SK62593A3 - Method of constructing synthetic leader sequences - Google Patents

Abstract

A yeast expression cloning vector comprising the following sequence 5'-SP-Xn-3'-RS-5'-Xm-(NZT)p-Xq-PS-*gene*-3' wherein SP is a DNA sequence encoding a signal peptide, Xn is a DNA sequence encoding n amino acids, wherein n is 0 or an integer of from 1 to about 10 amino acids, RS is a restriction endonuclease recognition site provided at the junction of Xn and Xm, Xm is a DNA sequence encoding m amino acids, wherein m is 0 or an integer from 1 to about 10, (NZT)p is a DNA sequence encoding Asn-Xaa-Thr, wherein p is 0 or 1, Xq is a DNA sequence encoding q amino acids, wherein q is 0 or an integer from 1 to about 10, PS is a DNA sequence encoding a peptide defining a yeast processing site, and *gene* is a DNA sequence encoding a heterologous polypeptide. The vector may be used to construct synthetic leader peptide sequences by inserting random DNA fragments in the "RS" site, culturing a yeast cell transformed with this vector and screening the culture for secretion of the heterologous polypeptide.

Description

Yeast organisms produce many proteins that are synthesized intracellularly. but which have a function outside the cell. Such extracellular proteins are referred to as secreted proteins. These secreted proteins are secreted initially within the cell in a precursor or pre-protein form containing a presequence to ensure efficient secretion of the secreted product by the endoplasmic reticulum (ER) membrane. The presequence, generally referred to as the signal peptide, is generally cleaved from the desired product during translocation. As soon as he enters the exclusion path. Protein is transferred to GolgiZ Golgi can proceed through different pathways that lead to sections such as the cell vacuole or cell membrane, or they can leave the cell and be secreted into the external environment of CS.R. Pfeffer and J.L. Rothman, Ann. Rev. Biochem. 56, p. 829, 1987).

Various methods of expression and secretion in yeast proteins heterologous to yeast have been proposed. European Patent Application Publication No. 88,632 describes the manner in which yeast, heterologous proteins are expressed. processing and secretion by transforming the yeast organism with an expression binder anchoring DNA encoding the desired protein and signal peptide, to prepare a culture of the transformed organism, to grow the culture, and to recover the protein from the culture medium. The signal peptide may be a signal peptide of the desired peptide itself, a heterologous signal peptide, or a hybrid of a native and heterologous signal peptide.

A problem with the use of signal peptides heterologous to yeast may be the fact that the heterologous signal peptide does not ensure efficient translocation and / or cleavage of the signal peptide.

S. cerevisiae MF 1 ((X-factor) is synthesized as a 165 amino acid preprofonna containing a 19 amino acid signal or prepeptide followed by a 64 amino acid leader or propeptide having three V-linked glycosylation sites followed by (LysArg (Asp / Glu.Ala) 2- (J-Kurjan and I. Herskovitz, Cell 30, pp. 933-943, 1982) The preproMf1 signaling leader is widely used to achieve synthesis and secretion of heterologous protein in S. cerevisiae.

The use of yeast signaling / leader peptides is known, for example, from U.S. Pat. No. 4,546,082, European Patent Application Publication No. 116201, 123294, 123544, 163529, and 123289, and Danish Patent Application Publication No. 3614/83.

According to European Patent Application No. 123289 is used

S. cerevisiae (X-factor precursor), wherein WO 84/01153 suggests the use of the Saccharomyces cerevisiae invertase signal peptide, and the published Danish application 3614/83 uses Saccharomyces cerevisiae PHO5 signal peptide for secretion of foreign proteins.

U.S. Pat. No. 4,560,882 and European Patent Nos. 16201, 123294, 123544 and 163529 disclose a method according to which the IX-factor signal leader C'signal-leader of Saccharomyces cerevisiae (MF * K1 or MF C (2 Described herein is a fusion of a DNA sequence encoding the Saccharomyces cerevisiae MF1 signal leader sequence to terminate the 5 'gene for the desired protein secretion and processing of the desired protein.

European Patent Specification No. 206783 discloses a system for secreting polypeptides from Saccharomyces cerevisiae, wherein the c (-factor leader sequence) is truncated to eliminate the four N -factor peptides contained on the native leader sequence, thereby releasing the leader peptide itself aligned to the heterologous polypeptide through the -factor processor LysArgGluAlaGluAla _{1 '} sites This construct is said to lead to an efficient method of making smaller peptides (containing less than 50 amino acids) For secretion and processing of larger polypeptides, the native-factor leader sequence is cut to release one or two factor peptides between the leader. peptide and polypeptide.

The number of secreted proteins is directed to be subjected to a proteolytic processing system that can cleave the peptide bond at the carboxyl terminus of the two following basic amino acids. This enzymatic activity is encoded by the KEX 2 gene in Saccharomyces cerevisiae (D-A. Julius et al. Cell 37, p. 1075, 1984b). Treatment of KEX 2 with the gene product is required for secretion of active Saccharomyces cerevisiae factor 1 (MF (λ 1 or -factor), but is not included in the secretion of active S. cerevisiae factor *).

The secretion and proper processing of the polypeptide to be the result of secretion is achieved in some cases when yeast organisms are cultured and transformed with a vector constructed as above. In many cases, however, the secretion level is very low or secretion does not occur at all, or the proteolytic processing may be incorrect or incomplete. It is therefore an object of the invention to provide leader peptides which provide for more efficient expression and / or processing of heterologous polypeptides.

SUMMARY OF THE INVENTION

The principle of the method of constructing a synthetic leader peptide sequence for the secretion of heterologous polypeptides in the yeast according to the invention is to:

a) introduces a statistical DNA fragment into a yeast expression vector comprising the sequence

5 '-SP-Xn-3'-RS-5'-X _m - (NZT) p-Xq-PS- ^, 'gen' ^t -3 '*

where it means

SP DNA sequence encoding signal peptide,

Xn DNA sequence encoding n amino acids, wherein n is or an integer of 1 to about 10 amino acids.

An RS restriction endonuclease recognizing site for the insertion of statistical DNA fragments that is at the junction of Xn and Xm,

Xm DNA sequence encoding m amino acid, wherein m is 0 or an integer from 1 to about 10 amino acids, (NZT) p DNA sequence encoding Asn-Xaa-Thr, wherein m is 0 or number 1,

Xq a DNA sequence encoding q amino acids, wherein q is 0 or an integer of 1 to about 10 amino acids,

A PS DNA sequence encoding a peptide defining a yeast, processing site, and geometry sequence encoding a heterologous polypeptide.

^PART B) transforming the yeast host cell with the expression vector of step J (a),

I! c) culturing the transformed host cell according to step (b) under suitable conditions; and

d) screening the culture according to step (c) for secreting the heterologous polypeptide.

'i; j i

Surprisingly, it has been found that it is possible to move (X-factor leader peptide by many different DNA sequences to achieve secretion of heterolocphic polypeptide in yeast. Based on this discovery, a method has been developed in which statistical DNA fragments are cloned into yeast vectors downstream The sequence encoding the signal peptide and upstream of the DNA sequence encoding the heterologous polypeptide After transformation with the vectors, the yeast cells are sorted for secretion of the desired heterologous polypeptide.

The invention therefore relates in particular to the above-defined method for constructing a synthetic leader peptide sequence for the secretion of heterologous polypeptides in yeast.

As used herein, the term leader peptide is intended to enable a heterologous polypeptide to be directed from an endoplasmic reticulum to a Golgi apparatus and further to a secretory binder for secretion into the environment (i.e., export of the extruded polypeptide through the cell wall or at least through the cell membrane to the periplasmic region). . By the term synthetic in the context of leader peptides, it is always meant herein that the leader peptide constructed in accordance with the invention has not been found in nature.

The term signal peptide always refers to a presequence which is predominantly hydrophobic in nature and is contained as an N-terminal sequence in yeast. The function of the signal peptide is to allow secretion of the heterologous protein into the endoplasmic reticulum. As a rule, the signal peptide is cleaved during this process. The signal peptide may be heterologous or homologous to the yeast protein producing organism as explained above. However, much more efficient cleavage of the signal peptide is achieved when it is homologous to the particular yeast organism.

By heterologous polypeptide is meant a polypeptide that is not produced by natural host yeast organisms. In the method of the invention, the heterologous polypeptide is preferably a polypeptide whose secretion by transformed yeast cells can be readily detected, for example, by establishing standard methods such as immunological screening using antibodies reactive with the polypeptide of interest (see, e.g., Sambrook, Fritsch and Maniatis, Molecular Cloning ^: A Laboratory Manual (Cold Spring Harbor, New York, 1989) or by screening for the specific biological activity of a heterologous peptide. Positive Sorting Result Indicates that a leader peptide useful for secreting a heterologous polypeptide in yeast has been constructed.

By "statistical DNA fragment" is meant any DNA sequence of at least three nucleotides in length, for example obtained by digesting genomic DNA (of any organism) with a restriction endonuclease or restriction endonuclease, or preparing synthetic DNA, for example, by the phosphioaridate method described by SL-Beaucut and HHC Tetrahedron Letters 22. 1859-1860, 1981.

The Asn-Xaa-Thr peptide encoded by (NZT) β is an asparagine-linked glycosylation site. Xaa is any of the known amino acids except proline.

The invention also relates to a yeast expression cloning vector comprising the following sequence

5 ' -SP-Xn-3 ' -RS-5 ' -Xm- (NZT) _P -X < ₁ -PS-geii ~ 3 ' wherein each symbol has the meaning given above.

This vector can be used for a method of constructing a synthetic leader peptide sequence as described above.

The invention also relates to a yeast expression vector comprising the following sequence

5 '-SP-Xn-statistical DNA-Xin- (NZT) p-Xq-PS- ^ gene ”-3' where the term statistical DNA” fragment inserted into the restriction endonuclease recognizing site at the junction of Xn and Xm and the other symbols above this meaning.

'In this vector, the leader peptide sequence (identified by the method of the invention) is composed of the sequence' Xn-statistical DNA-Xni- (NZT) _P -X _q '.

wherein each symbol has the meaning given above. Such a vector can be used for the products of the desired heterologous polypeptide.

The invention also relates to a method of preparing a heterologous polypeptide in yeast, wherein a yeast cell capable of expressing the heterologous polypeptide is transformed and transformed with a yeast expression vector as described above, including a leader peptide sequence constructed by the method of the invention in a suitable environment to obtain expressing and secreting the heterologous polypeptide, whereupon the heterologous peptide is finally recovered from the environment.

The length of the statistical DNA fragment incorporated into the expression vector is not critical. However, in order to be suitable for manipulation, the fragment is preferably 16 to 600 base pairs in length. In particular, the fragment has a length of about 15 to about 300 base pairs. It is currently believed that a suitable fragment length is about 30 to about 150 base pairs.

! Preferably, the statistical DNA fragment encodes a high proportion of polar amino acids. These amino acids are selected from the group consisting of Glu, Asp, Arg, His, Thr, Ser. Asn and Gin. In this context, the term "high fraction" means that the DNA fragment encodes a greater number of polar amino acids than the ability of other DNA sequences of corresponding length. Irrespective of or above, it may be advantageous for the fragment to encode at least one proline.

In Sequence 1

5 '-Sp-Xn-3' -RS-5 '-Xm- (NZT) p-Xc, -PS- ^ gene ^ -S' means n and / or m and / or q preferably 1 or greater than

1. In particular all symbols n, m. and q is 1 or greater than 1 and the other symbols are as defined above.

* There are some facts (cf.

WO 89/02463) which confirm that the presence of an asparagine-linked glycosylation site in the leader sequence may support; secretion efficiency of the leader peptide. In sequence

i.

5 '-SP-Xn-3' -RS-5 '-Xin- (NZT) p-Xq-PS- gene ^{and x <3'} is just code vc preferably 1, wherein the other symbols are as defined above.

The signal peptide sequence (SP) can encode any; a signal peptide that provides efficient control of the extruded heologic polypeptide into the secretory pathway of the cell. The signal peptide may be a naturally occurring signal peptide or a functional portion thereof, or it may be a synthetic peptide. Vhodnýt. '·;

The signaling peptides are (faktor factor signaling peptides, signaling ‘, mouse salivary gland peptide. modified carboxypeptidase signal peptide. yeast BAR1 signal peptide or Humicola lanuginosa lipase signal peptide or a derivative thereof. Amylase · the mouse salivary signal sequence is described in the publication

O. Hagenbuchle et al., Nature 289. p. 643-646, 1981. The carboxypeptidase signal sequence is described in the publication

L-A. Valls et al. Cell 48, p. 887-897, 1987;

The BAK1 yeast r peptide is described in the world patent specification

VO 87/02670. The lipase signal peptide of Humicola lanuginosa is described in EP 305 216.

Yeast processing site. any paired combination of Lys and Arg, e.g. Arg-Lys. Lys-Lys or Arg-Arg. which allows the production of a heterologous KEX2 polypeptide by the protease Saccharorayces cerevisiae or an equivalent protease of another yeast species (D.A. Julius et al., Cell 37, from p. 1075, 1984). If the KEX2 process is not suitable, for example, cleavage of the polypeptide product is to be achieved, a processing site for another protease should be selected instead of including an amino acid combination not found in the polypeptide product. for example, the FXa process site. Ile-Glu-Cly-Arg (as described by Sambrook, Eritscli and Maniatis. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, New York, 1989).

The heterologous protein produced by the method of the invention may be any protein that is preferably produced by yeast. Examples of such proteins include aprotinin, tissue factor inhibitor or other protease inhibitors, insulin or insulin precursors, human or bovine growth factor interleukin, glucagon, tissue plasminogen activator, transforming growth factor or β, growth factor derived from their blood cells, functional analogues. The term "functional analog" refers to a polypeptide and a similar function to the native protein (it refers to nature rather than the biological activity level of the native protein). The polypeptide may be structurally similar to the native protein and may be derived from the native protein by adding one or more amino acids to either or both the C and N-termini of the native protein, replacing one or more amino acids at one or many different sites in the native amino acid sequence. deleting one or more amino acids at one or both termini of the native protein at one or more sites in the amino acid sequence, or inserting one or more amino acids at one or more sites in the native amino acid sequence. Such modifications are well known for many of the above proteins.

Statistical DNA fragment and sequence

5'-SP-Xn-3 · -RS-5'-X _m - (NZT) β-Xq-PS-xgenx-3 · wherein the individual symbols are as defined above, can be prepared synthetically by known methods, for example phosphoamidate methods. described by SL Beaucage and MH Caruthers. Tetrahedron Letters 22, p. 1859-1869, 1981, or by the method of Matthes et al., EMBO Journal 3, p. Oligonucleotides are synthesized by the phosphoamidate method, for example, in an automated DNA synthesizer, purified, thermally hybridized, ligated, and cloned into a yeast expression vector. Reminds that sequence

5'-SP-Xn-3'-RS-5'-Xm- (NZT) p-Xq-PS-xgenx-3 'where each symbol has the meaning given above may not be prepared by a single operation but may be formed from two or from several oligonucleotides prepared synthetically in such a manner.

A statistical DNA fragment or one or more parts of a sequence

5'-SP-Xn-3'-RS-5'-X _m -CNZT) p -Xq-PS-xgenx-3 'where the individual symbols are as defined above may also be of genomic or cDNA origin, for example obtained by genomic preparation or a cDNA library sorted for DNA sequences coding for said pairs (typically SP or xgenx) by hybridization using synthetic oligonucleotide probes together with standard methods (Sambrook, Fritsch and Maniatis.

Molecular Cloning: A Laboratory Manual (Molecular ^Cloning: A Laboratory Manual), Cold Spring Harbor, New York, 1989). In such a case, the genomic or cDNA sequence encoding the signal peptide may bind to a genomic or cDNA sequence encoding a heterologous protein, whereby the DNA sequence may be modified by incorporating synthetic oligonucleotides encoding the sequence in a known manner.

Xn-3'-RS-5'-X _m - (NZT) p -Xq-PS wherein each symbol is as defined above.

Statistical DNA fragment and / or sequence

5'-SP-Xn-3 '-RS-5'-Xni- (NZT) _P -Xq-PS-xgenx-3' wherein each symbol is as defined above may be of synthetic and genomic origin. the mixed origin of synthetic and cDNA or the mixed origin of genomic and cDNA, the preparation being carried out in a known manner by thermal hybridization of fragments of synthetic, genomic or cDNA origin (as appropriate), wherein the fragments correspond to different portions of the DNA sequence as a whole.

It is therefore possible to have an idea.

The DNA sequence encoding the signal peptide or heterologous polypeptide may be of genomic or cDNA origin.

while the sequence

Xn-3'-RS-5'-Xm ^- (NZT) β-Xq-PS can be synthetically prepared.

Preferred construction of DNA encoding insulin precursors. is illustrated in Sequence Listing ID Nos. 1-13 or modifications thereof. Examples of suitable modifications of the DNA sequence are nucleotide substitutions that do not result in growth to another amino acid sequence of the protein, which may, however, correspond to the codomic use of the yeast organism.

into which a DNA construct or nucleotide substitution is inserted. that allow growth into a different amino acid sequence. and thus a possible different protein structure. As another example of possible modification, the insertion of three or multiple of three nucleotides into the sequence, addition of three or multiple of three nucleotides to terminate the sequence, and resulting in three or multiple of three nucleotides either from the termination or from within the sequence.

A recombinant expression vector carrying the sequence

5'-SP-Xn-3'-RS-5'-Xin- (NZT) _P -Xq-PS-xgenx-3 · or

5'-SP-Xn-statistical DNa-X _m - (NZT) p -Xq-PS-xgenx-3 · wherein each symbol has the meaning given above. may be any vector that is capable of replicating in a yeast organism. In the vector, any DNA sequence may be operably linked to a suitable sequence promoter. The promoter can be any DNA sequence that exhibits transcriptional activity in yeast and can be derived from genes encoding proteins either homologous or heterologous to yeast. The promoter is preferably derived from a gene encoding a protein homolog to yeast. Examples of suitable promoters include Saccharomycetes cerevisiae MFX.1, TPI, ADII or PGK promoters.

The above sequences are also to be operably linked to a suitable terminator. such as the TPI terminator (see T. Alber and G. Kawasaki, J. Mol. Appl. Genet. 1: 419-434, 1982).

The recombinant expression vector of the invention further comprises a DNA sequence. allowing the vector to replicate in yeast. Examples of such sequences are the yeast plasmid 2 / v replication genes REP 1-3 and the origin of replication. The vector may also include a selectable marker, for example, the Schizosaccharomyces pombe TPI gene. as described by P. R. Russell, Gene 40. p. 125-130, 1985,

Processes used to ligate the sequence

5 * -SP-Xn-3'-RS-5'-X _m - (NZT) _P -Xq-PS-xgenx-3 'wherein the individual symbols have the above meanings, the statistical DNA fragment, the promoter and terminator and their incorporation into suitable yeast vectors containing the information necessary for yeast replication are well known to those skilled in the art (see e.g.

Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory

Manual (Molecular Cloning: Laboratory Manual) Cold Spring

Harbor, New York. 1989). It is clear that the vector can be constructed either by first preparing a DNA construct containing the entire sequence

5 * -SP'Xn-3'-RS-5'-X _m - (NZT) _β -Xq-PS-xgenx-3 'wherein each symbol has the above meaning and then incorporates this fragment into a suitable expression vector or subsequent incorporation DNA fragments containing genetic information for individual elements (such as signal peptide, sequences)

Xn-3'-RS-5'-Xm- (NZT) _β -Xq-PS wherein each symbol is as defined above, or heterologous polypeptide) followed by ligation.

The yeast organism used in the method of the invention may be any suitable yeast organism that produces large amounts of heterologous polypeptide of interest in culture. Examples of such yeast organisms include yeast strains of the species Saccharomyces cerevisiae, Saccharomyces kluyveri, Schizosaccharomyces porobe, and Saccharomyces porobe. For example, transformation of yeast cells can be accomplished by protoplast formation followed by transformation in a known manner. The cell culture medium used may be any medium for the growth of a yeast organism. The secreted heterologous protein, a significant proportion of which is contained in the medium in the properly produced form, can be obtained in a known manner, including the separation of yeast cells from the medium by centrifugation or filtration. by precipitation of the protein components of the supernatant or by filtration using a salt such as ammonium sulfate and subsequent purification by various chromatographic processes, such as ion exchange chromatography with affinity chromatography.

BRIEF accompanying ^drawings: FIG. 1 is a construction diagram of mPT7426m; FIG. 2 is a construction diagram of pLaC202.

FIG. 3 is the DNA sequence and deduced amino acid sequence at the cloning site in pLaC202 for the statistical DNA fragments (it is recalled that the sequence is cleaved at the ClaI site and that ligation without incorporating the statistical DNA results in a change in the reading frame) in FIG.

is a construction diagram of pLSC6315D =.

The invention is further illustrated by the following examples, which are not intended to limit the invention.

DETAILED DESCRIPTION OF THE INVENTION

Plasmid and DNA materials

All expression plasmids are of the C-POT type. All plastimides are described in published European Patent Application No. 171142 and are characterized by the content of Schizosaccharomyces pombe triose phosphate isomerase (POT) gene for plasmid selection and stabilization purposes. The plasmid containing the POT gene is available as a deposited E. coli strain (ATCL 39685). The plasmids further contain the S. cerevisiae triose phosphate isomerase promoter and terminator (Ptpi and Ttpx). They are identical to pMT742 (M. Lngel-Mitani et al., Gene 73: 113-120, 1988) (see FIG. 1). except for the region defined by the Sph-Xba I restriction sites including PTPI and the coding region for the signal / leader / product.

Ptpi is modified with respect to the sequence found in pMT742 only to facilitate construction operation. The internal SphI restriction site is eliminated by SphI cleavage. removing tails and religions. In addition, the DNA sequence upstream of the promoter and without any attack on the promoter is removed by Bal31 exonuclease processing followed by the addition of a SpHI restriction site linker. This promoter construct on the 373 bp SphI-EcoRI fragment was designated pMT7426 (FIG. 1).

A set of different DNA fragments occupies an optional site in the smaller E. coli plasmid p'1'7 described above (see WO 89/02463) only modified with respect to the above described PTPI, i.e. pT7 6. For statistical cloning, further as described, genomic DNAs of different origins are used. S. cerevisiae DNA is isolated from strain MT633 (deposited on 7 December 1990 in the German Collection of Microorganisms and Cell Cultures under the provisions of the Budapest Agreement at the International Assembly on the Deposit of Microorganisms for the Purpose of Patent Procedures under DSM 6278). A. oryzae DNA was isolated from strain A1560 (IFO 4177).

Finally, numerous synthetic DNA fragments are used, all synthesized on an automated DNA synthesizer (Applied Blosystems model 380A) using phosphoramidite chemistry and commercially available reagents (S-L.Beaucage and M. H. Caruthers, Tetrahedrom Letters 22, pp. 1859-1869). The oligonucleotides are purified by polyacrylamide gel electrophoresis under denaturing conditions. Prior to thermal hydridation, complementary pairs of such single chain DNAs are kinized using T4 polynucleotide kinase and ATP.

and

All other methods and materials are generally known (see, for example, J. Sambrook et al., Molecular Cloning ^: A Laboratory Manual.).

. ·!

I

Spring Harbor Laboratory Press. Cold Spring Harbor, Nev. 1989).

Example 1

Construction of pLaC202

The 490 bp SphI-Apal pT7 1966 (see WO 89/02463, Fig. 5) and the 179 bp Hinf1-XbaI fragment of pT7. ^ M13 (see WO 89/02463. Fig. 1) linked in the 11 kbXbaI-SphI fragment of pMT742 via a synthetic adapter;

NOR367 / 373 CAACCATCGATAACACCACTTTGGCTAAGAG CCGGGTTGGTAGCTATTGTGGTGAAACCGATTCTCTAA result in plasmid pLaC202 (Figs. 2 and 3 as well as SEQ ID No. 1).

This vector, containing a specific Cla I site, constitutes one embodiment of a statistical DNA cloning vector in which the gene produced encodes for the insulin precursor MI3 (B (1-29) -Ala-Ala-Lys-A (1-21)). The following examples relate to the leading elements cloned by this construction.

Example 2

Construction of pLSC6315 and pLSC5210

Whole DNA is isolated from S. cerevisiae strain MT663 and digested with Taql, HinPI or Taql + HinPI. The products are separated by size on a 1% agarose gel and fragments smaller than 600 bp are isolated from each of the three digestions.

pLaC202, pre-digested with Clyl. which has been prevented from self-ligation with calf intestinal alkaline phosphatase (CIAP) by dephosphorylation, is mixed with the fragment pools described above and ligated. The strain E. coli MT172 (MT172 = MC 1000 m + r-ara + leuB-6; MC 1000 (see M. Casadaban and S. Cohen, J. Mol. Biol. 138, 179 (1980)) is transformed with the above. using said ligation mixture to obtain suitable 5000 Aβ ^R transformants for each mixture. Recombinant plasmids were prepared from each of the three types in pools containing all 5,000 transformants. These plasmid pools are used to transform S. cerevislae strain MT663 and the resulting T0I transformants are immuno-classified for MI3 secretion.

• J

From the surprisingly large number of positive transformants, the eight apparently most potent and isolated plasmid contents were isolated.

As a result of this operation, most yeast-derived transformants are expected to have a heterophenous population of plasmids, and a degree of plasmid re-isolation is therefore performed to obtain true clones. Plasmid preparations from each of the eight reisolated yeast transformants are used to transform L1. coli strain MT172 to Ap ^R. Plasmids from 12 E. coli transformants for I

each of the eight yeast isolates is individually used to transform the yeast strain MT663, TP1 and MI3 secreting transformants are identified by immuno-sorting.

Sequencing of the eight isolated pLaC202 derivatives shows three different sequences. two of them pLSC6315 and pLSC5210 are the most potent carriers of M13 secretion. The sequences of the kioned DNA and flanking regions are shown in Sequence Listing ID Nos. 2 and 4.

I

Example 3

Modification of pLSC6315 i

PLSC6315 is selected to further modify the cloned synthetics; sequence leader.

í í

PLSC6315 was digested with ApaI endonuclease followed by endonuclease Beil31 treatment. After phenol extraction, the resulting DNA was digested with XbaI and DNA fragments smaller than the original 367 bp ApaI-XbaI fragment were isolated.

pLaC202 was digested with ClaI and the single stranded CG tails were removed followed by XbaI digestion and isolation of the 11 kb XbaI-] ClaI [fragment (] [means that the single stranded tails were cut off). This fragment was mixed with the pLSC6415 fragments isolated above and ligated (Fig. 6).

Transformation and sorting process. described in Example 2, is repeated with pLSC6315D3 and PLSC6315D7 is isolated as plasmids promoting MI3 secretion much more efficiently than the original pLSC6315 (see Sequence Listing ID No. 6 or 8).

Example 4

Construction of pLA01 - 5

All DNA from the microorganisms Aspergillus oryzae strain A1560 is processed as described above for the microorganism S. cerevisiae DNA in Example 2 and cloning and recloning is performed exactly as described in Example 2, except that the number of E. coli transformants in the first cloning is reduced to about 3000 per ligation mixture. This experiment leads to the isolation of five A. oryzae DNA clones that mediate secretion of the insulin precursor MI3 from S. cerevisiae in the pLaC202 context.

The sequencing of the inserts shows five different sequences, two of which (pLAG2 and pLA05) are much more effective when M13 secretion is intended. The DNA sequences of the inserts in pLA02 and pLA05 are shown together with the flanking regions in SEQ ID NO: 10 or 12.

Example 5

Yeast strains, anchoring plasmids. as described above.

are grown in YP1 environment (F. Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory 1981). For each strain, 6 individual 5 ml cultures are shaken at 30 ° C for 60 hours with a final QD600 of approximately 15. After centrifugation, the supernatant is removed for HPLC analysis to measure the secreted insulin precursor concentration as described by Leo Snel et al., Chromatographia 24, p. 329-322, 1987).

Table 1 shows the expression levels of the insulin precursor, MI3, using leader sequences isolated by the method of the invention, as a percentage of the level obtained with pMT742j transformants using the MF (1) S. cerevisiae leader.

Table I

42742 PLSL6315 PLSC5210 PLSC6315D3 PLSC6315D7 pLA02 PLAO5

100% 100%% 175% 120% 120%%

Industrial usability

A yeast expression vector comprising a sequence for the construction of synthetic leader peptide sequences.

Sequence list

Cl) General information

(Ci) Applicant: Novo Nordisk A / S

Cii) Title of the Invention: A method of constructing a synthetic leader peptide sequence

(I) Number of sequences: 13

C i (v) Mailing address:

(A) Address: Novo Nordisk A / S, Patent Department (B) Street: Novo AIL (C) City: Bagsvaerd (E) Country ^ Denmark ZIP: DK-2880

Cv) Computer-readable form:

(A) environment type: floppy disk (B) computer: IBM PC compatible (C) operating system: PC-D0S / MS-D0S

CD) software: PatentInRelease # 1.0, version # 1.25

Cvi) Current data on the application:

CA) application number (B) filing date (C) international classification

Cviii) Agent information (A) Name: Tlialsoe-Madsen. Birgit

CB) No-- 3540.204-VO

Cix) Telecommunication information:

CA) Phone: +45 4444 8888

CB) Fax: +45 4449 3256

CC) telex: 37304

C2) Information for SEQ ID NO ^: 1

Ci) Sequence characteristics:

CA) length: 335 base pairs

CB) type: nucleic acid

CC) chain: single chain

CD) topology: linear

Cii) Type of molecule: cDNA

Cxi) Sequence description: SQQ ID NO: 1:

GAAITCATTC AAGAATAGIT CAAACAAGAA G ^ TTACAAAC TATCAATTTC ATACACAATA60

TAAAOGATTA AAAGAATGAA AGTOTOCOCIG CIGCTITCCC TCATIGGATr CIGCIGGGCC .120

CAACCATOGA TAACACCACT TIGGCTAAGA GATTCGTIAA CCAACACTIG TGCGGTTCCC180

ACTIGGTTGA AGdTTGTAC TTGGTTIGOG GTGAAAGAGG TITCTTCTAC ACTCCTAAGG240

CTCCTAAGGG TATIGTOGAA CAATCCTGTA CCTCCATCIG CTCCTIGTAC CAATIGGAAA300

ACTACIGCAA CTAGAOGCAG CCOGCAGGCT CTAGAlis

C2) Information for SEQ ID NQ: 2:

Ci) Sequence characteristics:

(A) length ^: 492 base pairs (B) type: nucleic acid (C) chain: single chain

CD) topology: linear

Cii) Type of molecule: cDNA

Cix) Characteristics (A) Name / Key ^: CDS (B) Location: 76..468 (ix) Characteristics (A) Name / Key: sig peptide

CB) location: 76..309

(Clx) Characteristics

CA) name / key: mat peptide (B) location: 310..468

Cxi) Sequence description: SEQ ID NO ^: 2 ^:

GAAITCATTC AAGAATAGIT CAAACAAGAA GATIACAAAC TATCAA'i'ľiC ATACACAATA

TAAAOGATTA AAAGA ATG AAA GTC TTC CIG CIG CIT TCC CTC ATT GGA ΊΤ0 Met Lys Val Phu Leu Leu Leu Ser Leu White Gly Phe -78 -75 -70

TGC TGG GCC CAA CCA TOG ΆΤΑ GAT GGA ACA CAT ΊΤΤ COG AAC AAC AAT cys Trp Ala Gin Pro Ser ile Asp Gly Ihr His Phe Pro Asn Asn Asn -65 -60 -55

111

159

GTC CCA ΑΤΑ GAC ACA AGA AAA

Val Pro ile Asp Thr Arg Lys Glu Gly Leu GLn His Asp lyr Asp ihr ”50 -45 _4q-35

GAA ATT TTC GAG CAC ΊΤ GA GGA AGC GAT GAG ΊΤ ATT TTC AAT GAAGAG

Glu White Leu Glu His White Gly Ser Asp Glu White Leu White Asn GluGlu

-30. -25-20

TAT GTT ATT GAA AGA ACT TTC CAA GCC

Tyr Val ile Glu Arg Thr Leu Gin Ala ile Asp Asn Thr Ihr LeuAla

-15 -10-5

AAG AGA TTC GTT AAC CAA CAC TTC TGC GCT TCC CAC TTC CTT GAA GCT Lys Arg Phe Val Asn Cys Gly Ser His Leu Val Glu Ala 1 510

TTC TAC ACT CCT AAG GCT GTC GTC GTC TTC TAC TTC TAC GTC GTC TTC TAC TTC TAC GTC TTC TAC TTC ACT TCT TAC ACT

20 2530

GCT AAG GCT ATT GTC GAA CAA TCC TCT ACC TCC ATC TCC TCC TTC Ala Lys Gly White Val Glu Gin Cys Cys Thr Ser Cys Ser Leu Tyr

4045

CAA TTC GAA AAC TAC TCC AAC TAGAOGCAGC COGCAGGCTC TAGA

Gin Leu Glu Asn Tyr Cys Asn

207

255

303

351

399

447

(2) Information for SEQ ID NO = 3:

(x) (x i)

Sequence characteristics:

(A) length ^: 131 amino acids (B) type: amino acid (D) topology ^: linear

Molecule type: protein

Sequence description: SEQ ID NQ: 3 =

Met Lys Val Phe Leu Leu Leu Ser Leu Clay Gly Phe Cys Trp Ala Gin

-78 -75 -70 "

Pro Ser J Asp Gly Ihr His Phe Pro Asn Asn Asn Val Pro J Asp

-60 -55-50

Thr Arg Lys Glu Glu Leu Gin His Asp Tyr Asp Ihr Glu White Leu Glu -45 -40 “35

His White Gly Ser Asp Glu Leu White Leu Asn Glu Glu Tyr Val I-le Glu -30 -25 -20-15 i

Arg Ihr Leu gin Ala Ile Asp same time Ihr Ihr Leu Ala Lys Arg Phe wall -10 -5 1 same time gin His Leu Cys Gly Ser His Leu wall Glu Ala Leu Tyr Leu wall 5 10 15 cys Gly Glu Arg Gly Phe Phe Tyr Thr for Lys Ala Ala Lys Gly Ile 20 25 30 wall Glu gin Cys Cys Thr Ser Ile Cys Ser Leu Tyr gin Leu Glu same time 35 40 45 50

Tyr Cys Asn (2) Information for SEQ ID Ν0 = 4:

(i) Sequence characteristics ^: (A) length: 420 base pairs (B) type: nucleic acid (C) chain: single strand (D) topology: linear (ii) Molecule type: cDNA (ix) Characteristics (A) name / key ^: CDS (B) location: 76..396 (ix) Characteristics (A) name / key: sig peptide (B) location: 76..237 (ix) Characteristics (A) name / key: mat peptide (B) Location: 238..396 (xi) Description of Sequence: SEQ ID NO = 4:

GAATTCAITC AAGAATAGIT CAAACAAGAA GATLACAAAC TATCAATCTC ATACACAÄTA

TAAACGAITA AAAGA ATG AAA GTC TTC CTC CTC CIT TCC CIC ATT GGA TTC Met Lys Val Phu Leu Leu Leu Serie Le Gly Phe -54 -50-45

TCC TCG GCC CAA CCA TOG CIA TTC GAG

Cys Trp Ala Gin Pro Ser Leu Glu Ser Leu Ihr Leu Val AspVal

-40 -35-30

GAC GCA CTC TCG GAT ΊΤΊΤ GAT CIT GIT GAG GCT TCT GAA ACG CITGTC

Asp Ala Leu Ser Asp Asp Asp Le Le Val Val Glu Ser Glu Ihr LeuVal

-25 -20-15

111

159

207

CIT GTC Leu Val -10 GAT AAC ACC ACT TIG GCT AAG AGA TTC GTT 255 Asp Asn Ihr Ihr Leu Ala Lys Arg Phe Val Gn His Leu 1 5 TGC GGT TCC CAC TTC GIT GAA GCT TTC TAC TIG GTT TCC GGT GAA AGA 303 Cys Gly Ser His Leu wall Glu Ala Leu IYR Leu wall Cys Gly Glu Arg 10 15 20 GGT TTC TTC TAC ACT CCT AAG GCT GCT AAG GGT AIT GTC GAA CAA TCC 351 Gly Phe Phe Tyr Ihr for Lys Ala Ala Lys Gly Ile wall Glu gin Cys 25 30 35 TGT ACC TCC ATC TGC TCC TIG TAC CAA TTG GAA AAC TAC TCC AAC 396 Cys Ihr Ser Ile Cys Ser Leu Tyr gin Leu Glu same time Tyr Cys same time 40 45 50

TAGAOGCAGC COGCAGGCTC TAGA 420 (2) Information for SEQ ID NO = 5:

(i) Sequence characteristics:

(A) length: 107 amino acids (B) type: amino acid (D), topology: linear

C i i) Type of molecule: protein (xi) Sequence description: SEQ ID NO = 5:

Met -54 Lys Val Phe Leu Leu Leu Serie Le Gly Phe Cys Trp Ala Gin -50 -45 -40 for Ser Leu Leu Glu Ser Leu Val Val Asp Val Asp Ala Leu Ser -35 -30 -25 F Asp Asp Val Leu Val Glu Ser Glu Ihr Leu Val Leu Val Asn j -20 -15 -10  * Thr Ihr Leu Ala Lys Arg Phe Val Gn His Leu Cys Gly Ser His s -5 1 5 10 i i Leu Val Glu Ala Tyr Leu Val Cys Glu Arg Gly Phe Phe Tyr and and 15 20 25 * Ihr For Lys Ala Ala Lys Gly White Val Glu Gin Cys Cys Ihr Ser ile in 30 35 40

Cys Ser Leu Tyr Gin Leu Glu Asn Tyr Cys Asn 45 50 ´i

(2) Information for SEQ ID 110 = 6 = (I) Sequence characteristics: (A) length: 453 base pairs (B) type = nucleic acid (C) chaining = one chain (D) topology = linear (i i) Molecule type: cDNA (Ix) characteristics (A) name / key = CDS s (B) Location: 76..420 • (Ix) characteristics (A) name / key: sig peptide Λ (B) Location: 76..270 (Ix) characteristics (A) name / key: mat peptide (B) Location: 271..420 (Xi) Sequence description: SEQ ID NO = 6 ^:

GAATTCAITC AAGAATAGIT CAÄACAAGAA GÄTTACAAAC TATCAÄTITC ATACACAATA60

TAAAOGÄTTA AAAGA ATC Ä GTC TTC CTC CTC CIT TCC CTC ΊΤ GGA TTC111

Met Lys Val Phe Leu Leu Leu Ser Leu White Gly Phe -65 -60 “55

TGC TGG cys Trp GCC CAA CCA ATA GAC ACA AGA AAA GAA Glu GGA CLA CAT CAT GAT 159 Ala Gin -50 for Ile Asp Ihr Arg -45 Lys Gly Leu Gin His Asp -40 TAC GAT ACA GAA ATT TTC GAG CAC AIT GGA AGC GAT GAG ΤΓΑ ACC CCG 207 Tyr Asp Ihr Glu Ile Leu Glu His Ile Gly Ser Asp Glu Leu Ihr for -35 -30 -25 AAT GAA GAG TAT GIT ATT GAA AGA ACT TTC CAA GCC ATC GAT AAC ACC 255 Asn Glu Glu Tyr wall Ile Glu Arg Ihr Leu gin Ala Ile Asp same time Ihr -20 -15 -10 ACT TTC GCT AAG AGA TTC GIT AAC CAA CAC TTC TCC GGT TCC CAC TTC 303 Thr Leu Ala Lys Arg Phe wall same time gin His Leu Cys Gly Ser His Leu -5 1 5 10 GIT GAA GCT TTC TAC TTG GIT TGC GGT GAA AGA GGT TTC TTC TAC ACT 351 Val Glu Ala Leu Tyr Leu wall Cys Gly Glu Arg Gly Phe Phe Tyr Ihr

20 25

CCT AAG GCT GCT AAG For Lys Ala Ala Lys 30

GGT ATT GTC GAA TCA ACC TCC ATC TGC

Gly White Val Glu Gin Cys Cys Ihr Ser Cys 35 40

399

TCC Ser

TTC TAC CAA TTC GAA AAC TACTGCAACT AGACGCAGCC CGCAGGCICT Tyr Gin Leu Glu Asn

50

450

AGA

(2) Information for SEQ ID NO = 7:

(i) Sequence characteristics:

(A) length: 115 amino acids (B) type: amino acid <D> topology: linear (ii) Molecule type: protein (xi) Sequence description: SEQ ID NO ^: 7 ^;

Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly Phe Cys Trp. Ala gin -65 -60 -55 -50 for Asp Thr Arg Lys Glu Gly Leu gin His Asp Tyr Asp Ihr Glu -45 -40 -35 Ile Leu Glu His Ile Gly Ser Asp Glu Leu Thr for same time Glu Glu Tyr -30 -25 -20 wall ile Glu Arg Ihr Leu gin Ala Ile Asp same time Ihr Ihr Leu Ala Lys -15 -10 -5 Arg Fhe Val same time gin His Leu Cys Gly Ser His Leu wall Glu Ala Leu 1 5 10 15 Tyr Leu Val Cys Gly 20 Glu Arg Gly ehe Phe 25 Tyr Ihr for Lys Ala 30 Ala Lys Gly ile wall G1U gin Cys Cys Ihr Ser Ile cys Ser Leu Tyr • Gin 35 40 45

Leu Glu Asn <2) Information for SEQ ID NO ^; 8:

(i) Sequence characteristics:

(A) length: 459 base pairs (B) type: nucleic acid (C) chain: single strand (D) topology: linear (ii) Molecule type: cDNA <ix) Characteristics (A) name / key: CDS (ix) (ix) (xi) (B) location: 76..435 Characteristics (A) name / key ^: sig peptide (B) location: 76..276 Characteristics (A) name / key- · have peptide (B) location: 277..435

Sequence description: SEQ ID NO = 8:

GAAITCATTC AAGAATAGIT CAAACAAGAA GATTACAAAC TATCAATTTC ATACACAATA

TAAAOGATIA AAAGA ATG AAA GTC TTC CTG CTG CIT TCC CTC ATT GGA TTC Met Lys Val Phe Leu Leu Leu Ser Leu White Gly Phe -67 -65 -60

TGC Cys -55 TGG GCC CAA gin CCT GTC CCA ATA Trp Ala For Val Pro -50 Ile Asp Thr Arg Lys Glu -45 -40 CAT GAT TAC GAT ACA GAA ATT TTG GAG CAC ATT GGA AGC GAT GAG ΊΤΑ His Asp Tyr Asp Thr Glu Ile Leu Glu His Ile Gly Ser Asp Glu Leu -35 -30 -25 ACC CCG AAT GAA GAG TAT GIT ATT GAA AGA ACT TTC CAA GCC ATC GAT Thr for same time Glu Glu Tyr wall Ile G1U Arg Thr Leu gin Ala Ile Asp -20 -15 -10 AAC ACC ACT TTG GCT AAG AGA TTC GIT AAC CAA CAC TTC TGC GGT TCC same time Thr Thr Leu Ala Lys Arg Phe Val same time gin His Leu Cys Gly Ser -5 1 5 CAC TTG GIT GAA GCT TTG TAC ' TTG < GIT ' TGC < GGT GAA AGA His Leu wall Glu Ala Leu Tyr Leu ' wall Cys < Gly Arg Gly Phe Phe 10 15 20 25 TAC ACT cer AAG GCT GCT AAG GGT. ATT GTC GAA ' CAA TGC TCT ACC Tyr Thr for Lys Ala Ala Lys Gly Ile wall Glu < Gin Cys Cys Thr Ser 30 35 40 ATC TGC TCC TTG TAC CAA TTG GAA AAC TAC TGC AAC TAGAOGCAGC Ile Cys Ser Leu Tyr gin leu Glu same time Tyr Cys same time 45 50

COGCAGGCTC TAGA

111

159

207

255

303

351

399

445

459

C2) Information for SEQ ID NO = 9:

(i) Sequence characteristics:

(A) length: 120 amino acids (B) type: amino acid

CD) topology: linear

Cii) Type of molecule: protein

Pop i with SEQ 'enc ie: SEQ ID NO: 9 = Met Lys wall FHE Leu Leu Leu Ser Leu Ile Gly Phe CYS Trp Ala gin -67 -65 -60 -55 for wall for Ile Asp Thr Arg Lys Glu Gly Leu gin His Asp Tyr Asp -50 -45 -40 Ihr Glu Ile Leu Glu His Ile Gly Ser Asp Glu Leu Thr for same time Glu -35 -30 -25 -20 Glu IYR wall Ile Glu Arg Ihr Leu gin Ala Ile Asp same time Ihr Ihr Leu -15 -10 -5 Ala Lys Arg Phe wall same time gin His Leu cys Gly Ser His Leu wall Glu 1 5 10 Ala Leu Tyr Leu wall cys Gly Glu Arg Gly Phe Phe IYR Ihr for Lys 15 20 25 Ala Ala Lys Gly Ile wall Glu gin Cys Cys Ihr Ser Ile Cys Ser Leu 30 35 40 45 Tyr gin Leu Glu same time IYR cys same time

C2) Information for SEQ ID NO-IO:

: Sequence characteristics:

j (A) length: 408 base pairs (B) type: nucleic acid

(CC) chaining: single chain

CD) topology: linear

Cii) Type of molecule: cDNA 'Cix) Characteristics i

· <CA) Name / Key: CDS?

(B) location: 76-.384 (ix) Characteristics (A) ineno / key: sig peptide (B) location: 76-.225 (ix) Characteristics (A) name / key: mat peptide (B) location: 226 ..384 (xi) Description of sequence of ^one of SEQ ID ^N0: 10:

GAATTCAITC AAGAATAGIT CAAACAAGAA GATTACAAAC TATCAATITC ATACACAATA60

TAAAOGATTA AAAGA ATG AAA GTC TTG CIC ATG GTC TTC111

Met Lys Val Phe Leu Leu Leu Ser Leu White Gly Phe -50 -45-40

TGC TGG GCC CAA CCA TOG ATC TTG Leu GAT TAT GIT GAC TTG 159 Cys Trp Ala Gin -35 for Ser íle Asp Tyr Val Ala Glu -30 -25 CTG ATC TCC ATT OGT GGG TAT GAT AAC CIC AAC GAC GOG ATC GAT AAC 207 Leu Ile Ser Ile Arg Gly Tyr Asp same time Leu same time Asp Ala Ile Asp same time -20 -15 -10 ACC ACT TTG GCT AAG AGA TTC GIT AAC CAA CAC TTG TGC GGT TCC CAC 255 Thr Thr Leu Ala Lys Arg Rie Val same time Gin His Leu Cys Gly Ser His -5 1 5 10 TTC GIT GAA GCT TTG TAC TTG GIT TGC GGT GAA AGA GGT TTC TTC TAC 303 Leu wall Glu Ala Leu Tyr Leu wall Cys Gly Glu Arg Gly Phe Phe Tyr 15 20 25 ACT CCT AAG GCT GCT AAG GGT ATT GTC GAA CAA TGC TGT ACC TCC ATC 351 Thr for Lys Ala Ala Lys Gly Ile wall Glu gin Cys Cys Thr Ser Ile 30 35 40 TGC TCC TTG TAC CAA TTG GAA AAC TAC TGC AAC TAGACGCAGC COGCAGGCTC 404 Cys Ser Leu Tyr gin Leu Glu same time Tyr Cys same time 45 50 TAGA 408

(2) Information for SEQ ID NO: 11:

(i) Sequence characteristics:

(A) length: 103 amino acids (B) type: amino acid (D) topology: linear

Molecule type: protein

Sequence description: SEQ ID NO = 11:

(ii) (xi)

Met Lys wall Phe Leu Leu Leu Ser Leu Ile Gly Phe Cys Trp Ala gin -50 -45 -40 -35 for Ser Ile Leu Asp IYR wall Asp Leu Gly Ala Glu Leu Ile Ser Ile -30 -25 -20 Arg Gly Tyr Asp same time Leu same time Asp Ala Ile Asp same time Thr Thr Leu Ala -15 -10 -5 Lys Arg Phe wall same time gin His Leu Cys Gly Ser His Leu wall Glu Ala 1 5 10 Leu Tyr Leu wall Cys Gly G1U Arg Gly Phe Phe Tyr Thr for Lys Ala 15 20 25 30 Ala Lys Gly Ile wall Glu gin Cys Cys Thr Ser Ile Cys Ser Leu Tyr 35 40 45 gin Leu Glu same time Tyr Cys same time

(2) Information for SEQ ID NO = 12:

(i) Sequence characteristics:

(A) length: 372 base pairs (B) type: nucleic acid (C) chainC: single chain (D) topology: linear (ii) Molecule type: cDNA (ix) Characteristics (A) name / key ^: qds (B) Location: 76..348 (ix) Characteristics (A) Name / Key: sig Peptide (B) Location: 76..189 (ix) Characteristics (A) Name / Key: mat Peptide (B) Location: 190..348 (xi) Sequence description: SEQ ID NO = 12:

GknITCATTC AAGAATAGIT CAAACAAGAA GAITACAAAC TATCAATITC ATACACAAIA

TAAACGATTA AAAGA ATG AAA GTC TTC CTC CTC CIT TCC CTC ATT GGA TTC Met Lys Val Phu Leu Leu Leu Serie Le Gly Phe -33

111

TCC TGG GCC CAA CCA TOG CAC ACT ACC ATC GGC ACC GCA ACT GAC AAA Cys Trp Ala Gin Pro Ser His Thr Thr Ile C-ly Thr Ala Thr Asp Lvs -25 -20 -15 ATAC CAT AAC ACC ACT TTC GCT AAG AGA TTC GIT AAC CAA CAC TTC Asp. Asp same time Thr Thr Leu Ala Lys Arg Phe wall same time gin His Leu -10 -5 1 5 TCC GGT TCC CAC TTC GIT GAA GCT TTC TAC TTC GTT TCC GGT GAA AGA Cys C-ly Ser His Leu wall Glu Ala Leu Tyr Leu wall cys Gly Glu Arg 10 15 20 GGT TTC TTC TAC ACT CCT AAG GCT GCT AAG GGT ATT GTC GAA CAA TGC Gly Phe Tyr Thr for Lys Ala Ala Lys c-ly Ile wall Glu gin Cys 25 30 35 TCT ACC TCC ATC TCC TCC TTC TAC CAA TTG CAA AAC TAC TCC AAC Cys Thr Ser Ile Cys Ser Leu Tyr gin Leu Glu same time Tyr Cys same time 40 45 50

TAGAOGCAGC COGCAGGCTC TAGA

159

207

255

303

343

372 (2) Information for SEQ ID NO-13-Sequence Characteristics:

(A) (i) (B) (D)

Type length: 91 amino acids type: amino acid topology: linear molecules: protein

(Xi) sequence description; SEQ ID NO = 13:

Met Lys wall Phe Leu Leu Leu Ser Leu Ile Gly Phe Cys Trp Ala gin -38 -35 -30 -25 for Ser His TNR Thr Ile Gly Thr Ala Thr Asp Lys same time Ile Asp same time -20 -15 -10 Thr Thr Leu Ala Lys Arg Phe wall same time gin His Leu Cys Gly Ser His -5 1 5 10 Leu wall Glu Ala Leu Tyr Leu wall Cys Gly Glu Arg Gly Phe FHE Tyr 15 20 25 for Lys Ala Ala Lys c-ly Ile wall C-lu gin Cys Cys Thr Ser Ile 30 35 40 Cys Ser Leu Tyr gin Leu C-lu same time Tyr Cys same time

50 fls / yz

Claims (25)

A method of constructing a synthetic leader peptide sequence for the secretion of heterologous polypeptides in yeast, characterized in that ^: (a) introduces a statistical DNA fragment into a yeast expression vector comprising the sequence 5'-SP-Xn-3'-RS-5'-Xm-CNZT) _P -Xg-PS-xgenx-3 where SP DNA sequence encoding signal peptide, Xn DNA sequence encoding n amino acids, wherein n is 0 or an integer of 1 to about 10 amino acids, An RS restriction endonuclease recognizing site for the insertion of statistical DNA fragments that is at the junction of Xn and Xm, Xm DNA sequence coding for m amino acids, wherein m is 0 or an integer of 1 to about 10 amino acids, (NZT) p DNA sequence coding for Asn-Xaa-Thr, wherein m is 0 or number 1, Xq a DNA sequence encoding g amino acids, wherein q is 0 or an integer of 1 to about 10 amino acids, A PS DNA sequence encoding a peptide defining a yeast processing site and an xgenx sequence encoding a heterologous polypeptide. b) transforming the yeast host cell with the expression vector of step (a); (c) culturing the transformed host cell according to step (b) under suitable conditions; and (d) screening the culture according to step (c) for secreting the heterologous polypeptide; Method according to claim 1, characterized in that the statistical DNA fragment. incorporated into the vector is of genomic or synthetic origin. 3. The method of claim 1, wherein the statistical DNA fragment is up to about 600 base pairs in length. A method according to claim 1, a statistical DNA fragment and an amino acid. The method of claim 1 encodes a statistical DNA fragment 1 until 3, characterized by with that. that codes high share polar 1 until 4, characterized by with that. that at least one proline. Method according to claim 1, characterized in that. that a / or m and / or q is 1 or a number greater than 1. Method according to claim 1, characterized in that. that P is 1. Method according to claim 1, characterized in that. that SP is a DNA sequence coding for the? -factor signal peptide, mouse salivary gland signal peptide, carboxypeptidase signal peptide, yeast signal peptide BAR1, or Humicola lanuginosa lipase signal peptide or a derivative thereof. Method according to claim 1, characterized in that. wherein PS is a DNA sequence encoding Lys-Arg, Arg-Lys, Lys-Lys, Arg-Arg or Ile-Glu-Gly-Arg. Method according to claim 1, characterized in that. wherein the heterologous peptide is selected from the group consisting of aprotinin, tissue factor inhibitor or other protease inhibitors. insulin or insulin precursors, human or bovine growth factor, interleukin, glucagon, tissue plasminogen activator, transforming growth factor or β, platelet-derived growth factor, enzymes or functional analogues thereof. Yeast expression cloning vector characterized by. that comprises a sequence 5'-SP-Xn-3'-RS-5'-Xm- (NZT) p-Xq-PS-xgenx-3 ' A DNA sequence encoding a signal peptide, A DNA sequence encoding n amino acids, wherein n is 0 or an integer of 1 to about 10 amino acids, a restriction endonuclease recognizing site to incorporate statistical DNA fragments that is at the junction of Xn and Xm, A DNA sequence encoding m amino acids, wherein m is 0 or an integer of 1 to about 10 amino acids, A DNA sequence encoding Asn-Xaa-Thr, wherein m is 0 or 1, A DNA sequence encoding q amino acids, wherein q is 0 or an integer of 1 to about 10 amino acids, A DNA sequence encoding a peptide defining a yeast processing site and a sequence encoding a heterologous polypeptide. Yeast expression cloning vector according to claim 11, characterized in that n and / or m and / or q is 1 or a number greater than 1. 13. A yeast expression cloning vector according to claim 11, wherein p is 1. 14. The method of claim 11, wherein the SP is a DNA sequence encoding a factor-signal peptide, a mouse salivary gland signal peptide, a carboxypeptidase signal peptide, or a BAR1 yeast signal peptide. where from: SP Xn RS Xin (NZT) p XQ PS xgenx 12. Method according to claim 11, characterized in that. that PS is a DNA sequence encoding Lys-Arg. Arg-Lys, Lys-Lys, Arg-Arg, or Ile-Glu-Gly-Arg. The method of claim 11, characterized in that. wherein the heterologous peptide is selected from aprotinin, a tissue inhibitor or other protease inhibitors, insulin or insulin precursors, human or bovine growth factor, interleukin, glucagon. tissue plasminogen activator. transforming growth factor or β, platelet-derived growth factor, enzymes or functional analogues thereof. 17- A yeast expression vector characterized. that comprises a sequence 5'-SP-Xn-statistical DNA-X _m - (NZT) _P -Xq-PS-xgenx-3 'where it means SP DNA sequence encoding a signal peptide. Xn DNA sequence encoding n amino acids, wherein n is 0 or an integer of 1 to about 10 amino acids, a statistical DNA fragment incorporated into the restriction endo nuclease recognizing site at the junction of X _n and X _m , and RS restriction endonuclease recognizing site to incorporate statistical DNA fragments that is at the junction of Xn and Xm. Xm DNA sequence encoding in amino acids, wherein m is 0 or an integer from 1 to about 10 amino acids, (NZT) p DNA sequence encoding Asn-Xaa-Thr, wherein m is 0 or number 1, Xq a DNA sequence encoding q amino acids, wherein q is 0 or an integer of 1 to about 10 amino acids, A PS DNA sequence encoding a peptide defining a yeast processing site and an xgenx sequence encoding a heterologous polypeptide. wherein the X-X sequence encodes a leader peptide sequence. Method according to claim 17, characterized in that. that the statistical DNA fragment incorporated into the vector is of genomic or synthetic origin - Method according to claim 17 or 18, characterized in that. wherein the statistical DNA fragment is 6 to about 600 base pairs in length. The method according to claims 17 to 19, characterized in that the statistical DNA fragment encodes a high proportion of polar amino acids. The method of claims 17 to 20, wherein the statistical DNA fragment encodes at least one proline. Method according to claim 17, characterized in that and / or m and / or i q is 1 or a number greater than First 23rd process by Claim 17, characterized by the team. that p stands for First 24th process by Claim 17, characterized by the team. that we know SP The DNA sequence encoding the O (-factor signal peptide, mouse salivary gland signal peptide, carboxypeptidase signal peptide, BAR1 yeast signal peptide or Humicola lanuginosa lipase signal peptide or a derivative thereof. 25. A method according to claim 17, characterized in that. wherein the PS is a DNA sequence encoding Lys-Arg, Arg-Lys, Lys-Lys, Arg-Arg, or Ile-Glu-Gly-Arg. 26. The method of claim 17 wherein the heterologous peptide is selected from the group consisting of aprotinin, insulin or insulin precursors, human or bovine growth factor, interleukin, glucagon, tissue plasminogen activator, transforming growth factor or β, growth factor derived from platelets, enzymes or functional analogues thereof. A yeast cell capable of expressing a heterologous polypeptide and transformed with a yeast expression vector according to claims 17 to 26. 28. A method of producing a heterologous polypeptide in yeast, comprising culturing a yeast cell capable of expressing the heterologous polypeptide and transformed with the yeast expression vector of claims 17 to 26 incorporating a leader peptide sequence constructed by the method of claim 1 in an appropriate medium for expression. and secreting the heterologous polypeptide, wherein the heterologous peptide is isolated from the environment.