RU2167939C2 - Method of polypeptide producing in yeast - Google Patents

Method of polypeptide producing in yeast Download PDF

Info

Publication number
RU2167939C2
RU2167939C2 RU97100750A RU97100750A RU2167939C2 RU 2167939 C2 RU2167939 C2 RU 2167939C2 RU 97100750 A RU97100750 A RU 97100750A RU 97100750 A RU97100750 A RU 97100750A RU 2167939 C2 RU2167939 C2 RU 2167939C2
Authority
RU
Russia
Prior art keywords
sequence
amino acid
denotes
general formula
ser
Prior art date
Application number
RU97100750A
Other languages
Russian (ru)
Other versions
RU97100750A (en
Inventor
Томас Берглум Кьельдсен
Кнуд Вад
Original Assignee
Ново Нордиск А/С
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ново Нордиск А/С filed Critical Ново Нордиск А/С
Publication of RU97100750A publication Critical patent/RU97100750A/en
Application granted granted Critical
Publication of RU2167939C2 publication Critical patent/RU2167939C2/en

Links

Images

Landscapes

  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

FIELD: biotechnology, microbiology. SUBSTANCE: method of polypeptide producing in yeast involves culturing yeast cells that are able to express this polypeptide transformed with yeast expression vector containing expressing cassette. Cassette has promoter sequence, DNA sequence encoding signal peptide, terminating sequence, DNA encoding peptide to be produced, DNA encoding processing site and DNA sequence LS encoding leader peptide of the general formula: Gln-Pro-Ile-(Asp/Glu)-(Asp/Glu)- X1-(Glu/Asp)-X2-Asn-Z-(Thr/Ser)-X3 (I) where X1 means peptide bond or encoded amino acid; X2 means peptide bond or encoding amino acid or sequence involving up to 4 similar or distinct encoded amino acids; Z means encoded amino acid except for Pro and X3 means sequence involving from 4 to 30 similar of distinct encoded amino acids. Culturing is carried out in suitable medium up to attainment of expression and secretion of indicated polypeptide followed by isolation of polypeptide from medium. EFFECT: improved method of producing. 44 cl, 2 tbl, 12 ex

Description

Настоящее изобретение относится к синтетическим лидерным пептидным последовательностям для секреции полипептидов в дрожжах. The present invention relates to synthetic leader peptide sequences for secretion of polypeptides in yeast.

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ
Дрожжевые организмы продуцируют большое число белков, синтезируемых внутриклеточно, но функционирующих за пределами клетки. Такие внеклеточные белки называют секретируемыми белками. Эти секретируемые белки сначала экспрессируются внутри клетки в форме предшественника (или пре-белка), содержащего предпоследовательность, обеспечивающую эффективное направление экспрессированного продукта через мембрану эндоплазматического ретикулума (ЭР). Предпоследовательность, которую обычно называют сигнальным пептидом, обычно отщепляется от интересующего нас продукта в ходе транслокации. Предназначенный для секреции белок транспортируется в аппарат Гольджи. Из аппарата Гольджи белок может быть различными путями доставлен в компартменты, такие как клеточная вакуоль или клеточная мембрана, или может быть выведен из клетки для секреции во внешнюю среду [1].BACKGROUND OF THE INVENTION
Yeast organisms produce a large number of proteins that are synthesized intracellularly, but functioning outside the cell. Such extracellular proteins are called secreted proteins. These secreted proteins are first expressed within the cell in the form of a precursor (or pre-protein) containing a presequence that provides efficient expression of the expressed product through the membrane of the endoplasmic reticulum (ER). The subsequence, which is usually called the signal peptide, is usually cleaved from the product of interest to us during translocation. Protein intended for secretion is transported to the Golgi apparatus. From the Golgi apparatus, protein can be delivered in various ways to compartments, such as a cell vacuole or cell membrane, or it can be removed from the cell for secretion into the external environment [1].

Было предложено несколько подходов к экспрессии и секреции в дрожжах гетерологичных для них белков. Известен [2] способ, при котором гетерологичные для дрожжей белки экспрессируются, процессируются и секретируются путем трансформации дрожжевого организма вектором экспрессии, несущим кодирующую интересующий нас белок ДНК и сигнальный пептид, получения культуры трансформированного организма, выращивания этой культуры и выделения указанного белка из такой культуральной среды. Сигнальный пептид может быть собственным сигнальным пептидом интересующего нас белка, гетерологичным сигнальным пептидом или гибридом нативного и гетерологичного сигнального пептида. Several approaches have been proposed for expression and secretion in yeast of proteins heterologous to them. There is a known [2] method in which yeast heterologous proteins are expressed, processed, and secreted by transforming the yeast organism with an expression vector carrying the DNA protein and signal peptide encoding us, obtaining a culture of the transformed organism, growing this culture, and isolating this protein from such a culture medium . The signal peptide can be a native signal peptide of a protein of interest to us, a heterologous signal peptide, or a hybrid of a native and heterologous signal peptide.

При использовании гетерологичных для дрожжей сигнальных пептидов может встать проблема необеспечения гетерологичным сигнальным пептидом эффективной транслокации и/или последующего отщепления такого сигнального пептида. When using signal peptides heterologous to yeast, the problem may arise of not providing the heterologous signal peptide with an effective translocation and / or subsequent cleavage of such a signal peptide.

Известно [3], что MFα1 (α-фактор) Saccharomyces cerevisiae синтезируется в препро форме из 165 аминокислот, содержащей сигнальный или препептид из 19 аминокислот, за которым следует "лидер" или пропептид из 64 аминокислот, включающий в себя три N-связанных сайта гликозилирования, за которым следует (Ly-sArg(Asp/Glu, Ala)2-3 α-фактор)4. Сигнально-лидерная часть препpoMFα1 широко используется для достижения синтеза и секреции гетерологичных белков в S. cerevisiae.It is known [3] that MFα1 (α-factor) of Saccharomyces cerevisiae is synthesized in a prepro form of 165 amino acids containing a signal or prepeptide of 19 amino acids, followed by a leader or propeptide of 64 amino acids, including three N-linked sites glycosylation followed by (Ly-sArg (Asp / Glu, Ala) 2-3 α-factor) 4 . The signal-leader part of preppoMFα1 is widely used to achieve the synthesis and secretion of heterologous proteins in S. cerevisiae.

Использование сигнал/лидер пептидов гомологичных для дрожжей известно из [4-10]. The use of signal / leader peptides homologous to yeast is known from [4-10].

Для секреции чужеродных белков описано использование предшественника α-фактора S. cerevisiae [9], сигнального пептида инвертазы S.cerevisiae [10] и использование сигнального пептида PH05 S.cerevisiae [11]. For the secretion of foreign proteins, the use of the S. cerevisiae α-factor precursor [9], S.cerevisiae invertase signal peptide [10] and the use of S.cerevisiae signaling peptide PH05 [11] have been described.

Описаны [4-8] способы, при помощи которых сигнал-лидер α-фактора S.cerevisiae (MFα и MFα2) используют для секреции экспрессированных гетерологичных белков в дрожжах. Путем присоединения ДНК-последовательности, кодирующей сигнал/лидер последовательность MFα1 S.cerevisiae, к 5' концу гена, кодирующего интересующий нас белок, была продемонстрирована секреция и процессинг интересующего нас белка. [4-8] methods are described by which the signal leader of the S. factor cerevisiae α-factor (MFα and MFα2) is used for secretion of expressed heterologous proteins in yeast. By attaching the DNA sequence encoding the signal / leader sequence of S. cerevisiae MFα1 to the 5 ′ end of the gene encoding the protein of interest, the secretion and processing of the protein of interest was demonstrated.

Известна [12] система секреции полипептидов из S.cerevisiae с использованием лидерной последовательности α-фактора, усеченной для исключения четырех единиц α-фактора, присутствующих на нативной лидерной последовательности, с тем чтобы оставить сам лидерный пептид, присоединенный к гетерологичному полипептиду через процессинговый сайт α-фактора LysArgGluAlaGluAla. Указано, что такая конструкция приводит к эффективному процессингу небольших пептидов (менее 50 аминокислот). Для секреции и процессинга более крупных пептидов нативная лидерная последовательность α-фактора была усечена, чтобы оставить одну или две единицы α-фактора между лидерным пептидом и полипептидом. A system of secretion of polypeptides from S. cerevisiae is known [12] using the α-factor leader sequence truncated to exclude four units of the α-factor present on the native leader sequence in order to leave the leader peptide attached to the heterologous polypeptide via the α processing site LysArgGluAlaGluAla. It is indicated that such a design leads to the efficient processing of small peptides (less than 50 amino acids). For secretion and processing of larger peptides, the native α-factor leader sequence was truncated to leave one or two α-factor units between the leader peptide and the polypeptide.

Множество секретируемых белков подвергается воздействию протеолитической процессинговой системы, способной расщеплять пептидную связь на карбокси-конце двух последовательных основных аминокислот. Эта ферментативная активность кодируется в S.cerevisiae геном KEX 2 [13]. Процессинг продукта протеазой KEX 2 необходим для секреции активного скрещивающего фактора α1 (MFα1 или α-фактора) S. cerevisiae, в то время как KEX 2 не вовлечена в секрецию активного скрещивающего фактора a S.cerevisiae. Many secreted proteins are exposed to a proteolytic processing system capable of cleaving a peptide bond at the carboxy-terminus of two consecutive basic amino acids. This enzymatic activity is encoded in S. cerevisiae by the KEX 2 gene [13]. Processing of the product with KEX 2 protease is necessary for the secretion of the active crossbreeding factor α1 (MFα1 or α-factor) of S. cerevisiae, while KEX 2 is not involved in the secretion of the active crossbreeding factor a S. cerevisiae.

Секреция и корректный процессинг полипептида, который должен быть секретирован, достигается в некоторых случаях при культивировании дрожжевых организмов, которые трансформированы вектором, сконструированным, как указано в приведенных выше ссылках. Однако во многих случаях уровень секреции очень низок или секреция отсутствует, или протеолитический процессинг осуществляется некорректно или неполностью. Таким образом, задачей данного изобретения является создание лидерных пептидов, которые обеспечивают более эффективную экспрессию и/или процессинг полипептидов. The secretion and proper processing of the polypeptide, which must be secreted, is achieved in some cases by culturing yeast organisms that are transformed with a vector constructed as described in the above links. However, in many cases, the level of secretion is very low or there is no secretion, or proteolytic processing is carried out incorrectly or incompletely. Thus, an object of the present invention is to provide leader peptides that provide more efficient expression and / or processing of polypeptides.

РЕЗЮМЕ
Неожиданно был обнаружен новый тип лидерного пептида, который позволяет достигать высокого уровня секреции полипептидов в дрожжах.SUMMARY
Unexpectedly, a new type of leader peptide was discovered that allows one to achieve a high level of secretion of polypeptides in yeast.

Согласно этому данное изобретение относится к ДНК экспрессирующей кассете, включающей в себя следующую последовательность:
5'-P-SP-LS-PS-*ген*-(Т)i-3',
где P обозначает промоторную последовательность,
SP обозначает ДНК последовательность, кодирующую сигнальный пептид,
LS обозначает ДНК последовательность, кодирующую лидерный пептид общей формулы I:
GlnProIle(Asp/Glu)(Asp/Glu)X1(Glu/Asp)X2AsnZ(Thr/Ser)X3, (I)
где Х1 обозначает пептидную связь или кодируемую аминокислоту,
Х2 обозначает пептидную связь или кодируемую аминокислоту, или последовательность до 4 одинаковых или разных кодируемых аминокислот,
Z обозначает кодируемую аминокислоту кроме Pro, и
Х3 обозначает последовательность от 4 до 30 одинаковых или разных кодируемых аминокислот,
PS обозначает ДНК последовательность, кодирующую процессинговый сайт,
*ген* обозначает ДНК последовательность, кодирующую полипептид,
Т обозначает терминаторную последовательность, и
i равно 0 или 1.According to this, the present invention relates to a DNA expression cassette comprising the following sequence:
5'-P-SP-LS-PS- * gene * - (T) i -3 ',
where P denotes a promoter sequence,
SP denotes a DNA sequence encoding a signal peptide,
LS denotes a DNA sequence encoding a leader peptide of General formula I:
GlnProIle (Asp / Glu) (Asp / Glu) X 1 (Glu / Asp) X 2 AsnZ (Thr / Ser) X 3 , (I)
where X 1 denotes a peptide bond or encoded amino acid,
X 2 denotes a peptide bond or encoded amino acid, or a sequence of up to 4 identical or different encoded amino acids,
Z denotes an encoded amino acid other than Pro, and
X 3 denotes a sequence of 4 to 30 identical or different encoded amino acids,
PS denotes a DNA sequence encoding a processing site,
* gene * refers to a DNA sequence encoding a polypeptide,
T denotes a terminator sequence, and
i is 0 or 1.

В данном контексте под термином "лидерный пептид" понимают пептид, чей функцией является позволить экспрессированному полипептиду быть направленным из эндоплазматического ретикулума в аппарат Гольджи и далее в секреторные везикулы для секреции в среду (то есть передвижение экспрессированного полипептида через клеточную стенку или по меньшей мере через клеточную мембрану в периплазматическое пространство клетки). Выражение "синтетический", используемое по отношению к лидерным пептидам, подразумевает, что такой лидерный пептид не обнаруживается в природе. In this context, the term “leader peptide” means a peptide whose function is to allow the expressed polypeptide to be sent from the endoplasmic reticulum to the Golgi apparatus and further to secretory vesicles for secretion into the medium (ie, the movement of the expressed polypeptide through the cell wall or at least through the cell wall membrane into the periplasmic space of the cell). The expression "synthetic" used with respect to leader peptides implies that such a leader peptide is not found in nature.

Выражение "сигнальный пептид" обозначает препоследовательность, главной особенностью которой является гидрофобная природа, и которая присутствует как N-концевая последовательность в предшественнике внеклеточного белка, экспрессируемого в дрожжах. Функция сигнального пептида заключается в том, чтобы позволить экспрессированному белку, который должен быть секретирован, попасть в эндоплазматический ретикулум. Сигнальный пептид в норме отщепляется в течение данного процесса. Сигнальный пептид может быть гетерологичным или гомологичным для дрожжевого организма, продуцирующего указанный белок. The expression "signal peptide" means a presequence, the main feature of which is hydrophobic in nature, and which is present as the N-terminal sequence in the precursor of extracellular protein expressed in yeast. The function of the signal peptide is to allow the expressed protein to be secreted to enter the endoplasmic reticulum. The signal peptide is normally cleaved during this process. The signal peptide may be heterologous or homologous to a yeast organism producing said protein.

Выражение "полипептид" обозначает как гетерологичный полипептид, то есть полипептид, который не продуцируется в природе хозяйским дрожжевым организмом, так и гомологичный полипептид, то есть полипептид, который продуцируется в природе хозяйским дрожжевым организмом, и любые их проформы. В предпочтительном воплощении экспрессирующая кассета по изобретению кодирует гетерологичный полипептид. The expression "polypeptide" means both a heterologous polypeptide, that is, a polypeptide that is not naturally produced by the host yeast organism, and a homologous polypeptide, that is, a polypeptide that is naturally produced by the host yeast organism, and any pro forma thereof. In a preferred embodiment, the expression cassette of the invention encodes a heterologous polypeptide.

Выражение "кодируемая аминокислота" подразумевает аминокислоту, которая может быть закодирована при помощи триплета ("кодона") нуклеотидоов. The term “encoded amino acid” means an amino acid that can be encoded using a triplet (“codon”) of nucleotides.

Если в аминокислотной последовательности, приведенной в настоящем описании, трехбуквенные коды двух аминокислот, разделенных косой чертой, даны в скобках, например (Asp/Glu), то подразумевается, что данная последовательность содержит либо одну, либо другую из этих аминокислот в соответствующем положении. If in the amino acid sequence given in the present description, the three-letter codes of two amino acids separated by a slash are given in brackets, for example (Asp / Glu), then it is understood that this sequence contains either one or the other of these amino acids in the corresponding position.

Еще одним аспектом данного изобретения является способ продуцирования полипептидов в дрожжах, при котором в подходящей среде культивируют дрожжевую клетку, способную экспрессировать полипептид и которая трансформирована дрожжевым вектором экспрессии, как описано выше, содержащим лидерную пептидную последовательность по изобретению, с достижением экспрессии и секреции полипептида, после чего этот полипептид выделяют из среды. Another aspect of the present invention is a method for producing polypeptides in yeast, wherein a yeast cell capable of expressing the polypeptide and transformed with the yeast expression vector as described above containing the leader peptide sequence of the invention is cultured in a suitable medium to achieve expression and secretion of the polypeptide after why this polypeptide is isolated from the environment.

КРАТКОЕ ОПИСАНИЕ ФИГУР
Настоящее изобретение иллюстрируется далее со ссылкой на прилагаемые фигуры.BRIEF DESCRIPTION OF THE FIGURES
The present invention is further illustrated with reference to the accompanying figures.

Фиг. 1 схематично изображает плазмиду pAK492. FIG. 1 schematically depicts plasmid pAK492.

Фиг. 2 показывает часть последовательности ДНК, кодирующей сигнальный пептид/лидер/М13 предшественник инсулина. FIG. 2 shows a portion of a DNA sequence encoding a signal peptide / leader / M13 insulin precursor.

Фиг. 3 показывает конструкцию плазмиды pAK546. FIG. 3 shows the construction of plasmid pAK546.

Фиг. 4 показывает аминокислотную последовательность лидера SEQ ID N 4 и кодирующую ее последовательность ДНК. FIG. 4 shows the amino acid sequence of the leader SEQ ID N 4 and the DNA sequence encoding it.

Фиг. 5 показывает ДНК последовательность экспрессионной плазмиды pAK546 S. cerevisiae, кодирующей YAP3 сигнальный пептид, лидера SEQ ID N 4 и предшественник инсулина M13, и закодированную аминокислотную последовательность. FIG. 5 shows the DNA sequence of the expression plasmid pAK546 of S. cerevisiae encoding the YAP3 signal peptide, leader SEQ ID N 4 and the insulin precursor M13, and the encoded amino acid sequence.

Фиг. 6 показывает аминокислотную последовательность лидера SEQ ID N 6 и кодирующую ее последовательность ДНК. FIG. 6 shows the amino acid sequence of the leader of SEQ ID N 6 and the DNA sequence encoding it.

Фиг. 7 показывает аминокислотную последовательность лидера SEQ ID N 8 и кодирующую ее последовательность ДНК. FIG. 7 shows the leader amino acid sequence of SEQ ID N 8 and the DNA sequence encoding it.

Фиг. 8 показывает аминокислотную последовательность лидера SEQ ID N 17 и кодирующую ее последовательность ДНК. FIG. 8 shows the leader amino acid sequence of SEQ ID N 17 and the DNA sequence encoding it.

Фиг. 9 показывает аминокислотную последовательность лидера SEQ ID N 16 и кодирующую ее последовательность ДНК. FIG. 9 shows the amino acid sequence of the leader of SEQ ID N 16 and the DNA sequence encoding it.

Фиг. 10 показывает аминокислотную последовательность лидера SEQ ID N 19 и кодирующую ее последовательность ДНК. FIG. 10 shows the amino acid sequence of the leader of SEQ ID N 19 and the DNA sequence encoding it.

Фиг. 11 показывает аминокислотную последовательность лидера SEQ ID N 20 и кодирующую ее последовательность ДНК. FIG. 11 shows the amino acid sequence of the leader of SEQ ID N 20 and the DNA sequence encoding it.

Фиг. 12 показывает аминокислотную последовательность лидера SEQ ID N 21 и кодирующую ее последовательность ДНК. FIG. 12 shows the amino acid sequence of the leader of SEQ ID N 21 and the DNA sequence encoding it.

Фиг. 13 показывает фрагмент ДНК pAK527, используемый как прямая матрица в конструкции SEQ ID N 4 и 6. FIG. 13 shows a pAK527 DNA fragment used as a direct matrix in the construction of SEQ ID Nos. 4 and 6.

Фиг. 14 показывает фрагмент ДНК pAK531, используемый как прямая матрица в конструкции SEQ ID N 8. FIG. 14 shows a pAK531 DNA fragment used as a direct matrix in the construction of SEQ ID N 8.

Фиг. 15 показывает фрагмент ДНК pAK555, используемый как прямая матрица в конструкции SEQ ID N 16 и 17. FIG. 15 shows a pAK555 DNA fragment used as a direct matrix in the construction of SEQ ID N 16 and 17.

Фиг. 16 показывает фрагмент ДНК pAK559, используемый как прямая матрица в конструкции SEQ ID N 19 и 20. FIG. 16 shows a pAK559 DNA fragment used as a direct template in construct SEQ ID N 19 and 20.

Фиг. 17 показывает фрагмент ДНК pAK562, используемый как прямая матрица в конструкции SEQ ID N 21. FIG. 17 shows a pAK562 DNA fragment used as a direct matrix in the construction of SEQ ID N 21.

Фиг. 18 показывает аминокислотную последовательность лидера SEQ ID N 27 и кодирующую ее последовательность ДНК SEQ ID N 66. FIG. 18 shows the amino acid sequence of the leader of SEQ ID N 27 and the DNA sequence encoding it of SEQ ID N 66.

Фиг. 19 показывает аминокислотную последовательность SEQ ID N 70, удлиненного с N-конца предшественника инсулина M13, и кодирующую ее последовательность ДНК SEQ ID N 71. FIG. 19 shows the amino acid sequence of SEQ ID N 70 extended from the N-terminus of the insulin precursor M13 and its DNA sequence encoding SEQ ID N 71.

Фиг. 20 показывает аминокислотную последовательность лидера SEQ ID N 67 и кодирующую ее последовательность ДНК SEQ ID N 69. FIG. 20 shows the amino acid sequence of the leader of SEQ ID N 67 and the DNA sequence encoding it of SEQ ID N 69.

Фиг. 21 показывает фрагмент ДНК SEQ ID N 72 pAK614, используемый как прямая матрица в конструкции SEQ ID N 27. FIG. 21 shows a DNA fragment of SEQ ID N 72 pAK614 used as a direct matrix in the construction of SEQ ID N 27.

Фиг. 22 показывает фрагмент ДНК SEQ ID N 73 pAK625, используемый как прямая матрица в конструкции SEQ ID N 67. FIG. 22 shows a DNA fragment of SEQ ID N 73 pAK625 used as a direct matrix in the construction of SEQ ID N 67.

ДЕТАЛЬНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ
Когда X1 в общей формуле I обозначает аминокислоту, она предпочтительно является Ser, Thr или Ala. Когда X2 в общей формуле I обозначает аминокислоту, она предпочтительно является Ser, Thr или Ala. Когда X2 в общей формуле I обозначает последовательность двух аминокислот, она предпочтительно представляет собой SerIle. Когда X2 в общей формуле I обозначает последовательность трех аминокислот, она предпочтительно представляет собой SerAlaIle. Когда X2 в общей формуле 1 обозначает последовательность четырех аминокислот, она предпочтительно представляет собой SerPheAlaThr. В предпочтительном воплощении X3 является аминокислотной последовательностью общей формулы II
X4-X5-X6, (II)
где X4 обозначает последовательность от 1 до 21 одинаковой или разной кодируемой аминокислоты, X5 обозначает Pro или одну из аминокислотных последовательностей ValAsnLeu или LeuAlaAsnVal- AlaMetAla, и X6 обозначает последовательность от 1 до 8 одинаковых или разных кодируемых аминокислот.DETAILED DESCRIPTION OF THE INVENTION
When X 1 in the general formula I is an amino acid, it is preferably Ser, Thr or Ala. When X 2 in the general formula I is an amino acid, it is preferably Ser, Thr or Ala. When X 2 in the general formula I denotes a sequence of two amino acids, it is preferably SerIle. When X 2 in the general formula I denotes a sequence of three amino acids, it is preferably SerAlaIle. When X 2 in the general formula 1 denotes a sequence of four amino acids, it is preferably SerPheAlaThr. In a preferred embodiment, X 3 is the amino acid sequence of the general formula II
X 4 -X 5 -X 6 , (II)
where X 4 denotes a sequence of 1 to 21 identical or different encoded amino acids, X 5 denotes Pro or one of the ValAsnLeu or LeuAlaAsnVal-AlaMetAla amino acid sequences, and X 6 denotes a sequence of 1 to 8 identical or different encoded amino acids.

В общей формуле II X4 предпочтительно обозначает аминокислотную последовательность, которая включает в себя один или несколько мотивов LeuValAsnLeu, SerValAsnLeu, MetAlaAsp, ThrGluSer, ArgPheAlaThr или ValAlaMetAla; или X4 обозначает аминокислотную последовательность, которая включает в себя последовательность AsnSerThr или AsnThrThr; или X4 обозначает аминокислотную последовательность, которая включает в себя последовательность
(Ser/Leu)ValAsnLeu,
(Ser/Leu)ValAsnLeuMetAlaAsp,
(Ser/Leu)ValAsnLeuMetAlaAspAsp,
(Ser/Leu)ValAsnLeuMetAlaAspAspThrGluSer,
(Ser/Leu)ValAsnLeuMetAlaAspAspThrGluSer Ile или
(Ser/Leu)ValAsnLeuMetAlaAspAspThrGluSerArgPheAlaThr; или
X4 обозначает аминокислотную последовательность, которая включает в себя последовательность
Asn(Thr/Ser)ThrLeu,
Asn(Thr/Ser)ThrLeuAsnLeu или
Asn(Thr/Ser)ThrLeuValAsnLeu; или любую их комбинацию.In the general formula II, X 4 is preferably an amino acid sequence that includes one or more LeuValAsnLeu, SerValAsnLeu, MetAlaAsp, ThrGluSer, ArgPheAlaThr or ValAlaMetAla motifs; or X 4 is an amino acid sequence that includes the sequence of AsnSerThr or AsnThrThr; or X 4 is an amino acid sequence that includes a sequence
(Ser / Leu) ValAsnLeu,
(Ser / Leu) ValAsnLeuMetAlaAsp,
(Ser / Leu) ValAsnLeuMetAlaAspAsp,
(Ser / Leu) ValAsnLeuMetAlaAspAspThrGluSer,
(Ser / Leu) ValAsnLeuMetAlaAspAspThrGluSer Ile or
(Ser / Leu) ValAsnLeuMetAlaAspAspThrGluSerArgPheAlaThr; or
X 4 denotes an amino acid sequence that includes a sequence
Asn (Thr / Ser) ThrLeu,
Asn (Thr / Ser) ThrLeuAsnLeu or
Asn (Thr / Ser) ThrLeuValAsnLeu; or any combination thereof.

В общей формуле II X5 предпочтительно обозначает Pro или аминокислотную последовательность, которая включает в себя последовательность ValAsnLeu, LeuAlaAsnValAlaMetAla, LeuAspValValAsnLeuProGly или LeuAspValValAsnLeuIleSerMet.In general formula II, X 5 is preferably a Pro or amino acid sequence that includes the sequence ValAsnLeu, LeuAlaAsnValAlaMetAla, LeuAspValValAsnLeuProGly or LeuAspValValAsnLeuIleSerMet.

Когда X6 в общей формуле II обозначает одну аминокислоту, она предпочтительно является Ala, Gly, Leu, Thr, Val или Ser. Когда X6 в общей формуле II обозначает последовательность двух аминокислот, она предпочтительно представляет собой GlyAla или SerAla. Когда X6 в общей формуле II обозначает последовательность трех аминокислот, она предпочтительно представляет собой AlaValAla. Когда X6 в общей формуле II обозначает последовательность восьми аминокислот, она предпочтительно представляет собой GlyAlaAspSerLysThrValGlu.When X 6 in general formula II is a single amino acid, it is preferably Ala, Gly, Leu, Thr, Val or Ser. When X 6 in the general formula II denotes a sequence of two amino acids, it is preferably GlyAla or SerAla. When X 6 in the general formula II denotes a sequence of three amino acids, it is preferably AlaValAla. When X 6 in the general formula II denotes a sequence of eight amino acids, it is preferably GlyAlaAspSerLysThrValGlu.

Примерами предпочтительных лидерных пептидов, кодируемых последовательностью ДНК LS, являются последовательности 1-67, приведенные в конце описания. Examples of preferred leader peptides encoded by the LS DNA sequence are sequences 1-67 at the end of the description.

Сигнальная последовательность (SP) может кодировать любой сигнальный пептид, который обеспечивает эффективное направление экспрессированного полипептида по секреторному пути в клетке. Этот сигнальный пептид может быть встречающимся в природе сигнальным пептидом или его функциональной частью либо синтетическим пептидом. Было обнаружено, что подходящими сигнальными пептидами являются сигнальный пептид α-фактора, сигнальный пептид амилазы из слюны мыши [14], модифицированный сигнальный пептид карбоксипептидазы [15] или дрожжевой BAR1 сигнальный пептид [16] или сигнальный пептид липазы из Humicola lanuginosa или их производные. Описан [17] сигнальный пептид дрожжевой аспартиновой протеазы 3. The signal sequence (SP) can encode any signal peptide that provides for the efficient directing of the expressed polypeptide along the secretory pathway in the cell. This signal peptide may be a naturally occurring signal peptide or a functional part thereof, or a synthetic peptide. Suitable signal peptides have been found to be the α-factor signal peptide, mouse saliva amylase signal peptide [14], modified carboxypeptidase signal peptide [15], or yeast BAR1 signal peptide [16] or lipic signal peptide from Humicola lanuginosa or their derivatives. The signal peptide of yeast aspartic protease 3 has been described [17].

Подходящим дрожжевым процессинговым сайтом, кодируемым последовательностью ДНК PS, может быть любая парная комбинация Lys и Arg, такая как LysArg, ArgLys, LysLys или ArgArg, которая позволяет осуществлять процессинг данного полипептида с помощью KEX2 протеазы Saccharomyces cerevisiae или эквивалентной протеазы в других видах дрожжей [13]. Если KEX2 процессинг не подходит, например если он будет вести к расщеплению полипептидного продукта, например из-за присутствия двух последовательных основных аминокислот в самом интересующем нас продукте, то может быть выбран процессинговый сайт для другой протеазы, включающий в себя комбинацию аминокислот, не встречающуюся в полипептидном продукте, например процессинговый сайт для FXa, IleGluGlyArg [18].A suitable yeast processing site encoded by the PS DNA sequence can be any pair of Lys and Arg combinations, such as LysArg, ArgLys, LysLys or ArgArg, which allows the processing of this polypeptide using KEX2 Saccharomyces cerevisiae protease or an equivalent protease in other types of yeast [13 ]. If KEX2 processing is not suitable, for example, if it leads to cleavage of the polypeptide product, for example, due to the presence of two consecutive basic amino acids in the product of interest to us, then a processing site for another protease may be selected, including a combination of amino acids not found in a polypeptide product, for example, a processing site for FX a , IleGluGlyArg [18].

Белком, продуцированным способом по изобретению, может быть любой белок, который успешно продуцируется в дрожжах. Примерами таких белков являются апротинин, ингибитор тканевого фактора пути метаболизма или ингибиторы других протеаз, инсулин или предшественники инсулина, человеческий или бычий гормон роста, интерлейкин, глюкагон, глюкагон-подобный пептид-1 (GLP-I), IGF-I, IGF-11, тканевой активатор плазминогена, трансформирующий фактор роста α или β , происходящий из тромбоцитов фактор роста, ферменты или функциональный аналог любого из этих белков. В данном контексте термин "функциональный аналог" обозначает белок со сходными с нативным белком функциями (подразумевается скорее природа, чем уровень биологической активности нативного белка). Белок может быть структурно схож с нативным белком и может быть получен из нативного белка путем добавления одной или нескольких аминокислот к С- и/или N-концу нативного белка, путем замещения одной или нескольких аминокислот в одном или нескольких различных сайтах нативной аминокислотной последовательности, путем делеции одной или нескольких аминокислот с одного или с обоих концов нативного белка или в одном или нескольких сайтах аминокислотной последовательности, или путем вставки одной или нескольких аминокислот в один или несколько сайтов нативной аминокислотной последовательности. Такие модификации хорошо известны для некоторых упомянутых выше белков. Также предшественники или промежуточные продукты для других белков могут быть получены способом по изобретению. Примером подходящего предшественника является предшественник инсулина M13, содержащий аминокислотную последовательность B(l-29)-Ala-Ala-Lys-A(l-21), где А(1-21) обозначает А цепь человеческого инсулина и В(1-29) обозначает В цепь человеческого инсулина, в которой отсутствует Thr (B30). The protein produced by the method of the invention can be any protein that is successfully produced in yeast. Examples of such proteins are aprotinin, a tissue factor pathway inhibitor or other protease inhibitors, insulin or insulin precursors, human or bovine growth hormone, interleukin, glucagon, glucagon-like peptide-1 (GLP-I), IGF-I, IGF-11 , tissue plasminogen activator, transforming growth factor α or β, platelet derived growth factor, enzymes, or a functional analog of any of these proteins. In this context, the term "functional analogue" refers to a protein with functions similar to the native protein (nature is meant rather than the level of biological activity of the native protein). A protein can be structurally similar to a native protein and can be obtained from a native protein by adding one or more amino acids to the C- and / or N-terminus of the native protein, by replacing one or more amino acids at one or more different sites of the native amino acid sequence, by deletions of one or more amino acids from one or both ends of the native protein or at one or more sites of the amino acid sequence, or by inserting one or more amino acids into one or more sites of the native amino acid sequence. Such modifications are well known for some of the proteins mentioned above. Also, precursors or intermediates for other proteins can be prepared by the method of the invention. An example of a suitable precursor is the insulin precursor M13 containing the amino acid sequence B (l-29) -Ala-Ala-Lys-A (l-21), where A (1-21) is the A chain of human insulin and B (1-29) denotes B chain of human insulin in which Thr is absent (B30).

Предпочтительны ДНК-конструкции, кодирующие лидерные последовательности, показанные на фиг. 4-12 или их подходящие модификации. Примерами подходящих модификаций последовательности ДНК являются замены нуклеотидов, которые не приводят к получению другой аминокислотной последовательности белка, а соответствуют использованию кодонов дрожжевого организма, в который вводят эту последовательность ДНК, или замены нуклеотидов, которые не приводят к получению другой аминокислотной последовательности и, следовательно, возможно, другой структуре белка. Другими примерами возможных модификаций являются вставки одного или нескольких кодонов в последовательность или добавление одного или нескольких кодонов к любому концу последовательности, или делеция одного или нескольких кодонов на любом конце или внутри данной последовательности. DNA constructs encoding the leader sequences shown in FIG. 4-12 or their suitable modifications. Examples of suitable modifications to the DNA sequence are nucleotide substitutions that do not result in a different amino acid sequence of the protein, but correspond to the use of codons of the yeast organism into which this DNA sequence are introduced, or nucleotide substitutions that do not result in a different amino acid sequence, and therefore it is possible , another protein structure. Other examples of possible modifications are the insertion of one or more codons into a sequence or the addition of one or more codons to either end of the sequence, or the deletion of one or more codons at either end or within a given sequence.

Рекомбинантным вектором экспрессии, несущим экспрессирующую кассету
5'-P-SP-LS-PS-*ген*-(T)i-3',
где P, SP, LS, *ген*, Т и i определены выше, может быть любой вектор, способный реплицироваться в дрожжевых организмах. Промотором может быть любая последовательность ДНК, обнаруживающая транскрипционную активность в дрожжах, и которая может быть получена из генов, кодирующих либо гомологичные, либо гетерологичные для дрожжей белки. Такой промотор предпочтительно получают из генов, кодирующих гомологичные для дрожжей белки. Примерами подходящих промоторов являются промоторы Saccharomyces cerevisiae MFα1, TPI, ADH или PGK.Recombinant expression vector carrying an expression cassette
5'-P-SP-LS-PS- * gene * - (T) i -3 ',
where P, SP, LS, * gene *, T, and i are defined above, there can be any vector capable of replicating in yeast organisms. The promoter can be any DNA sequence that detects transcriptional activity in yeast, and which can be obtained from genes encoding either proteins homologous or heterologous to yeast. Such a promoter is preferably derived from genes encoding yeast homologous proteins. Examples of suitable promoters are the promoters of Saccharomyces cerevisiae MFα1, TPI, ADH or PGK.

Показанные выше последовательности должны также предпочтительно быть присоединены к соответствующему терминатору, например TPI терминатору [19]. The sequences shown above should also preferably be attached to an appropriate terminator, for example a TPI terminator [19].

Рекомбинантный вектор экспрессии по изобретению содержит далее последовательность ДНК, способствующую репликации данного вектора в дрожжах. Примерами таких последовательностей являются гены репликации REP 1-3 и сайт инициации репликации дрожжевой плазмиды 2μ. Такой вектор также может содержать селективный маркер, например TPI ген Schizosaccharomyces pombe [20]. The recombinant expression vector of the invention further comprises a DNA sequence that facilitates the replication of the vector in yeast. Examples of such sequences are REP 1-3 replication genes and a 2μ yeast plasmid replication initiation site. Such a vector may also contain a selective marker, for example, the TPI gene of Schizosaccharomyces pombe [20].

Методы, используемые для лигирования последовательности 5'-P-SP-LS-PS-*ген*-(T)i-3' и вставки их в подходящие дрожжевые векторы, содержащие необходимую для репликации в дрожжах информацию, являются хорошо известными специалистам [18]. Очевидно, что такой вектор может быть сконструирован либо путем получения ДНК-конструкции, содержащей полную последовательность 5'-P-SP-LS-PS-*ген*-(T)i-3' с последующей вставкой этого фрагмента в подходящий вектор экспрессии, либо путем последовательной вставки в подходящий вектор фрагментов ДНК, кодирующих информацию об индивидуальных элементах (таких как промоторная последовательность, сигнальный пептид, лидерная последовательность GlnProlle (Asp/Glu) (Asp/Glu) X1 (Glu/Asp)X2AsnZ (Thr/Ser)X3, процессинговый сайт, полипептид и, если имеется, терминаторная последовательность), с последующим лигированием.The methods used to ligate the 5'-P-SP-LS-PS- * gene * - (T) i -3 'sequence and insert them into suitable yeast vectors containing the information necessary for replication in yeast are well known to those skilled in the art [18 ]. Obviously, such a vector can be constructed either by obtaining a DNA construct containing the complete sequence of 5'-P-SP-LS-PS- * gene * - (T) i -3 ', followed by insertion of this fragment into a suitable expression vector, or by sequentially inserting DNA fragments encoding information on individual elements (such as a promoter sequence, signal peptide, leader sequence GlnProlle (Asp / Glu) (Asp / Glu) X 1 (Glu / Asp) X 2 AsnZ (Thr / ser) X 3, the processing site, the polypeptide and, if available, followed by terminator atelnost) followed by ligation.

Дрожжевым организмом, используемым в способе по изобретению, может быть любой подходящий дрожжевой организм, который при культивировании продуцирует большие количества интересующего нас полипептида. Примерами подходящих дрожжевых организмов служат штаммы дрожжей видов Saccharomyces cerevisiae, Saccharomyces kluyveri, Saccharomyces pombe или Saccharomyces uvarum. Трансформацию дрожжевых клеток можно осуществить путем создания протопластов с последующей трансформацией известными способами. Средой, используемой для культивирования клеток, может быть любая традиционная среда, подходящая для выращивания дрожжевых организмов. Секретированный полипептид, значительная часть которого должна присутствовать в среде в правильно процессированной форме, может быть выделен из среды традиционными способами, включая отделение дрожжевых клеток от среды путем центрифугирования или фильтрации, осаждение белковых компонентов супернатанта или фильтрата с помощью соли, например сульфата аммония, с последующей очисткой различными хроматографическими методами, например ион-обменной хроматографией, аффинной хроматографией и т. д. The yeast organism used in the method according to the invention can be any suitable yeast organism that, when cultured, produces large quantities of the polypeptide of interest to us. Examples of suitable yeast organisms are yeast strains of the species Saccharomyces cerevisiae, Saccharomyces kluyveri, Saccharomyces pombe or Saccharomyces uvarum. The transformation of yeast cells can be accomplished by creating protoplasts followed by transformation by known methods. The medium used for culturing the cells may be any conventional medium suitable for growing yeast organisms. A secreted polypeptide, a significant part of which must be present in the medium in a properly processed form, can be isolated from the medium by conventional methods, including separation of yeast cells from the medium by centrifugation or filtration, precipitation of the protein components of the supernatant or filtrate with a salt, for example ammonium sulfate, followed by purification by various chromatographic methods, for example, ion exchange chromatography, affinity chromatography, etc.

Настоящее изобретение далее демонстрируется на следующих примерах, которые не ограничивают рамки заявленного изобретения. The present invention is further demonstrated by the following examples, which do not limit the scope of the claimed invention.

ПРИМЕРЫ
Плазмиды и ДНК
Все плазмиды для экспрессии имеют C-POT тип. Такие плазмиды описаны [21] , и характеризуются наличием гена триозо фосфат изомеразы (РОТ) из Schizosaccharomyces pombe для селекции и стабилизации плазмид. Содержащие ген РОТ плазмиды могут быть получены из депонированного штамма E.coli (ATCC 39685). Далее эти плазмиды содержат промотор и терминатор триозо фосфат изомеразы из S. cerevisiae (PTPI и TTPI). Они идентичны pMT742 [22] (см.фиг.1), за исключением области, определенной рестрикционным сайтом EcoRI-XbaI, охватывающим область, кодирующую сигнал/лидер/продукт.EXAMPLES
Plasmids and DNA
All expression plasmids are of the C-POT type. Such plasmids have been described [21] and are characterized by the presence of the triose phosphate isomerase gene (POT) from Schizosaccharomyces pombe for selection and stabilization of plasmids. The plasmids containing the POT gene can be obtained from the deposited E. coli strain (ATCC 39685). Further, these plasmids contain the promoter and terminator of triose phosphate isomerase from S. cerevisiae (P TPI and T TPI ). They are identical to pMT742 [22] (see FIG. 1), with the exception of the region defined by the EcoRI-XbaI restriction site, covering the region encoding the signal / leader / product.

Плазмиды pAK527, pAK531, pAK555, pAK559, pAK562, pAK614 и pAK625 были использованы в качестве ДНК-матриц в ПЦР, примененной в конструкции лидеров, описанной в примерах. Синтетические фрагменты ДНК, служащие в качестве прямых матриц, показаны на фиг. 13-17. За исключением показанных областей ДНК эти плазмиды идентичны pAK492, показанной на фиг. 1. Plasmids pAK527, pAK531, pAK555, pAK559, pAK562, pAK614, and pAK625 were used as DNA templates in PCR used in the leader construct described in the examples. Synthetic DNA fragments serving as direct templates are shown in FIG. 13-17. With the exception of the DNA regions shown, these plasmids are identical to pAK492 shown in FIG. 1.

Синтетические фрагменты ДНК были синтезированы на автоматическом ДНК-синтезаторе (Applied Biosystems model 380A) с использованием фосфорамидитной химии и коммерчески доступных реагентов [23]. Synthetic DNA fragments were synthesized using an automated DNA synthesizer (Applied Biosystems model 380A) using phosphoramidite chemistry and commercially available reagents [23].

Все остальные использованные материалы и методы являются широко известными [18]. All other materials and methods used are widely known [18].

Пример 1
Синтез лидера SEQ ID N 4 для экспрессии предшественника инсулина M13 в S.cerevisiae (штамм yAK546).Example 1
Synthesis of the leader SEQ ID N 4 for expression of the precursor of insulin M13 in S. cerevisiae (strain yAK546).

Лидер SEQ ID N 4 имеет следующую аминокислотную последовательность: GlnProIleAspAspGluAsnThrThrSerValAsnLeuProVal. The leader of SEQ ID N 4 has the following amino acid sequence: GlnProIleAspAspGluAsnThrThrSerValAsnLeuProVal.

Были синтезированы следующие олигонуклеотиды:
# 94 5'-TAAATCTATAACTACAAAAAACACATA-3' SEQ ID N 29
# 333 5'-GACTCTCTTAACTGGCAAGTTGACA-3' SEQ ID N 30
# 312 5'-AAGTACAAAGCTTCAACCAAGTGAGAACCACACAAGTGTTGGTTAACGAATCTCTT-3' SEQ ID N 31
# 1845 5'-CATACACAATATAAACGACGG-3' SEQ ID N 32
Следующие полимеразные цепные реакции (ПЦР) были осуществлены с использованием набора реагентов Gene Amp PCR (Perkin Elmer, 761 Main Avewalk, CT 06859, USA), согласно инструкции производителя. В течение реакции на ПЦР-смесь наслаивали 100 мкл минерального масла (Sigma Chemical СО, St. Louis MO, USA):
Полимеразная цепная реакция N 1
5 мкл олигонуклеотида # 94 (50 пмоль)
5 мкл олигонуклеотида # 333 (50 пмоль)
10 мкл 10x ПЦР-буфера
16 мкл смеси dNTP
0,5 мкл Taq фермента
0,5 мкл плазмиды pAK527 (фиг. 13) в качестве матрицы (0,2 мкг ДНК) 63 мкл воды
Было проведено в общем 12 циклов, один цикл составлял 94oC в течение 1 мин, 37oC в течение 2 мин, 72oC в течение 3 мин. ПЦР-смесь затем наносили на 2%-ный агарозный гель и стандартным образом проводили электрофорез [18]. Полученные фрагменты ДНК вырезали из агарозного геля и выделяли, используя Gene Clean kit (Bio 101 inc., PO BOX 2284, La Jolla, CA 92038, USA), согласно инструкции производителя.The following oligonucleotides were synthesized:
# 94 5'-TAAATCTATAACTACAAAAAAACACATA-3 'SEQ ID N 29
# 333 5'-GACTCTCTTAACTGGCAAGTTGACA-3 'SEQ ID N 30
# 312 5'-AAGTACAAAGCTTCAACCAAGTGAGAACCACACAAGTGTTGGTTAACGAATCTCTT-3 'SEQ ID N 31
# 1845 5'-CATACACAATATAAACGACGG-3 'SEQ ID N 32
The following polymerase chain reactions (PCR) were carried out using the Gene Amp PCR reagent kit (Perkin Elmer, 761 Main Avewalk, CT 06859, USA), according to the manufacturer's instructions. During the reaction, 100 μl of mineral oil (Sigma Chemical CO, St. Louis MO, USA) was layered onto the PCR mixture:
Polymerase chain reaction N 1
5 μl of oligonucleotide # 94 (50 pmol)
5 μl of oligonucleotide # 333 (50 pmol)
10 μl 10x PCR buffer
16 μl dNTP mixture
0.5 μl Taq enzyme
0.5 μl of plasmid pAK527 (Fig. 13) as a matrix (0.2 μg DNA) 63 μl of water
A total of 12 cycles were carried out, one cycle was 94 ° C for 1 minute, 37 ° C for 2 minutes, 72 ° C for 3 minutes. The PCR mixture was then applied to a 2% agarose gel and electrophoresis was carried out in a standard manner [18]. The resulting DNA fragments were excised from the agarose gel and isolated using the Gene Clean kit (Bio 101 inc., PO BOX 2284, La Jolla, CA 92038, USA) according to the manufacturer's instructions.

Полимеразная цепная реакция N 2
5 мкл олигонуклеотида # 312 (50 пмоль)
5 мкл олигонуклеотида # 94 (50 пмоль)
10 мкл 10x ПЦР-буфера
16 мкл смеси dNTP
0,5 мкл Taq фермента
10 мкл очищенного фрагмента ДНК из ПЦР N1
53,5 мкл воды
Было проведено в общем 12 циклов, один цикл составлял 94oC в течение 1 мин, 37oC в течение 2 мин, 72oC в течение 3 мин. Полученные после ПЦР N 2 фрагменты ДНК выделяли и очищали, используя Gene Clean kit (Bio 101 inc., PO BOX 2284, La Jolla, CA 92038, USA), согласно инструкции производителя.Polymerase chain reaction N 2
5 μl of oligonucleotide # 312 (50 pmol)
5 μl of oligonucleotide # 94 (50 pmol)
10 μl 10x PCR buffer
16 μl dNTP mixture
0.5 μl Taq enzyme
10 μl of purified DNA fragment from PCR N1
53.5 μl of water
A total of 12 cycles were carried out, one cycle was 94 ° C for 1 minute, 37 ° C for 2 minutes, 72 ° C for 3 minutes. DNA fragments obtained after PCR N 2 were isolated and purified using the Gene Clean kit (Bio 101 inc., PO BOX 2284, La Jolla, CA 92038, USA) according to the manufacturer's instructions.

Очищенные ПЦР фрагменты ДНК растворяли в 10 мкл воды и буфера для рестрикционных нуклеаз, и разрезали рестрикционными эндонуклеазами Asp 718 и Hind III в общем объеме 15 мкл, используя стандартные методики [18]. Фрагмент ДНК 167 пн Asp 718/Hind III подвергали электрофорезу на агарозном геле и очищали, используя Gene Clean kit, как описано. S.cerevisiae экспрессионная плазмида pAK492 (показано на фиг. 1) является производной описанной выше плазмиды pMT742, в которой фрагмент, кодирующий сигнал/лидер/предшественник инсулина был заменен на EcoRI-Xbal фрагмент, показанный на фиг. 2. Этот фрагмент был синтезирован на Applied Biosystem ДНК синтезаторе, согласно инструкциям производителя. Плазмиду pAK492 разрезали рестрикционными эндонуклеазами Asp 718 и Hind III и выделяли фрагмент ДНК 140 пн, кодирующий часть предшественника инсулина M13. Три фрагмента ДНК лигировали вместе, используя N4 ДНК-лигазу в стандартных условиях [18]. Затем лигированной смесью трансформировали компетентный штамм E.coli (R-, М+) и определяли трансформантов по устойчивости к ампицилину. Выделяли плазмиды из полученных колоний E.coli, используя стандартные методики [18], осуществляя проверку подходящими рестрикционными эндонуклеазами, то есть EcoRI,- XbaI, NcoI и Hind III. С помощью ДНК сиквенс- анализа (Sequenase, U.S. Biochemical Corp. ) с использованием праймера # 94 было показано, что отселектированная плазмида pAK546 содержит последовательность ДНК, кодирующую лидер SEQ ID N 4. Последовательность ДНК, кодирующая лидер SEQ ID No. 4, показана на фиг. 4. Плазмидой pAK546 трансформировали штамм MT663 S.cerevisiae [24] и назвали полученный штамм yAK546. Последовательность ДНК области экспрессионной плазмиды, кодирующей белок, дана на фиг. 5. Purified PCR DNA fragments were dissolved in 10 μl of water and restriction nuclease buffer, and cut with restriction endonucleases Asp 718 and Hind III in a total volume of 15 μl using standard techniques [18]. A 167 bp DNA fragment of Asp 718 / Hind III was subjected to agarose gel electrophoresis and purified using the Gene Clean kit as described. The S. cerevisiae expression plasmid pAK492 (shown in FIG. 1) is a derivative of the pMT742 plasmid described above, in which the fragment encoding the signal / leader / precursor of insulin has been replaced by the EcoRI-Xbal fragment shown in FIG. 2. This fragment was synthesized on an Applied Biosystem DNA synthesizer according to the manufacturer's instructions. Plasmid pAK492 was cut with Asp 718 and Hind III restriction endonucleases and a 140 bp DNA fragment encoding part of the insulin precursor M13 was isolated. Three DNA fragments were ligated together using N4 DNA ligase under standard conditions [18]. Then, the competent E. coli strain (R-, M +) was transformed with the ligation mixture and transformants were determined by ampicillin resistance. Plasmids were isolated from the obtained E. coli colonies using standard techniques [18], checking with suitable restriction endonucleases, that is, EcoRI, XbaI, NcoI and Hind III. Using sequence DNA analysis (Sequenase, U.S. Biochemical Corp.) using primer # 94, it was shown that the selected plasmid pAK546 contains the DNA sequence encoding the leader of SEQ ID N 4. The DNA sequence encoding the leader of SEQ ID No. 4 is shown in FIG. 4. Plasmid pAK546 transformed the S. cerevisiae MT663 strain [24] and named the resulting yAK546 strain. The DNA sequence of the region of the expression plasmid encoding the protein is given in FIG. 5.

Пример 2
Синтез лидера SEQ ID N 6 для экспрессии предшественника инсулина M13 в S.cerevisiae (штамм YAK531).Example 2
Synthesis of leader SEQ ID N 6 for expression of the insulin M13 precursor in S. cerevisiae (strain YAK531).

Лидер SEQ ID N 6 имеет следующую аминокислотную последовательность: GlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuProAla. The leader of SEQ ID N 6 has the following amino acid sequence: GlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuProAla.

Были синтезированы следующие олигонуклеотиды:
# 331 5'-GAATCTCTTAGCTGGCAAGTTGACAGAAGTAGTGTTAG TTTCAGAGTCGTCAATT-3' SEQ ID N 33
Полимеразная цепная реакция была проведена, как описано в примере 1, но вместо олигонуклеотида # 333 использовали олигонуклеотид # 331.The following oligonucleotides were synthesized:
# 331 5'-GAATCTCTTAGCTGGCAAGTTGACAGAAGTAGTGTTAG TTTCAGAGTCGTCAATT-3 'SEQ ID N 33
The polymerase chain reaction was carried out as described in Example 1, but oligonucleotide # 331 was used instead of oligonucleotide # 333.

Фрагмент ДНК 168 пн Asp 718/Hind III подвергали электрофорезу на агарозном геле и очищали, как описано в примере 1. Фрагмент ДНК Asp 718/Hind III субклонировали в S. cerevisiae экспрессионной плазмиде, как описано в примере 1. С помощью ДНК сиквенс-анализа, как описано в примере 1, было показано, что отселектированная плазмида pAK531 содержит последовательность ДНК, кодирующую лидер SEQ ID N 6. Последовательность ДНК, кодирующая лидер SEQ ID N 6, показана на фиг.6. Плазмидой pAK531 трансформировали штамм MT663 S.cerevisiae [25] и назвали полученный штамм yAK531. Последовательности ДНК, кодирующие сигнальный пептид и предшественник инсулина M13, являются такими же, как на фиг.5. A 168 bp DNA fragment of Asp 718 / Hind III was subjected to agarose gel electrophoresis and purified as described in Example 1. An Asp 718 / Hind III DNA fragment was subcloned into an S. cerevisiae expression plasmid as described in Example 1. Using a DNA sequence analysis as described in example 1, it was shown that the selected plasmid pAK531 contains the DNA sequence encoding the leader of SEQ ID N 6. The DNA sequence encoding the leader of SEQ ID N 6 is shown in Fig.6. The plasmid pAK531 transformed the S. cerevisiae MT663 strain [25] and named the resulting yAK531 strain. The DNA sequences encoding the signal peptide and the precursor of insulin M13 are the same as in figure 5.

Пример 3
Синтез лидера SEQ ID N 8 для экспрессии предшественника инсулина M13 в S.cerevisiae (штамм yAK547).Example 3
Synthesis of leader SEQ ID N 8 for expression of the insulin precursor M13 in S. cerevisiae (strain yAK547).

Лидер SEQ ID N 8 имеет следующую аминокислотную последовательность: GinProIleAspAspThrGluSerAsnThrThrSerValAsnLeuProAla. The leader of SEQ ID N 8 has the following amino acid sequence: GinProIleAspAspThrGluSerAsnThrThrSerValAsnLeuProAla.

Были синтезированы следующие олигонуклеотиды:
# 345 5'-AACGAATCTCTTAGCACCTGGCAAGTTGACAGAAGT-3' SEQ ID N 34
Полимеразная цепная реакция была проведена, как описано в примере 1, но вместо олигонуклеотида # 333 использовали олигонуклеотид # 345 и в качестве матрицы-плазмиду pAK531 (фиг.14).The following oligonucleotides were synthesized:
# 345 5'-AACGAATCTCTTAGCACCTGGCAAGTTGACAGAAGT-3 'SEQ ID N 34
The polymerase chain reaction was carried out as described in example 1, but instead of oligonucleotide # 333, oligonucleotide # 345 was used and pAK531 as the plasmid template (Fig. 14).

Фрагмент ДНК 171 пн Asp 718/Hind III подвергали электрофорезу на агарозном геле и очищали, как описано в примере 1. Фрагмент ДНК Asp 718/Hind III субклонировали в S. cerevisiae экспрессионной плазмиде, как описано в примере 1. С помощью ДНК сиквенс-анализа, как описано в примере 1, было показано, что отселектированная плазмида pAK547 содержит последовательность ДНК, кодирующую лидер SEQ ID N 8. Последовательность ДНК, кодирующая лидер SEQ ID N 8, показана на фиг. 7. Плазмидой pAK547 трансформировали штамм MT663 S. cerevisiae [25] и назвали полученный штамм yAK547. Последовательности ДНК, кодирующие сигнальный пептид и предшественник инсулина M13, являются такими же, как на фиг. 5. A 171 bp DNA fragment of Asp 718 / Hind III was subjected to agarose gel electrophoresis and purified as described in Example 1. An Asp 718 / Hind III DNA fragment was subcloned into an S. cerevisiae expression plasmid as described in Example 1. Using a DNA sequence analysis as described in Example 1, it was shown that the selected plasmid pAK547 contains the DNA sequence encoding the leader of SEQ ID N 8. The DNA sequence encoding the leader of SEQ ID N 8 is shown in FIG. 7. Plasmid pAK547 transformed the S. cerevisiae MT663 strain [25] and named the resulting yAK547 strain. The DNA sequences encoding the signal peptide and the insulin precursor M13 are the same as in FIG. 5.

Пример 4
Синтез лидера SEQ ID N 17 для экспрессии предшественника инсулина M13 в S.cerevisiae (штамм yAK561).Example 4
Synthesis of leader SEQ ID N 17 for expression of the precursor of insulin M13 in S. cerevisiae (strain yAK561).

Лидер SEQ ID N 17 имеет следующую аминокислотную последовательность: GlnProIleAspAspThrGluSerAsnThrThrLeuValAsnLeuProGlyAla. The leader of SEQ ID N 17 has the following amino acid sequence: GlnProIleAspAspThrGluSerAsnThrThrLeuValAsnLeuProGlyAla.

Были синтезированы следующие олигонуклеотиды:
25 # 376 5'-AACGAATCTCTTAGCACCTGGCAAGTTGACCAAAGTAGTGTTGATAGATTCAGTGTCGTC-3' SEQ ID N 35
Полимеразная цепная реакция была проведена, как описано в примере 1, но вместо олигонуклеотида # 333 использовали олигонуклеотид # 376 и в качестве матрицы - плазмиду pAK555 (фиг. 15).The following oligonucleotides were synthesized:
25 # 376 5'-AACGAATCTCTTAGCACCTGGCAAGTTGACCAAAGTAGTGTTGATAGATTCAGTGTCGTC-3 'SEQ ID N 35
The polymerase chain reaction was carried out as described in example 1, but oligonucleotide # 376 was used instead of oligonucleotide # 333 and plasmid pAK555 was used as template (Fig. 15).

Фрагмент ДНК 180 пн Asp 718/Hind III подвергали электрофорезу на агарозном геле и очищали, как описано в примере 1. Фрагмент ДНК Asp 718/Hind III субклонировали в S.cerevisiae экспрессионной плазмиде, как описано в примере 1. С помощью ДНК сиквенс-анализа, как описано в примере 1, было показано, что отселектированная плазмида pAK561 содержит последовательность ДНК, кодирующую лидер SEQ ID N 17. Последовательность ДНК, кодирующая лидер SEQ ID No. 17, показана на фиг. 8. Плазмидой pAK561 трансформировали штамм MT663 S. cerevisiae [25] и назвали полученный штамм yAK561. Последовательности ДНК, кодирующие сигнальный пептид и предшественник инсулина M13, являются такими же, как на фиг. 5. A 180 bp DNA fragment of Asp 718 / Hind III was subjected to agarose gel electrophoresis and purified as described in Example 1. An Asp 718 / Hind III DNA fragment was subcloned into the S. cerevisiae expression plasmid as described in Example 1. Using DNA sequencing analysis as described in example 1, it was shown that the selected plasmid pAK561 contains the DNA sequence encoding the leader of SEQ ID N 17. The DNA sequence encoding the leader of SEQ ID No. 17 is shown in FIG. 8. Plasmid pAK561 transformed the S. cerevisiae MT663 strain [25] and named the resulting yAK561 strain. The DNA sequences encoding the signal peptide and the insulin precursor M13 are the same as in FIG. 5.

Пример 5
Синтез лидера SEQ ID N 16 для экспрессии предшественника инсулина M13 в S.cerevisiae (штамм VAK559).Example 5
Synthesis of leader SEQ ID N 16 for expression of the insulin M13 precursor in S. cerevisiae (strain VAK559).

Лидер SEQ ID N 16 имеет следующую аминокислотную последовательность: GinProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMet- AlaAspAspThrGluSerIleAsnThrThrLeuValAsnLeuProGlyAla. The leader of SEQ ID N 16 has the following amino acid sequence: GinProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMet-AlaAspAspThrGluSerIleAsnThrThrLeuValAsnLeuProGlyAla.

Были синтезированы следующие олигонуклеотиды:
# 375 5'-AACGAATCTCTTAGCACCTGGCAAGTTAACCAAAGTAGT GTTGATAGATTCAGTGTCGTCAGCCATCAAGTTGAC-3' SEQ ID N 36
Полимеразная цепная реакция была проведена, как описано в примере 1, но вместо олигонуклеотида # 333 использовали олигонуклеотид # 375 и в качестве матрицы - плазмиду pAK555 (фиг.15).The following oligonucleotides were synthesized:
# 375 5'-AACGAATCTCTTAGCACCTGGCAAGTTAACCAAAGTAGT GTTGATAGATTCAGTGTCGTCAGCCATCAAGTTGAC-3 'SEQ ID N 36
The polymerase chain reaction was carried out as described in example 1, but instead of oligonucleotide # 333, oligonucleotide # 375 was used and plasmid pAK555 was used as a template (Fig. 15).

Фрагмент ДНК 222 пн Asp 718/Hind III подвергали электрофорезу на агарозном геле и очищали, как описано в примере 1. Фрагмент ДНК Asp 718/Hind III субклонировали в S.cerevisiae экспрессионной плазмиде, как описано в примере 1. С помощью ДНК сиквенс-анализа, как описано в примере 1, было показано, что отселектированная плазмида pAK559 содержит последовательность ДНК, кодирующую лидер SEQ ID N 16. Последовательность ДНК, кодирующая лидер SEQ ID N 16, показана на фиг. 9. Плазмидой pAK559 трансформировали штамм MT663 S. cerevisiae [25] и назвали полученный штамм yAK559. Последовательности ДНК, кодирующие сигнальный пептид и предшественник инсулина M13, являются такими же, как на фиг. 5. The 222 bp DNA fragment of Asp 718 / Hind III was subjected to agarose gel electrophoresis and purified as described in Example 1. The Asp 718 / Hind III DNA fragment was subcloned into the S. cerevisiae expression plasmid as described in Example 1. Using DNA sequencing analysis as described in Example 1, it was shown that the selected plasmid pAK559 contains the DNA sequence encoding the leader of SEQ ID N 16. The DNA sequence encoding the leader of SEQ ID N 16 is shown in FIG. 9. Plasmid pAK559 transformed the S. cerevisiae strain MT663 [25] and named the resulting strain yAK559. The DNA sequences encoding the signal peptide and the insulin precursor M13 are the same as in FIG. 5.

Пример 6
Синтез лидера SEQ ID N 19 для экспрессии предшественника инсулина M13 в S.cerevisiae (штамм yAK580).Example 6
Synthesis of leader SEQ ID N 19 for expression of the insulin M13 precursor in S. cerevisiae (strain yAK580).

Лидер SEQ ID N 19 имеет следующую аминокислотную последовательность: GlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMet- AlaAspAspThrGluSerArgPheAlaThrAsnThrThrLeuValAsnLeuProLeu. The leader of SEQ ID N 19 has the following amino acid sequence: GlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMet-AlaAspAspThrGluSerArgPheAlaThrAsnThrThrLeuValAsnLeuProLeu.

Были синтезированы следующие олигонуклеотиды:
# 384 5'-AACGAATCTCTTCAATGGCAAGTTAACCAAAGTAGTGT TAGTAGCGAATCTAGATTCAGTGTCGTCAGCCAT-3' SEQ ID N 37
Полимеразная цепная реакция была проведена, как описано в примере 1, но вместо олигонуклеотида # 333 использовали олигонуклеотид # 384 и в качестве матрицы - плазмиду pAK559 (фиг.16).The following oligonucleotides were synthesized:
# 384 5'-AACGAATCTCTTCAATGGCAAGTTAACCAAAGTAGTGT TAGTAGCGAATCTAGATTCAGTGTCGTCAGCCAT-3 'SEQ ID N 37
The polymerase chain reaction was carried out as described in example 1, but instead of oligonucleotide # 333, oligonucleotide # 384 was used and plasmid pAK559 was used as a template (Fig. 16).

Фрагмент ДНК 228 пн Asp 718/Hind III подвергали электрофорезу на агарозном геле и очищали, как описано в примере 1. Фрагмент ДНК Asp 718/Hind III субклонировали в S. cerevisiae экспрессионной плазмиде, как описано в примере 1. С помощью ДНК сиквенс-анализа, как описано в примере 1, было показано, что отселектированная плазмида pAK580 содержит последовательность ДНК, кодирующую лидер SEQ ID N 19. Последовательность ДНК, кодирующая лидер SEQ ID N 19, показана на фиг. 10. Плазмидой pAK580 трансформировали штамм MT663 S. cerevisiae [25] и назвали полученный штамм yAK580. Последовательности ДНК, кодирующие сигнальный пептид и предшественник инсулина M13, являются такими же, как на фиг. 5. A 228 bp DNA fragment of Asp 718 / Hind III was subjected to agarose gel electrophoresis and purified as described in Example 1. An Asp 718 / Hind III DNA fragment was subcloned into an S. cerevisiae expression plasmid as described in Example 1. Using a DNA sequence analysis as described in Example 1, it was shown that the selected plasmid pAK580 contains the DNA sequence encoding the leader of SEQ ID N 19. The DNA sequence encoding the leader of SEQ ID N 19 is shown in FIG. 10. Plasmid pAK580 transformed the S. cerevisiae MT663 strain [25] and named the resulting yAK580 strain. The DNA sequences encoding the signal peptide and the insulin precursor M13 are the same as in FIG. 5.

Пример 7
Синтез лидера SEQ ID N 20 для экспрессии предшественника инсулина M13 в S.cerevisiae (штамм yAK583).Example 7
Synthesis of leader SEQ ID N 20 for expression of the insulin precursor M13 in S. cerevisiae (strain yAK583).

Лидер SEQ ID N 20 имеет следующую аминокислотную последовательность: GlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMet- AlaAspAspThrGluSerIleAsnThrThrLeuValAsnLeuAlaAsnValAlaMetAla. The leader of SEQ ID N 20 has the following amino acid sequence: GlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMet-AlaAspAspThrGluSerIleAsnThrThrLeuValAsnLeuAlaAsnValAlaMetAla.

Были синтезированы следующие олигонуклеотиды:
# 390 5'-AACGAATCTCTTAGCCATGGCAACGTTAGCCAAGTTAA CCAAAGT-3' SEQ ID N 38
Полимеразная цепная реакция была проведена, как описано в примере 1, но вместо олигонуклеотида # 333 использовали олигонуклеотид # 390 и в качестве матрицы - плазмиду pAK559 (фиг. 16).The following oligonucleotides were synthesized:
# 390 5'-AACGAATCTCTTAGCCATGGCAACGTTAGCCAAGTTAA CCAAAGT-3 'SEQ ID N 38
The polymerase chain reaction was carried out as described in example 1, but oligonucleotide # 390 was used instead of oligonucleotide # 333 and plasmid pAK559 was used as template (Fig. 16).

Фрагмент ДНК 231 пн Asp 718/Hind III подвергали электрофорезу на агарозном геле и очищали, как описано в примере 1. Фрагмент ДНК Asp 718/Hind III субклонировали в S.cerevisiae экспрессионной плазмиде, как описано в примере 1. С помощью ДНК сиквенс-анализа, как описано в примере 1, было показано, что отселектированная плазмида pAK583 содержит последовательность ДНК, кодирующую лидер SEQ ID N 20. Последовательность ДНК, кодирующая лидер SEQ ID N 20, показана на фиг.11. Плазмидой pAK583 трансформировали штамм MT663 S. cerevisiae [25] и назвали полученный штамм yAK583. Последовательности ДНК, кодирующие сигнальный пептид и предшественник инсулина M13, являются такими же, как на фиг. 5. A 231 bp DNA fragment of Asp 718 / Hind III was subjected to agarose gel electrophoresis and purified as described in Example 1. An Asp 718 / Hind III DNA fragment was subcloned into the S. cerevisiae expression plasmid as described in Example 1. Using DNA sequencing analysis as described in Example 1, it was shown that the selected plasmid pAK583 contains the DNA sequence encoding the leader of SEQ ID N 20. The DNA sequence encoding the leader of SEQ ID N 20 is shown in FIG. 11. The plasmid pAK583 transformed the S. cerevisiae MT663 strain [25] and named the resulting yAK583 strain. The DNA sequences encoding the signal peptide and the insulin precursor M13 are the same as in FIG. 5.

Пример 8
Синтез лидера SEQ ID N 21 для экспрессии предшественника инсулина M13 в S.cerevisiae (штамм yAK586).Example 8
Synthesis of leader SEQ ID N 21 for expression of the insulin M13 precursor in S. cerevisiae (strain yAK586).

Лидер SEQ ID N 21 имеет следующую аминокислотную последовательность: GlnProIleAspAspThrGluSerAlaIleAsnThrThrLeuValAsnLeuProGlyAla. The leader of SEQ ID N 21 has the following amino acid sequence: GlnProIleAspAspThrGluSerAlaIleAsnThrThrLeuValAsnLeuProGlyAla.

Были синтезированы следующие олигонуклеотиды:
# 401 5'-AACGAATCTCTTAGCACCTGGCAAGTTGACCAAAGTAG TGTTGATAGCAGATTCAGTGTCG-3' SEQ ID N 39
Полимеразная цепная реакция была проведена, как описано в примере 1, но вместо олигонуклеотида # 333 использовали олигонуклеотид # 401 и в качестве матрицы - плазмиду pAK562 (фиг. 17). Фрагмент ДНК 183 пн Asp 718/Hind III подвергали электрофорезу на агарозном геле и очищали, как описано в примере 1.The following oligonucleotides were synthesized:
# 401 5'-AACGAATCTCTTAGCACCTGGCAAGTTGACCAAAGTAG TGTTGATAGCAGATTCAGTGTCG-3 'SEQ ID N 39
The polymerase chain reaction was carried out as described in example 1, but oligonucleotide # 401 was used instead of oligonucleotide # 333 and plasmid pAK562 was used as template (Fig. 17). The 183 bp DNA fragment of Asp 718 / Hind III was subjected to agarose gel electrophoresis and purified as described in Example 1.

Фрагмент ДНК Asp 718/Hind III субклонировали в S.cerevisiae экспрессионной плазмиде, как описано в примере 1. С помощью ДНК сиквенс-анализа, как описано в примере 1, было показано, что отселектированная плазмида pAK586 содержит последовательность ДНК, кодирующую лидер SEQ ID N 21. Последовательность ДНК, кодирующая лидер SEQ ID N 21, показана на фиг.12. Плазмидой pAK586 трансформировали штамм MT663 S.cerevisiae [25] и назвали полученный штамм yAK586. Последовательности ДНК, кодирующие сигнальный пептид и предшественник инсулина M13, являются такими же, как на фиг. 5. The Asp 718 / Hind III DNA fragment was subcloned into the S. cerevisiae expression plasmid as described in Example 1. Using the DNA sequence analysis as described in Example 1, it was shown that the selected plasmid pAK586 contains the DNA sequence encoding the leader SEQ ID N 21. The DNA sequence encoding the leader of SEQ ID N 21, shown in Fig.12. The plasmid pAK586 transformed the S. cerevisiae MT663 strain [25] and named the resulting yAK586 strain. The DNA sequences encoding the signal peptide and the insulin precursor M13 are the same as in FIG. 5.

Пример 9
Экспрессия предшественника инсулина с использованием выбранных лидерных последовательностей согласно настоящему изобретению.Example 9
Expression of an insulin precursor using selected leader sequences according to the present invention.

Дрожжевой штамм, несущий плазмиды, как описано выше, выращивают на YPD среде [26]. Для каждого штамма помещают на качалку при 30oC на 72 ч 6 индивидуальных культур по 5 мл до финальной OD600 около 15. После центрифугирования удаляют супернатант для HPLC анализа, с помощью которого измеряют концентрацию секретированного предшественника инсулина [27].A yeast strain carrying plasmids, as described above, is grown on YPD medium [26]. For each strain, 6 individual cultures of 5 ml each were placed on a shaker at 30 ° C for 72 h until the final OD 600 of about 15. After centrifugation, the supernatant was removed for HPLC analysis, which measured the concentration of secreted insulin precursor [27].

В таблице 1 даны уровни экспрессии предшественника инсулина M13, полученные с использованием выбранных лидерных последовательностей согласно изобретению, в виде процента от уровня, полученного у трансформантов pMT742 с использованием MFα(1) лидер S.cerevisiae. Table 1 shows the expression levels of the insulin precursor M13 obtained using the selected leader sequences according to the invention as a percentage of the level obtained from pMT742 transformants using MFα (1) leader S. cerevisiae.

Пример 10
Синтез лидера SEQ ID N 27 для экспрессии предшественника инсулина M13 в S.cerevisiae (штамм yAK677).Example 10
Synthesis of leader SEQ ID N 27 for expression of the insulin M13 precursor in S. cerevisiae (strain yAK677).

Лидер SEQ ID N 27 имеет следующую аминокислотную последовательность: GlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMet- AlaAspAspThrGluSerArgPheAlaThrAsnThrThrLeuAspValValAsnLeuIleSerMetAla. The leader of SEQ ID N 27 has the following amino acid sequence: GlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMet-AlaAspAspThrGluSerArgPheAlaThrAsnThrThrLeuAspValValAsnLeuIleSerMetAla.

Были синтезированы следующие олигонуклеотиды:
# 440 5'-GGTTAACGAACTTTGGAGCTTCAGCTTCAGCTTCTTCTCTCTTAGCCAT GGAGATCAAGTTAACAACATCCAAAGTAGTGTT-3' SEQ ID N 64
и
# 441 5'-CAAGTACAAAGCTTCAACCAAGTGGGAACCGCACAAGTGTTGGTTAACG AACTT-3' SEQ ID N 65
Полимеразная цепная реакция была проведена, как описано в примере 1, но вместо олигонуклеотида # 333 использовали олигонуклеотид # 440 и в качестве матрицы - плазмиду pAK614. Для второй ПЦР вместо олигонуклеотида # 312 использовали олигонуклеотид # 441.The following oligonucleotides were synthesized:
# 440 5'-GGTTAACGAACTTTGGAGCTTCAGCTTCAGCTTCTTCTCTCTTAGCCAT GGAGATCAAGTTAACAACATCCAAAGTAGTGTT-3 'SEQ ID N 64
and
# 441 5'-CAAGTACAAAGCTTCAACCAAGTGGGAACCGCACAAGTGTTGGTTAACG AACTT-3 'SEQ ID N 65
The polymerase chain reaction was carried out as described in example 1, but oligonucleotide # 440 was used instead of oligonucleotide # 333 and plasmid pAK614 was used as template. For the second PCR, oligonucleotide # 441 was used instead of oligonucleotide # 312.

Очищенные ПЦР фрагменты ДНК выделяли и разрезали рестрикционными эндонуклеазами Asp 718 и Hind III, как описано в примере 1. Фрагмент ДНК 268 пн Asp 718/Hind III подвергали электрофорезу на агарозном геле и очищали, как описано в примере 1. Фрагмент ДНК Asp 718/Hind III субклонировали в S.cerevisiae экспрессионной плазмиде, как описано в примере 1, за исключением того, что фрагмент 140 пн Hindlll/XbaI был получен из pAK602 и кодирует AspB28 человеческий инсулин. С помощью ДНК сиквенс-анализа, как описано в примере 1, было показано, что отселектированная плазиида pAK616 содержит последовательность ДНК, кодирующую лидер SEQ ID N 27. Последовательность ДНК SEQ ID N 66, кодирующая лидер SEQ ID N 27, показана на фиг.11. Фрагмент ДНК 268 пн Asp 718/Hind III из pAK616 выделяли и лигировали с фрагментом ДНК 10986 пн Asp 718/XbaI из pAK464 (кодирующим удлиненный AspB28 человеческий инсулин), обозначив pAK625. Фрагмент ДНК 180 пн Asp718/NcoI из pAK625 был выделен и лигирован с фрагментом ДНК 221 пн NcoI/XbaI из pJB146 (кодирующим удлиненный предшественник инсулина) и фрагментом ДНК 10824 пн Asp718/XbaI из pAK601, полученную плазмиду обозначили pAK677. Плазмидой pAK677 трансформировали штамм MT663 S.cerevisiae [25] и назвали полученный штамм yAK677. За исключением последовательности ДНК, кодирующей лидер, последовательность ДНК, кодирующая сигнальный пептид, показана на фиг. 5. Последовательность ДНК, кодирующая удлиненный предшественник инсулина M13, показана на фиг. 19.Purified PCR DNA fragments were isolated and cut with restriction endonucleases Asp 718 and Hind III as described in Example 1. A DNA fragment of 268 bp Asp 718 / Hind III was subjected to agarose gel electrophoresis and purified as described in Example 1. Asp 718 / Hind DNA fragment III was subcloned into the S. cerevisiae expression plasmid as described in Example 1, except that the 140 bp Hindlll / XbaI fragment was obtained from pAK602 and encodes Asp B28 human insulin. Using the DNA sequence analysis, as described in Example 1, it was shown that the selected plasmid pAK616 contains the DNA sequence encoding the leader of SEQ ID N 27. The DNA sequence of SEQ ID N 66 encoding the leader of SEQ ID N 27 is shown in FIG. 11 . A 268 bp DNA fragment of Asp 718 / Hind III from pAK616 was isolated and ligated with a 10986 bp Asp 718 / XbaI DNA fragment from pAK464 (encoding the extended Asp B28 human insulin), denoting pAK625. A 180 bp DNA fragment of Asp718 / NcoI from pAK625 was isolated and ligated with a 221 bp NcoI / XbaI DNA fragment from pJB146 (encoding an extended insulin precursor) and a 10824 bp Asp718 / XbaI DNA fragment from pAK601, the resulting plasmid was designated pAK677. The plasmid pAK677 transformed the S. cerevisiae MT663 strain [25] and named the resulting yAK677 strain. With the exception of the DNA sequence encoding the leader, the DNA sequence encoding the signal peptide is shown in FIG. 5. The DNA sequence encoding the extended precursor of insulin M13 is shown in FIG. 19.

Пример 11
Синтез лидера SEQ ID N 67 для экспрессии предшественника инсулина M13 в S.cerevisiae (штамм yAK680).Example 11
Synthesis of leader SEQ ID N 67 for expression of the insulin M13 precursor in S. cerevisiae (strain yAK680).

Лидер SEQ ID N 67 имеет следующую аминокислотную последовательность: GlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMet- AlaAspAspThrGluSerArgPheAlaThrAsnThrThrLeuAlaLeuAspValValAsnLeuIleSerMetAla. The leader of SEQ ID N 67 has the following amino acid sequence: GlnProIleAspAspThrGluSerAsnThrThrSerValAsnLeuMet-AlaAspAspThrGluSerArgPheAlaThrAsnThrThrLeuAlaLeuAspValValAsnLeuIleSerMet.

Были синтезированы следующие олигонуклеотиды:
# 577 5'-TCTCTTAGCCATGGAGATCAAGTTAACAACATCCAAAG CCAAAGTAGTGTT-3' SEQ ID N 68
Полимеразная цепная реакция была проведена, как описано в примере 1, но вместо олигонуклеотида # 333 использовали олигонуклеотид # 557 и в качестве матрицы - плазмиду pAK625, а вторую ПЦР не проводили. ПЦР фрагмент разрезали рестрикционными эндонуклеазами Asp 718 и Nco I, как описано в примере 1.The following oligonucleotides were synthesized:
# 577 5'-TCTCTTAGCCATGGAGATCAAGTTAACAACATCCAAAG CCAAAGTAGTGTT-3 'SEQ ID N 68
The polymerase chain reaction was carried out as described in example 1, but oligonucleotide # 557 was used instead of oligonucleotide # 333 and plasmid pAK625 was used as a template, and the second PCR was not performed. The PCR fragment was cut with restriction endonucleases Asp 718 and Nco I, as described in example 1.

Фрагмент ДНК 190 пн Asp 718/NcoI подвергали электрофорезу на агарозном геле и очищали, как описано в примере 1, за исключением того, что векторный фрагмент ДНК 10824 пн Asp 718/XbaI был выделен из pAK601. Фрагмент ДНК 190 пн Asp 718/NcoI субклонировали в S.cerevisiae экспрессионной плазмиде, как описано в примере 1, за исключением того, что фрагмент 221 пн NcoI/XbaI (кодирующий удлиненную версию предшественника инсулина) был получен из pAK677 и использован вместо фрагмента HindIII/XbaI ДНК. С помощью ДНК сиквенс-анализа, как описано в примере 1, было показано, что отселектированная плазмида pAK680 содержит последовательность ДНК, кодирующую лидер SEQ ID N 67. Последовательность ДНК SEQ ID N 69, кодирующая лидер SEQ ID N 67, показана на фиг. 20. Плазмидой pAK680 трансформировали штамм MT663 S.cerevisiae [25] и назвали полученный штамм yAK680. За исключением последовательности ДНК, кодирующей лидер, последовательность ДНК, кодирующая сигнальный пептид, показана на фиг. 5. Последовательность ДНК, кодирующая удлиненный предшественник инсулина M13, показана на фиг. 19. The DNA fragment of 190 bp Asp 718 / NcoI was subjected to agarose gel electrophoresis and purified as described in Example 1, except that the vector DNA fragment 10824 bp of Asp 718 / XbaI was isolated from pAK601. The 190 bp DNA fragment of Asp 718 / NcoI was subcloned into the S. cerevisiae expression plasmid as described in Example 1, except that the 221 bp NcoI / XbaI fragment (encoding an extended version of the insulin precursor) was obtained from pAK677 and used instead of the HindIII / fragment XbaI DNA. Using sequence DNA analysis as described in Example 1, it was shown that the selected plasmid pAK680 contains the DNA sequence encoding the leader of SEQ ID N 67. The DNA sequence of SEQ ID N 69 encoding the leader of SEQ ID N 67 is shown in FIG. 20. Plasmid pAK680 transformed the S. cerevisiae MT663 strain [25] and named the resulting yAK680 strain. With the exception of the DNA sequence encoding the leader, the DNA sequence encoding the signal peptide is shown in FIG. 5. The DNA sequence encoding the extended precursor of insulin M13 is shown in FIG. 19.

Пример 12
Экспрессия удлиненного с N-конца предшественника инсулина M13 с использованием лидерных последовательностей SEQ ID N 27 и SEQ ID N 67 согласно настоящему изобретению
Дрожжевой штамм, несущий плазмиды, как описано выше, выращивают на YPD среде [26] . Для каждого штамма помещают на качалку при 30oC на 72 ч 6 индивидуальных культур по 5 мл до финальной OD600 около 15. После центрифугирования удаляют супернатант для HPLC анализа, с помощью которого измеряют концентрацию секретированного предшественника инсулина [27].Example 12
Expression of the N-terminally extended M13 insulin precursor using leader sequences SEQ ID N 27 and SEQ ID N 67 according to the present invention
A yeast strain carrying plasmids, as described above, is grown on YPD medium [26]. For each strain, 6 individual cultures of 5 ml each were placed on a shaker at 30 ° C for 72 h until the final OD 600 of about 15. After centrifugation, the supernatant was removed for HPLC analysis, which measured the concentration of secreted insulin precursor [27].

В таблице 2 даны уровни экспрессии некоторых удлиненных с N-конца предшественников инсулина M13, полученных с использованием лидерных последовательностей SEQ ID N 27 и SEQ ID N67 согласно изобретению, в виде процента от уровня, полученного у трансформантов pMT742 с использованием MFα(1) лидера S.cerevisiae. Table 2 shows the expression levels of some N13-terminated M13 insulin precursors obtained using the leader sequences of SEQ ID N 27 and SEQ ID N67 according to the invention as a percentage of the level obtained from pMT742 transformants using MFα (1) leader S .cerevisiae.

Литература и перечень последовательностей приведены в конце описания. The literature and sequence listing are provided at the end of the description.

Claims (23)

1. Способ продуцирования полипептида в дрожжах, при котором культивируют дрожжевую клетку, способную экспрессировать этот полипептид и трансформированную дрожжевым вектором экспрессии, содержащим ДНК экспрессирующую кассету, включающую в себя промоторную последовательность, ДНК последовательность, кодирующую сигнальный пептид, терминаторную последовательность; ДНК последовательность, кодирующую желаемый полипептид; ДНК последовательность, кодирующую процессинговый сайт; и ДНК последовательность LS, кодирующую лидерный пептид общей формулы I
GlnProIle(Asp/Glu)(Asp/Glu)X1(Glu/Asp)X2AsnZ(Thr/Ser)X3,
где X1 обозначает пептидную связь или кодируемую аминокислоту;
X2 обозначает пептидную связь или кодируемую аминокислоту, или последовательность до 4 одинаковых или разных кодируемых аминокислот;
Z обозначает кодируемую аминокислоту кроме Pro;
X3 обозначает последовательность от 4 до 30 одинаковых или разных кодируемых аминокислот,
в подходящей среде для достижения экспрессии и секреции указанного полипептида, после чего этот полипептид выделяют из среды.1. A method of producing a polypeptide in yeast, in which a yeast cell is cultured that is capable of expressing the polypeptide and is transformed with a yeast expression vector containing a DNA expression cassette comprising a promoter sequence, a DNA sequence encoding a signal peptide, a terminator sequence; DNA sequence encoding the desired polypeptide; DNA sequence encoding a processing site; and DNA sequence LS encoding a leader peptide of general formula I
GlnProIle (Asp / Glu) (Asp / Glu) X 1 (Glu / Asp) X 2 AsnZ (Thr / Ser) X 3 ,
where X 1 denotes a peptide bond or encoded amino acid;
X 2 is a peptide bond or an encoded amino acid, or a sequence of up to 4 identical or different encoded amino acids;
Z is an encoded amino acid other than Pro;
X 3 denotes a sequence of from 4 to 30 identical or different encoded amino acids,
in a suitable medium to achieve expression and secretion of the specified polypeptide, after which the polypeptide is isolated from the medium. 2. Способ по п.1, где X1 в формуле I обозначает Ser, Thr или Ala.2. The method according to claim 1, where X 1 in the formula I denotes Ser, Thr or Ala. 3. Способ по п.1, где X2 в формуле I обозначает Ser, Thr или Ala.3. The method according to claim 1, where X 2 in the formula I means Ser, Thr or Ala. 4. Способ по п.1, где X2 в формуле I обозначает SerIle.4. The method according to claim 1, where X 2 in the formula I means SerIle. 5. Способ по п.1, где X2 в формуле I обозначает SerAlaIle.5. The method according to claim 1, where X 2 in the formula I means SerAlaIle. 6. Способ по п.1, где X2 в формуле I обозначает SerPheAlaThr.6. The method according to claim 1, where X 2 in the formula I means SerPheAlaThr. 7. Способ по п.1, где X3 в общей формуле I обозначает аминокислотную последовательность общей формулы II
X4-X5-X6,
где X4 обозначает последовательность от 1 до 21 кодируемой аминокислоты;
X5 обозначает Pro или аминокислотную последовательность, которая включает в себя аминокислотную последовательность ValAsnLeu, LeuAlaAsnValAlaMetAla, LeuAspValValAsnLeuProGly или LeuAspValValAsnLeuIleSerMet;
X6 обозначает последовательность от 1 до 8 кодируемых аминокислот.7. The method according to claim 1, where X 3 in General formula I denotes the amino acid sequence of General formula II
X 4 -X 5 -X 6 ,
where X 4 denotes a sequence of from 1 to 21 encoded amino acids;
X 5 is a Pro or amino acid sequence that includes the amino acid sequence of ValAsnLeu, LeuAlaAsnValAlaMetAla, LeuAspValValAsnLeuProGly or LeuAspValValAsnLeuIleSerMet;
X 6 denotes a sequence of 1 to 8 encoded amino acids. 8. Способ по п.7, где X4 в общей формуле II обозначает аминокислотную последовательность, которая включает в себя один или более чем один мотив LeuValAsnLeu, SerValAsnLeu, MetAlaAsp, ThrGluSer, ArgPheAlaThr или ValAlaMetAla.8. The method according to claim 7, where X 4 in the General formula II denotes an amino acid sequence that includes one or more than one motif LeuValAsnLeu, SerValAsnLeu, MetAlaAsp, ThrGluSer, ArgPheAlaThr or ValAlaMetAla. 9. Способ по п.7, где X4 в общей формуле II обозначает аминокислотную последовательность, которая включает в себя последовательность AsnSerThr или AsnThrThr.9. The method according to claim 7, where X 4 in the General formula II denotes an amino acid sequence that includes the sequence of AsnSerThr or AsnThrThr. 10. Способ по п.7, где X4 в общей формуле II обозначает аминокислотную последовательность, которая включает в себя последовательность
(Ser/Leu)ValAsnLeu;
(Ser/Leu)ValAsnLeuMetAlaAsp;
(Ser/Leu)ValAsnLeuMetAlaAspAsp;
(Ser/Leu)ValAsnLeuMetAlaAspAspThrGluSer;
(Ser/Leu)ValAsnLeuMetAlaAspAspThrGluSerIle;
(Ser/Leu)ValAsnLeuMetAlaAspAspThrGluSerArgPheAlaThr.10. The method according to claim 7, where X 4 in General formula II denotes an amino acid sequence that includes a sequence
(Ser / Leu) ValAsnLeu;
(Ser / Leu) ValAsnLeuMetAlaAsp;
(Ser / Leu) ValAsnLeuMetAlaAspAsp;
(Ser / Leu) ValAsnLeuMetAlaAspAspThrGluSer;
(Ser / Leu) ValAsnLeuMetAlaAspAspThrGluSerIle;
(Ser / Leu) ValAsnLeuMetAlaAspAspThrGluSerArgPheAlaThr. 11. Способ по п.7, где X4 в общей формуле II обозначает аминокислотную последовательность, которая включает в себя последовательность.11. The method according to claim 7, where X 4 in the General formula II denotes an amino acid sequence that includes a sequence. Asn(Thr/Ser)ThrLeu;
Asn(Thr/Ser)ThrLeuAsnLeu;
Asn(Thr/Ser)ThrLeuValAsnLeu.Asn (Thr / Ser) ThrLeu;
Asn (Thr / Ser) ThrLeuAsnLeu;
Asn (Thr / Ser) ThrLeuValAsnLeu. 12. Способ по п.7, где X5 в общей формуле II обозначает Pro.12. The method according to claim 7, where X 5 in the General formula II denotes Pro. 13. Способ по п.7, где X5 в общей формуле II обозначает аминокислотную последовательность ValAsnLeu.13. The method according to claim 7, where X 5 in the General formula II denotes the amino acid sequence of ValAsnLeu. 14. Способ по п.7, где X5 в общей формуле II обозначает аминокислотную последовательность LeuAlaAsnValAlaMetAla.14. The method according to claim 7, where X 5 in the General formula II denotes the amino acid sequence of LeuAlaAsnValAlaMetAla. 15. Способ по п.7, где X5 в общей формуле II обозначает аминокислотную последовательность LeuAspValValAsnLeuProGly.15. The method according to claim 7, where X 5 in the General formula II denotes the amino acid sequence LeuAspValValAsnLeuProGly. 16. Способ по п.7, где X5 в общей формуле II обозначает аминокислотную последовательность LeuAspValValAsnLeuIleSerMet.16. The method according to claim 7, where X 5 in the General formula II denotes the amino acid sequence LeuAspValValAsnLeuIleSerMet. 17. Способ по п.7, где X6 в общей формуле II обозначает Ala, Gly, Leu, Thr, Val или Ser.17. The method according to claim 7, where X 6 in the General formula II means Ala, Gly, Leu, Thr, Val or Ser. 18. Способ по п.7, где X6 в общей формуле II обозначает GlyAla или SerAla.18. The method according to claim 7, where X 6 in General formula II means GlyAla or SerAla. 19. Способ по п.7, где X6 в общей формуле II обозначает AlaValAla.19. The method according to claim 7, where X 6 in the General formula II means AlaValAla. 20. Способ по п.7, где X6 в общей формуле II обозначает GlyAlaAspSerLysThrValGlu.20. The method according to claim 7, where X 6 in the General formula II means GlyAlaAspSerLysThrValGlu. 21. Способ по п.1, где лидерный пептид, кодируемый ДНК последовательностью LS, выбран из группы, содержащей SEQ ID 1-28,67, приведенной в графической части. 21. The method according to claim 1, where the leader peptide encoded by the DNA sequence LS is selected from the group consisting of SEQ ID 1-28,67 shown in the graphic part. 22. Способ по п.1, где сигнальный пептид представляет собой сигнальный пептид α-фактора, сигнальный пептид мышиной слюнной амилазы, сигнальный пептид карбоксипептидазы, сигнальный пептид дрожжевой аспартиновой протеазы 3 или дрожжевой BAR1 сигнальный пептид. 22. The method of claim 1, wherein the signal peptide is an α-factor signal peptide, a mouse salivary amylase signal peptide, a carboxypeptidase signal peptide, a yeast aspartic protease 3 signal peptide, or a yeast BAR1 signal peptide. 23. Способ по п.1, где процессинговый сайт представляет собой LysArg, ArgLys, ArgArg, LysLys или Ile-GluGlyArg. 23. The method according to claim 1, where the processing site is a LysArg, ArgLys, ArgArg, LysLys or Ile-GluGlyArg.
RU97100750A 1994-06-16 1995-06-16 Method of polypeptide producing in yeast RU2167939C2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DK70594 1994-06-16
DK0705/94 1994-06-16
US08/282,852 1994-07-29

Publications (2)

Publication Number Publication Date
RU97100750A RU97100750A (en) 1999-05-20
RU2167939C2 true RU2167939C2 (en) 2001-05-27

Family

ID=8096593

Family Applications (1)

Application Number Title Priority Date Filing Date
RU97100750A RU2167939C2 (en) 1994-06-16 1995-06-16 Method of polypeptide producing in yeast

Country Status (1)

Country Link
RU (1) RU2167939C2 (en)

Similar Documents

Publication Publication Date Title
EP0763117B1 (en) Synthetic leader peptide sequences
US6214547B1 (en) Synthetic leader peptide sequences
US6500645B1 (en) N-terminally extended proteins expressed in yeast
JP3730255B2 (en) N-terminal extended protein expressed in yeast
AU660161B2 (en) A method of constructing synthetic leader sequences
AU667852B2 (en) Novel DNA molecules and hosts
EP0946735B1 (en) N-terminally extended proteins expressed in yeast
JP4180112B2 (en) Vector for expression of N-terminally extended protein in yeast cells
US6358705B1 (en) Method of making proteins in transformed yeast cells
RU2167939C2 (en) Method of polypeptide producing in yeast
RU2238323C2 (en) Method for preparing proteins in transformed yeast cells
CA2192942C (en) Synthetic leader peptide sequences
MXPA01000516A (en) Method of making proteins in transformed yeast cells

Legal Events

Date Code Title Description
MM4A The patent is invalid due to non-payment of fees

Effective date: 20060617