US20060099178A1 - Novel use of adenoviruses and nucleic acids coding therefor - Google Patents

Novel use of adenoviruses and nucleic acids coding therefor Download PDF

Info

Publication number
US20060099178A1
US20060099178A1 US10/515,238 US51523805A US2006099178A1 US 20060099178 A1 US20060099178 A1 US 20060099178A1 US 51523805 A US51523805 A US 51523805A US 2006099178 A1 US2006099178 A1 US 2006099178A1
Authority
US
United States
Prior art keywords
canceled
virus
cells
nucleus
replication
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/515,238
Other languages
English (en)
Inventor
Per Holm
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE2002123534 external-priority patent/DE10223534A1/de
Application filed by Individual filed Critical Individual
Publication of US20060099178A1 publication Critical patent/US20060099178A1/en
Priority to US12/769,435 priority Critical patent/US10155930B2/en
Priority to US15/452,470 priority patent/US10538744B2/en
Priority to US16/176,461 priority patent/US10731136B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C12N15/861—Adenoviral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A61K35/761—Adenovirus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A61K35/763—Herpes virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10332—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES

Definitions

  • the present invention relates to the use of adenoviruses as well as to nucleic acids coding therefor and recombinant viral oncoprotein.
  • a number of therapeutic concepts are currently used in the treatment of tumors. Apart from using surgery, chemotherapy and radiotherapy are predominant. All these techniques are, however, associated with considerable side effects.
  • the use of replication selective oncolytic viruses provides for a new platform for the treatment of tumors.
  • a selective intratumor replication of a viral agent is initiated which results in virus replication, lysis of the infected tumor cell and spreading of the virus to adjacent tumor cells.
  • virus replication capabilities of the virus is limited to tumor cells, normal tissue is spared from replication and thus from lysis by the virus.
  • Onyx-015 is an adenovirus having a completely deleted E1B-55kDa gene.
  • the complete deletion of the E1B55kDa protein of the adenovirus is based on the discovery that replication and thus lysis of cells is possible with an adenoviral vector having a p53 deficiency (Kim, D. et al., Proc. Am. Soc. Clin. Oncol.
  • the E1B-55kDa gene product is involved in the inhibition of p53, the transport of viral mRNA and the switching off the protein synthesis of the host cell.
  • the inhibition of p53 occurs via formation of a complex consisting of p53 and the adenoviral coded E1B-55kDa protein and/or a complex consisting of E1B-55kDa and E4orf6.
  • p53, coded by TP53 is the starting point for a complex regulatory mechanism (Zambetti, G. P. et al., FASEB J.
  • the gene TP 53 is deleted or mutated in about 50% of all human tumors which results in the absence of—desired—apoptosis due to chemotherapy or radiation therapy resulting in an usually unsuccessful tumor treatment.
  • a further concept of tumorlytic adenoviruses is based on the discovery that if the E1A protein is present in a specific deleted form or comprises one or several mutations, which do not affect the binding of Rb/E2F and/or p107/E2F and/or p130/E2F, such adenovirus will not induce the entry of the infected cells into the S phase and will be capable of replicating in tumor cells which do not have a functional Rb protein.
  • the E1A protein can be deleted at the N-terminus and comprise one or several mutations in the region of amino acid positions 1 to 76 of the E1A proteins, respectively, in order to inhibit the binding of E1A to p300 and thus to provide for a selective replication in tumor cells.
  • adenoviral systems for oncolysis known in the prior art thus comprise distinct deletions in the E1A protein, whereby such deletions had been made under the assumption that a functional Rb protein and complexes consisting of inactive Rb protein and E2F, respectively, would block an efficient in vivo replication and in order to provide an adenoviral replication in vivo in Rb-negative/mutated cells only.
  • These adenoviral systems according to the prior art are based on E1A in order to control in vivo replication using the early E2 promoter (engl. E2 early promoter) and free E2F (Dyson, N. Genes & Development, 12, 2245-2262, 1998).
  • a further form of tumorlytic adenoviral systems is based on the use of selective promoters for specifically expressing the viral oncogene E1A which provides for a selective replication in tumor cells (Rodriguez, R. et al., Cancer Res. 57, 2559-2563, 1997).
  • the selection of a cellular background which is appropriate for the respective concept underlying the mode of action is important for the various concepts of adenoviral tumorlytic viruses.
  • the various adenoviral systems currently known may only be used if distinct molecular biological prerequisites are realized. This limits the use of such systems to distinct patient groups.
  • MDR multidrug resistance
  • the problem underlying the present invention is to provide a technical teaching and in particular a means which allows to treat an organism, more particularly a human organism and a group of patients, respectively, specifically with tumorlytically active agents. It is a further problem underlying the present invention to provide a means which is suitable to cause tumorlysis in patients having tumor diseases which are resistant to cytostatics, particularly those which have a multidrug resistance.
  • the problem is solved in a first aspect by the use of a virus, preferably an adenovirus, for the manufacture of a medicament, whereby the virus is replication deficient in cells which do not have YB-1 in the nucleus, and the virus codes for an oncogene or oncogene product, preferably an oncogene protein, which transactivates at least one viral gene in YB-1 nucleus positive cells, preferably an adenoviral gene, whereby the gene is selected from the group comprising E1B55kDa, E4orf6, E4orf3 and E3ADP.
  • a virus preferably an adenovirus
  • the problem is solved by the use of a virus, preferably an adenovirus, for the replication in cells which have YB-1 in the nucleus, whereby the virus is replication deficient in cells which do not have YB-1 in the nucleus and the virus codes for an oncogene or oncogene product, in particular oncogene protein, which transactivates at least one viral gene, preferably an adenoviral gene, whereby the gene is selected from the group comprising E1B55kDa, E4orf6, E4orf3 and E3ADP.
  • a virus preferably an adenovirus
  • the virus preferably the adenovirus, replicates in cells which have YB-1 in the nucleus.
  • the viral oncogene protein is E1A and/or the oncogene is the gene coding for E1A and/or the oncogene protein is E1A.
  • the viral oncogene protein E1A is capable of binding to a functional Rb tumor suppressor gene product.
  • the viral oncogene protein E1A is not capable of binding to a functional Rb tumor suppressor gene product.
  • the viral oncogene protein E1A is not inducing nuclear localisation of YB-1.
  • the medicament is for patients the cells of whom are either Rb-positive or Rb-negative.
  • the cells are those cells which are involved in the formation of the condition which is to be influenced by the medicament.
  • the cells are Rb-negative and are YB-1 positive in the nucleus, preferably are YB-1 positive in the nucleus independent from the cell cycle.
  • the medicament is for the treatment of tumors.
  • the cells are resistant to drugs, in particular have a multidrug resistance, preferably a resistance against anti-tumor agents and more preferably against cytostatics.
  • the cells are expressing, preferably overexpressing the membrane-bound transport protein P-glycoprotein and/or MRP.
  • the cells are p53-positive or p53-negative.
  • the oncogene protein has, compared to the wildtype oncogene protein E1A, one or several mutations or deletions, whereby the deletion is preferably selected from the group comprising deletions of the CR3 region and deletions of the N-terminus and deletions of the C-terminus.
  • the E1A oncogene protein can bind to Rb.
  • the oncogene protein has, compared to the wildtype oncogene protein, one or several mutations or deletions, whereby the deletion is preferably in the CR1 region and/or the CR2 region. It is within the invention that the oncogene protein E1A is incapable of binding to Rb.
  • the viral oncogene protein in particular E1A, is under the control of a tissue-specific and/or tumor-specific promoter.
  • the virus in particular the adenovirus, codes for YB-1.
  • YB-1 is under the control of a tissue-specific and/or tumor-specific promoter.
  • the virus in particular the adenovirus, codes at least for one protein which is selected from the group comprising E4orf6, E4orf3, E1B55K and adenoviral E3ADP protein.
  • the cells have YB-1 in the nucleus, in particular the cells forming the tumor or part thereof have YB-1 in the nucleus.
  • the tumor has YB-1 in the nucleus upon inducing the transport of YB-1 into the nucleus.
  • the transport of YB-1 into the nucleus is triggered through at least one measure selected from the group comprising radiation, administration of cytostatics and hyperthermia.
  • the measure is applied to a cell, an organ or an organism.
  • the virus in particular the adenovirus, is selected from the group comprising Ad ⁇ 24, dl922-947, E1Ad/01/07, dll 119/1131, CB 016, dl520 and viruses which are lacking an expressed viral E1A oncogene which is capable of binding a functional Rb tumor suppressor gene product.
  • a virus preferably an adenovirus
  • the virus preferably the adenovirus
  • the virus is designed such that the replication is controlled through or by means of YB-1 through the activation of the E2-late promoter, preferably predominantly through the activation of the E2-late promoter.
  • YB-1 is either a transgenic YB-1 or a cellular, in particular cellular deregulated YB-1.
  • a transgenic YB-1 is preferably meant to be a YB-1 which is expressed in a cell by a vector, preferably a or the adenovirus.
  • the E2-late promoter is preferably the adenoviral E2-late promoter as present in the wildtype adenovirus, or an E2-late promoter as described herein in connection with the expression of transgenes.
  • a virus and particular an adenovirus for the replication in cells which have YB-1 in the nucleus, whereby the virus, in particular the adenovirus, is designed such that the replication is controlled by YB-1 through the activation of the E2-late promoter, preferably predominantly through the activation of the E2-late promoter.
  • YB-1 is either a transgenic YB-1 or a cellular, in particular cellular deregulated YB-1.
  • a transgenic YB-1 as used herein is preferably a YB-1 which is expressed in a cell by a vector, preferably a or the adenovirus.
  • the E2-late promoter is preferably the adenoviral E2-late promoter as present in the wildtype adenovirus, or an E2-late promoter as described herein in connection with the use of the expression of transgenes.
  • the adenovirus is designed such as disclosed herein, particularly such as it is designed in order to be used in accordance with the present invention.
  • a viral oncogene protein in particular an isolated viral oncogene protein which has the following characteristics:
  • YB-1 nucleus-positive cells which is selected from the group comprising E1B-55K, E3ADP and E4orf6 and E4orf3;
  • the viral oncoprotein is E1A.
  • the viral oncogene protein has, compared to the wildtype oncogene protein, one or several mutations or deletions, whereby the deletion is preferably selected from the group comprising deletion of the CR3 region, deletion of the N-terminus and deletion of the C-terminus.
  • the induction of YB-1 through the viral oncogene protein is absent when E4orf6 and/or E1B 55 kD are not present in the nucleus exhibiting cell.
  • the viral oncogene protein is capable of binding to Rb.
  • the viral oncogene protein comprises one or several mutations or deletions, whereby the deletion is preferably in the CR1 region and/or the CR2 region of the E1A oncogene protein. In connection therewith it is intended that the viral oncogene protein is not able to bind to Rb.
  • the invention is related to the use of a viral replication system, preferably an adenoviral replication system, comprising a nucleic acid which codes for a virus, in particular an adenovirus as used in accordance with the present invention, and comprising one nucleic acid of a helper virus, whereby the nucleic acid of the helper virus comprises a nucleic acid which codes for YB-1.
  • a viral replication system preferably an adenoviral replication system, comprising a nucleic acid which codes for a virus, in particular an adenovirus as used in accordance with the present invention, and comprising one nucleic acid of a helper virus, whereby the nucleic acid of the helper virus comprises a nucleic acid which codes for YB-1.
  • the viral nucleic acid in particular the adenoviral nucleic acid, and/or the nucleic acid of the helper virus are present as a vector which can replicate.
  • the invention is related to the use of a nucleic acid coding for a virus, in particular an adenovirus, as it is used in accordance with the invention, for the manufacture of a medicament, in particular for the manufacture of a medicament for the treatment of tumors.
  • the cells in particular the cells forming the tumor or parts thereof, are resistant, in particular have a multidrug resistance, against drugs, preferably anti-tumor agents, and more preferably cytostatics.
  • the invention is related to the use of a nucleic acid which codes for a virus, in particular an adenovirus, as is used in accordance with the present invention, for the replication in cells which have YB-1 in the nucleus, whereby the virus is replication deficient in cells which do not have YB-1 in the nucleus, and the virus codes for an oncogene or oncogene product which transactivates at least one viral gene, preferably an adenoviral gene, in YB-1 nucleus-positive cells, whereby the gene is selected from the group comprising E1B55kDa, E4orf6, E4orf3 and E3ADP.
  • a nucleic acid which codes for a virus, preferably an adenovirus, as is used in accordance with the invention, for the manufacture of a medicament, whereby the virus is designed such that the replication is controlled by YB-1 through the activation of the E2-late promoters, preferably predominantly through the activation of the E2-late promoter.
  • the YB-1 is either a transgenic YB-1 or a cellular, in particular cellular deregulated YB-1.
  • a transgenic YB-1 as used herein is preferably a YB-1 which is expressed in a cell by a vector, preferably a or the adenovirus.
  • the E2-late promoter is preferably the adenoviral E2-late promoter as is present in the wildtype adenovirus, or an E2-late promoter as described herein in connection with the use of the expression of transgenes.
  • the problem is solved by the use of a nucleic acid which codes for a virus, in particular an adenovirus, as used in accordance with the invention for replication in cells, whereby the virus is designed such that the replication is controlled by YB-1 through the activation of the E2-late promoter, preferably predominantly through the activation of the E2-late promoter.
  • the YB-1 is either a transgenic YB-1 or a cellular, in particular cellular deregulated YB-1.
  • transgenic YB-1 is preferably a YB-1 which is expressed by a vector in a cell, preferably by a or the adenovirus.
  • the E2-late promoter is preferably the adenoviral E2-late promoter as present in wildtype adenovirus, or an E2-late promoter as used in connection with the expression of transgenes described herein.
  • the problem is solved by the use of a vector comprising one of the previously described nucleic acids, for the use in accordance with the first or second aspect of the present invention.
  • the invention is related to the use of an agent interacting with YB-1 for the characterisation of cells, cells of a tumor tissue or patients, in order to determine whether these shall be contacted and/or treated with a virus, in particular an adenovirus, which is used in accordance with the invention.
  • the agent is selected from the group comprising antibodies, anticalines, aptamers, aptazymes and aptazymers.
  • the problem is solved by the use of the viral oncogene protein according to the present invention or a nucleic acid coding therefor, for the manufacture of a virus, in particular an adenovirus, which is used in accordance with the first and second aspect of the present invention.
  • the virus comprises a nucleic acid coding for a transgene.
  • the virus comprises the translation product and/or the transcription product of a transgene.
  • nucleic acid of the adenoviral replication system and/or the nucleic acid of the helper virus comprises a transgene or a nucleic acid coding for a transgene.
  • the nucleic acid comprises a transgene or a nucleic acid coding for a transgene.
  • the transgene is selected from the group comprising prodrug genes, cytokines, apoptosis-inducing genes, tumor suppressor genes, genes for metalloproteinases inhibitors and genes for angiogenesis inhibitors.
  • the transgene is selected from the group comprising nucleic acids for siRNA, for aptamers, for antisense molecules and for ribozymes, whereby the siRNA, the aptamers, the antisense molecules and/or the ribozymes are targeted against a target molecule.
  • the target molecule is selected from the group comprising resistance relevant factors, anti-apoptosis factors, oncogenes, angiogenesis factors, DNA synthesis enzymes, DNA repair enzymes, growth factors and their receptors, transcription factors, metalloproteinases, in particular matrix metalloproteinases, and plasminogen activator of the urokinase type.
  • the resistance-relevant factors are preferably selected from the group comprising P-glycoprotein, MRP and GST, and also comprise nucleic acids coding therefor.
  • the anti-apoptosis factors are selected from the group comprising BCL2, and also comprise the nucleic acids coding therefor.
  • the oncogenes are selected from the group comprising Ras, in particular mutated Ras, Rb and Myc, and also comprise nucleic acids coding therefor.
  • the angiogenesis factors are selected from the group comprising VEGF and HMG proteins and also comprise the nucleic acids coding therefor.
  • the DNA synthesis enzymes are selected from the group comprising telomerase and also comprise nucleic acids coding therefor.
  • the DNA repair enzymes are selected from the group which comprises Ku-80, and also comprise nucleic acids coding therefor.
  • the growth factors are selected from the group comprising PDGF, EGF and M-CSF, and comprise also nucleic acids coding therefor.
  • the receptors are in particular receptors for growth factors, whereby the growth factors are preferably selected from the group comprising PDGF, EGF and M-CSF, and also comprise the nucleic acids coding therefor.
  • the transcription factors are selected from the group comprising YB-1, and also comprise the nucleic acid coding therefor.
  • the metalloproteinases are preferably matrix metalloproteinases.
  • the matrix metalloproteinases are selected from the group comprising MMP-1 and MMP-2, and also comprise the nucleic acids coding therefor.
  • the plasminogen activators of the urokinase type are selected from the group comprising uPa-R, and also comprise the nucleic acids coding therefor.
  • the medicament comprises additionally at least one pharmaceutically active compound.
  • the pharmaceutically active compound is selected from the group comprising cytokines, metalloproteinase inhibitors, angiogenesis inhibitors, cytostatics and cell cycle inhibitors.
  • E1A-modified adenoviruses are adenoviruses which (a) do not replicate in YB-1 nucleus-negative cells or show a reduced, preferably a strongly reduced replication in YB-1 nucleus-negative cells compared to the respective wildtype, (b) transactivate at least one viral gene, whereby the gene is in particular selected from the group comprising E1B-55kDa, E4orf6, E4orf3 and E3ADP, and/or (c) do not translocate cellular YB-1 through the adenovirus into the nucleus.
  • the adenoviruses used in accordance with the present invention have the further characteristic that the binding of the adenoviral encoded E1A protein interferes with the binding of E2F to Rb and is able to dissolve the respective complex consisting of E2F and Rb, respectively.
  • Adenoviruses which have at least one or several of the aforementioned features a) to c), preferably all of features a) to c), are replication deficient in cells which do not have YB-1 in the nucleus.
  • a strongly reduced replication as used herein particularly means a replication which, compared to the wildtype, is reduced by a factor of 2, preferably by a factor of 5, more preferably by a factor of 10 and most preferably by a factor of 100.
  • such comparison of the replication is performed using identical or similar cell lines, identical or similar virus titers for infection (multiplicity of infection, MOI, or plaque forming unit, pfu) and/or identical or similar general experimental conditions.
  • Replication as used herein particularly means formation of particles.
  • the measure for replication can be the extent of viral nucleic acid synthesis. Methods for the determination of the extent of the viral nucleic acid synthesis as well as methods for determining particle formation are known to the ones skilled in the art.
  • a replication which is comparable to wildtype replication can be realized upon an infection rate of 1 to 10 pfu/cell compared to 10 to 100 pfu/cell according to the prior art when using the viruses according to the present invention or when using the viruses described herein in accordance with the present invention.
  • Cellular YB-1 as used herein shall mean any YB-1 which is coded by a cell and preferably is also expressed by a cell, whereby this YB-1 is present in the cell, preferably prior to the infection of the respective cell with an adenovirus, preferably an adenovirus and/or a helpervirus as described herein. It is, however, also within the present invention that cellular YB-1 is a YB-1 which is introduced into the cell or produced by such cell upon application of exogenous measures such as, e. g., infection with a virus, in particular with an adenovirus.
  • the present inventor assumes that the E2-early promoter, i. e. the early E2 promoter is not switched on through the human cellular E2F transcription factor in connection with the replication of the viruses used herein in accordance with the present invention.
  • the switching on of the replication is independent of the Rb status of the cells, i. e. which means that the tumor cells which are infected using the viruses disclosed herein and which are preferably lysed subsequently thereafter, may comprise both functional as well as inactive Rb proteins.
  • adenoviral replication does neither need any functional p53 protein nor is it affected by its presence, when using the adenoviruses disclosed herein or under the conditions disclosed herein.
  • the technical teaching departs from the principle underlying the use of the oncolytic or tumorlytic adenoviruses of the Ad ⁇ 24, dl922-947, E1Ad/01/07, CB016 type or of those adenoviruses which are, for example, described in European patent EP 0 931 830, and into which one or several deletions have been introduced into the E1A protein under the assumption that intact functional Rb proteins are an obstacle to an efficient replication in vivo thus providing an adenoviral replication in vivo only in Rb-negative and Rb-mutated cells, respectively.
  • adenoviral systems according to the prior art are based on E1A in order to control in vivo replication of adenoviruses by means of the early E2 promoter (E2 early promoter) and “free E2F”. Nevertheless, these viruses according to the prior art may be used in accordance with the present invention, i. e. for replication in cells which contain YB-1 in the nucleus independent from the cell cycle.
  • viruses described in said European patent EP 0 931 830 and in particular adenoviruses may be used in accordance with the present invention. More particularly, the viruses described in said patent are replication deficient and lack an expressed viral oncoprotein which is capable of binding a functional Rb tumor suppressor gene product.
  • the adenovirus can particularly be an adenovirus which is lacking expressed viral E1A oncoprotein which is capable of binding a finctional tumor suppressor gene product, in particular Rb.
  • the viral E1A oncoprotein can comprise an inactivating mutation, for example in the CR1 domain at amino acid positions 30 to 85 in Ad 5, nucleotide positions 697 to 790 and/or the CR2 domain at amino acid positions 120 to 139 in Ad 5, nucleotide positions 920 to 967 which are involved in the binding of p105 Rb protein, p130 and p107 protein. It can also be intended that the adenovirus is of type 2 dl 312 or the adenovirus is of type 5 NT dl 1010.
  • Replication ultimately occurs in cells which comprise YB-1 in the nucleus, preferably independent from the cell cycle, which are thus YB-1 nucleus-positive, when using adenoviruses in accordance with the invention for the manufacture of a medicament, in particular for the manufacture of a medicament for the treatment of tumor diseases, and when using adenoviruses in accordance with the invention for replication in cells which have YB-1 in the nucleus.
  • the adenoviruses as such do not replicate in cells which do not have YB-1 in the nucleus but have YB-1 essentially in the cytoplasm only, or replicate at a significantly reduced level.
  • YB-1 is present in the nucleus for a successful replication of these viruses.
  • measures to the cells which result in the expression of YB-1 in the nucleus or in the presence of YB-1 in the nucleus.
  • a respective measure can, for example, be the coding and expression, respectively, of YB-1 through adenoviruses used in accordance with the present invention which in addition to the adenoviral genes also comprise a genetic information coding for YB-1 and in particular for the expression of YB-1.
  • Other measures which result in transport, induction or expression of YB-1 in the nucleus of the cell are stress conditions such as administration of cytostatics, irradiation, hyperthermia and the like, to the cell and to an organism containing such cell.
  • adenoviruses which are used in connection with the present invention are further characterized such that they do not replicate in cells which do not have YB-1 in the nucleus, in other words which are YB-1 nucleus-negative.
  • a further feature of the adenoviruses which are to be used in accordance with the invention is that they code for a viral oncoprotein which is also referred to herein as oncogene protein, whereby the oncogene protein is preferably E1A, whereby the oncogene protein is capable of activating at least one viral gene which can have an impact on the replication of the virus and/or cell lysis of the cells infected by the virus. It is preferred that the influence on replication is such that the virus replicates better in the presence of the oncogene protein compared to a situation where the oncogene protein of the respective virus is lacking. This process is referred to herein also as transactivating and in particular E1A transactivating, when the transactivation is mediated through E1A.
  • transactivate or “transactivation” describes preferably the process that the respective viral oncoprotein has an impact on the expression and/or the transcription of one or several other genes different from the viral oncoprotein coding gene itself, i. e. is preferably controlling its expression and/or translation, and in particular activates this/these.
  • viral genes are preferably E1B55kDa, E4orf6, E4orf3 and E3ADP as well as any combination of the aforementioned genes and gene products, respectively.
  • the adenoviruses used in accordance with the present invention bind to Rb or do not bind to Rb.
  • the use of both alternative embodiments of the adenoviruses is possible independently from the Rb status of the cell to be treated.
  • the following deletions of the E1A oncoprotein are, for example, possible: Deletion in the CR1 region (amino acid positions 30-85 in Ad5) and deletion of the CR2 region (amino acid positions 120-139 in AD5). In doing so, the CR3 region is maintained and can have its transactivating function on the other early viral genes.
  • deletions to the E1A oncoprotein are in principle possible in order to impart E1A the capability to bind to Rb: deletion of the CR3 region (amino acid positions 140-185); deletion of the N-terminus (amino acid positions 1-29); deletion of amino acid positions 85-119; and deletion of the C-terminus (amino acid positions 186-289).
  • the regions recited herein do not interfere with the binding of E2F to Rb.
  • the transactivating finction remains, however, is reduced compared to wildtype Ad5.
  • viruses which are known in the prior art are generally regarded as replication deficient. It is, however, the merit of the present inventor that he has recognised that they are capable of replication in a suitable background nevertheless, in particular a cellular background.
  • a suitable cellular background is caused or provided by the presence of YB-1 in the nucleus, preferably a cell cycle independent presence of YB-1 in the nucleus.
  • the term cells or cellular systems, as used herein, comprises fragments of cells or fractions of cell lysates as well as cells which are present in vitro, in vivo or in situ.
  • the term cellular systems or cells also comprises cells which are present in a cell culture, tissue culture, organ culture or in any other tissue or organ in vivo and in situ, respectively, isolated, in groups or as part of tissues, organs or organisms or are also present as such in a preferably living organism.
  • the organism is preferably a vertebrate organism and more preferably a mammal. It is particularly preferred that the organism is a human organism.
  • new viruses are generated which have the replication characteristic of the adenoviruses described herein as well as the one of adenoviruses of the prior art in cells which are YB-1 nucleus-positive.
  • further viruses can be designed which have the features defined herein needed for their use in accordance with the present invention.
  • the modified E1A oncoprotein of the various adenoviruses which are to be used in accordance with the invention, is capable of transactivating the early viral genes such as, for example, E1B55K, E4orf3, E4orf6, E3ADP, in YB-1 nucleus-positive cells.
  • the respective adenovirus can otherwise correspond to an adenovirus of the wildtype or any derivative thereof.
  • viruses disclosed herein which code for a transactivating oncogene protein in the sense of the present invention or which comprise such oncogene protein comprise, for example, the adenoviruses Ad ⁇ 24, dl922-947, E1Ad/01/07, CB106 and/or the adenoviruses described in European patent EP 0 931 380, which are each capable of transactivating the early genes, such as E1B, E2, E3 and/or E4, and are comparable to adenoviruses of the wildtype, in particular wildtype Ad5.
  • a particular region of the E1A protein is responsible for transactivation in these cases.
  • Within various adenovirus serotypes there are three highly conserved regions in the E1A protein.
  • the transactivating function is primarily based on the presence of the CR3 region in the E1A protein.
  • the amino acid sequence of CR3 is unaltered in the aforementioned adenoviruses. This results in a transactivation of the early genes E1B, E2, E3 and E4 independent from the presence of YB-1 in the nucleus or in the cytoplasma.
  • dl520 expresses a so-called E1A12S protein which does not comprise the amino acid sequence of the CR3 region.
  • E1A12S protein which does not comprise the amino acid sequence of the CR3 region.
  • dl520 can exert a very weak transactivating function only, in particular on the E2 region, and thus does not replicate in YB-1 nucleus-negative cells.
  • YB-1 nucleus-positive cells YB-1 is transactivating the E2 region and thus allows an efficient replication of dl520. This is the basis for the use of systems like dl520 and of systems on the basis of dl520 for the purposes disclosed herein, respectively.
  • delta 24 (herein also referred to as Ad ⁇ 24) and dl520 resides in the fact that with dl520 the early genes E1B, E3 and E4 are more strongly transactivated in YB-1 nucleus-positive cells compared to YB-1 nucleus-negative cells. In contrast, there are no or only minor differences with delta 24.
  • the transactivation effect of dl520 and more particularly of the E1A12S protein, however, is significantly reduced compared to wildtype adenovirus. This transactivation is, however, sufficient in order to allow for an efficient replication in YB-1 nucleus-positive cells, as shown in example 10.
  • adenoviruses which are to be newly constructed typically have an E1 deletion, an E1/E3 deletion and/or an E4 deletion, i. e .
  • the corresponding adenoviruses are not able to generate functionally active E1 and/or E3 and/or E4 expression products and respective products, respectively, or, in other words, these adenoviruses are only capable to generate functional inactive E1, E3 and/or E4 expression products, whereby a functionally inactive E1, E3 and/or E4 expression product as such which is either not present as an expression product at all, whether at the transcription level and/or the translation level, or it is present in a form in which it at least is lacking one of the functions it has in wildtype adenoviruses.
  • the function(s) of the expression product of the wildtype adenovirus is/are known to the ones skilled in the art and, for example, described in Russell, W.
  • the individually named genes as well as the transgenes disclosed herein can be cloned into the E1 and/or E3 and/or E4 region and be expressed independently by virtue of a suitable promoter or under the control of a suitable promoter.
  • the regions E1, E3 and E4 are similarly suitable as cloning sites within the adenoviral nucleic acid.
  • Suitable promoters are, among others, those as disclosed herein in connection with the control and expression, respectively, of E1A, in particular of the modified E1A.
  • the adenoviruses which are to be used in accordance with the present invention are deficient with regard to E 1 B, in particular with regard to E1B 19 kDa.
  • the term deficient generally means a condition in which E1B does not have all of the characteristics inherent to the wildtype but at least one of these characteristics is absent.
  • the adenoviruses which are used in accordance with the invention disclosed herein are, basically, known in the prior art in some embodiments.
  • the adenoviruses used in accordance with the present invention are preferably recombinant adenoviruses, particularly also when a change, compared to the wildtype, has been made in accordance with the technical teaching provided herein. It is within the skills of those of the art to delete or mutate those adenoviral nucleic acid sequences which are not essential for the present invention. Such deletions may, for example, be related to a part of the nucleic acid coding for E3 and E4 as also described herein.
  • a deletion of E4 is particularly preferred if such deletion does not extend to the protein E4orf6, or, in other words, the adenovirus to be used in accordance with the present invention codes for E4orf6.
  • these adenoviral nucleic acids may still be packed into the viral capsid and may thus form infectious particles. The same is true for the use of the nucleic acids in accordance with the present invention. It should be noted that in general the adenoviral systems may be deficient with regard to single or several expression products.
  • this may be either based on the fact that the nucleic acid coding for such expression product is completely mutated or deleted or mutated or deleted to the extent that essentially no expression product is produced anymore or based on the lack of promoters or transcription factors which control the expression, or which are active in a manner different from wildtype, either at the nucleic acid level (lack of a promoter; cis-acting element) or at the translation system and the transcription system, respectively (trans-acting elements). Particularly the latter aspect may be dependent on the cellular background.
  • novel adenoviruses can be used to the same extent as has already been disclosed for the other adenoviruses described herein.
  • the novel adenoviruses according to the invention result from the technical teaching provided herein.
  • Particularly preferred representatives are, for example, the viruses Xvir03 and Xvir03/01 depicted in FIG. 16 and FIG. 17 , the design principle of which is also further illustrated in examples 11 and 12.
  • a CMV promoter is cloned into the E1 region which codes the nucleic acids for E1B 55K and E4orf6, which are separated by a IRES sequence. Due to the introduction of these two genes and the gene products produced therefrom, respectively, a replication efficiency is created which factually corresponds to the one of wildtype viruses, whereby the selectivity of the replication is maintained for cells, particularly tumor cells, insofar as a replication happens in particular in YB-1 nucleus-positive cells and more particularly in cells in which YB-1 is deregulated.
  • Cells in which YB-1 is deregulated are preferably those which show an increased expression of YB-1, preferably compartment-independent, compared to normal or non-tumor cells.
  • virus Xvir03/01 into which, in a preferred embodiment, therapeutic genes or transgenes are cloned under the control of a specific promoter, in particular a tumor-specific or tissue-specific promoter. It is also within the scope of such a virus that also the E4 region is functionally inactive, preferably is deleted.
  • the transgenes described herein may also be cloned into the E4 region, whereby this may occur in addition or alternative to the cloning of a transgene into the E3 region.
  • Such therapeutic genes may be prodrug genes, genes for cytokines, apoptosis-inducing genes, tumor suppressor genes, genes for metalloproteinase inhibitors and/or angiogenesis inhibitors.
  • siRNA, aptamers, antisense and ribozymes may be expressed which are directed against cancer-relevant target molecules.
  • the single or the multiple target molecules is/are selected from the group comprising resistance relevant factors, anti-apoptosis factors, oncogenes, angiogenesis factors, DNA synthesis enzymes, DNA repair enzymes, growth factors and their receptors, transcription factors, metalloproteinases, in particular matrix metalloproteinases and plasminogen activator of the urokinase type. Preferred embodiments thereof have already been disclosed herein.
  • Possible prodrug genes are, for example, cytosine deaminase, thymidine kinase, carboxypeptidase, uracil phosphoribosyl transferase; purine nucleosidephosphorylase (PNP); Kim et al, Trends in Molecular Medicine, Volume 8, No. 4 (Suppl), 2002; Wybranietz W. A. et al., Gene Therapy, 8, 1654-1664, 2001; Niculescu-Duvaz et al., Curr. Opin. Mol.
  • PNP purine nucleosidephosphorylase
  • Possible cytokines which may be used in preferred embodiments, are, for example, GM-CSF, TNF-alpha, Il-12, Il-2, Il-6, CSF, interferon-gamma; Gene Therapy, Advances in Pharmacology, Volume 40, Editor: J. Thomas August, Academic Press; Zhang und Degroot, Endocrinology, 144, 1393-1398, 2003; Descamps et al., J. Mol. Med., 74, 183-189, 1996; Majumdar et al., Cancer Gene Therapy, 7, 1086-1099, 2000.
  • Possible apoptosis inducing genes are, for example, decorin: Tralhao et al., FASEB J, 17, 464-466, 2003; retinoblastoma 94: Zhang et al., Cancer Res., 63, 760-765, 2003; Bax and Bad: Zhang et al, Hum. Gene Ther., 20, 2051-2064, 2002; apoptin: Noteborn and Pietersen, Adv. Exp. Med.
  • Possible tumor suppressor genes are, for example, E1A, p53, p16, p21, p27, MDA-7.
  • angiogenesis inhibitors are, for example, endostatin, angiostatin: Hajitou et al., FASEB J., 16, 1802-1804, 2002, and antibodies against VEGF (Ferrara, N., Semin Oncol 2002 December; 29 (6 Suppl 16): 10-4.
  • Possible metalloproteinase inhibitors as may be used in preferred embodiments are, for example, Timp-3, Ahonen et al., Mol Therapy, 5, 705-715, 2002; PAI-l; Soff et al., J. Clin. Invest., 96, 2593-2600, 1995; Timp-1, Brandt K. Curr. Gene Therapy, 2, 255-271, 2002.
  • siRNA short interfering RNA
  • siRNA consists of two, preferably two separate RNA strands, which hybridise with each other due to base complementarity, i. e. are essentially base paired and preferably have a length of up to 50 nucleotides, preferably between 18 and 30 nucleotides, more preferably less than 25 nucleotides and most preferably 21, 22 or 23 nucleotides, whereby these figures refer to the single strand of the siRNA, in particular to the length of the stretch of the single strand which hybridises with one, and more particularly with the second single strand and is base paired therewith, respectively.
  • siRNA specifically induces or mediates the degradation of mRNA.
  • siRNA represents a biological strategy for cells to inhibit certain alleles during development and to protect itself from viruses.
  • siRNA mediated RNA interference is used for the specific suppression or even complete knock-out of the expression of a protein by introducing a gene specific double-stranded RNA.
  • an siRNA having a length from 19 to 23 nucleotides is thus particularly preferred as it does not result in activation of an inspecific defense reaction, the so-called interleukin response.
  • oligonucleotides having a length of 64 nucleotides which contain the 19 nucleotide long target sequence, both in sense as well as in antisense orientation, separated through a, for example, 9 nucleotide long spacer sequence which was introduced into the vector.
  • the resulting transcript folded into a hairpin structure having a stem structure of, for example, 19 base pairs. The loop is rapidly degraded in the cell so that a functional siRNA is generated (Brummelkamp et al., Science, 296, 550-553, 2002).
  • the activity of pRb and E2F, respectively, is regulated through phosphorylation.
  • the hypophosphorylated form of pRb is predominantly present in the G1 and M phase.
  • the hyperphosphorylated form of pRb is present in the S and G2 phase.
  • E2F is released from the complex consisting of E2F and hypophosphorylated pRb by phosphorylation of pRb.
  • the release of E2F from the complex consisting of E2F and hypophosphorylated pRb results in the transcription of E2F dependent genes.
  • the E1A protein does not only bind to the hypophosphorylated form of pRb, whereby the binding of E1A to pRb happens mostly through the CR2 region of the E1A protein. Additionally, it also binds to the CR1 region, although with lower affinity (Ben-Israel and Kleiberger, Frontiers in Bioscience, 7, 1369-1395, 2002; Helt and Galloway, Carcinogenesis, 24, 159-
  • the nucleic acid coding for YB-1 which, in an embodiment of the adenoviruses to be used in accordance with the present invention, is part of the adenoviruses, may also comprise a nucleic acid sequence mediating the transport of YB-1 into the nucleus.
  • nucleic acids, adenoviruses and adenoviral systems in accordance with the invention as well as the adenoviruses known in the prior art such as, for example, Onyx-015, Ad ⁇ 24, dl922-947, E1Ad/01/07, CB016, dl 520 and the adenoviruses described in patent EP 0 931 830, can be used as such or in combination with these nucleic acids in accordance with the invention in connection therewith as adenoviruses and adenoviral systems and thus as the corresponding nucleic acids.
  • Suitable nucleic acid sequences which mediate nucleus transport are known to the ones skilled in the art and, for example, described in (Whittaker, G.
  • YB-1 is formed as a fusion protein together with a signal peptide and is introduced into the nucleus and that the replication of the adenoviruses according to the present invention thus occurs.
  • YB-1 can be provided with a transporter sequence which, preferably starting from synthesis in the cytoplasma, introduces YB-1 into the cell nucleus or which translocates YB-1 into the cell nucleus, and promotes viral replication there.
  • a particularly effective nucleic acid sequence mediating nucleus transport is the TAT sequence of HIV which is, among other suitable nucleic acid sequences of that type described in Efthymiadis, A., Briggs, L J, Jans, D A., JBC 273, 1623-1628, 1998.
  • the adenoviruses which are used in accordance with the present invention comprise nucleic acid sequences which code for peptides coding for nuclear transportation.
  • YB-1 is present in its full length, particularly in a form which corresponds to the wildtype of YB-1. It is within the present invention that YB-1 is used or present as a derivative, such as, e. g. in shortened or truncated form.
  • a YB-1 derivative as used or present within the present invention is a YB-1 which is capable of binding to the E2-late promoter and thus activates gene expression of the adenoviral E2 region.
  • Such derivatives particularly comprise the YB-1 derivatives disclosed herein. Further derivatives may be generated by deletion of single or several amino acids at the N-terminus, at the C-terminus or within the amino acid sequence.
  • adenovirus and adenoviral system shall have essentially the same meaning within the present invention.
  • Adenovirus shall particularly refer to the complete viral particle comprising the capsid and the nucleic acid.
  • the term adenoviral system particularly focuses on the fact that the nucleic acid shall be changed compared to the wildtype. Preferably such changes comprise changes in the structure of the genome of the adenovirus as may arise from deleting and/or adding and/or mutating promoters, regulatory sequences and/or coding sequences such as open reading frames.
  • the term adenoviral system is preferably used in connection with a vector, which is, for example, used in gene therapy.
  • the adenoviruses to be used in accordance with the present invention and the nucleic acids coding therefor, respectively, may be any respective adenoviral nucleic acid which results in a replication event as such or in combination with further nucleic acid sequences. It is possible, as explained herein, that by means of helper virus the sequences and/or gene products required for replication are provided. To the extent it is referred to coding nucleic acid sequences and to the extent that such nucleic acid sequences are known, it is within the invention that not only the identical sequences used but also sequences derived therefrom.
  • derived sequences shall in particular refer herein to sequences which still result in a gene product, either a nucleic acid or a polypeptide, that exhibits a function which corresponds to one or the function of a non-derived sequence. This can be determined by simple routine tests known to the one skilled in the art.
  • An example for such derived nucleic acid sequences are those nucleic acid sequences which code for the same gene product, in particular for the same amino acid sequence, however, have a deviating sequence of bases due to the degeneracy of the genetic code.
  • the adenoviral nucleic acid is deficient for the expression of the oncogene protein, particularly of the E1A protein, which means that it is either not coding for the 12S E1A protein or for the 13S E1A protein, or it is neither coding for the 12S E1A protein nor the 13S E1A protein, or is modified, as defined herein, and that the adenoviral replication system further comprises a nucleic acid of a helper virus, whereby the nucleic acid of the helper virus comprises a nucleic acid sequence which codes for the oncogene protein, in particular for the E1A protein, which has the following characteristics and imparts the following characteristics to the adenovirus, respectively, namely that it preferably is not replicating in YB-1 nucleus-negative cells but in cells which are independent from the cell
  • the adenoviral nucleic acid and/or the nucleic acid of the helper virus are furthermore present as vectors which are capable of replicating.
  • the coding nucleic acid(s) coding for the adenoviruses which are used according to the present invention, is/are present in a vector, preferably in an expression vector and this expression vector is used in accordance with the present invention.
  • the present invention is also related to a vector group comprising at least two vectors, whereby the vector group comprises altogether an adenoviral replication system as described herein, and the vector group is used in accordance with the present invention. It is intended that each of the components of the adenoviral replication system is arranged on an individual vector, preferably an expression vector.
  • the present invention is related in a further aspect to the use of a cell for the same purposes as described herein for the adenoviruses, whereby the cell comprises one or several nucleic acids which code for the adenoviruses described herein to be used in accordance with the invention and/or a respective adenoviral replication system and/or a respective vector and/or a vector group according to the present invention.
  • adenoviruses and in particular their nucleic acids and the nucleic acids coding therefor, may also be introduced into a cell in parts, particularly into a tumor cell, whereupon due to the presence of the various individual components they may act together such as if the individual components originated from a single nucleic acid and a single or several adenoviruses, respectively.
  • nucleic acids coding for adenoviruses, adenoviral systems or parts thereof, which are used in accordance with the invention may be present as vectors. Preferably, they are present as viral vectors. In case of nucleic acids comprising adenoviral nucleic acids the virus particle is preferably the vector. However, it is also within the invention that said nucleic acids are present in a plasmid vector. In any case the vector comprises elements which provide for the propagation of the inserted nucleic acid, i. e. replication and optionally expression of the inserted nucleic acid, and control of them, respectively.
  • Suitable vectors in particular expression vectors, and corresponding elements are known to the ones skilled in the art and, for example, described in Grunhaus, A., Horwitz, M. S., 1994, Adenoviruses as cloning vectors. In Rice, C., edit., Seminars in Virology, London: Saunders Scientific Publications.
  • a vector group comprises at least two vectors. Otherwise, what has been said in relation to the vectors is also applicable to the vectors and the vector group, respectively.
  • adenoviruses which are used in accordance with the invention are characterised by various nucleic acids and gene products, respectively, disclosed herein, and may otherwise comprise all those elements known to the one skilled in the art, as is also the case for adenoviruses of the wildtype (Shenk, T.: Adenoviridae: The virus and their replication. Fields Virology, 3 rd edition, edit. Fields, B. N., Knipe, D. M., Howley, P. M. et al., Lippincott-Raven Publishers, Philadelphia, 1996, chapter 67).
  • the replication of adenoviruses is a very complex procedure and usually makes use of the human transcription factor E2F.
  • E1, E2, E3 and E4 are expressed.
  • the group of the “late genes” is responsible for the synthesis of the viral structural proteins.
  • the E1 region consisting of the two transcriptional units E1A and E1B, which code for different E1A and E1B proteins, are critical as the transcription of the E2, E3 and E4 is induced by them (Nevins, J. R., Cell 26, 213-220, 1981). Additionally, the E1A proteins can induce DNA synthesis in resting cells and thus initiate the entry into the S phase (c. f.
  • the E2F factors may subsequently bind to corresponding promoter regions of both cellular as well as viral genes (in particular to the adenoviral E2 early promoter) and thus initiate transcription and replication (Nevins, J. R., Science 258, 424-429, 1992).
  • the gene products of the E2 region are especially needed for the initiation and performance, respectively, of the replication, as they code for three essential proteins.
  • the transcription of the E2 proteins is controlled by two promoters, the “E2-early E2F-dependent” promoter which is also referred to herein as E2-early promoter or early E2 promoter, and the “E2-late” promoter (Swaminathan and Thimmapaya, The Molecular Repertoire of Adenoviruses III: Current Topics in Microbiology and Immunology, Vol 199, 177-194, Springer Verlag 1995).
  • the products of the E4 region together with the E1A and E1B-55kDa protein play an important role for the activity of E2F and the stability of p53, respectively.
  • the promoter is even more activated by a direct interaction of the E4orf6/7 protein coded by the E4 region, with the heterodimer consisting of E2F and DP1 (Swaminathan and Thimmapaya, JBC 258, 736-746, 1996).
  • p53 is inactivated by the complex consisting of E1B-55kDa and E4orf6 (Steegenga, W. T. et al., Oncogene 16, 349-357, 1998), in order to successfully complete a lytic infectious cycle.
  • E1B-55kDa protein exhibits a further important function insofar as it promotes by interacting with the E4orf6 protein the export of viral RNA from the nucleus, whereas the proprietary RNAs of the cell are retained in the nucleus (Bridge and Ketner, Virology 174, 345-353, 1990).
  • a further important discovery is that the protein complex consisting of E1B-55kDa/E4orf6 is localised in the so-called “viral inclusion bodies”. It is assumed that these structures are the sites of replication and transcription (Ornelles and Shenk, J. Virology 65, 424-429, 1991).
  • a further region which is important for replication and in particular for the release of adenoviruses is the E3 region.
  • the E3 region comprises more particularly the genetic information for a variety of comparatively small proteins which are not essential for the adenoviral infectious cycle in vitro, i. e. are not essential in cell culture. However, they play an important role for the survival of the virus during an acute and/or latent infection in vivo, as they have, among others, immune regulatory and apoptotic function(s) (Marshall S. Horwitz, Virololgie, 279, 1-8, 2001; Russell, supra). It could be shown that a protein having a size of about 11.6 kDa induces cell death.
  • the protein was, due to its function, referred to as ADP—for the english term adenovirus death protein—(Tollefson, J. Virology, 70, 2296-2306, 1996).
  • ADP for the English term adenovirus death protein—(Tollefson, J. Virology, 70, 2296-2306, 1996).
  • the protein is predominantly formed in the late phase of the infectious cycle. Furthermore, overexpression of the protein results in a better lysis of the infected cells (Doronin et al., J. Virology, 74, 6147-6155, 2000).
  • E1A deleted viruses i. e. in particular viruses which do not have a 12S E1A protein and which also do not express a 13S E1A protein
  • E1A-like activity This phenomenon is referred to as “E1A-like activity” in literature.
  • two proteins namely the 12S and 13S protein, control and induce, respectively, expression of the other adenoviral genes (Nevins, J. R., Cell 26, 213-220, 1981; Boulanger, P. und Blair, E.; Biochem. J.
  • transactivating function is predominantly provided by the CR3 region of the 13S protein (Wong H K und Ziff E B., J Virol., 68, 4910-20, 1994).
  • Adenoviruses which have specific deletions in the CR1 and/or CR2 region and/or CR3 region of the 13S protein, are mostly replication-deficient, however, are still transactivating in some cell lines the viral genes and promoters, respectively, in particular the E2 region (Wong H K, Ziff E B., J Virol. 68, 4910-20, 1994; Mymryk, J. S. and Bayley, S. T., Virus Research 33, 89-97, 1994).
  • YB-1 After infection of a cell, typically a tumor cell, using a wildtype adenovirus, YB-1 is induced into the nucleus which is mediated by E1A, E1B-55K and E4orf6, and is co-localised with E1B-55K in the nucleus in the viral inclusion bodies, which allows for an efficient replication of the virus in the cell nucleus both in vitro and in vivo.
  • E4orf6 binds to E1B-55K (Weigel, S. and Dobbelstein, M. J. Virology, 74, 764-772, 2000; Keith N.
  • E1B-55K into the nucleus, which provides for an optimum virus production and adenoviral replication, respectively.
  • An efficient replication of the virus in accordance with the present invention is possible due to the interaction of E1A, E1B-55K and YB-1, and by the complex consisting of E1B-55K/E4orf6 with YB-1, respectively, and the co-localisation of YB-1 and E1B-55K in the nucleus in the so-called viral inclusion bodies and thus the use of the viruses described herein for replication in cells which are YB-1 nucleus-positive and for the manufacture of a medicament for the treatment of diseases, whereby YB-1 nucleus-positive cells are involved.
  • the replication being thus possible with this cellular background, results in lysis of the cell, release of the virus and infection and lysis of adjacent cells, so that in case of an infection of a tumor cell and a tumor, respectively, finally lysis of the tumor, i. e. oncolysis, occurs.
  • YB-1 belongs to the group of highly conserved factors which bind to an inverted CAAT sequence, the so-called Y-box. They may be active in a regulatory manner both at the level of transcription as well as translation (Wolffe, A. P. Trends in Cell Biology 8, 318-323, 1998). A growing number of Y-box dependant regulatory pathways is found in the activation but also in the inhibition of growth and apoptosis associated genes (Swamynathan, S. K. et al., FASEB J. 12, 515-522, 1998). Accordingly, YB-1 directly interacts with p53 (Okamoto, T.
  • Fas (Lasham, A. et al., Gene 252, 1-13, 2000), MDR and MRP gene expression (Stein, U. et al., JBC 276, 28562-69, 2001; Bargou, R. C. et al., Nature Medicine 3, 447-450, 1997) and in the activation of topoisomerases and metalloproteinases (Mertens. P. R. et al., JBC 272, 22905-22912, 1997; Shibao, K. et al., Int. J. Cancer 83, 732-737, 1999).
  • YB-1 is involved in the regulation of mRNA stability (Chen, C-Y. et al., Genes & Development 14, 1236-1248, 2000) and repair processes (Ohga, T. et al., Cancer Res. 56, 4224-4228, 1996).
  • the nuclear localisation of YB-1 in tumor cells results in E1A independent viral replication whereby in particular neither a 12S E1A protein nor a 13S E1A protein is present in an expressed form and used, respectively (Holm, P. S. et al. JBC 277, 10427-10434, 2002) and in case of overexpression of the protein YB-1 in multidrug resistance (multiple resistance). Additionally it is known that the adenoviral proteins such as e. g. E4orf6 and E1B-55K have a positive effect on viral replication (Goodrum, F. D. and Ornelles, D. A, J.
  • E1A protein is responsible for switching on the other viral gene products (such as E4orf6, E3ADP and E1B-55K) (Nevins J. R., Cell 26, 213-220, 1981).
  • E4orf6, E3ADP and E1B-55K the other viral gene products
  • the nuclear localisation of YB-1 in multidrug resistant cells which have YB-1 in the nucleus provides for replication and particle formation, respectively, of such E1A-minus viruses. In this case, however, the efficiency of viral replication and particle formation is reduced by several multiples compared to wildtype Ad5.
  • a system preferably with an adenoviral system, which switches on adenoviral genes, but which does not allow for viral replication
  • Suitable cytostatics are, among others, those which belong to the following groups: anthracyclines, such as daunomycin and adriamycin; alkylating agents, such as cyclophosphamide; alkaloids, such as etoposide; vin-alkaloids, such as vincristine and vinblastine; antimetabolites such as for example 5-fluorouracil and methrotrexate; platin derivatives, such as for example cis-platin; topoisomerase inhibitors, such as camphothecine; and taxanes, such as for example taxole.
  • anthracyclines such as daunomycin and adriamycin
  • alkylating agents such as cyclophosphamide
  • alkaloids such as etoposide
  • vin-alkaloids such as vincristine and vinblastine
  • antimetabolites such as for example 5-fluorouracil and methrotrexate
  • platin derivatives such as for example cis-
  • the adenoviruses disclosed herein in particular the recombinant adenoviruses, which are only capable of replicating in YB-1 nucleus-positive cells, are limited in their capability to transactivate the viral genes E1B-55K, E4orf6, E4orf3 and E3ADP, compared to the corresponding transactivating capabilities of wildtype adenoviruses, in particular wildtype Ad5.
  • the present inventor has now surprisingly found that these limited transactivating capabilities may be compensated by the corresponding genes and in particular by E1B-55K and E4orf6 being expressed in combination with the nuclear localisation of YB-1.
  • viral replication and particle formation, respectively is increased under such conditions to a level which is comparable to the replication and particle formation behaviour of wildtype adenoviruses.
  • the medicament in connection with which or for the manufacture of which the adenoviruses described herein are used in accordance with the present invention is usually applied systematically, although it is also within the present invention to apply or deliver such medicament locally.
  • the application is done with the intention that particularly those cells are infected with the adenovirus and that particularly in these cells replication occurs, which are involved, preferably in a causal manner, in the formation of a condition, typically a disease, for the diagnosis and/or prevention and/or treatment of which the medicament according to the present invention is used.
  • Such a medicament is preferably for the treatment of tumor diseases.
  • the tumor diseases those are particularly preferred in which either YB-1 is already located in the nucleus due to the mechanism underlying the tumor disease, in particular the underlying pathological mechanism, or those where the presence of YB-1 in the nucleus is caused by exogenous measures, whereby the measures are suitable to transfer YB-1 into the nucleus, induce YB-1 there or to express YB-1 there.
  • the term tumor or tumor disease as used herein shall comprise both malignant as well as benign tumors and respective diseases.
  • the medicament comprises at least one further pharmaceutically active compound. The kind and the amount of such further pharmaceutically active compound will depend on the indication for which the medicament is to be used.
  • cytostatics such as for example cis-platin and taxol, daunoblastin, daunorubicin, adriamycin and/or mitoxantron or others of the cytostatics or groups of cytostatics which are described herein, are used.
  • the medicament according to the present invention can be present in various formulations, preferably in a liquid form.
  • the medicament will contain stabilisers, buffers, preservatives and such agents which are known to the one skilled in the art of pharmaceutical formulations.
  • the present inventor has surprisingly found that the use in accordance with the invention of the viruses described herein can be applied with a very high success rate to tumors which have YB-1 in the nucleus independent from the cell cycle.
  • YB-1 is located in the cytoplasm, in particular also in the perinuclear plasma.
  • S-phase of the cell cycle YB-1 can be found in the cell nucleus of both normal cells as well as tumor cells. This, however, is not sufficient to provide for viral oncolysis using thus modified adenoviruses. The comparatively little efficacy of such attenuated adenoviruses described in the prior art is ultimately based on their wrong application.
  • adenoviral systems can be used, particularly also with an increased efficacy, where the molecular biological prerequisites for viral oncolysis are given when the attenuated or modified viruses as described herein, are administered.
  • the adenoviruses which are to be used in accordance with the invention as described herein, such as Ad ⁇ 24, dl922-947, E1Ad/01/07, CB016, dl520 and the recombinant adenoviruses described in European patent EP 0 931 830, the prerequisites are given in case of tumor diseases the cells of which show a nuclear localisation of YB-1 independent of the cell cycle.
  • This form of nuclear localisation may be either caused by the kind of tumor itself or may be caused by the measures or agents in accordance with the invention which are described herein.
  • the present invention thus defines a new group of tumors and tumor diseases, respectively, and thus also of patients, which can still be treated successfully with the viruses in accordance with the invention, particularly also with the attenuated or modified adenoviruses already described in the prior art.
  • adenoviruses in connection with this group of patients are based on the finding that the induction of viral replication is based on the nuclear localisation of YB-1 with subsequent binding of YB-1 to the E2-late promoter. Due to the findings disclosed herein adenoviruses such as Ad ⁇ 24, dl922- 947 , E1Ad/01/07, CB106 and/or the adenoviruses described in European patent EP 0 931 830 may also replicate in cells which are YB-1 nucleus-positive and/or in cells in which YB-1 is deregulated as defined in the present invention.
  • these adenoviruses can, according to the present invention, be used for the treatment of diseases and groups of patients, respectively, which/who comprise cells having these characteristics, particularly when these cells are involved in the formation of the respective disease to be treated.
  • a further group of patients which can be treated in accordance with the invention using the adenoviruses which are described herein as being usable in accordance with the invention, and using those viruses, in particular adenoviruses, which are described herein for the first time, are those which are YB-1 nucleus-positive and/or which are YB-1 nucleus-positive as a result of the treatments described in the following, whereby such treatment is preferably a medical treatment, and/or those patients which have undergone such treatment concomitantly with the administration of respective viruses.
  • YB-1 nucleus-positive patients are patients which have YB-1 in the nucleus independent from the cell cycle in a number of cells formiing a tumor.
  • radiation preferably radiation as used in a tumor therapy
  • Radiation means in particular radiation with high energy radiation, preferably radioactive radiation, preferably as used in tumor therapy.
  • Hyperthermia and the application of hyperthermia, preferably hyperthermia as used in tumor therapy, are further treatments. In a particularly preferred embodiment hyperthermia is applied locally.
  • hormon treatment particularly hormon treatment as used in tumor therapy, is a further treatment. In connection with such hormon treatment anti-estrogens and/or anti-androgens are used.
  • Anti-estrogens such as tamoxifene, particularly in the therapy of breast cancer, and anti-androgens such as for example flutamide or cyproterone acetate, are used in the therapy of prostate cancer.
  • some of the cells forming the tumor comprise YB-1 either inherently or after induction and active introduction into the nucleus, respectively, or comprise deregulated YB-1 in the sense of the present disclosure.
  • YB-1 preferably, about 5% or any percentage above, i. e. 6%, 7%, 8% etc. of the tumor forming cells are such YB-1 nucleus-positive cells or cells in which YB-1 is present in a deregulated manner.
  • Nuclear localisation of YB-1 can be induced by stress applied from outside and by locally applied stress, respectively. This induction can, for example, occur by means of radiation, in particular UV radiation, application of cytostatics, as, among others, already disclosed herein, and hyperthermia.
  • the medicament according to the present invention could thus also be administered to patients and groups of patients, or may be intended for them, where through appropriate pretreatment or concomitant treatment a transport of YB-1 is affected, preferably in the respective tumor cells.
  • E1A which, for example, may comprise deletions or point mutations in order to thus generate various embodiments of the adenoviruses, which may be used in connection with the use in accordance with the invention.
  • the adenoviruses which are used in accordance with the present invention are capable of replicating in such cells and cellular systems, respectively, which have YB-1 in the nucleus.
  • the status of the cells with regard to the presence or absence of Rb, i. e. the retinoblastome tumor suppressor product is irrelevant.
  • adenoviruses not essential to take into consideration the p53 status of the infected cells, the cells to be infected or the cells to be treated, as by using the adenoviral systems as disclosed herein in connection with YB-1 nucleus-positive cells, i. e. cells which have YB-1 in the nucleus irrespective of the cell cycle, this p53 status as well as the Rb status do not have an impact on the performance of the technical teaching disclosed herein.
  • the oncogene and oncogene protein, respectively, in particular E1A can be either under the control of the proprietor natural adenoviral promoters and/or be controlled by means of a tumor or tissue specific promoter.
  • Suitable non-adenoviral promoters can be selected from the group comprising cytomegalovirus promoter, RSV (Rous sarcoma virus) promoter, adenovirus-based promoter Va I and the non-viral YB-1 promoter (Makino Y. et al., Nucleic Acids Res. 1996, 15, 1873-1878).
  • telomerase promoter comprises the alpha-fetoprotein (AFP) promoter, the caecinoembryonic antigen promoter (CEA) (Cao, G., Kuriyama, S., Gao, J., Mitoro, A., Cui, L., Nakatani, T., Zhang, X., Kikukawa, M., Pan, X., Fukui, H., Qi, Z. Int. J.
  • the L-plastin promoter Choung, I., Schwartz, P E., Crystal, R C., Pizzomo, G, Leavitt, J., Deisseroth, A B. Cancer Gene Therapy, 6, 99-106, 1999
  • the arginine vasopressin promoter Coulson, J M, Staley, J., Woll, P J. British J. Cancer, 80, 1935-1944, 1999
  • the E2f promoter Tsukada et al.
  • telomerase promoter is of crucial importance in human cells. Accordingly, telomerase activity is regulated through transcriptional control of the telomerase reverse transcriptase gene (hTERT), which is the catalytic subunit of the enzyme.
  • hTERT telomerase reverse transcriptase gene
  • the expression of the telomerase is active in 85% of human tumor cells. In contrast thereto, it is not active in most of the normal cells. Exempt therefrom are germ cells and embryonic tissue (Braunstein, I. et al., Cancer Research, 61, 5529-5536, 2001; Majumdar, A. S. et al., Gene Therapy 8, 568-578, 2001).
  • this promoter and the specific fragments, respectively, are suitable to provide for a specific expression of a gene and particularly of a transgene, preferably one of the transgenes disclosed herein, in tumor cells only.
  • the promoter shall allow the expression of the modified oncogene, preferably the E1A oncogene protein, in tumor cells only.
  • the expression of a transgene, particularly one which is selected from the group comprising E4orf6, E1B55kD, ADP and YB-1, in such adenoviral vector is under the control of any of these promoters.
  • the open reading frame of the transactivating oncogene protein, in particular of the E1A protein is in frame with one or several of the gene products of the adenoviral system.
  • the open reading frame of the transactivating E1A protein can also be independent therefrom.
  • Resistance refers preferably to a resistance against the cytostatics described herein.
  • This multidrug resistance preferably goes along with the expression, preferably an overexpression, of the membrane-bound transport protein P-glycoprotein which can be used as a marker for determining respective cells and can thus also be used for tumors and respective groups of patients having such multidrug resistance.
  • resistance as used herein comprises both the P-glycoprotein mediated resistance which is also referred to as classical resistance, as well as atypical resistance which comprises resistance which is mediated through MRP, or other, non-P-glycoprotein mediated resistances.
  • a further marker which can basically be used in a manner similar as P-glycoprotein, is MRP.
  • a further marker at least to the extent that the colorectal carcinoma cells or patients with colorectal carcinoma are concerned, is PCNA (engl. proliferating cell nuclear antigen) (Hasan S. et al., Nature, 15, 387-391, 2001), as, for example, described by Shibao K. et al. (Shibao K et al., Int. Cancer, 83, 732-737, 1999).
  • MDR multiple drug resistance
  • MDR multiple drug resistance
  • a further possible marker which can be used in accordance with the present invention, is p73 (Kamiya, M., Nakazatp, Y., J Neurooncology 59, 143-149 (2002); Stiewe et al., J. Biol. Chem., 278, 14230-14236, 2003).
  • tumor refers herein in general to each and any tumor or cancer disease which either contains YB-1 in the nucleus inherently or contains YB-1 in the nucleus, preferably independent from the cell cycle, as a consequence of realising exogenous measures as described herein.
  • the viruses described herein can be used for the treatment of tumors in general.
  • these tumors are selected from the group comprising breast cancer, ovary carcinoma, prostate carcinoma, osteosarcoma, glioblastoma, melanoma, small cell lung carcinoma and colorectal carcinoma.
  • Further tumors are those which are resistant as described herein, preferably those which are multiple resistant and particularly also those tumors of the above described group.
  • the invention is related in a further aspect to a method for the screening of patients which can be treated using one of the modified adenoviruses, i. e. an adenovirus as used in accordance with the present invention such as, for example, Ad ⁇ 24, dl922-947, E1Ad/01/07, CB016 or the viruses described in European patent EP 0 931 830, whereby such method comprises the following steps:
  • the presence of the afore-described markers can be detected instead of or in addition to YB-1.
  • the tumor tissue or a part thereof comprise YB-1 in the nucleus, in particular independent from cell cycle
  • the adenoviruses disclosed therein can be used in accordance with the practice of the present invention.
  • the examination of the tumor tissue is done by using an agent which is selected from the group comprising antibodies against YB-1, aptamers against YB-1 and aptamers against YB-1 as well as anticalines against YB-1.
  • an agent which is selected from the group comprising antibodies against YB-1, aptamers against YB-1 and aptamers against YB-1 as well as anticalines against YB-1.
  • the same means can be produced for the corresponding markers and used accordingly.
  • the manufacture of antibodies, in particular monoclonal antibodies, is known to the ones skilled in the art.
  • a further means for specific detection of YB-1 or the markers are peptides which bind with a high affinity to the target structures, in the present case YB-1 or said markers. In the prior art methods are known such as phage-display in order to generate such peptides.
  • a peptide library is taken as a starting point, whereby individual peptides have a length of from 8 to 20 amino acids and the size of the library is about 10 2 to 10 18 , preferably 10 8 to 10 15 different peptides.
  • a special form of target molecule binding polypeptides are the so-called anticalines which are, for example, described in German patent application DE 197 42 706.
  • a further means for specific binding of YB-1 or the corresponding markers disclosed herein and thus for the detection of cell cyclus independent localisation of YB-1 in the cellular nucleus are the so-called aptamers, i.e. D-nucleic acids which are present either as RNA or DNA either as a single strand or a double strand and specifically bind to the target molecule.
  • aptamers i.e. D-nucleic acids which are present either as RNA or DNA either as a single strand or a double strand and specifically bind to the target molecule.
  • the generation of aptamers is, for example, described in European patent EP 0 533 838.
  • a special form of aptamers are the so-called aptazymes, which, for example, are described by Piganeau, N. et al. (2000), Angew. Chem. Int. Ed., 39, no. 29, pages 4369-4373.
  • aptamers insofar as they comprise apart from the aptamer part a ribozyme part and get catalytically active upon binding or release of the target molecule binding to the aptamer part and cleave a nucleic acid substrate which goes along with the generation of a signal.
  • a further form of aptamers are the so-called aptamers, i. e. target molecule binding nucleic acids which are made of L-nucleic acids.
  • aptamers i. e. target molecule binding nucleic acids which are made of L-nucleic acids.
  • the method for the manufacture of such aptamers is, for example, described in WO 98/08856.
  • the sample of the tumor tissue can be obtained by puncture or through surgery.
  • the assessment whether YB-1 is localised in the nucleus independent from the cell cycle is frequently done by using microscopic techniques and/or immuno histoanalysis, preferably using the antibody or any of the other aforementioned means.
  • Further means for detecting YB-1 in the nucleus and in particular for detecting that YB-1 is located there independent from the cell cycle are known to the one skilled in the art.
  • the localisation of YB-1 can be easily detected in stained tissue sections when screening them.
  • the frequency of the presence of YB-1 in the nucleus already indicates that the localisation is independent from the cell cycle.
  • a further option for cell cycle independent detection of YB-1 in the nucleus resides in the staining against YB-1 and detection whether YB-1 is localised in the nucleus and determination of the phase of the cells.
  • This as well as the detection of YB-1 may also be performed by using the aforementioned means directed against YB-1.
  • the detection of the means is done by methods known to the one skilled in the art.
  • agents specifically binding to YB-1 and not to any other structures within the sample to be analysed, particularly the cells their localisation and because of their specific binding to YB-1 also the localisation of YB-1 can be detected and established by a suitable labelling of the means. Methods for the labelling of said means are known to the ones skilled in the art.
  • FIG. 1 shows the structural design of the adenoviral vectors referred to as AdE1/E3-minus herein which are E1/E3-deleted adenoviruses, of wildtype adenovirus and adenovirus dl520.
  • FIG. 2 shows the binding domains of the E1A protein with regard to the binding of p300, p107 and p105.
  • FIG. 3 shows U2OS cells which do not have YB-1 in the nucleus, after infection with the E1/E3-deleted adenoviruses Ad5, referred to as E1/E3-minus Ad5, and dl520.
  • FIG. 4 shows 257RDB cells which have YB-1 in the nucleus, after infection with the E1/E3-deleted adenoviruses Ad5, referred to as E1/E3-minus Ad5, and adenovirus dl520.
  • FIG. 5 shows 257RDB cells and U2OS cells after infection with adenovirus dl19/1131.
  • FIG. 6 shows the result of an EMSA analysis which confirms that YB-1 is present in multidrug resistant cells and cell lines 257RDB, 181 RDB, MCF-7Ad, respectively, whereas YB-1 is not present in the nucleus of U2OS and HeLa cells.
  • FIG. 7 shows the structural design of the E1A protein of wildtype adenovirus, of adenovirus dl520 and adenovirus dl 1119/1131.
  • FIG. 8 is a column diagram showing the replication efficiency of adenoviruses in the presence of additionally expressed viral proteins in absolute figures.
  • FIG. 9 is a column diagram showing the increase of replication efficiency of adenoviruses in the presence of additionally expressed viral proteins.
  • FIG. 10 shows wells grown with U2OS cells after crystal violet staining and infection with dl520 with 10 and 30 pfu/cell, respectively, and control (K) without administration of daunorubicine and with the administration of 40 ng daunorubicine per ml, respectively.
  • FIG. 11 shows wells grown with HeLa cells, after crystal violet staining and infection with dl520 and 10 and 30 pfu/cell and control (K), respectively, without administration of daunorubicine and administration of 40 ng daunorubicine per ml, respectively.
  • FIG. 12 is a diagram of the tumor volume of tumors having different origins (RDB257 and HeLa) as a function of time after treatment with PBS and dl520, respectively.
  • FIG. 13 show pictures of sacrificed mice which developed a tumor based on RDB257 cells after treatment with PBS and 5 ⁇ 10 8 pfu dl520, respectively.
  • FIG. 14 is the result of a Southern Blot analysis of a cell extract (of the tumors grown subcutaneously) of RDB257 cells and HeLa cells after infection with dl520.
  • FIG. 15 is a column diagram showing the replication efficiency and particle formation, respectively, of dl520 and wildtype adenoviruses in YB-1 nucleus-positive tumor cells (257RDB and 181RDB) and YB-1 nucleus-negative tumor cells (HeLa, U2OS).
  • FIG. 16 shows the structural design of wildtype adenovirus and adenoviral vector AdXvir03.
  • FIG. 17 shows the structural design of adenoviral vector AdXvir03/ 01 .
  • FIG. 18A /B shows wells grown with 181RDB cells ( FIG. 18A ) and 272RDB cells ( FIG. 18B ) after crystal violet staining and infection with Ad312 (20 pfu/cell), Xvir03 (5 pfu/cell) and control (non-infected), whereby crystal violet staining was performed five days past infection.
  • FIG. 1 shows the structural design of adenoviral vectors AdE1/E3-minus, i. e. E1/E3-deleted adenoviruses, wildtype adenovirus and adenovirus dl520.
  • Adenovirus AdE1/E3-minus does not have a region coding for a functional E1A or a functional E1B or E3 and is used in the present experiments as a control for toxicity.
  • Wildtype E1A gene codes for a total of 5 proteins which are generated through alternative splicing of the E1A RNA. Among others, two different proteins are generated, namely a 289 amino acid protein and a 243 amino acid protein. dl520 does not code for the 289 amino acid protein as it has a deletion in the CR3 stretch of the E1A gene which results in the lack of the 13S gene product.
  • the adenovirus dl520 which may be used in accordance with the invention is referred to as 12S-E1A virus by those skilled in the art.
  • Adenovirus dl347 (Wong und Ziff, J. Virol., 68, 4910-4920, 1994) known in the prior art is also a 12S-E1A virus which can be used in accordance with the present invention.
  • CR1, CR2 and CR3 regions which are conserved among various adenoviral subtypes. These are referred to as CR1, CR2 and CR3. While CR1 and CR2 are present in both E1A proteins (E1A 12S and E1A 13S), i. e. in both the 289 amino acid and the 243 amino acid protein, the CR3 region is only present in the bigger one of the two aforementioned proteins.
  • the CR3 region is required for the activation of viral genes, in particular of E1B, E2, E3 and E4.
  • Viruses which only comprise the smaller, i. e. 243 amino acid protein are only very weakly transactivating the viral genes and do not promote adenoviral replication in those cells which do not have YB-1 in the nucleus.
  • YB-1 is present in the nucleus only in tumor cells and can be detected only there, this vector is suitable to induce tumor-specific replication.
  • this adenovirus cannot translocate cellular YB-1 into the cell's nucleus which is also referred to herein as translocation, and is thus not in a position to replicate in cells which are YB-1 nucleus-negative and is thus a virus which can be used in accordance with the present invention, whereby this virus comprises the transactivation required in accordance with the present invention.
  • FIG. 2 shows the binding domains of the E1A protein with regard to the binding of p300, p107 and p105.
  • P300 as well as p107, is a cellular binding protein.
  • pRb and p107/p300 are in combination with the cellular transcription factor E2F effective in regulating transcription.
  • the wildtype E1A protein interferes with the binding of E2F to Rb.
  • the thus released E2F binds to the E2 early promoter and induces adenoviral replication thereby.
  • the adenoviral vector dl922-947 comprises a deletion in the CR2 region (amino acid positions 122-129) and the vector CB016 has deletions in the CR1 region (amino acid positions 27-80) and CR2 region (amino acid positions 122-129).
  • the vector E1Adl01/07 comprises a deletion in the CR2 region (amino acid positions 111-123).
  • the adenoviral vector Ad ⁇ 24 comprises a deletion in the CR2 region (amino acid positions 120-127).
  • the adenoviral vector described in patent EP 0 931 830 comprises deletions in the CR1 region and CR2 region.
  • E2F/RB and the release of E2F mediated through E1A is fundamentally different from the mechanism underlying the present invention. Unlike assumed in the prior art it is not the release of E2F from the Rb protein which is essential, not to say critical for viral replication, but it is the nuclear localisation of the human transcription factor YB-1. This transcription factor is, in normal cells, only present in the cytoplasm over most of the cell cycle.
  • tumor diseases including, for example, but not limited thereto, breast cancer, ovary carcinoma, prostate carcinoma, osteosarcoma, glioblastoma, melanoma, small cell lung carcinoma and colorectal carcinoma.
  • the U2OS cells which do not have YB-1 in the nucleus show no lysis as illustrated by crystal violet staining after infection with two different adenoviruses, namely the E1/E3-deleted adenovirus referred to as E1/E3-minus, and adenovirus dl520, which can be used in accordance with the present invention.
  • E1/E3-minus E1/E3-deleted adenovirus
  • adenovirus dl520 which can be used in accordance with the present invention.
  • the medium is removed.
  • the cells are overlaid with crystal violet (50% ETOH, 3% formaldehyde, 5% acetic acid, 1% crystal violet) and incubated at room temperature for 5-10 min.
  • the plates having 6 wells are thoroughly rinsed with water and dried at room temperature.
  • 100,000 257RDB cells were plated per well. On the next day the cells were infected with the various adenoviruses as depicted in FIG. 4 . The infection was performed in 500 ⁇ l serum free DMEM medium for 1 h at 37° C. Subsequently, the infection medium was removed and replaced by 2 ml complete medium (10% FCS/DMEM). The analysis was performed after three days using crystal violet staining.
  • E1/E3-minus Ad5 which is E1/E3-deleted
  • dl520 which, as shown in example 3, does not replicate in YB-1 nucleus-negative cells and at the same time codes with E1A for a transactivating oncogene protein in accordance with the present invention, results in a factually complete lysis at an MOI (multiplicity of infection) of 40 pfu per cell and a still predominant lysis at an MOI of 10 pfu per cell.
  • dl520 and similar viruses such as described herein by dl1119/1131 or AdXvir 03, require an MOI which is reduced by about 1 magnitude (factor of ten) compared to E1-deleted or an E1/E3-deleted adenovirus which justifies their clinical use.
  • the protein E1A of dl520 is characterised in that the CR3 region thereof is deleted which results in the transactivation required for the use in accordance with the present invention and replication in YB-1 nucleus-positive cells.
  • adenovirus dl1119/1131 is thus a further adenovirus which can be used in accordance with the present invention. It is within the present invention that also viruses can be used which are designed similar to dl1119/1131 with regard to the CR3 region, but, in contrast thereto, have the CR1 region and/or CR2 region.
  • nuclear YB-1 should bind as a transcription factor to the Y-box (CAAT sequence) within the mdrl promoter (engl. multiple drug resistance promoter).
  • EMSA analysis electrospreading assay
  • nuclear protein is isolated and subsequently 1-10 ⁇ g protein is incubated together with a short DNA fragment (oligo) at 37° C.
  • oligo short DNA fragment
  • the following oligonucleotide was used: mdr1 promoter in contrast to U2O3 (Position ⁇ 86 to ⁇ 67): TGAGGCTGATTGGCTGGGCA (the X-box is underlined).
  • This DNA fragrnent is radioactively labelled at the 5′ end with 32 P prior to that. Subsequently, separation is performed in a native polyacryl amide gel. In case the protein YB-1 is binding to a sequence in the oligonucleotide, this can be detected as any non-bound oligonucleotide is migrating faster in the gel than bound oligonucleotide (Holm, P. S. et al., JBC 277, 10427-10434, 2002; Bargou, R. C. et al., Nature Medicine 3, 447-450, 1997).
  • YB-1 is present in the nucleus of multidrug resistant cells 257RDB, 181RDB and MCF-7Ad cells in contrast to cell lines U2OS and HeLa cells.
  • results shown in example 4 and 5 confirm that the adenoviruses dl520 and dl1119/1131 replicate in YB-1 nucleus-positive cells such as, e. g., 257RDB in contrast to U205, and induce lysis thereof. This confirms the finding about the use of the adenoviruses in accordance with the present invention.
  • results confirm that already a, compared to wildtype adenovirus, weak transactivation of viral genes in YB-1 nucleus-positive cells through modified or deleted E1A gene products results in successful replication and lysis of such cells in the presence of YB-1 in the nucleus, including, for example, multidrug resistant cells and that the adenoviruses as described herein, can thus be used in the lysis of such tumors.
  • Ad-55K is an E1/E3 deleted virus, whereby E1B-55K is cloned into E1 and is under the control of CMV. This substitution is necessary with regard to the fact that AdYB-1, i. e.
  • an adenovirus which expresses YB-1 does not express these early genes and that the present inventor has recognised that a substitution of these early genes in a replication system which contains YB-1 in the nucleus, is capable of increasing replication efficiency and particle formation efficiency, respectively, to an extent comparable to the one of wildtype adenoviruses of type Ad5.
  • the plasmid pE4orf6 carries the DNA sequence coding for the early viral gene E4orf6 under the control of CMV.
  • Ad-55K is an E1/E3-deleted virus which carries as transgene the viral gene E1B-55K under CMV control.
  • FIGS. 8 and 9 show the result of the plaque assay, represented in absolute figures. The most significant difference compared to infection with AdYB-1 alone is shown by transfection with the plasmid pE4orf6 and co-infection with the two viruses AdYB-1 and Ad-55K.
  • FIG. 8 shows the result of the plaque assay, represented in absolute figures. The most significant difference compared to infection with AdYB-1 alone is shown by transfection with the plasmid pE4orf6 and co-infection with the two viruses AdYB-1 and Ad-55K.
  • FIG. 9 shows the result of FIG. 8 , whereby the increase of the replication efficiency is represented as multifold of the replication determined for AdYB-1.
  • YB-1 localised in the nucleus controls adenoviral replication by means of activation of the adenoviral E2-late promoter. The combination of both effects can be used in order to provide for specific tumor lysis.
  • daunorubicine induces the replication of dl520 through nuclear localisation of YB-1.
  • dl520 creates a bigger tumorlytic effect in combination with the cytostatic daunorubicine compared to daunorubicine alone.
  • the HeLa (YB-1 nucleus-negative) and 257RDB (YB-1 nucleus-positive) cells used in this in vivo study were expanded under sterile cell culture conditions. Prior to the injection of the cells into mice (strain CD1NuNu) in order to generate a subcutaneous tumor, the cells are harvested by trypsinisation, taken up in DMEM medium (10% FCS), counted and washed with PBS one time. Subsequently, the cells are centrifuged, the PBS aspired and the cells are portioned in fresh PBS with the desired cell number. The cell number which was subcutaneously injected in this study, was each 5 ⁇ 10 6 cells of both cell lines.
  • the injection was performed subcutaneously into one flank of the animals, whereby HeLa cells were injected into the right side and 257RDB cells were injected into the left side for better distinction.
  • the virus and PBS as negative control, respectively were intratumorally applied.
  • the volumes to be injected were identical and were 50 ⁇ l each time. This was repeated on 3 consecutive days.
  • the overall dosage of applied viruses was 5 ⁇ 10 8 pfu.
  • the tumor growth was continued to be documented twice a week and the volume was calculated.
  • the mice were sacrificed and the tumors removed for further analysis.
  • FIG. 12 shows a diagram representing the tumor volume as a function of time and the various treatment schemes.
  • the tumor was formed by RDB257, there was a significant growth of the tumor to about 438 mm 3 to 1466 mm 3 upon injection of PBS.
  • the vector dl520 which was used in accordance with the invention, tumor growth could be reduced significantly. Starting from a mean tumor size of 344 mm 3 , the tumor size increased only by 21% to a total of 543 mm 3 .
  • the tumor consisting of HeLa cells was used as a control which upon administration of PBS behaved similarly to the RDB257 based tumor upon administration of PBS.
  • FIG. 13 shows a picture of the sacrificed nude mice which had a tumor grown using RDB257. It can be clearly seen that after the application of adenovirus dl520 in accordance with the present invention a significant reduction of the tumor occurred. In the present case there was even a reduction in the tumor volume (day 1 after administration of virus dl520: 515 mm 3 ; day 30 after administration of virus dl520: 350 mm 3 ).
  • DNA was extracted from a tumor sample which has been taken from the middle of the tumor developed in example 9.
  • the Dneasy Tissue Kit of Qiagen is used for isolation. The DNA isolation is done in accordance with manufacturer's instructions. In accordance therewith, the DNA was released from the cells through alkaline lysis. Subsequently, the isolated DNA is purified over a column. Subsequently, the concentration of the isolated DNA is determined by photometry at 260 nm. The analysis was performed using 2 ⁇ g of the DNA samples which were digested with 10 units of restriction enzyme Kpn I. Subsequently, an electrophoretic separation of the samples was performed in a 0.8% agarose gel.
  • the DNA was blotted onto a nylon membrane (performed according to the system of Schleicher & Schuell).
  • the DNA blotted onto the membrane is hybridised against a specific 1501 bp DNA probe.
  • the 1501 bp DNA probe specifically binds to the 3369 bp Kpn I fragment within the E2A coding Ad5 sequence.
  • the probe was prepared by PCR (primer: 5′- GTC GGA GAT CAG ATC CGC GT, 5′- GAT CCT CGT CGT CTT CGC TT) and radioactively labelled using 32 P.
  • the membrane is washed and exposed to a film.
  • FIG. 14 The result of the Southern Blot of tumor DNA is depicted in FIG. 14 .
  • the analysis confirms that only dl520 replicates in vitro in resistant cells RDB257, as depicted in lanes 3, 4 and 5.
  • Lane 1 shows as positive control Ad-5d
  • lane 6, 7 and 8 show DNA from HeLa cells which were infected with dl520.
  • HeLa cells are not YB-1 nucleus positive the virus dl520 did not replicate so that, in accordance therewith, the E2A sequence could not be detected.
  • FIG. 15 A further result with dl520 is depicted in FIG. 15 .
  • the particle formation (pfu/ml) was investigated after infection with dl520 and wildtype adenovirus.
  • Various YB-1 nucleus-positive (257RDB and 181RDB) tumor cells and YB-1 nucleus-negative tumor cells were infected with dl520 and wildtype adenovirus.
  • the result of the plaque assay shows that dl520 is replicating in YB-1 nucleus-positive cells (257RDB and 181RDB) similar to wildtype adenovirus. Insofar a replication efficiency can be observed similar to the one of wildtype adenoviruses when using, in accordance with the present invention, the adenoviruses described herein.
  • FIG. 16 shows the structural design of the adenoviral vector Xvir03.
  • the adenovirus Xvir03 is a so-called E1/E3-deleted adenovirus. This means that no E1A, E1B and E3 proteins are manufactured which are functional in adenoviral replication.
  • the deletion of the E1 region extends from 342-3528; the deletion of the E3 region of the amino acid position 27865-30995.
  • the term “E1-deleted virus” means a virus in which E1 is no longer functionally active. This can be achieved by inactivation with an otherwise mostly intact nucleic acid and amino acid sequence, however, can also mean a deletion of the E1 region coding proteins having various sizes.
  • the E4 region such as E4orf6
  • E4orf6 is only weakly expressed (about 1-5% compared to wildtype adenoviruses) or expressed not at all.
  • the viral genes E1B55k and E4orf6 are expressed in the E1 region by means of the heterologuous CMV promoter (Clontech: Plasmid pShuttle) introduced into Xvir03. Instead of the CMV promoter each and any of the promoters as disclosed herein in connection with the expression of E1A can be used.
  • the open reading frame of both genes is linked with each other by means of a so-called IRES sequence (engl. internal ribosomal entry site) (Pelletier, J. and Sonenberg, N. Nature, 1988, 334, 320-325).
  • IRES sequence engagingl. internal ribosomal entry site
  • the vector was manufactured as follows:
  • E1B55k-pShuttle The plasmid E1B55k-pShuttle was created by cloning the open reading frame of E1B55k from pCGNE1B from M. Dobelstein (University of Marburg) with XbaI and BfrI into the pShuttle vector from Clontech. Subsequently, E1B55k in pShuttle was linearised with ApaI, the ends blunt ended and cut with NheI.
  • the fragment IRES-E4orf6 was linked with the open vector E1B55k-pShuttle (blunt, NheI).
  • the cassette was subsequently cloned from the E1B55k-IRES-E4orf6-pShuttle together with the CMV promoter and the bovine growth hormone (BGH)-PolyA into the ⁇ E1, ⁇ E3 Adeno-X-Plasmid (Clontech) with I-Ceu I and PI-SceI, and referred to as AdcmvE1B/IRES/E4orf6. Subsequently, the adenovirus was made in accordance with manufacturer's instructions (Clontech).
  • the adeno plasmid which was linearised with PacI having the expression element CMV-E1B55k-IRES-E4orf6-BGH polyA was transfected into HEK293 cells and 11 days post transfectionem the ablating cells were removed together with the medium in order to release the adenoviruses through repeated freeze-thaw cycles.
  • the vector described above is in principle suitable as are the other viruses described herein for use in accordance with the present invention.
  • the afore-described vector is suitable to replicate and trigger lysis insofar, in cells which are YB-1 nucleus-positive cells as well as in cells where YB-1 is deregulated, i. e. is overexpressed compared to normal cells and non-tumor cells, respectively.
  • the use of this vector particularly applies to those diseases and groups of patients or collectives of patients which are disclosed in connection with the other adenoviruses which are described herein to be used in accordance with the present invention and the other adenoviruses of the present invention disclosed herein.
  • Xvir03/01 is a further development of Xvir03.
  • Therapeutic genes such as, for example, the genes described herein and the transgene can be cloned into the E3 region. Additionally, a deletion was introduced into the E4 region so as to avoid homologous recombination with the E4orf6 from the expression cassette of Xvir03. This allows that larger transgenes can be cloned in this construct.
  • the deleted E3 region contains SacI, NdeI and NheI restriction sites for introducing a cassette, into which, for example, the therapeutic transgenes can be cloned.
  • the pAdenoX-Plasmid of Clontech has a restriction site for SfuI behind the 3′ ITR region which is absent in wildtype adenovirus.
  • the expression cassette was subsequently, as described for Xvir03, cloned with I-Ceu I and PI-SceI from the E1B55k-IRES-E4orf6-pShuttle together with the CMV promoter and the bovine growth hormone (BGH)-PolyA into pAdenoX E3 ⁇ 27865-30995,E4 ⁇ 33241-33875 and referred to as AdcmvE1B/IRES/E4orf6- ⁇ E4. Subsequently, the adenovirus was made in accordance with manufacturer's instructions (Clontech).
  • the afore-described vector is in principle useful as are the other viruses described herein to be used in accordance with the present invention.
  • the afore-described vector is suitable to replicate in YB-1 nucleus-positive cells as well as cells in which YB-1 is deregulated, i. e. is overexpressed compared to normal cells and non-tumor cells, and to cause lysis insofar.
  • This vector can also be used for those diseases and groups of patients and collectives of patients which are disclosed herein for the other adenoviruses to be used in accordance with the present invention and the adenoviruses in accordance with the present invention.
  • the multidrug resistant cells which have YB-1 in the nucleus show lysis after infection with Ad312 and Xvir03 only in case of Xvir03 as represented by the crystal violet staining of the cells.
  • the medium is removed.
  • the cells are covered with crystal violet (50% ETOH, 3% formaldehyde, 5% acetic acid, 1% crystal violet) and incubated at room temperature for 5-10 min.
  • the six well plates are thoroughly rinsed with water and dried at room temperature.
  • E1A-deleted viruses e. g. Ad312
  • Ad312 E1A-deleted viruses
  • MOIs Nevins J. R., Cell 26, 213-220, 1981
  • E1A-like activity The adenovirus Ad312 as used herein, is an E1 Adeleted virus.
  • the early adenoviral genes such as E1B55k and E4orf6 are not expressed or expressed only to a very small extent (Nevins J. R., Cell 26, 213-220, 1981). As already described herein, these genes and proteins play an important role in viral replication. In contrast thereto, these genes and proteins, respectively, are expressed by adenovirus Xvir03 ( FIG. 16 ). As may be taken from FIGS.
  • the expression of the genes E1B55k and E4orf6 will result in an efficient viral replication and cell lysis at a concomitantly lower infection titer required (expressed as pfu/cell).
  • the titer required therefor of only 1 to 5 pfu/cell now allows for clinical application.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
US10/515,238 2002-05-27 2003-05-27 Novel use of adenoviruses and nucleic acids coding therefor Abandoned US20060099178A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US12/769,435 US10155930B2 (en) 2002-05-27 2010-04-28 Use of adenovirus and nucleic acids coding therefor
US15/452,470 US10538744B2 (en) 2002-05-27 2017-03-07 Use of adenovirus and nucleic acids coding therefor
US16/176,461 US10731136B2 (en) 2002-05-27 2018-10-31 Use of adenovirus and nucleic acids coding therefor

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
DE2002123534 DE10223534A1 (de) 2002-05-27 2002-05-27 Verwendung von Adenoviren und dafür codierenden Nukleinsäuren
DE10223534.1 2002-05-27
DE10225400.1 2002-06-07
DE10225400 2002-06-07
DE10248039 2002-10-15
DE10248039.7 2002-10-15
DE10322530 2003-05-19
DE10322530.7 2003-05-19
PCT/EP2003/005583 WO2003099859A2 (de) 2002-05-27 2003-05-27 Neue verwendung von adenoviren und dafür codierenden nukleinsäuren

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/005583 A-371-Of-International WO2003099859A2 (de) 2002-05-27 2003-05-27 Neue verwendung von adenoviren und dafür codierenden nukleinsäuren

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/769,435 Continuation US10155930B2 (en) 2002-05-27 2010-04-28 Use of adenovirus and nucleic acids coding therefor

Publications (1)

Publication Number Publication Date
US20060099178A1 true US20060099178A1 (en) 2006-05-11

Family

ID=29587746

Family Applications (5)

Application Number Title Priority Date Filing Date
US10/515,238 Abandoned US20060099178A1 (en) 2002-05-27 2003-05-27 Novel use of adenoviruses and nucleic acids coding therefor
US12/769,435 Expired - Lifetime US10155930B2 (en) 2002-05-27 2010-04-28 Use of adenovirus and nucleic acids coding therefor
US15/452,470 Expired - Fee Related US10538744B2 (en) 2002-05-27 2017-03-07 Use of adenovirus and nucleic acids coding therefor
US16/176,461 Expired - Fee Related US10731136B2 (en) 2002-05-27 2018-10-31 Use of adenovirus and nucleic acids coding therefor
US16/704,669 Expired - Lifetime US11268073B2 (en) 2002-05-27 2019-12-05 Use of adenovirus and nucleic acids coding therefor

Family Applications After (4)

Application Number Title Priority Date Filing Date
US12/769,435 Expired - Lifetime US10155930B2 (en) 2002-05-27 2010-04-28 Use of adenovirus and nucleic acids coding therefor
US15/452,470 Expired - Fee Related US10538744B2 (en) 2002-05-27 2017-03-07 Use of adenovirus and nucleic acids coding therefor
US16/176,461 Expired - Fee Related US10731136B2 (en) 2002-05-27 2018-10-31 Use of adenovirus and nucleic acids coding therefor
US16/704,669 Expired - Lifetime US11268073B2 (en) 2002-05-27 2019-12-05 Use of adenovirus and nucleic acids coding therefor

Country Status (9)

Country Link
US (5) US20060099178A1 (enExample)
EP (1) EP1506021B1 (enExample)
JP (3) JP5213298B2 (enExample)
KR (1) KR101083450B1 (enExample)
CN (2) CN1655827B (enExample)
AU (2) AU2003242585A1 (enExample)
CA (1) CA2487811A1 (enExample)
WO (1) WO2003099859A2 (enExample)
ZA (1) ZA200409361B (enExample)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100310554A1 (en) * 2004-12-31 2010-12-09 Per Sonne Holm Methods for Reversing Multiple Resistance in Animal Cells
US20110275093A1 (en) * 2003-11-14 2011-11-10 Per Sonne Holm Novel use of adenoviruses and nucleic acids that code for said viruses
US20150374766A1 (en) * 2013-03-14 2015-12-31 Salk Institute For Biological Studies Oncolytic adenovirus compositions
US10155930B2 (en) 2002-05-27 2018-12-18 Per Sonne Holm Use of adenovirus and nucleic acids coding therefor
US11130968B2 (en) 2016-02-23 2021-09-28 Salk Institute For Biological Studies High throughput assay for measuring adenovirus replication kinetics
US11401529B2 (en) 2016-02-23 2022-08-02 Salk Institute For Biological Studies Exogenous gene expression in recombinant adenovirus for minimal impact on viral kinetics
US11813337B2 (en) 2016-12-12 2023-11-14 Salk Institute For Biological Studies Tumor-targeting synthetic adenoviruses and uses thereof
US12365878B2 (en) 2018-04-09 2025-07-22 Salk Institute For Biological Studies Oncolytic adenovirus with enhanced replication properties comprising modifications in E1A, E3, and E4

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060270016A1 (en) * 2003-11-14 2006-11-30 Holm Per S Novel adenoviruses, nucleic acids that code for the same and the use of said viruses
US8361976B2 (en) 2004-07-09 2013-01-29 University Of Massachusetts Therapeutic alteration of transplantable tissues through in situ or ex vivo exposure to RNA interference molecules
EP1830864A2 (de) * 2004-12-31 2007-09-12 Per Sonne Holm E1 -minus adenoviren und deren verwendung
WO2012022496A2 (en) 2010-08-19 2012-02-23 Per Sonne Holm Method for killing tumor stem cells
CA3092907A1 (en) 2018-03-05 2019-09-12 Klinikum Rechts Der Isar Der Technischen Universitat Munchen Treatment of tumors by a combination of an oncolytic adenovirus and a cdk4/6 inhibitor
EP3810638A1 (en) * 2018-06-25 2021-04-28 Ospedale San Raffaele S.r.l. Gene therapy
US20220354911A1 (en) 2019-09-05 2022-11-10 Klinikum Rechts Der Isar Der Technischen Universität München Treatment of tumors by a combination of an oncolytic adenovirus, a cdk4/6 inhibitor and a further therapeutically active agent
EP4123021A4 (en) * 2020-03-23 2024-05-15 Curigin Co.,Ltd. Structure of oncolytic virus comprising bispecific nucleic acid molecule
CN114540349B (zh) * 2020-11-27 2024-11-22 中国科学院分子细胞科学卓越创新中心 结合yb-1蛋白的核酸分子
EP4404947A4 (en) 2021-09-23 2025-12-10 Sagittarius Bio Inc Adenovirus and Methods of Using Adenovirus

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801029A (en) * 1993-02-16 1998-09-01 Onyx Pharmaceuticals, Inc. Cytopathic viruses for therapy and prophylaxis of neoplasia
US6683059B1 (en) * 1996-10-18 2004-01-27 Board Of Regents, The University Of Texas System Mini-E1A gene and gene products
US6730662B1 (en) * 1996-07-05 2004-05-04 Mcgill University Adenovirus E4 proteins for inducing cell death
US7001596B1 (en) * 1999-11-15 2006-02-21 Onyx Pharmaceuticals, Inc. Oncolytic adenovirus

Family Cites Families (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US931830A (en) * 1907-09-17 1909-08-24 Harry Zimmerman Material-cutter.
US4947842A (en) 1988-09-22 1990-08-14 Medical Engineering And Development Institute, Inc. Method and apparatus for treating tissue with first and second modalities
KR970002255B1 (ko) 1990-06-11 1997-02-26 넥스스타 파아마슈티컬드, 인크. 핵산 리간드
PT931830E (pt) 1993-02-16 2001-08-30 Onyx Pharma Inc Virus citopaticos para terapia e profilaxia de neoplasia
US5698443A (en) 1995-06-27 1997-12-16 Calydon, Inc. Tissue specific viral vectors
WO1995034671A1 (en) 1994-06-10 1995-12-21 Genvec, Inc. Complementary adenoviral vector systems and cell lines
US5998205A (en) 1994-11-28 1999-12-07 Genetic Therapy, Inc. Vectors for tissue-specific replication
JP3827163B2 (ja) 1995-03-24 2006-09-27 ジェンザイム・コーポレーション 遺伝子治療用のアデノウイルスベクター
US5707618A (en) 1995-03-24 1998-01-13 Genzyme Corporation Adenovirus vectors for gene therapy
US6676935B2 (en) 1995-06-27 2004-01-13 Cell Genesys, Inc. Tissue specific adenoviral vectors
WO1997016547A1 (en) 1995-10-31 1997-05-09 The Board Of Regents, The University Of Texas System ADENOVIRUS-ANTISENSE K-ras EXPRESSION VECTORS AND THEIR APPLICATION IN CANCER THERAPY
US6022863A (en) 1996-05-21 2000-02-08 Yale University Regulation of gene expression
CA2259152C (en) 1996-07-05 2002-02-12 Philip E. Branton Adenovirus e4 proteins for inducing cell death
JP2001504448A (ja) 1996-08-30 2001-04-03 フュルステ，イェンス，ペーター 核酸の鏡面対称選択および進化
US5994132A (en) 1996-10-23 1999-11-30 University Of Michigan Adenovirus vectors
AU5253998A (en) 1996-11-13 1998-06-03 Board Of Regents, The University Of Texas System Diminishing viral gene expression by promoter replacement
US6080578A (en) 1996-12-31 2000-06-27 Onyx Pharmaceuticals, Inc. Cytopathic adenoviral E1B mutated viruses for therapy and prophylaxis of neoplasia
US6100086A (en) 1997-04-14 2000-08-08 Genzyme Corporation Transgene expression systems
EP1002103B1 (en) 1997-08-04 2007-10-17 Cell Genesys, Inc. A human glandular kallikrein enhancer, vectors comprising the enhancer and methods of use thereof
DE19742706B4 (de) 1997-09-26 2013-07-25 Pieris Proteolab Ag Lipocalinmuteine
NZ518945A (en) 1997-10-09 2007-03-30 Wellstat Biologics Corp Treatment of neoplasms with viruses
CN1110553C (zh) * 1998-07-15 2003-06-04 杭州赛狮生物技术开发有限公司 基因工程腺病毒及其用途
CA2345211A1 (en) 1998-10-15 2000-04-20 John A. Howe Recombinant e1a deleted adenoviral vectors
US6649158B1 (en) 1998-10-15 2003-11-18 Canji, Inc. Methods and compositions to induce antitumor response
DE19860602A1 (de) 1998-12-29 2000-07-06 Max Delbrueck Centrum Gentransfervektor für die Diagnostik und die Therapie von malignen Tumoren
US6428968B1 (en) 1999-03-15 2002-08-06 The Trustees Of The University Of Pennsylvania Combined therapy with a chemotherapeutic agent and an oncolytic virus for killing tumor cells in a subject
GB9906815D0 (en) 1999-03-24 1999-05-19 Isrec Anti-neoplastic viral agents
DE19929569A1 (de) 1999-06-21 2000-12-28 Holm Per Sonne Mittel zur Behandlung maligner Erkrankungen unter Verwendung des Proteins YB-1
AU6425800A (en) 1999-06-30 2001-01-22 Max-Delbruck-Centrum Fur Molekulare Medizin Agents for the diagnosis, prognosis and treatment of malignant diseases
US6955808B2 (en) 1999-09-24 2005-10-18 Uab Research Foundation Capsid-modified recombinant adenovirus and methods of use
US6635476B1 (en) * 1999-10-15 2003-10-21 Canji, Inc. Targeted vectors
US6140126A (en) 1999-10-26 2000-10-31 Isis Pharmaceuticals Inc. Antisense modulation of Y-box binding protein 1 expression
DE10015413A1 (de) 2000-03-23 2001-09-27 Max Delbrueck Centrum Mittel zur Diagnose und Therapie viraler Erkrankungen
EP1301612A2 (en) 2000-05-31 2003-04-16 Genvec, Inc. Method and composition for targeting an adenoviral vector
AU784975B2 (en) 2000-10-11 2006-08-10 Sumitomo Chemical Company, Limited DNA-binding protein YB-1-containing collagen accumulation inhibitors
AU2002235141A1 (en) 2000-11-27 2002-06-03 Geron Corporation Glycosyltransferase vectors for treating cancer
US20030095989A1 (en) 2000-12-18 2003-05-22 Irving John M. Chimeric cytolytic viruses for cancer treatment
AU2002229679B2 (en) 2000-12-28 2007-12-20 Per Sonne Holm Use of transcription factor YB-1 in adenoviral systems
DE10150945A1 (de) 2001-10-16 2003-04-17 Holm Per Sonne Adenovirale Systeme und deren Anwendungen
US20030138405A1 (en) 2001-04-17 2003-07-24 Juan Fueyo Conditionally replicative adenovirus to target the Rb and Rb-related pathways
WO2003025190A1 (en) 2001-09-14 2003-03-27 The New Industry Research Organization Tumor-specific promoter and use thereof
DE10150984A1 (de) 2001-10-16 2003-04-17 Holm Per Sonne Verwendung des adenoviralen E2-late-Promotors
WO2004001032A2 (en) 2002-04-25 2003-12-31 Crucell Holland B.V. Stable adenoviral vectors and methods for propagation thereof
CN1655827B (zh) 2002-05-27 2010-06-23 佩尔·松内·霍尔姆 腺病毒和编码其的核酸的新应用
US8951772B2 (en) * 2002-10-15 2015-02-10 Per Sonne Holm Adenoviruses, nucleic acids coding therefor, and use thereof
JP4988199B2 (ja) 2002-10-15 2012-08-01 ホルム，ペル・ゾンネ 新規アデノウイルス、それをコードする核酸及びその使用
CA2522380A1 (en) 2003-03-19 2004-09-30 Isogenis, Inc. Specific inhibition of allorejection
WO2005051430A1 (de) 2003-11-14 2005-06-09 Per Sonne Holm Neue verwendung von adenoviren und dafür codierenden nukleinsäuren
US20060270016A1 (en) 2003-11-14 2006-11-30 Holm Per S Novel adenoviruses, nucleic acids that code for the same and the use of said viruses
JP4621743B2 (ja) 2004-12-13 2011-01-26 カンジ，インコーポレイテッド 複製欠損アデノウイルスの産生のための細胞株
AU2006203736B2 (en) 2004-12-31 2012-03-29 Per Sonne Holm Method for reversing multiple resistance in animal cells
EP1830864A2 (de) 2004-12-31 2007-09-12 Per Sonne Holm E1 -minus adenoviren und deren verwendung
US20070292396A1 (en) 2006-03-02 2007-12-20 Juan Fueyo Combination therapy with oncolytic adenovirus

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801029A (en) * 1993-02-16 1998-09-01 Onyx Pharmaceuticals, Inc. Cytopathic viruses for therapy and prophylaxis of neoplasia
US5972706A (en) * 1993-02-16 1999-10-26 Onxy Pharmaceuticals, Inc. Cytopathic viruses for therapy and prophylaxis of neoplasia
US6730662B1 (en) * 1996-07-05 2004-05-04 Mcgill University Adenovirus E4 proteins for inducing cell death
US6683059B1 (en) * 1996-10-18 2004-01-27 Board Of Regents, The University Of Texas System Mini-E1A gene and gene products
US7001596B1 (en) * 1999-11-15 2006-02-21 Onyx Pharmaceuticals, Inc. Oncolytic adenovirus

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11268073B2 (en) 2002-05-27 2022-03-08 Per Sonne Holm Use of adenovirus and nucleic acids coding therefor
US10731136B2 (en) 2002-05-27 2020-08-04 Per Sonne Holm Use of adenovirus and nucleic acids coding therefor
US10538744B2 (en) 2002-05-27 2020-01-21 Per Sonne Holm Use of adenovirus and nucleic acids coding therefor
US10155930B2 (en) 2002-05-27 2018-12-18 Per Sonne Holm Use of adenovirus and nucleic acids coding therefor
US10300096B2 (en) 2003-11-14 2019-05-28 Per Sonne Holm Use of adenoviruses and nucleic acids that code for said viruses
US20110275093A1 (en) * 2003-11-14 2011-11-10 Per Sonne Holm Novel use of adenoviruses and nucleic acids that code for said viruses
US20170252443A1 (en) * 2004-12-31 2017-09-07 Per Sonne Holm Methods for reversing multiple resistance in animal cells
US20100310554A1 (en) * 2004-12-31 2010-12-09 Per Sonne Holm Methods for Reversing Multiple Resistance in Animal Cells
US20110286999A1 (en) * 2004-12-31 2011-11-24 Per Sonne Holm Methods for reversing multiple resistance in animal cells
US11369650B2 (en) 2004-12-31 2022-06-28 Per Sonne Holm Methods for reversing multiple resistance in animal cells
US20150374766A1 (en) * 2013-03-14 2015-12-31 Salk Institute For Biological Studies Oncolytic adenovirus compositions
US11077156B2 (en) * 2013-03-14 2021-08-03 Salk Institute For Biological Studies Oncolytic adenovirus compositions
US11130968B2 (en) 2016-02-23 2021-09-28 Salk Institute For Biological Studies High throughput assay for measuring adenovirus replication kinetics
US11401529B2 (en) 2016-02-23 2022-08-02 Salk Institute For Biological Studies Exogenous gene expression in recombinant adenovirus for minimal impact on viral kinetics
US12281324B2 (en) 2016-02-23 2025-04-22 Salk Institute For Biological Studies Exogenous gene expression in recombinant adenovirus for minimal impact on viral kinetics
US11813337B2 (en) 2016-12-12 2023-11-14 Salk Institute For Biological Studies Tumor-targeting synthetic adenoviruses and uses thereof
US12365878B2 (en) 2018-04-09 2025-07-22 Salk Institute For Biological Studies Oncolytic adenovirus with enhanced replication properties comprising modifications in E1A, E3, and E4

Also Published As

Publication number Publication date
EP1506021B1 (de) 2019-05-01
KR20050008744A (ko) 2005-01-21
US11268073B2 (en) 2022-03-08
KR101083450B1 (ko) 2011-11-16
AU2010219364B2 (en) 2011-06-09
US10155930B2 (en) 2018-12-18
AU2003242585A1 (en) 2003-12-12
WO2003099859A3 (de) 2004-04-15
JP2012179058A (ja) 2012-09-20
CN101843641A (zh) 2010-09-29
JP5719800B2 (ja) 2015-05-20
AU2003242585A2 (en) 2003-12-12
WO2003099859A2 (de) 2003-12-04
US20190055522A1 (en) 2019-02-21
CN1655827B (zh) 2010-06-23
CA2487811A1 (en) 2003-12-04
CN1655827A (zh) 2005-08-17
JP2006512284A (ja) 2006-04-13
EP1506021A2 (de) 2005-02-16
US20180002674A1 (en) 2018-01-04
US20200095560A1 (en) 2020-03-26
US20110033424A1 (en) 2011-02-10
US10731136B2 (en) 2020-08-04
AU2010219364A1 (en) 2010-09-30
CN101843641B (zh) 2014-09-17
JP2014224141A (ja) 2014-12-04
JP5213298B2 (ja) 2013-06-19
US10538744B2 (en) 2020-01-21
ZA200409361B (en) 2005-08-31

Similar Documents

Publication Publication Date Title
US11268073B2 (en) Use of adenovirus and nucleic acids coding therefor
US10300096B2 (en) Use of adenoviruses and nucleic acids that code for said viruses
US8586354B2 (en) Adenoviruses, nucleic acids that code for the same and the use of said viruses
AU2010257327B2 (en) Adenovirus expressing genes in reverse order and use thereof
KR101123510B1 (ko) 신규한 아데노바이러스, 이를 암호화하는 핵산 및 이들의 조성물
AU2015201828B2 (en) Novel use of adenoviruses and nucleic acids coding therefor
CN1705740B (zh) 具有反向基因表达的腺病毒及其应用

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION