.
  • a threshold of significance For a discussion of basic issues in similarity searching of sequence databases, see Altschul et al. (1994), Nature Genetics 6, 119-129, which is fully incorporated by reference.
  • the search parameters for histogram, descriptions, alignments, expect i.e., the statistical significance threshold for reporting matches against database sequences
  • cutoff i.e., the statistical significance threshold for reporting matches against database sequences
  • filter low complexity
  • the default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff et al. (1992), Proc. Natl. Acad. Sci. USA 89, 10915-10919, fully incorporated by reference), recommended for query sequences over 85 in length (nucleotide bases or amino acids).
  • the scoring matrix is set by the ratios of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty score for mismatching residues), wherein the default values for M and N can be +5 and ⁇ 4, respectively.
  • M i.e., the reward score for a pair of matching residues
  • N i.e., the penalty score for mismatching residues
  • the default values for M and N can be +5 and ⁇ 4, respectively.
  • the site that generates the polymorphism described above that is to say, the site on the sense strand and the site on the complementary anti-sense strand are termed the “detection site,” and the domain that includes the detection site and enables hybridization with the probe for detection of the polymorphism is termed the “hybridizing domain or the detection sequence”.
  • the detection sequence in which the detection site is a wild-type variant is termed a “wild-type detection sequence” and a detection sequence in which the detection site is a mutant-type variant is termed a “mutant-type detection sequence.”
  • the probe for detection of the EGFR 858 polymorphism (t/g) is termed an “EGFR 858 probe”
  • the probe for detection of the exon 19 polymorphism is termed an “exon 19 probe”
  • the probe for detection of the EGFR 790 polymorphism (c/t) is termed an “EGFR 790 probe.”
  • a “probe” is defined as a nucleic acid, capable of binding to a target nucleic acid of complementary nucleotide sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation.
  • a probe may include natural (i.e. A, G, U, C or T) or modified nucleotides (e.g. 7-deazaguanosine, inosine, etc.).
  • the nucleotides in probes may be joined by a linkage other than a phosphodiester bond, so long as it does not interfere with hybridization.
  • probes may be peptide nucleic acids in which the constituent nucleotides are joined by peptide bonds rather than phosphodiester linkages.
  • the probe that hybridizes with the wild-type detection sequence stronger than with the mutant-type detection sequence is termed as a “wild-type probe.”
  • the probe that hybridizes with the mutant-type detection sequence stronger than with the wild-type detection sequence is termed as a “mutant-type probe.”
  • the “strength of hybridization” can be expressed, for example, by the relationship of the Tm value. Specifically, the “strength of hybridization” can be expressed by the high-low relationship between the Tm value of a double-stranded nucleic acid composed of a probe and a wild-type detection sequence and the Tm value of a double-stranded nucleic acid composed of the probe and a mutant-type detection sequence.
  • the wild-type probe shows a higher Tm value with the wild-type detection sequence than with the mutant-type detection sequence.
  • the mutant-type probe shows a higher Tm value with the mutant-type detection sequence than with the wild-type detection sequence.
  • the difference between the Tm values may be at least 3° C., at least 4° C., or at least 5° C.
  • the upper limit of the difference between the Tm values is not limited at all, and is, for example, 30° C.
  • the amplification domain in the EGFR gene for example may be a domain in the sense strand of the EGFR gene, may be a domain in the corresponding anti-sense strand, or may be both such domains.
  • the terminal of the nucleotide sequence means the nucleotide on furthest 5′ or 3′ end of the nucleotide sequence.
  • the 5′ terminal domain is a domain of a number of nucleotides from the 5′ terminal of the nucleotide sequence
  • the 3′ terminal domain is a domain of a number of nucleotides from the 3′ terminal of the nucleotide sequence.
  • a number of nucleotides is, for example, 1 nucleotide to 10 nucleotides from the terminal.
  • a nucleotide at the Zth position (Z being a positive integer) from the terminal of the nucleotide sequence is a sequence that takes the terminal nucleotide to be the 1 st position.
  • the probe for detection of a polymorphism according to the present invention as described above is a labeled probe capable of detecting a genetic mutation in EGFR exon 21 L858R and comprises a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to at least one of the following P1, P3, and P15-P18 oligonucleotides.
  • oligonucleotide comprising or consisting of a sequence at least about 85% identical to a complementary nucleotide sequence of 11 to 50 nucleotides to nucleotides 251 to 261 of SEQ ID NO: 1;
  • P3 An oligonucleotide comprising or consisting of a sequence at least about 85% identical to a complementary nucleotide sequence of 5 to 50 nucleotides to nucleotides 257 to 261 of SEQ ID NO: 1;
  • oligonucleotide comprising or consisting of a sequence at least about 85% identical to a nucleotide sequence of 9 to 50 nucleotides comprising or consisting of nucleotides 104 to 112 of SEQ ID NO: 2;
  • oligonucleotide comprising or consisting of a sequence at least about 85% identical to a nucleotide sequence of 16 to 50 nucleotides comprising or consisting of nucleotides 104 to 119 of SEQ ID NO: 2;
  • oligonucleotide comprising or consisting of a sequence at least about 85% identical to a nucleotide sequence of 10 to 50 nucleotides comprising or consisting of nucleotides 136 to 145 of SEQ ID NO: 3;
  • oligonucleotide comprising or consisting of a sequence at least about 85% identical to a complementary nucleotide sequence of 6 to 50 nucleotides to nucleotides 259 to 264 of SEQ ID NO: 1;
  • oligonucleotide comprising or consisting of a sequence at least about 85% identical to a complementary nucleotide sequence of 5 to 50 nucleotides to nucleotides 258 to 262 of SEQ ID NO: 1;
  • oligonucleotide comprising or consisting of a sequence at least about 85% identical to a nucleotide sequence of 16 to 50 nucleotides comprising or consisting of nucleotides 249 to 264 of SEQ ID NO: 1;
  • oligonucleotide comprising or consisting of a sequence at least about 85% identical to a nucleotide sequence of 8 to 50 nucleotides comprising or consisting of nucleotides 257 to 264 of SEQ ID NO: 1.
  • the probe according to additional embodiments of the present invention may include at least one of the following P1, P3, P5-P7, and P15-P18 oligonucleotides.
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 11 to 50 nucleotides to nucleotides 251 to 261 of SEQ ID NO: 1;
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 5 to 50 nucleotides to nucleotides 257 to 261 of SEQ ID NO: 1;
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 9 to 50 nucleotides comprising nucleotides 104 to 112 of SEQ ID NO: 2;
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 16 to 50 nucleotides comprising nucleotides 104 to 119 of SEQ ID NO: 2;
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 10 to 50 nucleotides comprising nucleotides 136 to 145 of SEQ ID NO: 3;
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 6 to 50 nucleotides to nucleotides 259 to 264 of SEQ ID NO: 1;
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 5 to 50 nucleotides to nucleotides 258 to 262 of SEQ ID NO: 1;
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 16 to 50 nucleotides comprising nucleotides 249 to 264 of SEQ ID NO: 1; and
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 8 to 50 nucleotides comprising nucleotides 257 to 264 of SEQ ID NO: 1.
  • the probe according to yet additional embodiments of the present invention may include at least one of the following P1, P3, P5-P7, and P15-P18 oligonucleotides.
  • oligonucleotide of at least 11, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides comprising or consisting of a complementary nucleotide sequence to a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to nucleotides 251 to 261 of SEQ ID NO: 1;
  • An oligonucleotide of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides comprising or consisting of a complementary nucleotide sequence to a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to nucleotides 258 to 262 of SEQ ID NO: 1;
  • oligonucleotide of at least 16, 20, 25, 30, 35, 40, 45, or 50 nucleotides comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to nucleotides 249 to 264 of SEQ ID NO: 1; and
  • oligonucleotide of at least 8, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to nucleotides 257 to 264 of SEQ ID NO: 1.
  • the probes may be fluorescence-labeled probes.
  • the probes are, for example, probes capable of detecting a genetic mutation in EGFR.
  • the oligonucleotides P1, P3, and P15 to P18 may be the oligonucleotides described below.
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence to a nucleotide sequence of 11 to 50 nucleotides comprising or consisting of nucleotides 251 to 261 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 251 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence to a nucleotide sequence of 5 to 50 nucleotides comprising or consisting of nucleotides 257 to 261 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 257 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence to a nucleotide sequence of 6 to 50 nucleotides comprising or consisting of nucleotides 259 to 264 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, and cytosine positioned at the 3′ side relative to the nucleotide is fluorescence-labeled.
  • An oligonucleotide comprising or consisting of a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence to a nucleotide sequence of 5 to 50 nucleotides comprising or consisting of nucleotides 258 to 262 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, and cytosine positioned at the 5′ side relative to the nucleotide is fluorescence-labeled.
  • An oligonucleotide comprising or consisting of a sequence that is at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 16 to 50 nucleotides comprising or consisting of 249 to 264 nucleotides of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is thymine or guanine, and cytosine positioned at the 5′ side relative to the nucleotide is fluorescence-labeled.
  • An oligonucleotide comprising or consisting of a sequence that is at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 8 to 50 nucleotides comprising or consisting of nucleotides 257 to 264 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is thymine or guanine, and cytosine positioned at the 3′ side relative to the nucleotide is fluorescence-labeled.
  • Probes configured from oligonucleotides according to P1, P3, and P15-P18 are probes for detection of the EGFR 858 polymorphism (t/g), in other words, the EGFR 858 probe. These probes are probes for detection of the presence or absence of a substitution mutation in the nucleotide at position 261 in the nucleotide sequence of SEQ ID NO: 1.
  • each of the oligonucleotides according to P1, P3, and P15-P18 is complementary to the sense strand of the EGFR gene, and the polymorphism can be confirmed by hybridization with the sense strand.
  • the nucleotide that is complementary (corresponding) to the nucleotide (t or g) at position 261 of SEQ ID NO: 1 is adenine (a) or cytosine (c).
  • the oligonucleotide having the nucleotide that is complementary (corresponding) to the nucleotide (t or g) at position 261 of SEQ ID NO: 1 is adenine (a) is also referred to as “P1-wt” and the oligonucleotide having the nucleotide that is complementary (corresponding) to the nucleotide (t or g) at position 261 of SEQ ID NO: 1 is cytosine (c) is also referred to as “P1-mt.” Since the P1-wt strongly hybridizes with the EGFR 858 wild-type detection sequence as compared to the EGFR 858 mutant-type detection sequence, it may be termed an EGFR 858 wild-type probe.
  • an EGFR 858-mutant-type probe Since the P1-mt strongly hybridizes with the EGFR 858 mutant-type detection sequence as compared to the EGFR 858 wild-type detection sequence, it may be termed an EGFR 858-mutant-type probe.
  • the polymorphism in an EGFR gene can be detected depending on whether these oligonucleotides strongly hybridize with the EGFR 858 wild-type detection sequence or with the EGFR 858 mutant-type detection sequence out of the detection sequences for EGFR gene.
  • the oligonucleotide according to P3 for example is complementary to the sense strand of the EGFR gene, and the polymorphism can be confirmed by hybridization with the sense strand.
  • the nucleotide that is complementary (corresponding) to the nucleotide (t or g) position 261 of SEQ ID NO: 1 is adenine (a) or cytosine (c).
  • the oligonucleotide having the nucleotide that is complementary (corresponding) to the nucleotide (t or g) at position 261 of SEQ ID NO: 1 is adenine (a) is also referred to as “P3-wt” and the oligonucleotide having the nucleotide that is complementary (corresponding) to the nucleotide (t or g) at position 261 of SEQ ID NO: 1 is cytosine (c) is also referred to as “P3-mt.” Since the P3-wt strongly hybridizes with the EGFR 858 wild-type detection sequence as compared to the EGFR 858 mutant-type detection sequence, it may be termed an EGFR 858 wild-type probe.
  • an EGFR 858 mutant-type probe Since the P3-mt strongly hybridizes with the EGFR 858 mutant-type detection sequence as compared to the EGFR 858 wild-type detection sequence, it may be termed an EGFR 858 mutant-type probe.
  • the polymorphism in an EGFR gene can be detected depending on whether these oligonucleotides strongly hybridize with the EGFR 858 wild-type detection sequence or with the EGFR 858 mutant-type detection sequence out of the detection sequences for EGFR gene.
  • the oligonucleotide according to P1 has a nucleotide length of 11 to 50 nucleotides, a nucleotide length of 11 to 40 nucleotides, a nucleotide length of 11 to 30 nucleotides, or a nucleotide length of 12 to 20 nucleotides.
  • the oligonucleotide according to P3 (3T-EGFR-858-R1) has a nucleotide length of 5 to 50 nucleotides as described above, a nucleotide length of 10 to 40 nucleotides, and a nucleotide length of 10 to 30 nucleotidenucleotides, or a nucleotide length of 12 to 20 nucleotides.
  • the site that is labeled by a labeling substance there is no particular limitation on the site that is labeled by a labeling substance, including for example, the 5′ terminal domain, the 3′ terminal domain, the 5′ terminal, and the 3′ terminal.
  • the nucleotide that is labeled by a labeling substance in the above oligonucleotides includes, for example, cytosine (c) or guanine (g).
  • the labeling substance for example may be directly labeled on the nucleotide, or the nucleotide may be indirectly labeled by labeling of a site at any of the nucleotide residues including the nucleotide.
  • the oligonucleotide P1 may include the fluorescence-labeled nucleotide that is complementary (corresponding) to the nucleotide at position 251 at the 1 st to 3 rd position counted from the 3′ terminal.
  • the “nucleotide that is complementary (corresponding) to the nucleotide at position 251” in the oligonucleotide means a nucleotide (c) that is complementary to the nucleotide (g) at position 251 in the nucleotide sequence of SEQ ID NO:1 when the oligonucleotide is aligned with the nucleotide sequence of SEQ ID NO:1. More specifically, the nucleotide that is complementary to nucleotide 251 is expressed by c in the oligonucleotide according to P1.
  • the oligonucleotide according to P1 may include the fluorescence-labeled nucleotide that is complementary to the nucleotide at position 251 at the 3′ terminal.
  • the P1-mt is for example the oligonucleotide of SEQ ID NO: 7
  • the P1-wt is for example the oligonucleotide of SEQ ID NO: 8.
  • the oligonucleotide P3 may include the fluorescence-labeled nucleotide that is complementary (corresponding) to the nucleotide at position 257 at the 1 st to 3 rd position counted from the 3′ terminal.
  • the “nucleotide that is complementary (corresponding) to the nucleotide at position 257” in the oligonucleotide means a nucleotide (c) that is complementary to the nucleotide (g) at position 257 in the nucleotide sequence of SEQ ID NO: 1 when the oligonucleotide is aligned with the nucleotide sequence of SEQ ID NO: 1. More specifically, the nucleotide that is complementary to nucleotide 257 is expressed by c in the oligonucleotide according to P3.
  • the P3-wt is for example the oligonucleotide of SEQ ID NOs: 12-14, and the P3-mt is for example the oligonucleotide of SEQ ID NOs: 9-11.
  • the oligonucleotide according to P15 includes, for example, the oligonucleotides according to P15-1-P15-5.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 30 to 50 nucleotides to nucleotides 235 to 264 of SEQ ID NO: 1; and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 235 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 26 to 50 nucleotides to nucleotides 239 to 264 of SEQ ID NO: 1; and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 239 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 21 to 50 nucleotides to nucleotides 244 to 264 of SEQ ID NO: 1; and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 244 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 7 to 50 nucleotides to nucleotides 258 to 264 of SEQ ID NO: 1; and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 258 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 6 to 50 nucleotides to nucleotides 259 to 264 of SEQ ID NO: 1; and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 259 is cytosine, and the cytosine is fluorescence-labeled.
  • the oligonucleotide according to P16 includes, for example, the oligonucleotides according to P16-1-P16-10.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 6 to 50 nucleotides to nucleotides 258 to 263 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 263 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 5 to 50 nucleotides to nucleotides 258 to 262 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 262 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 14 to 50 nucleotides to nucleotides 258 to 271 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 271 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 17 to 50 nucleotides to nucleotides 258 to 274 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 274 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 18 to 50 nucleotides to nucleotides 258 to 275 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 275 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 19 to 50 nucleotides to nucleotides 258 to 276 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 276 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 21 to 50 nucleotides to nucleotides 258 to 278 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 278 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 23 to 50 nucleotides to nucleotides 258 to 280 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 280 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 24 to 50 nucleotides to nucleotides 258 to 281 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 281 is cytosine, and the cytosine is fluorescence-labeled.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 27 to 50 nucleotides to nucleotides 258 to 284 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 284 is cytosine, and the cytosine is fluorescence-labeled.
  • the oligonucleotide according to P17 includes, for example, the oligonucleotides according to P17-1-P17-4.
  • oligonucleotide including a sequence that is at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 29 to 50 nucleotides including nucleotides 236 to 264 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide 261 is thymine or guanine, the nucleotide corresponding to nucleotide 236 is cytosine, and the cytosine is fluorescence-labeled.
  • the oligonucleotide according to P18 includes, for example, the oligonucleotides according to P18-1-P18-5.
  • the EGFR 858 probe of the present invention may be a probe in which the nucleotides at the both ends are cytosine and each cytosine is labeled.
  • An example of such a probe includes the labeled oligonucleotide P19 below.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 18 to 50 nucleotides to nucleotides 257 to 274 of SEQ ID NO: 1.
  • the probe may be a fluorescence-labeled probe.
  • the probe is, for example, a probe capable of detecting a genetic mutation in EGFR.
  • the oligonucleotide according to P19 may be the oligonucleotide described below.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 18 to 50 nucleotides to nucleotides 257 to 274 of SEQ ID NO: 1, and in which the nucleotide corresponding to nucleotide number 261 is adenine or cytosine, the nucleotide corresponding to nucleotide 257 and the nucleotide corresponding to nucleotide 274 are cytosine, and each cytosine is fluorescence-labeled.
  • the description, in relation to the oligonucleotides according to P1 and P3 can be applied to the oligonucleotides according to P15 to P19 unless otherwise noted.
  • the labeled site in each oligonucleotide may be a cytosine residue as described above.
  • the labeled site may be a cytosine residue corresponding to guanine in SEQ ID NO: 1.
  • the labeled site may be a cytosine residue in SEQ ID NO: 1.
  • the lower limit of the nucleotide length of the oligonucleotide according to P15 may be as short as 6 nucleotides or as long as 16 nucleotides.
  • the lower limit of the nucleotide length of the oligonucleotide according to P16 may be as short as 5 nucleotides or 6 nucleotides, or as long as 18 nucleotides.
  • the lower limit of the nucleotide length of the oligonucleotide according to P17 may be as short as 16 nucleotides or as long as 20 nucleotides.
  • the lower limit of the nucleotide length of the oligonucleotide according to P18 may be as short as 8 nucleotides or as long as 20 nucleotides.
  • the upper limit of the nucleotide length of each of the oligonucleotides according to P15 to P19 may be as long as 50 nucleotides or 40 nucleotides, or as short as 30 nucleotides.
  • the nucleotide corresponding to the target polymorphism site can be either a wild-type or a mutant-type, for example.
  • the nucleotides according to P15, P16, and P19 such nucleotides can be expressed by m (a or c), and in the oligonucleotides according to P17 and P18, such nucleotides can be expressed by k (t or g).
  • the present invention is not limited to the sequences below.
  • P15-1 (SEQ ID NO: 72) 5′-gccCgcccaaaatctgtgatcttgacatgc-3′ (3T-EGFR-858-R4)
  • P15-2 (SEQ ID NO: 73) 5′-gccCgcccaaaatctgtgatcttgac-3′ (3T-EGFR-858-R5)
  • P15-3 (SEQ ID NO: 74) 5′-tggccCgcccaaaatctgtgatc-3′ (3T-EGFR-858-R6)
  • P15-4 (SEQ ID NO: 75) 5′-agcagtttggccCgcc-3′ (3T-EGFR-858-R7)
  • P15-5 (SEQ ID NO: 76) 5′-acccagcagtttggccCgc-3′ (3T-EGFR-858-R8)
  • P16-1 (SEQ ID NO: 77) 5′-ccCgcccaa
  • the exon 19 probe according to the present invention as described above is a probe capable of detecting a genetic mutation in EGFR exon 19 deletion and comprises at least one of the following P5-P7 labeled oligonucleotides
  • An oligonucleotide including a sequence that is at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 9 to 50 nucleotides comprising nucleotides 104 to 112 of SEQ ID NO: 2.
  • An oligonucleotide including a sequence that is at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 16 to 50 nucleotides comprising nucleotides 104 to 119 of SEQ ID NO: 2.
  • An oligonucleotide including a sequence that is at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 10 to 50 nucleotides comprising nucleotides 136 to 145 of SEQ ID NO:.
  • the probes may be fluorescence-labeled probes.
  • the probes are, for example, probes capable of detecting a genetic mutation in EGFR.
  • the oligonucleotides according to P5 to P7 may be the oligonucleotides described below.
  • An oligonucleotide including a sequence that is at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 9 to 50 nucleotides comprising nucleotides 104 to 112 of SEQ ID NO: 2, and in which the nucleotide corresponding to nucleotide 112 is thymine, the nucleotide corresponding to nucleotide 104 is cytosine, and the cytosine is fluorescence-labeled;
  • An oligonucleotide including a sequence that is at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 16 to 50 nucleotides comprising nucleotides 104 to 119 of SEQ ID NO: 2, and in which the nucleotide at position 119 is substituted by a nucleotide other than G, and in which the nucleotide corresponding to nucleotide 104 is cytosine, and the cytosine is fluorescence-labeled; and
  • An oligonucleotide including a sequence that is at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleotide sequence of 10 to 50 nucleotides comprising nucleotides 136 to 145 of SEQ ID NO: 3, and in which the nucleotide corresponding to nucleotide 145 is cytosine, and the cytosine is fluorescence-labeled.
  • the probe configured from the oligonucleotides in P5 to P7 above is a probe for detection of an exon 19 polymorphism, that is to say, the exon 19 probe.
  • oligonucleotides P5 to P7 above are complementary to the antisense chain of the EGFR gene, and enables confirmation of the polymorphism by hybridization with the antisense chain.
  • the oligonucleotide P5 strongly hybridizes with the detection sequence as compared to the case where the nucleotides at positions 104 to 112 of SEQ ID NO: 2 are the mutant-type variant resulting from a deletion mutation.
  • an exon 19 polymorphism that is to say, an exon 19 wild-type variant (polymorphism 1 in Table 1) in the EGFR gene, or whether there is an exon 19 mutant-type variant (polymorphisms 2-17 in Table 1) depending on whether the oligonucleotide P5 strongly hybridizes with the wild-type detection sequence or the mutant-type detection sequence out of the detection sequences for EGFR gene.
  • a probe comprising the oligonucleotide P5 is termed an exon 19 wild-type probe.
  • the oligonucleotide P6 strongly hybridizes with the detection sequence with the exception of the nucleotide at position 119 when the nucleotides at positions 104 to 119 of SEQ ID NO: 2 are the wild-type variant. Therefore, it is possible to detect whether there is an exon 19 polymorphism, that is to say, an exon 19 wild-type variant (polymorphism 1 in Table 1) in the EGFR gene, or whether there is an exon 19 mutant-type variant (polymorphisms 2-15 and 17 in Table 1) by whether or not the oligonucleotide P6 strongly hybridizes with the detection sequence of the EGFR gene.
  • a probe comprising the oligonucleotide P6 is termed an exon 19 mutant-type (sub) probe.
  • the oligonucleotide P7 strongly hybridizes with the detection sequence when the nucleotides at positions 137 to 151 of SEQ ID NO: 2 are mutant-type variants resulting from a deletion mutation as compared to the case where the nucleotides at positions 137 to 151 of SEQ ID NO: 2 are the wild-type variants having no deletion mutation.
  • an exon 19 polymorphism that is to say, an exon 19 wild-type variant (polymorphism 1 in Table 1) in the EGFR gene, or whether there is an exon 19 mutant-type variant (polymorphism 18 in Table 1) depending on whether the oligonucleotide P7 strongly hybridizes with the wild-type sequence or the mutant-type sequence out of the detection sequences for EGFR gene.
  • a probe comprising the oligonucleotide P7 is termed an exon 19 mutant-type (del) probe.
  • the oligonucleotide according to P5 has a nucleotide length of 9 to 50 nucleotides, a nucleotide length of 20 to 40 nucleotides, a nucleotide length of 25 to 35 nucleotides, or a nucleotide length of 10 to 30 nucleotides.
  • the oligonucleotide according to P6 (5T-EGFR-EX19-No19-F2-3) has a nucleotide length of 9 to 50 nucleotides as described above, a nucleotide length of 20 to 40 nucleotides, a nucleotide length of 25 to 35 nucleotides, or a nucleotide length of 10 to 30 nucleotides.
  • the oligonucleotide according to P7 (3T-EGFR-EX19-No18-F1) has a nucleotide length of 10 to 50 nucleotides as described above, a nucleotide length of 10 to 30 nucleotides, a nucleotide length of 12 to 30 nucleotides, or a nucleotide length of 15 to 20 nucleotides.
  • the site that is labeled by a labeling substance there is no particular limitation on the site that is labeled by a labeling substance, and, in some embodiments, it is the 5′ terminal domain or the 3′ terminal domain, and, in further embodiments, the 5′ terminal or the 3′ terminal.
  • the nucleotide that is labeled by a labeling substance in the above oligonucleotides according to some embodiments is cytosine (c) or guanine (g).
  • the labeling substance for example may be directly labeled on the nucleotide, or the nucleotide may be indirectly labeled by labeling of a site at any of the nucleotide residues including the nucleotide.
  • the oligonucleotide P5 may include the fluorescence-labeled nucleotide corresponding to the nucleotide at position 104 at the 1 st to 3 rd position counted from the 5′ terminal.
  • the oligonucleotide P6 may include the fluorescence-labeled nucleotide corresponding to the nucleotide at position 104 at the 1 st to 3 rd position counted from the 5′ terminal.
  • nucleotide corresponding to the nucleotide at position X means a nucleotide (c) that is homologous to the nucleotide (c) at position X in the relevant nucleotide sequence.
  • nucleotide corresponding to the nucleotide at position 104 means a nucleotide (c) that is homologous to the nucleotide (c) at position 104 in the nucleotide sequence of SEQ ID NO: 2. More specifically, the nucleotide that is homologous to nucleotide number 104 is expressed by c in the oligonucleotide according to P5 and P6.
  • the oligonucleotide P7 may include the fluorescence-labeled nucleotide that is homologous to the nucleotide at position 145 at the 1 st to 3 rd position counted from the 3′ terminal.
  • nucleotide corresponding to the nucleotide at position 145 means a nucleotide (c) that is homologous to the nucleotide (c) at position 145 in the nucleotide sequence of SEQ ID NO: 3. More specifically, the nucleotide that is homologous to nucleotide number 145 is expressed by c in the oligonucleotide according to P7.
  • the oligonucleotide P5 may include the fluorescence-labeled nucleotide that is homologous to the nucleotide at position 104 at the 5′ terminal.
  • the oligonucleotide P6 may include the fluorescence-labeled nucleotide that is homologous to the nucleotide at position 104 at the 5′ terminal.
  • the oligonucleotide P7 may include the fluorescence-labeled nucleotide that is homologous to the nucleotide at position 145 at the 3′ terminal.
  • the oligonucleotide according to P5 is for example the oligonucleotide of SEQ ID NO: 5.
  • the oligonucleotide according to P6 is for example the oligonucleotide of SEQ ID NO: 4.
  • the oligonucleotide according to P7 is for example the oligonucleotide of SEQ ID NO: 6.
  • Hybridization between the probe described herein and the target sequence gives double-strand nucleotides.
  • the double-strand nucleotides can be detected electrochemically or by fluorescence.
  • each of the oligonucleotides (P1), (P3), (P5)-(P7), and (P15)-(P19) may be, for example, an oligonucleotide that hybridizes to a strand complementary to each of the oligonucleotides under stringent conditions.
  • the hybridization can be detected by, for example, various hybridization assays.
  • the methods and conditions described in Molecular Cloning: A Laboratory Manual, Third Edition (Sambrook & Russell, Cold Spring Harbor Laboratory Press, 2001) and the like can be employed as the hybridization assays and the stringent conditions.
  • the oligonucleotides according to P1, P3, P5-P7, and P15-P19 each may be an oligonucleotide including (comprising or consisting of) a sequence having a sequence about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of the sequences described above.
  • the probe of the present invention may be a probe configured from the oligonucleotides described above or a probe containing the oligonucleotides described above.
  • the probe may be configured from either native nucleic acids or non-native nucleic acids, for example.
  • the native nucleic acids include DNA and RNA.
  • the non-native nucleic acids include peptide nucleic acid (PNA) and cross-linking nucleic acid such as Bridged Nucleic Acid (BNA, also referred to as Locked Nucleic Acid (LNA)).
  • PNA peptide nucleic acid
  • BNA Bridged Nucleic Acid
  • LNA Locked Nucleic Acid
  • the prediction of the Tm value of a double-stranded nucleic acid composed of a probe configured from the LNA and the target sequence to be detected can be calculated using the website of EXIQON (exiqon.com/oligo-tools).
  • the fluorescence-labeled oligonucleotide for example includes a substance that emits fluorescent light when not hybridized to the target sequence, and in which the fluorescent intensity increases or decreases when hybridized to the target sequence. Furthermore, the fluorescence-labeled oligonucleotide for example includes a substance that emits fluorescent light when not hybridized to the target sequence, and in which the fluorescent intensity decreases when hybridized to the target sequence.
  • the fluorescent dye includes for example a fluorescent substance such as a fluorophore or the like.
  • the fluorescent dye includes fluorescein, fluorophor, rhodamine, polymethine dye derivatives, and the like.
  • Commercially available fluorescent dyes include PACIFIC BLUE (manufactured by Molecular Probes), BODIPY FL (manufactured by Molecular Probes), FluorePrime (manufactured by Amersham Pharmacia), Fluoredite (manufactured by Millipore), FAM (manufactured by ABI), Cy3 and Cy5 (manufactured by Amersham Pharmacia), TAMRA (manufactured by Molecular Probes), and the like.
  • the detection conditions for the fluorescent dye there is no particular limitation on the detection conditions for the fluorescent dye, and for example, suitable determination is enabled by the type of fluorescent dye that is used. Detection is enabled for example using PACIFIC BLUE at a detection wavelength of 450-480 nm, TAMRA at a detection wavelength of 585-700 nm, and BODIPY FL at a detection wavelength of 515-555 nm.
  • Use of the fluorescence-labeled oligonucleotides as described above for example enables simple confirmation of the hybridization and dissociation in response to the fluctuation in the fluorescent intensity by detection of fluorescence as a signal and by measurement of the fluorescent intensity that is used as a signal value.
  • the probe for detection of a polymorphism is a labeled probe having a label attached thereto.
  • An actual example of the labeling substance in the labeled probe for example includes a fluorescent dye or a fluorophore.
  • An actual example of the labeled probe includes, but is not limited to, a probe that is labeled with a fluorescent dye and in which the fluorescent light is emitted when in an independent configuration and which decreases (for example, undergoes quenching) as a result of the formation of a hybrid.
  • Quenching probes include a probe in which a nucleotide in the 3′ domain of the oligonucleotide (for example, the 3′ terminal) or the 5′ domain of the oligonucleotide (for example, the 5′ terminal) is labeled with a fluorescent dye, and the nucleotide to be labeled may be cytosine (C).
  • C cytosine
  • a nucleotide sequence in the labeled probe may be designed so that a nucleotide that forms a pair with the terminal nucleotide C in the labeled probe or a nucleotide that is separated by 1 to 3 nucleotides from the nucleotide forming such a pair in the detection target sequence for hybridization with the labeled probe is a guanine (G).
  • G guanine
  • This type of probe is generally termed as “guanine quenching probe”, and is known as a so-called “QPROBE”.
  • this type of guanine quenching probe hybridizes with the detection target sequence, a phenomenon occurs in which the C on the terminal labeled by fluorescent dye approaches the G in the detection target sequence and therefore the emission of fluorescent light is weakened (fluorescent intensity is decreased).
  • the use of this type of probe enables simple confirmation of hybridization and dissociation in response to the fluctuation in the signal.
  • the labeling substance can be typically bonded to the nucleotide of a phosphate group.
  • the probe according to the present invention may add a phosphate group to the 3′ terminal.
  • DNA (target DNA) that detected the presence or the absence of a mutation can be prepared by a gene amplification method such as PCR, and at that time, the probe according to the present invention may coexist in the reaction solution for the gene amplification reaction.
  • the probe when a phosphate group is added to the 3′ terminal of the probe, the probe itself can sufficiently prevent the extension due to the gene amplification reaction. Furthermore the same effect is obtained by addition of the labeling substance as described above to the 3′ terminal.
  • a known detection method may be applied.
  • This type of detection method includes for example a Taq-man Probe method or an RFLP method.
  • fluorescent dye includes for example fluorescein, fluorophor, rhodamine, polymethine dye derivatives, and the like.
  • fluorescent dyes include BODIPY FL (manufactured by Molecular Probes), FluorePrime (manufactured by Amersham Pharmacia), Fluoredite (manufactured by Millipore), FAM (manufactured by ABI), Cy3 and Cy5 (manufactured by Amersham Pharmacia), TAMRA (manufactured by Molecular Probes), and the like.
  • a combination of fluorescent dyes used in a plurality of probes for example may enable detection under different conditions, and without particular limitation thereon, the combination may include PACIFIC BLUE (detection wavelength of 450-480 nm), TAMRA (detection wavelength of 585-700 nm), and BODIPY FL (detection wavelength of 515-555 nm).
  • the method of detecting a polymorphism according to the present invention is a method of detecting a polymorphism in an EGFR gene, and is characterized by use of a probe that hybridizes with the detection sequence.
  • the method of detecting a polymorphism according to the present invention is characterized by use of the probe for detecting a polymorphism according to the present invention.
  • the following description does not impose any limitation on other features of configuration or conditions or the like.
  • the present invention can be applied, for example, to polymorphism detection in an EGFR gene in the fields excluding diagnosis and treatment.
  • the method of detecting a polymorphism according to the present invention for example includes step (A) and step (B) below.
  • B A step of determining the polymorphism in the nucleic acid to be detected from the fluctuation in the signal value associated with the temperature change.
  • the probe for detecting a polymorphism according to the present invention for example may be a single type or may combine use of two or more.
  • the type of probe that is used for detecting a polymorphism for example enables suitable determination in response to the polymorphism of the detection target.
  • the probe or probes for detecting a polymorphism used in step (A) includes at least one probe that is the probe for detecting a polymorphism according to the present invention.
  • the type of probe for example enables suitable determination in response to the polymorphism of the detection target in the EGFR gene.
  • detection of only the EGFR 858 polymorphism may be executed, detection of only the exon 19 polymorphism may be executed, or detection of both polymorphisms in a single reaction system may be executed.
  • the other polymorphism and for example, may include an EGFR 790 polymorphism in the EGFR gene.
  • the EGFR 858 probe of the probe for detection of a polymorphism according to the present invention may be used.
  • the EGFR 858 probe may be an EGFR 858 wild-type probe, an EGFR 858 mutant-type probe, or a combination of both.
  • the exon 19 wild-type probe When detecting only the exon 19 polymorphism, of the probes for detection of a polymorphism according to the present invention, at least one type of the exon 19 wild-type probe, the exon 19 mutant-type (sub) probe, and the exon 19 mutant-type (del) probe may be used.
  • the use of the exon 19 wild-type probe enables detection of whether the exon 19 polymorphism is an exon 19 wild-type variant (polymorphism 1) or an exon 19 mutant-type variant (polymorphism 2 to polymorphism 17).
  • exon 19 mutant-type (sub) probe enables detection of whether the polymorphism is an exon 19 wild-type variant (polymorphism 1) or an exon 19 mutant-type variant (polymorphism 2-15, and 17).
  • exon 19 mutant-type (del) probe enables detection of whether the polymorphism is an exon 19 wild-type variant (polymorphism 1) or an exon 19 mutant-type variant (polymorphism 18).
  • any of the exon 19 wild-type probe, the exon 19 mutant-type (sub) probe, and the exon 19 mutant-type (del) probe may be used.
  • a combination of P5 and P7 enables detection of the 18 types of polymorphism 1-18 and the combination of P6 and P7 enables detection of 17 types with the exception of polymorphism 16 (although P5 is subjected to self quenching, P6 does not undergo self quenching), that P5 used in isolation enables detection of 17 types with the exception of polymorphism 18, P6 used in isolation enables detection of 16 types with the exception of polymorphism 16 and 18 (although P5 is subjected to self quenching, P6 does not undergo self quenching), and P7 used in isolation enables detection of only one type being polymorphism 18.
  • the present invention may combine the EGFR 858 probe and the exon 19 probe. Since the probe according to the present invention as described above enables detection of a polymorphism with superior reliability. Therefore for example, the EGFR 858 polymorphism and the exon 19 polymorphism can be respectively detected specifically even when the EGFR 858 probe and an exon 19 probe are used in a single reaction solution. As described above, the exon 19 wild-type probe, the exon 19 mutant-type (sub) probe and the exon 19 mutant-type (del) probe may be used in combination as the exon 19 probes.
  • the present invention detects the EGFR 790 polymorphism or simultaneously detects the EGFR 858 polymorphism and/or the exon 19 polymorphism. “Simultaneously detects” for example includes the meaning of detection by use of the same single reaction system. In this case, the present invention in addition to both probes may combine use of the EGFR 790 probe.
  • the EGFR 790 probe includes a probe comprising the oligonucleotide (P14) below.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence of 14 to 50 nucleotides to nucleotides 334 to 347 of SEQ ID NO: 21, in which the nucleotide (g) at position 334 in the nucleotide sequence of SEQ ID NO: 21 is the 5′ terminal.
  • the probe may be a fluorescence-labeled probe.
  • the probe is, for example, a probe capable of detecting a genetic mutation in EGFR.
  • the oligonucleotide according to P14 may be the oligonucleotide described below.
  • An oligonucleotide including a sequence at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a complementary nucleotide sequence to an oligonucleotide of 14 to 50 nucleotides to nucleotides 334 to 347 of SEQ ID NO: 21, in which the nucleotide (g) at position 334 in the nucleotide sequence of SEQ ID NO: 21 is the 5′ terminal, and in which the nucleotide corresponding to nucleotide 347 is guanine or adenine and the nucleotide corresponding to nucleotide 334 is cytosine.
  • the probe comprising the oligonucleotide according to (P14), for example, is a probe for detection of the presence or absence of a substitution mutation in the nucleotide at position 347 in the nucleotide sequence of SEQ ID NO: 21.
  • the oligonucleotide according to (P14), for example, is complementary to the sense strand of the EGFR gene, and the polymorphism can be confirmed by hybridization with the sense strand.
  • the nucleotide that is complementary to the nucleotide at position 347 of SEQ ID NO: 21 is expressed by r.
  • the denotation r refers to guanine (g) and adenine (a).
  • an oligonucleotide in which r is guanine (g) strongly hybridizes with the EGFR 790 wild-type detection sequence as compared to the EGFR 790 mutant-type detection sequence it may be termed an EGFR 790 wild-type probe.
  • an oligonucleotide in which r is adenine (a) strongly hybridizes with the EGFR 790 mutant-type detection sequence as compared to the EGFR 790 wild-type detection sequence it may be termed an EGFR 790 mutant-type probe.
  • oligonucleotides enable detection of the EGFR gene polymorphism depending on whether these oligonucleotides strongly hybridize with the EGFR 790 wild-type detection sequence or the EGFR 790 mutant-type detection sequence out of the detection sequences for EGFR gene.
  • the 3′ terminal of the oligonucleotide according to (P14) is cytosine.
  • the oligonucleotide according to (P14) includes the oligonucleotide of SEQ ID NO: 22, and in that the nucleotide sequence, r, has the same denotation as that described above.
  • Actual examples of the oligonucleotide include the oligonucleotide of SEQ ID NO: 23 that is an EGFR790 mutant-type probe and the oligonucleotide of SEQ ID NO: 24 that is an EGFR790 wild-type probe.
  • the oligonucleotide according to P14 may be an oligonucleotide including a sequence that is at least about 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of the sequences described above.
  • each probe for example may be a labeled probe that includes a different labeling substance.
  • the different labeling substances may be labeling substances that include different detection conditions.
  • the nucleic acid to be detected includes single-stranded nucleic acid or double-stranded nucleic acid.
  • step (A) may include a step in which the reaction system is heated, and the double-stranded nucleic acid to be detected is dissociated. The dissociation of the double-stranded nucleic acid into a single-strand nucleic acid for example facilitates hybridization between the single-stranded nucleic acid and the probe for detection of a polymorphism according to the present invention.
  • the nucleic acid to be detected for example may be a nucleic acid originally contained in the test sample, or, since the detection accuracy can be improved, the nucleic acid to be detected may be an amplification product amplified by a nucleic acid amplification method using the nucleic acid as template nucleic acid.
  • the amplification product may be an amplification product using DNA in the sample as a template.
  • the nucleic acid to be detected may be cDNA that is synthesized from RNA such as the total RNA, mRNA or the like in the test sample using RT-PCR (reverse transcription PCR), or may be an amplification product using cDNA as a template.
  • the amplification product for example may be an amplification product of a domain including the detection sequence.
  • the detection sequence may include only the detection site of the EGFR858 polymorphism as the detection site or may include only the detection site of the exon 19 polymorphism as the detection site. Further, the detection sequence may include the EGFR858 polymorphism and the exon 19 polymorphism as the detection site. Furthermore, the detection sequence may further include the EGFR790 polymorphism as described above as the detection site.
  • the method of detection of a polymorphism according to the present invention may further include a step of producing the amplification product from template nucleic acid.
  • the amplification product production step for example may be performed in advance of the step (A) above, or may be performed during the step (A).
  • an amplification product may be prepared in advance for use in the step (A) and a reaction system may be prepared that includes the probe for detection of a polymorphism according to the present invention and the amplification product, or the amplification product may be prepared from the template nucleic acid in the reaction system in the presence of the probe for detection of the polymorphism according to the present invention and a reaction system may be prepared that includes the probe for detection of a polymorphism and the amplification product.
  • the method of amplifying the nucleic acid includes a polymerase chain reaction (PCR) method, a nucleic acid sequence based amplification (NASBA) method, a transcription-mediated amplification (TMA) method, a strand displacement amplification (SDA) method, and of those methods, the PCR method may be used.
  • PCR polymerase chain reaction
  • NASBA nucleic acid sequence based amplification
  • TMA transcription-mediated amplification
  • SDA strand displacement amplification
  • a primer for amplifying the sequence including the target polymorphism to be detected in the EGFR gene in the production of the amplification product from the template nucleic acid may be used.
  • the amplification domain of the primer may be the domain including the detection site of the EGFR858 polymorphism, that is to say, the domain that includes the nucleotide at position 261 in the nucleotide sequence of SEQ ID NO: 1. More specifically, the amplification domain may be the domain that includes the sequence that hybridizes with at least one of the oligonucleotides according to P1, P3, and P15-P19 in the nucleotide sequence of SEQ ID NO: 1 of the EGFR gene.
  • the amplification domain may be the domain that includes the detection site for the exon 19 polymorphism, that is to say, the domain that includes the nucleotides at positions 112 to 151 in the nucleotide sequence of SEQ ID NO: 2. More specifically, the domain may include the sequence that hybridizes with at least one of the oligonucleotides according to P5 to P6 in the nucleotide sequence of SEQ ID NO: 2 and the oligonucleotide according to P7 in the nucleotide sequence of SEQ ID NO: 3.
  • the amplification domain may be the two domains being the domain that includes the detection site for the exon 19 polymorphism and the domain that includes the detection site for the EGFR858 polymorphism.
  • the amplification domain further may include the domain that includes the detection site for the EGFR790 polymorphism.
  • primer sequence there is no particular limitation on the primer sequence, and for example, it is sufficient if it enables amplification of the detection sequence including the detection site, and may be suitably defined by a known method in response to the detection sequence and peripheral sequences thereto.
  • primer length There is no particular limitation on the primer length, and may be set to a generally-used length, and for example a nucleotide length of 10 to 50 nucleotides may be used.
  • the primer for example includes use of any one of a forward primer that amplifies the sense strand (hereinafter denoted as “F primer”) and a reverse primer that amplifies the antisense strand (hereinafter denoted as “R primer”).
  • F primer forward primer that amplifies the sense strand
  • R primer reverse primer that amplifies the antisense strand
  • both as a pair in the configuration of a primer set may be used.
  • An example of the primer will be described in relation to the primer according to the present invention.
  • a primer configured to detect a genetic mutation in EGFRexon21 L858R includes a primer that amplifies the region that includes the sequence that hybridizes with at least one of the oligonucleotides according to P1, P3, and P15-P19 in the nucleotide sequence of SEQ ID NO: 1 in the EGFR gene, and more specifically, is a primer selected from the group consisting of oligonucleotides P8 to P10.
  • P10 An oligonucleotide of 10 to 50 nucleotides complementary to nucleotides 290 to 299 of SEQ ID NO: 1, and in which the 3′ terminal is the nucleotide C complementary to the nucleotide G at position 290.
  • the oligonucleotide according to P8 for example includes the oligonucleotide of SEQ ID NO: 15, the oligonucleotide of P9 for example includes the oligonucleotide of SEQ ID NO: 17, and the oligonucleotide of P10 for example includes the oligonucleotide of SEQ ID NO: 16.
  • a primer configured to detect a genetic mutation in EGFRexon19 deletion includes a primer that amplifies the region that includes the sequence that hybridizes with at least one of the oligonucleotides according to P5 and P6 in the nucleotide sequence of SEQ ID NO: 2 in the EGFR gene, or the region that includes the sequence that hybridizes with the oligonucleotide according to P7 in the nucleotide sequence of SEQ ID NO: 3 and more specifically, is a primer selected from the group consisting of oligonucleotides P11-P13.
  • P11 An oligonucleotide of 10 to 50 nucleotides homologous to nucleotides 86 to 95 of SEQ ID NO: 2, and in which the 3′ terminal is the nucleotide G at position 95.
  • P12 An oligonucleotide of 10 to 50 nucleotides homologous to nucleotides 64 to 73 of SEQ ID NO: 2, and in which the 3′ terminal is the nucleotide C at position 73.
  • the oligonucleotide according to P11 for example includes the oligonucleotide of SEQ ID NO: 18, the oligonucleotide according to P12 for example includes the oligonucleotide of SEQ ID NO: 19, and the oligonucleotide according to P13 for example includes the oligonucleotide of SEQ ID NO: 20.
  • the primers may be a polymorphism detecting primer capable of detecting a genetic mutation in EGFR.
  • the primer addition concentration there is no particular limitation on the primer addition concentration and for example, a single type of primer may have a concentration of 0.1-4 ⁇ mol/L, 0.25-1.5 ⁇ mol/L, or 0.5-1 ⁇ mol/L.
  • a single type of primer may have a concentration of 0.1-4 ⁇ mol/L, 0.25-1.5 ⁇ mol/L, or 0.5-1 ⁇ mol/L.
  • the addition ratio of the F primer (F) and the R primer (R) mole ratio F:R
  • a ratio of 1:0.25-1:4 or 1:0.5-1:2 may be used.
  • step (A) there is no particular limitation on the addition ratio (molar ratio) of the probe for detection of the polymorphism according to the present invention relative to the nucleic acid to be detected, and in light of ensuring a sufficient detection signal, may be no more than times one.
  • the nucleic acid to be detected may be the total of the nucleic acid that includes the wild-type detection sequence and the nucleic acid that includes the mutant-type detection sequence, or may be the total of the amplification product that includes the wild-type detection sequence and the amplification product that includes the mutant-type detection sequence.
  • the addition ratio (mole ratio) with the probe for detection of a polymorphism may be no more than 20 times relative to the nucleic acid that includes the detection sequence strongly hybridizes with (the amplification product including the detection sequence described above), no more than 10 times, or no more than 5 times. There is no particular lower limitation, and for example, it may be, at least 0.001 times, at least 0.01 times, or at least 0.1 times.
  • the addition ratio of the probe for detection of the polymorphism according to the present invention relative to the nucleic acid to be detected for example may be a mole ratio relative to the double-stranded nucleic acid, or a mole ratio relative to the single-stranded nucleic acid.
  • the addition concentration of the probe for detection of a polymorphism according to the present invention in the reaction system there is no particular limitation on the addition concentration of the probe for detection of a polymorphism according to the present invention in the reaction system, and for example, a single type of probe for detection of a polymorphism may be added in the range of 10-1000 nmol/L, or in the range of 20-500 nmol/L.
  • test sample used in the method of detection of a polymorphism according to the present invention includes a biological sample.
  • the biological sample include whole blood, haemocytes such as white blood cells or the like, bone marrow, cells from the oral cavity such as the tunica mucosa oris or the like, somatic cells such as the nails, hair or the like, reproductive cells, sputum, amniotic fluid, paraffin encased tissue samples, urine, gastric juices, gastric lavage solution, or the like.
  • the method of obtaining the sample the method of preparing the nucleic acid to be detected from the sample, or the like, and a known and conventional method may be used.
  • the concentration of the whole blood in the reaction system for example, is 0.01-2 volume %, 0.05-1.5 volume %, or 0.1-1 volume %
  • the concentration of the blood serum in the reaction system for example, is 0.1-20 volume %, 0.25-15 volume %, or 0.5-10 volume %
  • the method of detection of a polymorphism according to the present invention can be used in so-called Tm analysis as described above (hereinafter referred to as melting curve analysis).
  • Tm analysis As described above, the absorbance at 260 nm increases. The increase results from the breakage of hydrogen bonds between the strands in the double-stranded DNA resulting from the heating, and the dissociation into single-stranded DNA (DNA melting).
  • DNA melting the dissociation into single-stranded DNA
  • the absorbance exhibits approximately a 1.5 increase from the absorbance at which heating started (absorbance when only double-stranded DNA is present). In this manner, completion of melting can be determined.
  • a melting temperature Tm is generally defined as a temperature at the time when the amount of increase in absorbance reaches 50% of the total amount of increase in absorbance.
  • the measurement of the signal indicating the state of melting of the hybridization product formed from the nucleic acid to be detected and the probe for detection of a polymorphism may be performed by measuring the signal of the fluorescent dye as described above.
  • the labeled probe includes a labeled probe that shows a signal in isolation and does not show a signal upon formation of a hybrid, or a probe that does not show a signal in isolation and shows a signal upon formation of a hybrid.
  • a signal is not exhibited when forming a hybrid (double-stranded DNA) with the amplification product, and a signal is exhibited when the probe dissociates from the amplification product due to heating.
  • a signal is exhibited when forming a hybrid (double-stranded DNA) with the amplification product, and a signal is decreased (quenched) when the probe dissociates from the amplification product due to heating. Accordingly, by detecting the signal of the fluorescent dye, progress of the melting of the hybridization product and the Tm value can be determined as in the case of the measurement of an absorbance at 260 nm.
  • the signal detection of the fluorescent dye may be performed using a condition that is specific to the signal from the fluorescent dye, and such conditions include for example an excitation wavelength, a detection wavelength and the like.
  • the fluorescent dye and the labeled probe conform to the description above.
  • the probe for detecting a polymorphism according to the present invention that is used in the present example is a labeled probe that is labeled with fluorescent dye.
  • Amplification is performed from a template nucleic acid in the presence of the probe for detecting a polymorphism, and the resulting amplification product is taken to be the nucleic acid to be detected.
  • the method of detection of a polymorphism according to the present invention is characterized by use itself of the probe for detecting a polymorphism according to the present invention, and is not limited in any manner in relation to other steps or conditions.
  • genomic DNA is isolated from the biological sample.
  • the isolation of the genomic DNA from the biological sample may be performed by a known and conventional method. Actual examples include for example a commercially available genomic DNA isolation kit (product name: GFX Genomic Blood DNA Purification Kit, manufactured by GE Healthcare Biosciences).
  • the labeled probe is added to the sample containing the isolated genomic DNA to thereby prepare a reaction solution.
  • the labeled probe for example as stated above may be a QPROBE.
  • the labeled probe may be added to the sample containing the isolated genomic DNA, or may be mixed with the genomic DNA in a solvent.
  • a solvent there is no particular limitation on the solvent, and examples include known solvents such as a buffering solution such as Tris-HCl, or the like, a solvent containing KCl, MgCl 2 , MgSO 4 , glycerol, or the like, or an amplification reaction solution such as a PCR reaction solution.
  • addition of the labeled probe there is no particular limitation on the timing of addition of the labeled probe, and for example, addition is possible before, during, or after the amplification reaction. Of those options, addition to the reaction solution prior to the amplification reaction may be due to the fact that there is no requirement during addition for exposure of the reaction solution to the external environment, and due to the fact that measurement of the signal value and the amplification reaction can be performed continuously. In this case, as described above, the 3′ terminal of the labeled probe may be modified using a labeling substance or a phosphate group.
  • the sequence containing the detection site generating the target polymorphism is amplified using a method of amplification such as PCR in the presence of the labeled probe using the isolated genomic DNA as a template.
  • a method of amplification such as PCR in the presence of the labeled probe using the isolated genomic DNA as a template.
  • PCR is performed using the reaction solution above that contains the genomic DNA, the labeled probe and the primer.
  • the composition of the reaction solution and suitable setting thereof may be performed by a person skilled in the art.
  • the solution may include polymerases such as DNA polymerase or the like, nucleoside triphosphates, a buffering solution, and various types of catalysts, or the like.
  • polymerases such as DNA polymerase or the like, nucleoside triphosphates, a buffering solution, and various types of catalysts, or the like.
  • the addition ratio of the primer and the labeled probe in the reaction solution and for example, it may fall within the respective ranges described above.
  • DNA polymerase there is no particular limitation in relation to DNA polymerase, and for example a known and conventional polymerase originating from a thermoduric bacterium may be used, and more specifically, includes commercially available types such as DNA polymerase originating from Thermus aquaticus (U.S. Pat. No. 4,889,818, and No.
  • thermoduric polymerase originating from Thermus aquaticus may be used.
  • the addition ratio of the DNA polymerase in the reaction solution there is no particular limitation on the addition ratio of the DNA polymerase in the reaction solution, and for example, it may be 1-100 U/mL, 5-50 U/mL, or 20-40 U/mL.
  • the activity unit of DNA polymerase (U) is generally such that 1U is the activity when using activated salmon sperm DNA as a template primer, and all nucleotides in 10 nmol are incorporated into an acid-insoluble precipitate in 30 minutes at 74° C. in a reaction solution used for measurement of activity.
  • the composition of the reaction solution used for measurement of activity is for example 25 mmol/L TAPS buffer (pH 9.3, 25° C.), 50 mmol/L KCl, 2 mmol/L MgCl 2 , 1 mmol/L melcaptoethanol, 200 ⁇ mol/L dATP, 200 ⁇ mol/L dGTP, 200 ⁇ mol/L dTTP, 100 ⁇ mol/L “ ⁇ - 32 P” dCTP, and 0.25 mg/mL activated salmon sperm DNA.
  • the nucleoside triphosphates above normally include dNTP (dATP, dCTP, dGTP, and dTTP or dUTP).
  • dNTP dATP, dCTP, dGTP, and dTTP or dUTP
  • the addition ratio of dNTP in the reaction solution may be 0.01-1 mmol/L, 0.05-0.5 mmol/L, or 0.1-0.3 mmol/L.
  • the buffering solution for example includes Tris-HCl, Tricine, MES, MOPS, HEPES, CAPS and the like, and a commercially available PCR buffering solution or commercially available buffering solution for a PCR kit may be used.
  • the reaction solution may further include heparin, betaine, KCl, MgCl 2 , MgSO 4 , glycerol, or the like, and the addition ratio thereof may be set for example within a range that does not impede the PCR reaction.
  • the overall volume of the reaction solution there is no particular limitation on the overall volume of the reaction solution, and for example, it may be suitably set in response to the equipment used such as a thermal cycler, or the like, and normally has a volume of 1-500 ⁇ L, or 10-100 ⁇ L.
  • PCR is performed.
  • cycle conditions for PCR there is no particular limitation on the cycle conditions for PCR, and for example, conditions are exemplified below in Table 2 respectively in relation to (1) dissociation of double-stranded DNA that is the nucleic acid to be detected into single-stranded DNA, (2) annealing of the primer to the single-stranded DNA, and (3) extension of the primer using a polymerase reaction.
  • the number of cycles there is no particular limitation on the number of cycles, and when the three steps in (1) to (3) below are taken as one cycle, for example, at least thirty cycles may be performed.
  • the upper limit on the total number of cycles and for example, it may be no more than 100 cycles, no more than 70 cycles, or no more than 50 cycles.
  • the temperature change in each step may be automatically controlled using a thermal cycler or the like.
  • the addition ratio of the labeled probe in the reaction solution there is no particular limitation on the addition ratio of the labeled probe in the reaction solution, and for example, the labeled probe may be added in a range of 10-1000 nmol/L, or in a range of 20-500 nmol/L.
  • the mole ratio of the labeled probe to the nucleic acid to be detected in the reaction solution may be no more than times one in light of ensuring a sufficient signal value.
  • the addition ratio of the labeled probe to the nucleic acid to be detected for example, may be a mole ratio relative to double-stranded nucleic acid, or may be a mole ratio relative to single-stranded nucleic acid.
  • dissociation of the resulting amplification product (double-stranded DNA) and hybridization is performed using the single-stranded DNA resulting from dissociation and the labeled probe.
  • This may be performed by changing the temperature of the reaction solution in the presence of the labeled probe.
  • a reaction solution having the labeled probe added in advance may be subjected to the amplification reaction, and then the temperature of the reaction solution is changed.
  • the heating temperature in the dissociation step there is no limitation on the heating temperature in the dissociation step as long as the double-stranded amplification product can be dissociated into single-strands, and for example, the temperature may be 85-95° C. Furthermore, there is no particular limitation on the heating time, and normally the time is 1 second to 10 minutes, or 1 second to 5 minutes.
  • the hybridization between the dissociated single-stranded DNA and the labeled probe may be performed after the dissociation step by decreasing the heating temperature in the dissociation step.
  • the temperature condition is for example 40-50° C.
  • the temperature of the reaction solution is changed to thereby measure the signal value that indicates the state of melting of the hybridization product formed from the amplification product and the labeled probe. More specifically, for example, the reaction solution (the hybridization body of the single-stranded DNA and the labeled probe) is heated to thereby measure the fluctuation in the signal value associated with the temperature increase.
  • a guanine quenching probe that is to say, a probe labeled with a terminal cytosine (c)
  • fluorescence is decreased (or quenched) when in a hybridized state with the single-stranded DNA, and fluorescence is emitted when in a dissociated state. Therefore, for example, the hybridization product that exhibits decreasing (or quenching) fluorescence is gradually heated to thereby measure the increase in the fluorescence intensity associated with the temperature increase.
  • the temperature range when measuring the fluctuation in the fluorescence intensity may be from ambient temperature to 85° C., or from 25-70° C.
  • the final temperature for example may be 40-105° C.
  • the temperature increase rate it may be for example 0.1-20° C./sec, or 0.3-5° C./sec.
  • the Tm value is determined by analyzing the fluctuation in the signal value. More specifically, a fluorescent intensity change amount per unit time for each temperature ( ⁇ d fluorescent intensity increase amount/dt) is calculated from the resulting fluorescent intensity and the temperature that exhibits the lowest value is determined as the Tm value. Alternatively, the highest point in the fluorescent intensity increase amount per unit time (d fluorescent intensity increase amount/t) can be determined as the Tm value. In contrast, the decrease amount in the fluorescent intensity may be measured when the labeled probe is not a fluorescent quenching probe but rather a probe that does not exhibit a signal when in isolation and that exhibits a signal when forming a hybrid.
  • the Tm value can be calculated using known and conventional MELTCALC software (meltcalc.com/) or the like, or may be determined using a nearest neighbor method.
  • the Tm value is used to determine whether the polymorphism in the EGFR gene is a wild-type variant or a mutant-type variant.
  • the wild-type probe strongly hybridizes with the wild-type detection sequence as compared to the mutant-type detection sequence. Therefore, the Tm value of a double-stranded nucleic acid composed of the wild-type probe and the wild-type detection sequence shows a higher value than the Tm value of a double-stranded nucleic acid composed of the wild-type probe and the mutant-type detection sequence.
  • the mutant-type probe strongly hybridizes with the mutant-type detection sequence as compared to the wild-type detection sequence.
  • the Tm value of a double-stranded nucleic acid composed of the mutant-type probe and the mutant-type detection sequence shows a higher value than the Tm value of a double-stranded nucleic acid composed of the mutant-type probe and the wild-type detection sequence. Consequently, determination in advance in relation to the labeled probe of a Tm value (Tm H ) in which the probe strongly hybridizes with the detection sequence and a Tm value (Tm L ) in which the probe hybridizes with the detection sequence at a value lower than the Tm value (Tm H ) enables determination of whether or not the detection sequence includes either the wild-type polymorphism or the mutant-type polymorphism.
  • the sequence can be determined to be the mutant-type detection sequence when a Tm value (Tm L ) lower than the Tm value (Tm H ) is obtained using the wild-type probe.
  • the sequence can be determined to be the wild-type detection sequence when a Tm value (Tm L ) lower than the Tm value (Tm H ) is obtained using the mutant-type probe.
  • the polymorphism can be determined to be a mutant-type variant when exhibiting the predetermined Tm value (Tm H ) with the predetermined mutant-type detection sequence, and the polymorphism can be determined to be a wild-type variant when exhibiting a Tm value (Tm L ) lower than the predetermined Tm value (Tm H ).
  • the polymorphism can be determined to be a wild-type variant when exhibiting the predetermined Tm value (Tm H ) with the wild-type detection sequence, and the polymorphism can be determined to be a mutant-type variant when exhibiting a Tm value (Tm L ) lower than the predetermined Tm value (Tm H ).
  • a method used in the present invention of measuring the signal fluctuation associated with a temperature increase by increasing the temperature of a reaction system including a probe for detecting a polymorphism (heating a hybridization product) for example, measurement of a signal fluctuation may be performed at the time of hybrid formation. That is to say, the temperature of the reaction system including the probe for detecting a polymorphism is decreased to thereby form a hybridization product, and then the signal fluctuation associated with the temperature decrease is measured.
  • a labeled probe that exhibits a signal when in isolation and does not exhibit a signal when forming a hybrid for example, a guanine quenching probe
  • fluorescence is emitted in a state in which the single-stranded DNA is dissociated from the labeled probe
  • the fluorescence is decreased (or quenched). Therefore, for example, the decrease in the fluorescent intensity associated with the temperature decrease may be measured by gradually decreasing the temperature of the reaction solution.
  • the fluorescence is not emitted in a state in which the single-stranded DNA is dissociated from the labeled probe, when a hybrid is formed due to a decrease in the temperature, the fluorescence is emitted. Therefore, for example, the increase in the fluorescent intensity associated with a temperature decrease may be measured by gradually decreasing the temperature of the reaction solution.
  • the present invention enables use of two or more types of probes for detection of a polymorphism in a single reaction system.
  • the timing of addition of each probe for example may be as described above, and simultaneous addition in advance of step (A) may be performed.
  • simultaneous addition in advance of the amplification reaction may be performed.
  • the plurality of probes for example may be a combination of an EGFR858 probe and an exon19 probe, and more specifically, includes examples such as a combination of an EGFR858 probe and an exon19 wild-type probe, a combination of an EGFR858 probe and an exon19 mutant-type (del) probe, and a combination of an EGFR858 probe and an exon19 wild-type probe and an exon19 mutant-type (del) probe.
  • the combination may further include the EGFR790 probe.
  • the EGFR858 probe and the exon19 probe may be used.
  • the EGFR858 probe and the exon19 probe as described above may include respectively different labeling substances.
  • the respective Tm values can be determined by detecting a signal corresponding to the measurement conditions of each labeling substance by changing the temperature of the reaction system.
  • Detection of the EGFR858 polymorphism or the EGFR790 polymorphism is enabled, for example, by respectively combining a wild-type probe and a mutant-type probe in relation to the target polymorphism.
  • determination of the type of polymorphism is enabled by which probe exhibits a Tm of the hybrid that is a completely complementary match.
  • the polymorphism when using a wild-type probe and a mutant-type probe that have different labeling substances, the polymorphism is determined to be a mutant-type variant when the mutant-type probe exhibits a Tm value of the hybrid that is a completely complementary match, and the polymorphism is determined to be a wild-type variant when the wild-type probe exhibits a Tm value of the hybrid that is a completely complementary match.
  • the mutant may be located anywhere in the probe described herein provided that the location of the mismatch allows for a change in the melting temperature between the mutant and wild-type sequences. Accordingly, when the probe does not exhibit completely complementary match to a sample, the mismatch may be located anywhere in the probe. Specifically, the mismatch may be a 3′ or 5′ terminal mismatch.
  • the mismatch may be located at or near the center of the probe such that the mismatch is most likely to destabilize the duplex with the target sequence under the test hybridization conditions.
  • the method of detecting a polymorphism according to the present invention enables a combination of the probe for detecting a polymorphism according to the present invention for detecting a polymorphism in an EGFR gene and a probe for detecting a polymorphism in another gene.
  • the combination of the probe for detecting a polymorphism according to the present invention and the probe for detecting a polymorphism in another gene enables detection of a polymorphism in two or more genes including the EGFR gene.
  • the other polymorphisms in the EGFR gene includes the EGFR790 polymorphism.
  • the determination method according to the present invention is characterized by execution of the method for detecting a polymorphism by use of the probe for detecting a polymorphism according to the present invention, and there are no other limitations in respect of other steps or conditions.
  • the determination of the efficacy of or resistance to EGFR-TKI due to a polymorphism is for example performed according to a known standard.
  • the reagent kit for detection of a polymorphism in the EGFR gene according to the present invention is characterized by inclusion of the probe for detecting a polymorphism according to the present invention.
  • the probe according to the present invention included in the reagent kit according to the present invention may be a single type or two or more types, and for example, a combination may be included as described above.
  • the reagent kit according to the present invention for example may include the primer according to the present invention as described above. The combination of primers may be in accordance with the above description without any particular limitation thereon.
  • the reagent kit according to the present invention for example may further include required components for the amplification reaction of the nucleic acid, explanatory materials, and the like.
  • the primer reagent according to the present invention may contain any one type of primer according to the present invention, or may contain two or more types.
  • the type of primer for example may be suitably set in response to the target amplification domain.
  • at least one of the primers configured from the oligonucleotides according to P8, P9 and P10 may be included, and in particular, at least one primer selected from the group consisting of the oligonucleotides of SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17 may be included.
  • At least one of the primers formed from the oligonucleotides according to P11, P12 and P13 may be included, and in particular, at least one primer selected from the group consisting of the oligonucleotides of SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20 may be included.
  • the primer reagent according to the present invention for example enables amplification of a detection sequence including the EGFR858 polymorphism and the detection sequence including the exon19 polymorphism by having a primer that includes the oligonucleotide according to P8, and the oligonucleotide according to P9 or P10, the oligonucleotide according to P11 or P12, and the oligonucleotide according to P13.
  • a combination of primers has been described above, there is no limitation in this regard.
  • the reagent for detection of a polymorphism according to the present invention is a reagent for detection of a polymorphism in an EGFR gene, and is characterized by inclusion of the probe for detection of a polymorphism according to the present invention.
  • the reagent for detection of a polymorphism according to the present invention for example can be said to be a probe kit used in the detection of a polymorphism in the EGFR gene.
  • the reagent for detection of a polymorphism for example may include one type of probe for detection of a polymorphism, or two or more types, and may be suitably set in response to the polymorphism that is the target of detection.
  • the EGFR858 probe may be included.
  • the EGFR858 probe for example may be the EGFR858 wild-type probe, may be the EGFR858 mutant-type probe, or may include both.
  • the exon19 probe may be included.
  • the exon19 probe for example may be any one of the exon19 wild-type probe, may be the exon19 mutant-type (sub) probe, may be the exon19 mutant-type (del) probe, may include two types, or may include all types. Furthermore, although a combination of probes has been described above, there is no limitation in this regard.
  • the reagent kit for detection of a polymorphism according to the present invention is a reagent kit for use in detection of a polymorphism in the EGFR gene, and is characterized by inclusion of the probe according to the present invention.
  • One type or two or more types of the probe according to the present invention may be provided in the reagent kit according to the present invention. In the latter configuration, the two or more probes may be included in a mixed configuration, or may be included as separate reagents.
  • each probe when included in a probe kit according to the present invention in a configuration in which two or more probes according to the present invention are mixed, or when executing Tm analysis of each probe and each detection target sequence in the same reaction system at the same time although included as separate reagents, each probe may be labeled with separate fluorescent substances.
  • the variation of the type of fluorescent substance in this manner enables detection of respective probes even in the same reaction system.
  • the fluorescent substance may be a substance having a different detection wavelength.
  • the reagent kit for detection of a polymorphism in an EGFR gene may include a primer set for the amplification of a sequence including the polymorphic site (domain with which the probe undergoes hybridization).
  • Tm analysis was performed in the common presence of a wild-type plasmid and a mutant-type plasmid in order to detect an EGFR858 polymorphism in an EGFR gene.
  • the wild-type plasmid and a mutant-type plasmid are prepared as an EGFR858 wild-type plasmid (L858WT) and as an EGFR858 mutant-type plasmid (L858R).
  • the EGFR858 wild-type plasmid (L858WT) includes a partial sequence of the EGFR gene by insertion of the oligonucleotides from position 112 to position 411 of SEQ ID NO: 1, and in which the nucleotide (k) at position 261 of SEQ ID NO: 1 is thymine (t).
  • the EGFR858 mutant-type plasmid (L858R) includes a partial sequence of the EGFR gene by insertion of the oligonucleotides from position 112 to position 411 of SEQ ID NO: 1, and in which the nucleotide (k) at position 261 of SEQ ID NO: 1 is guanine (g). These plasmids are mixed in a predetermined ratio as shown below to thereby prepare three types of samples. These samples include 250 plasmid copies per ⁇ L.
  • PCR and Tm analysis were performed in relation to 50 ⁇ L of PCR reaction solution as illustrated in Table 4 using a fully automatic SNPs detection apparatus (product name: i-densy (trademark) IS-5310 manufactured by Arkray Inc.).
  • PCR included repetition of 50 cycles after processing at 95° C. for one minute with a single cycle being one second at 95° C. and 15 seconds at 58° C., and then processing for one second at 95° C. and 60 seconds at 40° C. Then, the reaction solution was heated from 40° C. to 75° C. with a rate of temperature increase being 1° C./3 seconds to thereby perform Tm analysis by measurement of the change in the fluorescence intensity over time at a detection wavelength of 585-700 nm.
  • the sequence of the EGFR858 primer is shown below.
  • F primer (SEQ ID NO: 15) (EGFR-L858R-F2) 5′-aggaacgtactggtgaaacaccgc-3′
  • R primer (SEQ ID NO: 16) (EGFR-L858R-R2) 5′-ttactttgcctccttctgcatggtattc-3′
  • the EGFR858 primer that was used is the EGFR858 mutant-type probe having the sequence below.
  • the EGFR858 mutant-type probe is a mutant-type probe in the sense strand of the EGFR858 mutant-type EGFR gene.
  • the nucleotide that is underlined is a nucleotide that is complementary to the EGFR858 mutant-type variant, and the EGFR858 mutant-type probe was labeled with a fluorescent dye TAMRA at the 3′ terminal.
  • EGFR858 mutant-type probe SEQ ID NO: 7 (3T-EGFR-858-R2) 5′-ttggcccgcccaaaatc-(TAMRA)-3′
  • FIG. 1 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • (A) is the result for L858WT 100%
  • (B) is the result for L858R 5%
  • (C) is the result for L858R 10%.
  • the horizontal axis shows the temperature (° C.) during measurement
  • the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”.
  • the units are shown as “d fluorescent intensity increase amount/dt” (dF/dt).
  • the Tm value of the L858WT and EGFR858 mutant-type probe is in proximity to 55° C.
  • the Tm value of the L858R and EGFR858 mutant-type probe is in proximity to 64° C.
  • the L858WT Tm value is the only confirmed peak for L858WT 100%.
  • peaks were confirmed at both the Tm value for L858WT and the Tm value for L858R for L858R 10% that includes 10% mutant-type plasmid.
  • peaks were confirmed at both the Tm value for L858WT and the Tm value for L858R for L858R 5% in which the content of the mutant-type plasmid is reduced to 5%.
  • Tm analysis was respectively executed in relation to wild-type artificial nucleic acid and mutant-type artificial nucleic acid to thereby detect the EGFR 858 polymorphism in the EGFR gene.
  • EGFR858 wild-type artificial nucleic acid (EGFR-L858R(WT)-F) and EGFR858 mutant-type artificial nucleic acid (EGFR-L858R(MT)-F) that is homologous to positions 241 to 290 SEQ ID NO: 1 as illustrated in the sequence below were prepared.
  • the underlined portion corresponds to the nucleotide at position 261 SEQ ID NO: 1.
  • the respective artificial nucleic acids were adjusted to 5 ⁇ mol/L and were used as test samples.
  • EGFR-L858R(WT)-F (SEQ ID NO: 32) caagatcacagattttgggctggccaaactgctgggtgcggaagagaaag EGFR-L858R(MT)-F (SEQ ID NO: 33) caagatcacagattttgggcgggccaaactgctgggtgcggaagagaaag
  • Tm analysis was performed in relation to 25 ⁇ L of the reaction solution as illustrated in Table 5 using a fully automatic SNPs detection apparatus (product name: i-densy (trademark) IS-5310 manufactured by Arkray Inc.). Tm analysis was performed by processing at 95° C. for one second and 60 seconds at 40° C. Then, the reaction solution was heated from 40° C. to 75° C. with a rate of temperature increase being 1° C./3 seconds to thereby measure the change in the fluorescence intensity over time at a detection wavelength of 585-700 nm.
  • a fully automatic SNPs detection apparatus product name: i-densy (trademark) IS-5310 manufactured by Arkray Inc.
  • the EGFR858 mutant-type probe is a mutant-type probe in the sense strand of the EGFR858 mutant-type EGFR gene.
  • the underlined nucleotide corresponds to the nucleotide which is complementary to the EGFR858 mutant-type variant.
  • the EGFR858 mutant-type probe was labeled with a fluorescent dye TAMRA at the 3′ terminal.
  • EGFR858 mutant-type probe (SEQ ID NO: 9) (3T-EGFR-858-R1) 5′-cagtttggcc c gccc-(TAMRA)-3′
  • FIG. 2 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • (A) is the result for EGFR-L858R(WT)-F and (B) is the result for EGFR-L858R(MT)-F.
  • the horizontal axis shows the temperature (° C.) during measurement, and the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”).
  • the units are illustrated as “d fluorescent intensity increase amount/dt” (dF/dt).
  • the Tm value of the EGFR-L858R(WT)-F and EGFR858 mutant-type probe is in proximity to 54° C.
  • the Tm value of the EGFR-L858R(MT)-FL and EGFR858 mutant-type probe is in proximity to 66° C.
  • the EGFR-L858R(WT)-F Tm value is the only confirmed peak for EGFR-L858R(WT)-F.
  • the EGFR-L858R(MT)-F Tm value is the only confirmed peak for EGFR-L858R(MT)-F.
  • Tm analysis was performed in relation to wild-type oligonucleotides and mutant-type oligonucleotides to thereby detect the EGFR gene exon19 polymorphism.
  • the detection wavelength of BODIPY FL was 520-555 nm
  • the detection wavelength of TAMRA was 585-700 nm.
  • the wild-type and mutant-type oligonucleotides were prepared using the oligonucleotides 1-18 in Table 6. These oligonucleotides are sequences that are complementary to the sense strand of the EGFR gene.
  • the oligonucleotide 1 is the wild-type oligonucleotide, and is complementary to the partial sequence of the sense strand including the exon19 polymorphism 1.
  • the oligonucleotides 2-18 are the mutant-type oligonucleotides, and are complementary to the partial sequence of the sense strand including the exon19 polymorphisms 2-18.
  • Table 6 shows the corresponding domain in the nucleotide sequence of SEQ ID NO: 2 for each oligonucleotide. The range of the nucleotide sequence continuing from the triangle is the deletion site.
  • Tm analysis was performed in relation to 25 ⁇ L of the reaction solution as illustrated in Table 7 using a fully automatic SNPs detection apparatus (product name: i-densy (trademark) IS-5310 manufactured by Arkray Inc.). Tm analysis was performed by processing at 95° C. for one second and 60 seconds at 40° C. Then, the reaction solution was heated from 40° C. to 75° C. with a rate of temperature increase being 1° C./3 seconds to thereby measure the change in the fluorescence intensity over time at a detection wavelength corresponding to each fluorescent dye. Furthermore, a negative control was prepared by adding 5 ⁇ L of distilled water to 25 ⁇ L of the reaction solution instead of 5 ⁇ L of sample and measuring the change in the fluorescence intensity over time in the same manner.
  • a fully automatic SNPs detection apparatus product name: i-densy (trademark) IS-5310 manufactured by Arkray Inc.
  • the oligonucleotides 1-18 were adjusted to 5 ⁇ mol/L. Samples of the reaction solution were prepared using a sample 1s of the oligonucleotide 1 in isolation and samples 2m-18m in which the oligonucleotide 1 and the oligonucleotides 2-18 are mixed in a volume ratio of 1:4.
  • Probes with the sequences below were used as exon19 probes.
  • the probes have sequences perfectly complementary to the wild-type oligonucleotide 1, and the Tm value of the probe and the wild-type oligonucleotide 1 is in proximity to 74° C.
  • exon19 wild-type probe (SEQ ID NO: 5) (5FL-EGFR-EX19-F2) 5′-(BODIPY FL)-cccgtcgctatcaaggaattaagagaagc-3′
  • FIG. 9 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • (A)-Q) are the results in order for detection of the fluorescent dye in relation to samples 1s, 2m-17m.
  • R shows the results for the negative control.
  • the horizontal axis shows the temperature (° C.) during measurement, and the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”).
  • the units are shown as “d fluorescent intensity increase amount/dt” (dF/dt).
  • Table 8 shows the results of Tm analysis in relation to each sample for peak number, Tm value of each peak and the difference between the Tm value for each peak and the Tm value (74° C. for the wild-type oligonucleotide 1 (4° C.).
  • the sample is including only the wild-type oligonucleotide 1 exhibits a peak only at the Tm value (74° C.) for the wild-type oligonucleotide 1.
  • the samples 2m-17m including the wild-type oligonucleotide 1 and the mutant-type oligonucleotides 2-17 have two respective peaks.
  • the samples 2m-17m have peaks at the Tm value of the wild-type oligonucleotide 1 and the exon19 wild-type probe and also at a lower temperature.
  • the sample 18 that contains the mutant-type oligonucleotide 18 has a peak only at the Tm value (74° C.) for the wild-type oligonucleotide 1, and a peak was not confirmed at any other temperature.
  • the oligonucleotides 1-18 were adjusted to 5 ⁇ mol/L. Samples of the reaction solution were prepared using a sample is of the oligonucleotide 1 in isolation and the samples 2m-18m in which the oligonucleotide 1 and the oligonucleotides 2-18 are mixed in a volume ratio of 1:4.
  • Probes with the sequences below were used as exon19 probe.
  • the probe has a sequence perfectly complementary to the mutant-type oligonucleotide 18, and the Tm value of the probe and the mutant-type oligonucleotide 18 is in proximity to 58° C.
  • exon19 mutant-type (del) probe SEQ ID NO: 6
  • SEQ ID NO: 6 3T-EGFR-EX19-No.18-F1) 5′-agcaacaaaggaaatc-(TAMRA)-3′
  • FIG. 10 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • (A)-(R) are the results in order for detection of the fluorescent dye in relation to samples 1s, 2m-18m.
  • the horizontal axis shows the temperature (° C.) during measurement, and the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”).
  • the units are shown as “d fluorescent intensity increase amount/dt” (dF/dt).
  • Table 9 shows the results of Tm analysis in relation to each sample for peak number, Tm value of each peak and the difference between the Tm value for each peak and the Tm value (58° C.) for the mutant-type oligonucleotide 18 ( ⁇ ° C.).
  • the sample 18m including the mutant-type oligonucleotide 18 has a peak only at the Tm value (58° C.) for the mutant-type oligonucleotide 18.
  • a peak was not confirmed in relation to the sample is that includes only the wild-type oligonucleotide 1.
  • the samples 2m-17m that include oligonucleotides other than the mutant-type oligonucleotide 18 have a peak at a lower temperature than the sample 18m.
  • the oligonucleotides 1-18 were adjusted to 5 ⁇ mol/L. Samples (1s-18s) of the reaction solution were respectively used in isolation.
  • Probes with the sequences below were used as exon19 probes.
  • the probes have sequences complementary to the wild-type oligonucleotide 1 except that the nucleotide at position 119 in SEQ ID NO: 1 is t, and the Tm value of the probe and the wild-type oligonucleotide 1 is in proximity to 67° C.
  • exon19 mutant-type (sub) probe (SEQ ID NO: 4) (5FL-EGFR-EX19No. 19-F2-3) 5′-(BODIPY FL)-cccgtcgctatcaagtaattaagagaagcaaca-3′
  • FIG. 11 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • (A)-(Q) are the results in order for detection of the fluorescent dye in relation to samples 1s-17s.
  • (R) shows the results of the negative control.
  • the horizontal axis shows the temperature (° C.) during measurement, and the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”).
  • the units are shown as “d fluorescent intensity increase amount/dt” (dF/dt).
  • Table 10 shows the results of Tm analysis in relation to each sample for peak number, Tm value of each peak and the difference between the Tm value for each peak and the Tm value (67° C.) for the wild-type oligonucleotide 1 ( ⁇ ° C.).
  • the sample 1s including only the wild-type oligonucleotide 1 has a peak only at the Tm value (67° C.) for the wild-type oligonucleotide 1.
  • the samples 2s-15s and 17s including only the mutant-type oligonucleotides 2-15 and 17 have respective peaks at a temperature that is lower than the Tm value of the wild-type oligonucleotide 1.
  • a peak was not confirmed in relation to the samples 16s and 18s that include only the mutant-type oligonucleotide 16 or 18.
  • the oligonucleotides 1-18 were adjusted to 5 ⁇ mol/L. Samples (1s-18s) of the reaction solution were respectively used in isolation.
  • Probes with the sequences below were used as exon19 probes.
  • the probes have sequences strongly hybridize with the wild-type oligonucleotide 1, and the Tm value of the probe and the wild-type oligonucleotide 1 is in proximity to 72° C.
  • exon19 wild-type probe (SEQ ID NO: 28) (5FL-EGFR-EX19-WT-F1) 5′-(BODIPY FL)-caaggaa t taagagaagcaacatctccg-3′
  • FIG. 12 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • (A)-(R) are the results in order for detection of the fluorescent dye in relation to samples 1s-18s.
  • the horizontal axis shows the temperature (° C.) during measurement
  • the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”).
  • the units are shown as “d fluorescent intensity increase amount/dt” (dF/dt).
  • Table 11 shows the results of Tm analysis show that for each sample in relation to the difference between the Tm value for the largest peak and the Tm value (72° C.) for the wild-type oligonucleotide 1 and the peak Tm value.
  • the peak for sample 1s exhibits a shoulder irrespective of whether including only the wild-type oligonucleotide 1, and it is not possible to discriminate whether it is the wild-type oligonucleotide or the mutant-type oligonucleotide. Furthermore a plurality of peaks is confirmed in relation to the samples 2s-18s including only the mutant-type oligonucleotide 2-18. As illustrated in Table 11, the Tm value for the largest peak of the samples 2s-18s exhibits almost no difference from the Tm value of the wild-type oligonucleotide 1.
  • Tm analysis was performed in the presence of both a wild-type plasmid and a mutant-type plasmid to thereby detect the EGFR gene exon19 polymorphism.
  • a partial sequence of the EGFR gene was prepared using a plasmid including the insertion of the oligonucleotides illustrated in Table 6. More specifically, an exon19 wild-type plasmid (ex19WT) including the insertion of wild-type oligonucleotide 1, an exon19 mutant-type plasmid 2 (ex19mt2) including the insertion of mutant-type oligonucleotide 2, an exon19 mutant-type plasmid 4 (ex19mt4) including the insertion of mutant-type oligonucleotide 4, and an exon19 mutant-type plasmid 6 (ex19mt6) including the insertion of mutant-type oligonucleotide 6 were prepared. The plasmids were mixed using the predetermined ratio shown in Table 12 to thereby prepare four samples. The samples were adjusted so that 250 plasmid copies are present per ⁇ L.
  • Tm analysis was performed in relation to 50 ⁇ L of the PCR reaction solution as illustrated in Table 13 using a fully automatic SNPs detection apparatus (product name: i-densy (trademark) IS-5310 manufactured by Arkray Inc.). PCR and Tm analysis were performed in the same manner as Example 1 with the exception that the detection wavelength was taken to be 520-555 nm and 585-700 nm.
  • the exon19 primer sequence is shown below.
  • the exon19 probe used was the exon19 wild-type probe and the exon19 mutant-type (del) probe as described in Example 3.
  • F primer (SEQ ID NO: 18) (EGFR-EX19-F1) 5′-gatcccagaaggtgagaaag-3′ R primer (SEQ ID NO: 20) (EGFR-EX19-R1) 5′-gaaactcacatcgaggatttc-3′ exon19 wild-type probe (SEQ ID NO: 5) (5FL-EGFR-EX19-F2) 5′-(BODIPY FL)-cccgtcgctatcaaggaattaagagaagc-3′ exon19 mutant-type (del) probe (SEQ ID NO: 6) (3T-EGFR-EX19-No18-F1) 5′-agcaacaaggaaatc-(TAMRA)-3′
  • FIG. 3 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • (A) is the result for ex19WT 100%
  • (B) is the result for ex19mt 2 5%
  • (C) is the result for ex19mt 4 5%
  • (D) is the result for ex19mt 6 5%.
  • the horizontal axis shows the temperature (° C.) during measurement
  • the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”).
  • the units are shown as “d fluorescent intensity increase amount/dt” (dF/dt).
  • the Tm value of the ex19WT and exon19 wild-type probe is in proximity to 68° C.
  • the Tm value of the ex19mt2 is a lower temperature than the Tm value of the ex19WT and the exon19 mutant-type (del) probe, and are respectively 51° C., 59° C., and 60° C.
  • the ex19WT Tm value is the only confirmed peak for ex19WT 100%.
  • FIGS. 3 (B)-(D) peaks at two Tm values were confirmed in the samples that include the wild-type plasmid and the mutant-type plasmid. In other words, as illustrated in FIGS. 3 (B)-(D), peaks were confirmed at both the Tm values for the wild-type ex19WT and the exon19 wild-type probe and at a lower temperature.
  • Tm analysis was performed in the presence of both a wild-type plasmid and a mutant-type plasmid to thereby detect the EGFR gene EGFR858 polymorphism.
  • the detection wavelength of PACIFIC BLUE is 445-480 nm
  • the detection wavelength of BODIPY is 520-555 nm
  • the detection wavelength of TAMRA is 585-700 nm.
  • Example 1 The three samples from Example 1 (L858WT 100%, L858R 5%, and L858R 10%) were prepared. The samples were adjusted so that 250 plasmid copies are present per ⁇ L.
  • PCR and Tm analysis were performed in relation to 50 ⁇ L of PCR reaction solution as illustrated in Table 14 using a fully automatic SNPs detection apparatus (product name: i-densy (trademark) IS-5310 manufactured by Arkray Inc.). PCR repeated 50 cycles after processing at 95° C. for one minute with a single cycle being one second at 95° C. and 30 seconds at 60° C., followed by processing for one second at 95° C. and 60 seconds at 40° C. Then, the reaction solution was heated from 40° C. to 75° C. with a rate of temperature increase being 1° C./3 seconds to thereby perform Tm analysis by measurement of the change in the fluorescence intensity over time at a detection wavelength according to the fluorescent dye used in each probe.
  • the EGFR858 probe was an EGFR858 mutant-type probe (SEQ ID NO: 7) having the same sequence as that in Example 1 and labeled with PACIFIC BLUE in substitution for TAMRA.
  • the exon19 probe was the exon19 wild-type probe (SEQ ID NO: 5) from Example 3.
  • the EGFR790 probes were the probes having the sequences below.
  • the EGFR790 mutant-type probe was a probe strongly hybridizes with the detection sequence in the sense strand of the EGFR790 mutant-type variant in the EGFR gene, and in that sequence, the underlined nucleotide is the nucleotide that is complementary to the EGFR790 mutant-type variant.
  • the EGFR790 mutant-type probe was labeled at the 3′ terminal with the fluorescent dye TAMRA.
  • EGFR858 mutant-type probe (SEQ ID NO: 7) (3PB-EGFR-858-R2) 5′-ttggcc c gcccaaaatc-(PACIFIC BLUE)-3′ exon19 wild-type probe (SEQ ID NO: 5) (5FL-EGFR-EX19-F2) 5′-(BODIPY FL)-cccgtcgctatcaaggaattaagagaagc-3′ EGFR790 mutant-type probe (SEQ ID NO: 23) (3T-EGFR-790M-mt-R3) 5′-tgagctgc a tgatgaggtgcac-(TAMRA)-3′
  • FIG. 4 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • (A) is the result for L858WT 100%
  • (B) is the result for L858R 5%
  • (C) is the result for L858R 10%
  • the horizontal axis shows the temperature (° C.) during measurement
  • the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”).
  • the units are shown as “d fluorescent intensity increase amount/dt” (dF/dt).
  • the Tm value of the L858WT and EGFR858 mutant-type probe is in proximity to 51° C.
  • the Tm value of the L858R and EGFR858 mutant-type probe is in proximity to 61° C.
  • the L858WT Tm value is the only confirmed peak for L858WT 100%.
  • peaks were confirmed at both the Tm value for L858WT and the Tm value for L858R for L858R 10% that includes 10% mutant-type plasmid.
  • peaks were confirmed at both the Tm value for L858WT and the Tm value for L858R for L858R 5% in which the content of the mutant-type plasmid is reduced to 5%.
  • Example 5-1 the following three types of samples were used to execute PCR and Tm analysis in the same manner as Example 5-1 and thereby detect the exon19 polymorphism in the EGFR gene with the exception that the detection wavelength was 525-555 nm.
  • the samples were prepared by mixing the exon19 wild-type plasmid (ex19WT) and the exon19 mutant-type plasmid 6 (ex19mt6) from Example 4 in the predetermined ratio illustrated below. The samples were adjusted so that 250 plasmid copies are present per
  • FIG. 5 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • (A) is the result for ex19WT 100%
  • (B) is the result for ex19mt6 5%
  • (C) is the result for ex19mt6 10%
  • the horizontal axis shows the temperature (° C.) during measurement
  • the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”).
  • the units are shown as “d fluorescent intensity increase amount/dt” (dF/dt).
  • the Tm value of the ex19WT and exon19 wild-type probe is in proximity to 68° C.
  • the Tm value of the ex19mt6 and exon19 wild-type probe is in proximity to 59° C.
  • the ex19WT Tm value is the only confirmed peak for ex19WT 100%.
  • peaks were confirmed at both the Tm value for ex19WT and the Tm value for ex19mt6 for ex19mt6 10% that includes 10% mutant-type plasmid.
  • peaks were confirmed at both the Tm value for ex19WT and the ex19mt6 Tm value for ex19mt6 5% in which the content of the mutant-type plasmid is reduced to 5%.
  • Example 5-1 the following three types of samples were used to execute PCR and Tm analysis in the same manner as Example 5-1 and thereby detect the EGFR790 polymorphism in the EGFR gene with the exception that the detection wavelength was 585-700 nm.
  • the EGFR790 wild-type plasmid (T790WT) and the EGFR790 mutant-type plasmid (T790M) were prepared as the wild-type plasmid and the mutant-type plasmid.
  • the EGFR790 wild-type plasmid (T790WT) includes a partial sequence of the EGFR gene being an insertion of the oligonucleotides from position 197 to position 496 of SEQ ID NO: 21, and the nucleotide (y) at position 347 of SEQ ID NO: 21 is cytosine (c).
  • the EGFR790 mutant-type plasmid includes a partial sequence of the EGFR gene being an insertion of the oligonucleotides from position 197 to position 496 of SEQ ID NO: 21, and the nucleotide (y) at position 347 of SEQ ID NO: 21 is thymin (t).
  • the plasmids were mixed using the predetermined ratio shown below to thereby prepare three samples. The samples were adjusted so that 250 plasmid copies are present per ⁇ L.
  • FIG. 6 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • (A) is the result for T790WT 100%
  • (B) is the result for T790M 5%
  • (C) is the result for T790M 10%
  • the horizontal axis shows the temperature (° C.) during measurement
  • the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”).
  • the units are shown as “d fluorescent intensity increase amount/dt” (dF/dt).
  • the Tm value of the T790WT and EGFR790 mutant-type probe is in proximity to 60° C.
  • the Tm value of the T790M and EGFR790 mutant-type probe is in proximity to 66° C.
  • the T790WT Tm value is the only confirmed peak for T790WT 100%.
  • peaks at both the T790WT Tm value and the T790M Tm value were confirmed in T790M 10% that includes the 10% mutant-type plasmid.
  • peaks were confirmed at both the T790WT Tm value and the T790M Tm value for T790M 5% in which the content of the mutant-type plasmid is reduced to 5%.
  • the EGFR 858 polymorphism in the EGFR gene was detected in the same manner as Example 2 with the exception that the EGFR858 probe was the EGFR858 wild-type probe.
  • the EGFR858 wild-type probe is a probe that strongly hybridizes with the detection sequence in the sense strand of the EGFR858 wild-type variant of the EGFR gene, and in the sequence below, the underlined nucleotide is the nucleotide that is complementary to the EGFR858 wild-type variant.
  • the EGFR858 wild-type probe was labeled at the 5′ terminal with a fluorescent dye PACIFIC BLUE.
  • EGFR858 wild-type probe (SEQ ID NO: 27) (5PB-EGFR858861WT-R1) 5′-(PACIFIC BLUE)-ccagcagtttggcc a gc-3′
  • FIG. 7 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • (A) is the result for EGFR-L858R(WT)-F (SEQ ID NO: 32)
  • (B) is the result for EGFR-L858R(MT)-F (SEQ ID NO: 33)
  • (C) is the result for a sample in which EGFR-L858R(WT)-F (SEQ ID NO: 32) and EGFR-L858R(MT)-F (SEQ ID NO: 33) are mixed in a ratio of 1:1.
  • the horizontal axis shows the temperature (° C.) during measurement, and the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”).
  • the units are shown as “d fluorescent intensity increase amount/dt” (dF/dt).
  • the L858WT 100% only exhibits a peak at 68° C.
  • the L858R 100% only exhibits a peak at 71° C.
  • the difference between the temperatures of both peaks was 3° C., and that difference was small.
  • the mixed sample of EGFR-L858R(WT)-F (SEQ ID NO: 32) and EGFR-L858R(MT)-F (SEQ ID NO: 33) exhibits a temperature of 71° C. which overlaps with the peaks for L858WT and L858R and therefore detection of both peaks was not possible. Since the detection peak of the EGFR858 wild-type variant and the detection peak of the EGFR858 mutant-type variant are proximate, accurate detection is difficult when mixing the wild-type variant and the mutant-type variant.
  • samples were used to detect the EGFR gene exon19 polymorphism in the same manner as Example 3 with the exception that the exon19 wild-type probe was used as the exon 19 probe and the detection wavelength was 520-555 nm.
  • the samples were prepared by adjusting the oligonucleotides 1, 2, 4 and 6 to 5 ⁇ mol/L.
  • a sample 1 was the oligonucleotide 1 used in isolation, and a sample 2, a sample 4 and a sample 6 were prepared by mixing the oligonucleotide 1 with the oligonucleotides 2, 4 or 6 in a volume ratio of 1:5.
  • the exon19 wild-type probe is a probe that strongly hybridizes with the detection sequence in the antisense strand of the exon19 wild-type EGFR gene.
  • the nucleotide that is underlined is the nucleotide that is complementary to the exon19 wild-type variant, and the exon19 wild-type probe was labeled with a fluorescent dye BODIPY FL at the 5′ terminal
  • exon19 wild-type probe (SEQ ID NO: 28) (5FL-EGFR-EX19-WT-F1) 5′-(BODIPY FL)-caaggaa t taagagaagcaacatctccg-3′
  • FIG. 8 is a graph of the Tm analysis showing the change in the fluorescent intensity associated with temperature increase.
  • FIG. 8 shows the results of using the exon19 wild-type probe to obtain the detection results in relation to (A) sample 1, (B) sample 2, (C) sample 4, and (D) sample 6.
  • the horizontal axis shows the temperature (° C.) during measurement, and the vertical axis shows the change in the fluorescent intensity (hereinafter referred to as “fluorescent change amount”).
  • the units are shown as “d fluorescent intensity increase amount/dt” (dF/dt).
  • the Tm value of oligonucleotide 1 and the exon19 wild-type probe is proximate to 71° C.
  • the Tm value of oligonucleotide 2 and the exon19 wild-type probe is proximate to 71° C.
  • the Tm value of oligonucleotide 4 and the exon19 wild-type probe is proximate to 49° C.
  • the Tm value of oligonucleotide 6 and the exon19 wild-type probe is proximate to 71° C.
  • the Tm value for oligonucleotide 1 is the only confirmed peak for sample 1 which only contains wild-type oligonucleotide 1.
  • sample 4 which contains wild-type oligonucleotide 1 and mutant-type oligonucleotide 4 includes peaks that were confirmed at both the Tm value for wild-type oligonucleotide 1 and the Tm value for mutant-type oligonucleotide 4.
  • samples 2 and 6 that contain wild-type oligonucleotide 1 and mutant-type oligonucleotide 2 or 6 includes peaks that were confirmed at both the Tm value for wild-type oligonucleotide 1, a peak was not confirmed in relation to the Tm value for the respective mutant-type oligonucleotides.
  • An EGFR858 polymorphism in an EGFR gene was detected in the same manner as Example 2 with the exception that Tm analysis was respectively executed in relation to the wild-type artificial nucleic acid and mutant-type artificial nucleic acid below using the probes illustrated in Table 17.
  • the probes of SEQ ID NOs: 71 and 87 are probes that do not correspond to the probe of the present invention.
  • EGFR858 wild-type artificial nucleic acid SEQ ID NO: 67: EGFR-L858R (WT)-F90
  • EGFR858 mutant-type artificial nucleic acid SEQ ID NO: 68: EGFR-L858R (MT)-F90
  • the respective artificial nucleic acids were adjusted to 5 ⁇ mol/L and were used as a 858 wild-type sample and a 858 mutant-type sample.
  • EGFR-L858R(WT)-F90 actggtgaaaacaccgcagcatgtcaagatcacagattttgggctggccaaactgctgggtgcggaagagaaagaataccatgcagaag g EGFR-L858R(MT)-F90 (SEQ ID NO: 68) actggtgaaaacaccgcagcatgtcaagatcacagattttgggcgggccaaactgctgggtgcggaagagaaagaataccatgcagaa gg
  • the Tm value of a double-stranded nucleic acid composed of each of the probes and the wild-type sample and the Tm value of a double-stranded nucleic acid composed of each of the probes and the mutant-type sample were measured, and then the difference ( ⁇ Tm) therebetween was calculated. Then, on the basis of the calculated value, it was evaluated whether or not each probe can be judged as a wild-type or a mutant-type. The results are illustrated in Table 17.
  • ⁇ Tm is at least 3° C. and judgment of whether a polymorphism is a wild-type or a mutant-type can be performed effectively.
  • x: ⁇ Tm is less than 3° C. and judgment of whether a polymorphism is a wild-type or a mutant-type cannot be performed effectively.
  • each of the probes of Examples showed one peak in relation to both the wild-type sample and the mutant-type sample and showed the Tm value with the mutant-type sample at least 3° C. higher than the Tm value with the wild-type sample ( ⁇ Tm ⁇ 3° C.).
  • each of the probes of Comparative Examples showed one peak in relation to both the wild-type sample and the mutant-type sample but ⁇ Tm was less than 3° C. From these, it was found out that, even in the common presence of the wild-type detection sequence and the mutant-type detection sequence, use of the probes of Examples enables effective judgment of the wild-type and the mutant-type.
  • an EGFR858 polymorphism in an EGFR gene was detected in the same manner as Example 2 with the exception that Tm analysis was respectively executed in relation to the wild-type artificial nucleic acid and mutant-type artificial nucleic acid below using the probes illustrated in Table 18.
  • the probe of SEQ ID NO: 93 is a probe that does not correspond to the probe of the present invention.
  • EGFR858 wild-type artificial nucleic acid SEQ ID NO: 69: EGFR-L858R (WT)-R90
  • EGFR858 mutant-type artificial nucleic acid SEQ ID NO: 70: EGFR-L858R (MT)-R90
  • the underlined nucleotides correspond to the nucleotide at position 261 SEQ ID NO: 1.
  • the respective artificial nucleic acids were adjusted to 5 ⁇ mol/L and were used as a EGFR 858 wild-type sample and a EGFR 858 mutant-type sample.
  • EGFR-L858R(WT)-R90 (SEQ ID NO: 69) ccttctgcatggtattctttctcttccgcacccagcagtttggccagcccaaaatctgtgatcttgacatgctgcggtgttttcaccagt EGFR-L858R(MT)-R90 (SEQ ID NO: 70) ccttctgcatggtattctttctctccgcacccagcagtttggcccgcccaaaatctgtgatcttgacatgctgcggtgttttcaccagt
  • Tm value of a double-stranded nucleic acid composed of each of the probes and the wild-type sample and the Tm value of a double-stranded nucleic acid composed of each of the probes and the mutant-type sample were measured.
  • Each probe was evaluated in the same manner as Example 6. The results are illustrated in Table 18.
  • each of the probes of Examples showed one peak in relation to both the wild-type sample and the mutant-type sample and showed the Tm value with the mutant-type sample at least 3° C. higher than the Tm value with the wild-type sample ( ⁇ Tm ⁇ 3° C.).
  • the probe of Comparative Example showed one peak in relation to both the wild-type sample and the mutant-type sample but ⁇ Tm was less than 3° C. From these, it was found out that, even in the common presence of the wild-type detection sequence and the mutant-type detection sequence, use of the probes of Examples enables effective judgment of the wild-type and the mutant-type.
  • Examples 1 to 7 and Comparative Examples 1 to 3 demonstrate that use of the F primer, the R primer and the probe according to each of the examples enables detection of the EGFR858 polymorphism, the exon19 polymorphism and the EGFR790 polymorphism in the EGFR gene by discrimination of the wild-type variant and the mutant-type variant for example even when wild-type variant and the mutant-type variant are mixed.
  • the method of detection of a polymorphism according to the present invention enables simple and highly reliable discrimination of a polymorphism in an EGFR gene for example by using of a probe for detection of a polymorphism according to the present invention. More specifically, even when the target polymorphism in a sample coexists in a wild-type EGFR gene and a mutant-type EGFR gene, simple and highly reliable detection is possible of the wild-type and mutant-type polymorphism. Furthermore, the primer according to the present invention for example enables specific amplification of the domain containing the EGFR gene polymorphism.
  • the present invention enables the simple and highly reliable amplification and discrimination of the EGFR gene polymorphism, the detection results can be reflected in a selection of a therapeutic regime for disease and the present invention exhibits extreme utility in the field of medical care, or the like. Furthermore, the present invention enables application to the detection of a polymorphism in an EGFR gene in diverse areas including biochemistry in addition to medical fields.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
US13/285,883 2010-10-29 2011-10-31 Probe for Detection of Polymorphism in EGFR Gene, Amplification Primer, and Use Thereof Abandoned US20120107817A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/165,530 US9359647B2 (en) 2010-10-29 2014-01-27 Probe for detection of polymorphism in EGFR gene, amplification primer, and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2010244643 2010-10-29
JP2010-244643 2010-10-29

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/165,530 Division US9359647B2 (en) 2010-10-29 2014-01-27 Probe for detection of polymorphism in EGFR gene, amplification primer, and use thereof

Publications (1)

Publication Number Publication Date
US20120107817A1 true US20120107817A1 (en) 2012-05-03

Family

ID=44862766

Family Applications (2)

Application Number Title Priority Date Filing Date
US13/285,883 Abandoned US20120107817A1 (en) 2010-10-29 2011-10-31 Probe for Detection of Polymorphism in EGFR Gene, Amplification Primer, and Use Thereof
US14/165,530 Active US9359647B2 (en) 2010-10-29 2014-01-27 Probe for detection of polymorphism in EGFR gene, amplification primer, and use thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
US14/165,530 Active US9359647B2 (en) 2010-10-29 2014-01-27 Probe for detection of polymorphism in EGFR gene, amplification primer, and use thereof

Country Status (5)

Country Link
US (2) US20120107817A1 (zh)
EP (2) EP3219814B1 (zh)
JP (2) JP5859274B2 (zh)
KR (2) KR101536318B1 (zh)
CN (2) CN105331733B (zh)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130029861A1 (en) * 2011-05-31 2013-01-31 Arkray, Inc. Method for Detecting a Plurality of Nucleotide Polymorphisms at a Single Wavelength Using a Plurality of Oligonucleotides Modified With Fluorescent Dye Having the Same or Close Detection Wavelength
US20190127785A1 (en) * 2013-10-30 2019-05-02 Mast Group Limited Nucleic acid probe with single fluorophore label bound to internal cytosine for use in loop mediated isothermal amplification
US11434533B2 (en) * 2016-02-09 2022-09-06 Eiken Kagaku Kabushiki Kaisha Method for detecting target nucleic acid and nucleic acid probe used therein

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140341884A1 (en) * 2012-12-04 2014-11-20 Roche Molecular Systems, Inc. Novel Complex Mutations in the Epidermal Growth Factor Receptor Kinase Domain
JP2018088883A (ja) * 2016-12-06 2018-06-14 東洋紡株式会社 上皮成長因子受容体遺伝子変異の検出方法
CN106755400A (zh) * 2016-12-21 2017-05-31 上海浦美生物医药科技有限公司 一种血液egfr基因t790m突变的检测方法
WO2018212247A1 (ja) * 2017-05-16 2018-11-22 公立大学法人和歌山県立医科大学 Egfr変異非小細胞肺がんにおけるegfrチロシンキナーゼ阻害剤の治療奏功性の予測方法
CN109295055B (zh) * 2017-07-25 2024-02-06 广州普世利华科技有限公司 基于C2c2的肿瘤相关突变基因的gRNA、检测方法、检测试剂盒
EP3587595A1 (en) * 2018-06-21 2020-01-01 Diadx Methods and kits for detecting egfr mutations
WO2020145754A1 (ko) * 2019-01-11 2020-07-16 주식회사 진캐스트 유전자 변이 특이성이 증가된 dna 중합효소를 이용한 질량분석법
KR102310819B1 (ko) * 2019-01-11 2021-10-12 주식회사 진캐스트 Tert 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트
KR102370550B1 (ko) * 2019-01-11 2022-03-08 주식회사 진캐스트 Egfr 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트
CN110904234A (zh) * 2019-12-19 2020-03-24 苏州绘真医学检验有限公司 基于ddPCR及EGFR热点突变检测人循环肿瘤细胞的引物组、探针组、试剂盒及用途

Family Cites Families (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4889818A (en) 1986-08-22 1989-12-26 Cetus Corporation Purified thermostable enzyme
US5079352A (en) 1986-08-22 1992-01-07 Cetus Corporation Purified thermostable enzyme
ATE169337T1 (de) 1989-12-22 1998-08-15 Hoffmann La Roche Rekombinante expressionsvektoren und reinigungsverfahren für dns-polymerase aus thermus thermophilus
US5322785A (en) 1990-04-26 1994-06-21 New England Biolabs, Inc. Purified thermostable DNA polymerase obtainable from thermococcus litoralis
WO1992009689A1 (en) 1990-12-03 1992-06-11 Stratagene PURIFIED THERMOSTABLE $i(PYROCOCCUS FURIOSUS)
WO2001042486A1 (en) * 1999-12-08 2001-06-14 Smithkline Beecham Corporation Axor12
JP4454249B2 (ja) * 2003-04-18 2010-04-21 アークレイ株式会社 膵ラ氏島アミロイドタンパク質変異遺伝子の検出法ならびにそのための核酸プローブおよびキット
JP2005229834A (ja) * 2004-02-17 2005-09-02 Shionogi & Co Ltd 糸球体を用いたスクリーニング方法
JP2005270053A (ja) * 2004-03-26 2005-10-06 Pharmaceuticals & Medical Devices Agency Urat1遺伝子上の多型を利用した低尿酸レベルに起因する疾患の検査方法、および創薬のための用途
GB2424886A (en) 2005-04-04 2006-10-11 Dxs Ltd Polynucleotide primers against epidermal growth factor receptor and method of detecting gene mutations
CN1749417A (zh) * 2005-07-27 2006-03-22 上海奇诺肿瘤生物高新技术有限公司 上皮生长因子受体外显子19缺失变异的实时定量pcr检测试剂盒和方法
ZA200802854B (en) * 2005-10-05 2009-06-24 Astrazeneca Ltd Method to predict or monitor the response of a patient to an ErbB receptor drug
US8598333B2 (en) * 2006-05-26 2013-12-03 Alnylam Pharmaceuticals, Inc. SiRNA silencing of genes expressed in cancer
EP1881079A1 (en) 2006-07-20 2008-01-23 Pangaea Biotech, S.A. Method for the detection of EGFR mutations in blood samples
US20100068713A1 (en) * 2007-07-13 2010-03-18 Arkray, Inc. Probe for detecting mutation in jak2 gene and use thereof
US20110123553A1 (en) * 2007-11-08 2011-05-26 Biogen Idec Ma Inc. Use of LINGO-4 Antagonists in the Treatment of Conditions Involving Demyelination
CN101565742B (zh) * 2008-04-25 2011-09-21 中山大学达安基因股份有限公司 引物特异荧光pcr检测egfr突变的试剂盒
CN101586151A (zh) * 2008-05-21 2009-11-25 北京华安佛医药研究中心有限公司 预测表皮生长因子受体抑制剂疗效的试剂盒
CN101586154A (zh) * 2008-05-21 2009-11-25 北京华安佛医药研究中心有限公司 预测表皮生长因子受体抑制剂疗效的试剂盒
CN101586153A (zh) * 2008-05-21 2009-11-25 北京华安佛医药研究中心有限公司 预测表皮生长因子受体抑制剂疗效的试剂盒
CN101586152A (zh) * 2008-05-21 2009-11-25 北京华安佛医药研究中心有限公司 预测表皮生长因子受体抑制剂疗效的试剂盒
CN102076849A (zh) * 2008-12-16 2011-05-25 爱科来株式会社 核酸扩增的对照的检测方法及其用途

Non-Patent Citations (15)

* Cited by examiner, † Cited by third party
Title
Buck et al. (1999) Design Strategies and Performance of Custom DNA Sequencing Primers. Biotechniques, 27(3): 528-536 *
Caplin et al. (1999) LightCycler(TM) Hybridization Probes. Biochemica, 1:5-8 *
Crockett et al. (2001) Fluorescein-Labeled Oligonucleotides for Real-Time PCR: Using the Inherent Quenching of Deoxyguanosine Nucleotides. Analytical Biochemistry, 290:89-97. *
dbSNP Cluster Report for rs121434568 (obtained from <http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?searchType=adhoc_search&type=rs&rs=rs121434568> on September 10, 2013, 3 pages) *
Eun et al. (2000) Simultaneous quantitation of two orchid viruses by the TaqMan real-time RT-PCR. Journal of Virological Methods, 87:151-160. *
GenBank record NM_005228.3 GI:41327737, Homo sapiens epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) (EGFR), transcript variant 1, mRNA. 29 Sep 2009. Accessed from: http://www.ncbi.nlm.nih.gov/nuccore/41327737?sat=13&satkey=5013309 on 11/21/2012. Seven pages. *
Harvey et al. "Southern Blotting as a Diagnostic Method" in: Walker et al., Medical Biomethods Handbook (New Jersey, Humana Press, 2005), pages 35-42 *
Hill, Marian "Conformation-Sensitive Gel Electrophoresis" in: Walker et al., Medical Biomethods Handbook, New Jersey, Humana Press, 2005, pages 147-153 *
Hoshi et al. (2007) Rapid Detection of Epidermal Growth Factor ReceptorMutations in Lung Cancer by the SMart-Amplification Process. Clinical Cancer Research, 13(17):4974-4983. *
Marchetti et al. (2005) EGFR Mutations in Non-Small-Cell Lung Cancer: Analysis of a Large Series of Cases and Development of a Rapid and Sensitive Method for Diagnostic Screening With Potential Implications on Pharmacologic Treatment. Journal of Clinical Oncology, 23(4):857-865 *
Nelson et al. "Lehninger Principles of Biochemistry, 4th ed". New York:W. H. Freeman and Company, 2005, pages 297-298 *
Rozen et al. (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-389 *
Taylor et al. (2009) Mutation scanning using high-resolution melting. Biochem. Soc. Trans. 37:433-437, published April 2009 *
Willmore-Payne et al. (2008) The Use of EGFR Exon 19 and 21 Unlabeled DNA Probes to Screen for Activating Mutations in Non-Small Cell Lung Cancer. Journal of Biomolecular Techniques, 19:217-224 *
Yatabe et al. (2006) A Rapid, Sensitive Assay to Detect EGFR Mutation in Small Biopsy Specimens from Lung Cancer. Journal of Molecular Diagnostics, 8(3):335-341. *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130029861A1 (en) * 2011-05-31 2013-01-31 Arkray, Inc. Method for Detecting a Plurality of Nucleotide Polymorphisms at a Single Wavelength Using a Plurality of Oligonucleotides Modified With Fluorescent Dye Having the Same or Close Detection Wavelength
US20190127785A1 (en) * 2013-10-30 2019-05-02 Mast Group Limited Nucleic acid probe with single fluorophore label bound to internal cytosine for use in loop mediated isothermal amplification
US11111523B2 (en) * 2013-10-30 2021-09-07 Mast Group Limited Nucleic acid probe with single fluorophore label bound to internal cytosine for use in loop mediated isothermal amplification
US11434533B2 (en) * 2016-02-09 2022-09-06 Eiken Kagaku Kabushiki Kaisha Method for detecting target nucleic acid and nucleic acid probe used therein

Also Published As

Publication number Publication date
EP2447378A1 (en) 2012-05-02
CN105331733A (zh) 2016-02-17
JP2012105646A (ja) 2012-06-07
US20140170657A1 (en) 2014-06-19
KR20130075757A (ko) 2013-07-05
KR101536318B1 (ko) 2015-07-13
KR20120046068A (ko) 2012-05-09
EP3219814B1 (en) 2023-02-15
JP2016073304A (ja) 2016-05-12
JP6095137B2 (ja) 2017-03-15
EP2447378B1 (en) 2017-06-21
CN105331733B (zh) 2019-10-25
EP3219814A1 (en) 2017-09-20
JP5859274B2 (ja) 2016-02-10
US9359647B2 (en) 2016-06-07
KR101364223B1 (ko) 2014-02-14
CN102559866A (zh) 2012-07-11
CN102559866B (zh) 2017-03-01

Similar Documents

Publication Publication Date Title
US9359647B2 (en) Probe for detection of polymorphism in EGFR gene, amplification primer, and use thereof
JP5637850B2 (ja) 標的核酸配列の増幅方法、それを用いた変異の検出方法、および、それに用いる試薬
JP5224526B2 (ja) 遺伝子増幅用プライマーセット、それを含む遺伝子増幅用試薬およびその用途
JP5917144B2 (ja) 疾患関連遺伝子の多型検出用プローブおよびその用途
EP2025764A1 (en) Probe for detection of mutation in abl gene and use thereof
KR101649179B1 (ko) 표적 서열의 증폭 방법, 다형 검출 방법 및 그것에 사용하는 시약
KR101119417B1 (ko) 비만 유전자 증폭용 프라이머 세트, 그것을 포함하는 비만 유전자 증폭용 시약 및 그 용도
WO2011077990A1 (ja) c-kit遺伝子の多型検出用プローブおよびその用途
JP5635496B2 (ja) Egfr遺伝子多型検出用プローブおよびその用途
US9169518B2 (en) Primer set for detecting EGFR exon 21 polymorphism and application thereof
KR102543156B1 (ko) 높은 특이도의 표적핵산 증폭방법 및 이를 이용한 표적핵산 증폭용 조성물
JP2017163889A (ja) K−ras遺伝子増幅用フォワードプライマーセット、K−ras遺伝子増幅用キット、K−ras遺伝子増幅方法、多型解析方法、及び薬効判定方法

Legal Events

Date Code Title Description
AS Assignment

Owner name: ARKRAY, INC.,, JAPAN

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:IGUCHI, AKI;IJUIN, MOEKO;REEL/FRAME:027152/0684

Effective date: 20111028

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION