CA2098731A1 - Method of constructing synthetic leader sequences - Google Patents
Method of constructing synthetic leader sequencesInfo
- Publication number
- CA2098731A1 CA2098731A1 CA002098731A CA2098731A CA2098731A1 CA 2098731 A1 CA2098731 A1 CA 2098731A1 CA 002098731 A CA002098731 A CA 002098731A CA 2098731 A CA2098731 A CA 2098731A CA 2098731 A1 CA2098731 A1 CA 2098731A1
- Authority
- CA
- Canada
- Prior art keywords
- sequence encoding
- dna sequence
- yeast
- arg
- signal peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
- C12N15/625—DNA sequences coding for fusion proteins containing a sequence coding for a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/036—Fusion polypeptide containing a localisation/targetting motif targeting to the medium outside of the cell, e.g. type III secretion
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
- C07K2319/75—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Consolidation Of Soil By Introduction Of Solidifying Substances Into Soil (AREA)
Abstract
A yeast expression cloning vector comprising the following sequence 5'-SP-Xn-3'-RS-5'-Xm-(NZT)p-Xq-PS-*gene*-3' wherein SP
is a DNA sequence encoding a signal peptide, Xn is a DNA
sequence encoding n amino acids, wherein n is 0 or an integer of from 1 to about 10 amino acids, RS is a restriction endonuclease recognition site provided at the junction of Xn and Xm, Xm is a DNA sequence encoding m amino acids, wherein m is 0 or an integer from 1 to about 10, (NZT)p is a DNA sequence encoding Asn-Xaa-Thr, wherein p is 0 or 1, Xq is a DNA sequence encoding q amino acids, wherein q is 0 or an integer from 1 to about 10, PS is a DNA sequence encoding a peptide defining a yeast processing site, and *gene* is a DNA sequence encoding a heterologous polypeptide. The vector may be used to construct synthetic leader peptide sequences by inserting random DNA fragments in the "RS" site, culturing a yeast cell transformed with this vector and screening the culture for secretion of the heterologous polypeptide.
is a DNA sequence encoding a signal peptide, Xn is a DNA
sequence encoding n amino acids, wherein n is 0 or an integer of from 1 to about 10 amino acids, RS is a restriction endonuclease recognition site provided at the junction of Xn and Xm, Xm is a DNA sequence encoding m amino acids, wherein m is 0 or an integer from 1 to about 10, (NZT)p is a DNA sequence encoding Asn-Xaa-Thr, wherein p is 0 or 1, Xq is a DNA sequence encoding q amino acids, wherein q is 0 or an integer from 1 to about 10, PS is a DNA sequence encoding a peptide defining a yeast processing site, and *gene* is a DNA sequence encoding a heterologous polypeptide. The vector may be used to construct synthetic leader peptide sequences by inserting random DNA fragments in the "RS" site, culturing a yeast cell transformed with this vector and screening the culture for secretion of the heterologous polypeptide.
Description
WO9'/l1378 PCT/DK91/00396
2~87~1 A METEIOD OF CONSTRUCTING SYNTHETIC LEADER SEQUENCES
FIELD OF INVENTION
5 The present invention relates to a method of constructing synthetic leader peptide sequences for secreting heterologous polypeptides in yeast, and yeast expression vectors for use in `; the method.
. ` ~ "
~ lo BACKGROUND OF THE INVENTION
, ` Yeast organisms produae a number of proteins which are synthesized intracellularly, but which have a function outside ~`~ the cell. Such extracellular proteins are referred to as lS ~ecreted proteins. These secreted proteins are expressed initially inside the cell in a precursor or a pre-protein form containing a presequence ensuring effective direction of the expressed product across the membrane of the endoplasmic -` reticulum tER). The presequence, normally named a signal ; 20 peptide, is generalIy cleaved off from the desired product S`~i during translocation. once entered in the secretory pathway, the protein is transported to the Golgi apparatus. From the Golgi the protein can follow different routes that lead to compartments such as the cell vacuole or the cell membrane, or 25 it can be routed out of the cell to be secreted to the external ` medium (Pfeffer, S.R. and Rothman, J.E. Ann.Rev.Biochem. 56 (1987), 829-852).
. ., ~
Several approaches have been suggested for the expression and 30 secretion in yeast of proteins heterologous to yeast. European published patent application No. 88 632 describes a process by which proteins heterologous to yeast are expressed, processed .~ and secreted by transforming a yeast organism with an ~-a expression vehicle harbouring DNA encoding the desired protein 35 and a signal peptide, preparing a culture of the transformed ~ organism, growing the culture and recovering the protein from - the culture medium. The signal peptide may be the signal -, :
"s WO~7/ll378 PCT/D~91/00396 ;~ 3 ~ ~ 2 peptide of the desired protein itself, a heterologous signal peptide or a hybrid of native and heterologous signal peptide.
:., A problem encountered with the use of signal peptides hetero-~ 5 logous to yeast might be that the heterologous signal peptide ; does not ensure efficien~ translocation and/or cleavage after ; the signal peptide.
~ The S. cerevisiae MF~1 t~ factor) is synthesized as a prepro . ~ .
form of 165 amino acids comprising signal-or prepeptide of 19 amino acids followed by a "leader" or propeptide of 64 amino aicds, encompassing three N-linked glycosylation sites followed ;~ by (LysArg(Asp/Glu, Ala)23~-factor)4 (Kurjan, 3. and Herskowit2, I. Cell 30 (1982), 933-943). The signal-leader part of the preproMF~1 has been widely employed to obtain synthesis ~ and secretion of heterologous proteins in S. cerivisiae.
'~
Use of signal/leader peptides homologous to yeast is known from i.a. US patent specification No. 4,546,082, European published patent applications Nos. 11~ 201, 123 294, 123 544, 163 529, ;.~ and 123 289 and DK patent application No. 3614/83.
In EP 123 289 utilization of the S. cerevisiae a-factor pre-cursor is described whereas W0 84/01153 indicates utilization of the Saccharomyces cerevisiae invertase signal peptide and ~, DX 3614/83 utilization of the Saccharomyces cerevisiae PH05 signal peptide for secretion of foreign proteins.
.. ~
~: US patent specification No. 4,546,082, EP 16 201, 123 294, 123 544, and 163 529 describe processes by which the ~-factor ; signal-leader from SaccharomYces cerevisiae (MF~1 or MF~2) isutilized in the secretion process of expressed heterologous proteins in yeast. By fusing a DNA sequence encoding the S.
, cerevisiea MF~1 signal/leader sequence at the 5' end of the 3S gene for the desired protein secretion and processing of the desired protein was demonstrated.
. .
., : ,..
''.'.'' ..... ...... . . . . .
WOg~/l1318 PCT/~K91/00396 2 ~ n ~ 7~?l1 ` EP 206 783 discloses a system for the secretion of polypep~ides from S. cerevisiae whereby the ~-factor leader sequence has been truncated to eliminate the four ~-factor peptides present on the native leader sequence so as to leave the leader peptide : 5 itself fused to a heterologous polypeptide via the a-factor ~ processing site LysArgGluAlaGluAla. This construction is -. indicated to lead to an efficient process of smaller peptides (less than 50 amino acids). For the secretion and procassing ~i of larger polypep~ides, the native ~-factor leader sequence has ~ lO been truncated to leave one or two ~ factor peptides between `- the leader peptide and the polypeptide.
A number of secreted proteins are routed so as to be exposed . to a proteolytic processing system which can cleave the peptide 15 bond at the carboxy end of two consecutive basic amino acids.
This enzymatic activity is in S. cerevisiae encoded by the KEX
2 gene (Julius, D.A. et al., Cell 37 (198~b), 1075). Processing . of the product by the KEX 2 gene product is needed for the secretion of active S. cerevisiae mating factor ~l (MF~l or ~-20 factor) but is not involved in the secretion of active S.
cerevisiae mating factor a.
. . .
".;
,' Secretion and correct processing of a polypeptide intended to '~ be secreted is obtained in some cases when culturing a yeast :~ 25 organism which is transformed with a vector constructed as s indicated in the references ~iven above. In many cases, how-ever, the level of secretion is very low or there is no se-cretion, or the proteolytic processing may be incorrect or - incomplete. It is therefore the object of the present invention 30 to provide leader peptides which ensure a more efficient ~, expression and/or processing of heterologous polypeptides.
''''1 .- SUMMARY OF THE INVENTION `~
; - 35 It has surprisingly been found possible to replace the ~-factor . leader peptide by a variety of different DNA sequences, thereby obtaining secretion of a heterologous polypeptide in yeast. -. ;~, !.
~092/l1378 ?~ u ~ 3 PC~/DK91/00396 sased on this observation, a method has been developed by which ~ random DNA fragments are cloned into yeast vectors downstream : of a DNA se~uence coding for a signal peptide and upstream of a DNA sequence coding for a heterologous polypepti~e. A*ter transformation with the vectors, yeast cells are screened for secretion of the heterologous polypeptide in question.
~ More specifically, the present invention relates to a method `.`` of constructing a synthetic leader peptide sequence for secreting heterologous polypeptides in yeas~, the method ~` comprising : (a) inserting a random DNA fragment into a yeast expression ~: vector comprising the following sequence 5 1 ~SP~Xn 3 ~ -RS-5 1 ~Xm- (NZT)p-Xq-PS-*gene*-3 .
.: ~
.j wherein SP is a DNA sequence encoding a signal peptide, . Xn is a DNA sequence encoding n amino acids, wherein n is 0 or an integer of from 1 to about 10 amino acids, ,~ RS is a restriction endonuclease recognition site for insertion .~, of random DNA fragments, which site is provided at the junction .,~
of Xn and Xm, ~ Xm is a DNA sequence encoding m amino acids, wherein m is 0 or :; 25 an integer from 1 to about 10, (NZT)p is a DNA sequence encoding Asn-Xaa-Thr, wherein p is 0 ::~ or 1, ., .~ .
.. Xq is a DNA sequence encoding q amino acids, wherein q is 0 or ' an integer from 1 to about 10, PS is a DNA sequence encoding a peptide defining a yeast processing site, and *gene* is a DN~ sequence encoding a heterologous polypeptide;
(b) transforming a yeast host cell with the expression vector of step (a);
.'' -` (c) culturing the transformed host cell of step (b) under . . 1 , .
.
..,~
WO92/1137~ 2 ~ n ~, rl 3 L PCT/D~91/0~396 appropriate conditi~ns; and (d) screening the culture of step (c) for secretion of the heterologous polypeptide.
In the present context, the expression "leader peptide" is understood to indicate a peptide whose function is to allow the heterologous polypeptide to be directed from the endoplasmic reticulum to the Golgi apparatus and further to a secretory ve sicle for secretion into the medium, (i.e. exportation of the expressed polypeptide across the cell wall or at least through the cellular membrane into the periplasmic space of the cell).
The term "synthetic" used in connection with leader peptides is intended to indicate that the leader peptide constructed by lS the present method is one not found in nature.
The term "signal peptide" is understood to mean a presequence .~ ~
which is predominantly hydrophobic in nature and present as an N-terminal sequence of the precursor form of an extracellular protein expressed in yeast. The function of the signal peptide is to allow the heterologous protein to be secreted to enter ~, the endoplasmic reticulum. The signal peptide is normally ~< cleaved off in the course of this process. The signal peptide # may be heterologous or homologous to the yeast organism producing the protein but, as explained above, a more efficient cleavage of the signal peptide may be obtained when it is '~r homologous to the yeast organism in question.
:. :
The expression "hetero1ogous polypeptide" is intended to indicate a polypeptide which is not produced by the host yeast organism in nature. In the method of the invention, the - heterologous polypeptide is preferably one the secretion of which by transformed yeast cells may easily be detected, e.g.
by established standard methods such as by immunological screening by means of antibodies reactive with the polypeptide in question (cf. for instance Sambrook, Fritsch and Maniatis, Molecular Cloninq: A Laboratory Manual, Cold Spring Harbor, New ~
., .
: ~.
. .. :, - , . ~,:
WO92~ll378 PCT/DK91/00396 ~`York, 1989) or by screening for a specific biological activity : of the heterologous polypeptide. A positive result of the screening i~dicates that a leader peptide useful for the secretion of heterolo~ous polypeptides in yeast has been constructed.
The expression "a random DNA fragment" is intended to indicate any se~uence of DNA at least 3 nucleotides in length, for instance obtained by digesting genomic DNA (of any organism) ~lO with restriction endonuclease(s) or by preparing synthetic DNA, `~e.g. by the phosphoamidite method described by S.L. Beaucage and M.H. Caruthers, Tetrahedron Letters 22, 1981, pp. 1859-.1869.
. ~.
~15 The peptide Asn-Xaa-Thr encoded hy "(NZT)p" is an asparagine-".~linked glycosylation site. "Xaa" denotes any one of the known `~samino acids except Pro.
. . ~ ~;.
In another aspect, the present invention relates to a yeast expression cloning vector comprising the following sequence . .
5'-SP-Xn-3'-RS-5'-Xm- (NZT)p-Xq-PS-*gene*-3' wherein SP, Xn, RS, Xm, (NZT)p, Xq, PS and *gene~ are as defined 2S above.
~ G
~`This vector may be used in the construction of leader peptide sequences according to the method described above.
In a further aspect, the present invention relates to a yeast expression vector comprising the following sequence ..~
~5'-SP-Xn-ranDNA-Xm-(NZT)p-Xq-PS-*gene*-3' . .~ .
35 wherein SP, Xn, Xm, (NZT)p, Xq/ PS and *gene* are as defined ~`
;~above, and ranDNA is a random DNA fragment inserted in a ~-restriction endonuclease recognition site provided at the ,, ~.
.;, .
i , 2 Q (~ O r~ ~ I
junction of Xn and Xm.
In this vector, the leader peptide sequence (once identified by the method of the invention) will be composed of the sequence Xn-ranDNA-Xm-~NZT)p~Xq. Such a vector may be used in the production of a heterologous polypeptide of interest.
.
In a still further aspect, the present invention relates to a process for producing a heterologous polypeptide in yeast, the process comprising culturing a yeast cell, whlch is capable of expressing a heterologous polypeptide and which is transformed with a yeast expression vector as described above including a leader peptide sequence constructed by the method of the invention, in a suitable medium to obtain expression and secretion of the heterologous polypeptide, after which the heterologous polypeptide is recovered from the medium.
DETAILED DISCLOSURE OF THE INVENTION
: . :
;` 20 The length of the random DNA fragment inserted in theexpression vector is not particularly critical. However, in s order to be of a manageable length, the fragment preferably has : a length of from 16 to about 600 base pairs. More preferably,the fragment has a length of from about 15 to about 300 base / 25 pairs. It is at present considered that a suitable length of -~ the fragment is from about 30 to about 150 base pairs.
... .
- The random DNA fragment preferahly encodes a high proportion - of polar amino acids. These are selected from the group consisting of Glu, Asp, Lys, Arg, His, Thr, Ser, Asn and Gln.
-, In the present context, the term "a high proportion of" is understood to indicate that the DNA fragment encodes a larger number of polar amino acids than do other DNA sequences of a corresponding length. Independently hereof, or in addition hereto, it may be advantageous that the fragment encodes at least one proline.
, .i~
' ~' .
. s .,~
. ' ' , :
WO92tl1378 PCT/D~91/00396 ~ 1~ 3 ~
In the sequence 5'-SP-Xn-3'-RS-5'-Xm-(NZT)p-Xq-PS-*gene*-3', n and/or m and/or q are preferably >1. In particular, all of n, m and q are ~1.
There is some evidence (cf. WO 89~02463) to support that the presence of an asparagine-linked glycosylation site in the leader sequence may confer a higher secretion efficiency to the leader peptide. In the sequence 5l-SP-Xn-3'-RS-5'-Xm- (NZT) p~Xq~
PS-*gene~-3', p is therefore preferably 1.
The signal peptide sequence (SP) may encode any signal peptide ~which ensures an effective direction of the expressed - heterologous polypeptide into the secretory pathway of the cell. The signal peptide may be a naturally occurring signal `15 pep~ide or funccional parts thereof, or it may be a synthetic ~` peptide. Suitakle signal peptides have been found to be the ~-factor signal peptide, the signal peptide of mouse salivary amylase, a modified carboxypeptidase signal peptide, the yeast BAR1 signal peptide or the Humicola lanuqinosa lipase signal peptide, or a derivative thereof. The mouse salivary amylase ,signal sequence is described by O. Hagenbuchle et al., Nature ~289, 1981, pp. 643-646. The carboxypeptidase signal sequence is described by L.A. Valls et al., Cell 48, 1987, pp. 887-897.
lThe BAR1 signal peptide is disclosed in WO 87/02670. The H.
lanu~inosa lipase signal peptide is disclosed in EP 305 216.
, The yeast processing site encoded by the DNA sequence PS may suitably be any paired combination of Lys and Arg, such as Lys-Arg, Arg-Lys, Lys-Lys or Arg-Arg, which permits processing of the heterologous polypeptide by the KEX2 protease of - Saccharomvces cerevisiae or the equivalent protease in other ^ yeast species (D.A. Julius et al., Cell 37, 1984, 1075 ff.).
~'If KEX2 processing is not convenient, e.g. if it would lead to cleavage of the polypeptide product, a processing site for '35 another protease may be selected instead comprising an amino acid combination which is not found in the polypeptide product, e.g. the processing site for FXa, Ile-Glu-Gly-Arg (cf.
, ~ .
:.
:
WO92/1137X PCT/DK91/0~396 ?~ t3 ~
. ` , Sambro~k, F~i~sch and Maniatis, Molecular Cloninq: A Laboratory Manual, Cold Spring Harbor, New York, 1989).
, The heterolo~ous protein produced by the method of the inven-- 5 tion may be any protein which may advantayeously be produced ;in yeast. Examples of such proteins are aprotinin, tissue factor pathway inhibitor or other protease inhibitors, insulin or insulin precursors, human or bovine growth hormone, interleukin, glucagon, tissue plasminogen activator, transforming growth factor ~ or ~, platelet-derived growth ` factor, enzymes, or a functional analoyue thereof. In the present context, the term "functional analogue" is meant to indicate a polypeptide with a similar function as ~he native protein (this is intended to be understood as relating to the ,~A 15 nature rather than the level of biological activity of the native protein). The polypeptide may be structurally similar ` to the native protein and may be derived from the native protein by addition of one or more amino acids to either or both the C- and N-terminal end of the native protein, substitution of one or more amino acids at one or a number of different sites in the native amino acid sequence, deletion of one or more amino acids at either or both ends of the native protein or at one or several sites in the amino acid sequence, or insertion of one or more amino acids at one or more sites -~ 25 in the native amino acid sequence. Such modifications are well . . ., :
~known for several of the proteins mentioned above. ~
.. .~ . .:
"";JThe random DNA fragment and the sequence 5 ~-SP-Xn-31-RS-51~Xm~
6(NZT)p-Xq-PS-*gene* 3' may be prepared synthetically by 30 established standard methods, e.g. the phosphoamidite method described by S.L. Beaucage and M.H. Caruthers, Tetrahedron Letters 22, 1981~ pp. 1859-1869~ or the method described by Matthes et al., EMBO Journal 3 ~ 1984 ~ pp. 801-805. According to the phosphoamidite method, oligonucleotides are synthèsized, 35 e.g. in an automatic DNA synthesizer, purified, annealed, ligated and cloned into the yeast expression vector. It should be noted that the sequence 5'~SP~Xn~3'~RS~5'~Xm~(NZT)p~Xq~PS~
.,.' . .
',",'~
., : .: .: . .. . ~ ,: ,, ::: : .: : : : , -WO9~/ll37X PCT/DK91/00396 ~ iu~ 10 *gen~*-3' need n~t be prepared in a single operation, but may b~ assembled from ~wo or more oligonucleotides prepared synthetically in this fashion.
The random DNA fragment or one or more parts of the sequence 5'-SP-Xn-3'-RS-5'-Xm- (NZT)p-Xq-PS-*gene*-3' may also be of genomic or cDNA origin, for instance obtained by preparing a -` genomic or cDNA library and screening for DNA sequences coding for said parts (typically SP or *gene*) by hybridization using synthetic oligonucleotide probes in accordance with standard techniques (cf. Sambrook, Fritsch and Maniatis, Molecular Clon-inq: A Laboratorv Manual, Cold Spring Harbor, New York, 1989).
In this case, a genomic or cDNA sequence encoding a signal : peptide may be joined to a genomic or cDNA sequence encoding `~ 15 the heterologous protein, a~ter which the DNA sequence may be modified by the insertion of synthetic oligonucleotides encoding the sequence Xn~3'~RS~5l~Xm~~NZT)p~Xq~PS in accordance ~- with well-known procedures.
! l Finally, the random DNA fragment and/ or the sequence 5'-SP-X~-
FIELD OF INVENTION
5 The present invention relates to a method of constructing synthetic leader peptide sequences for secreting heterologous polypeptides in yeast, and yeast expression vectors for use in `; the method.
. ` ~ "
~ lo BACKGROUND OF THE INVENTION
, ` Yeast organisms produae a number of proteins which are synthesized intracellularly, but which have a function outside ~`~ the cell. Such extracellular proteins are referred to as lS ~ecreted proteins. These secreted proteins are expressed initially inside the cell in a precursor or a pre-protein form containing a presequence ensuring effective direction of the expressed product across the membrane of the endoplasmic -` reticulum tER). The presequence, normally named a signal ; 20 peptide, is generalIy cleaved off from the desired product S`~i during translocation. once entered in the secretory pathway, the protein is transported to the Golgi apparatus. From the Golgi the protein can follow different routes that lead to compartments such as the cell vacuole or the cell membrane, or 25 it can be routed out of the cell to be secreted to the external ` medium (Pfeffer, S.R. and Rothman, J.E. Ann.Rev.Biochem. 56 (1987), 829-852).
. ., ~
Several approaches have been suggested for the expression and 30 secretion in yeast of proteins heterologous to yeast. European published patent application No. 88 632 describes a process by which proteins heterologous to yeast are expressed, processed .~ and secreted by transforming a yeast organism with an ~-a expression vehicle harbouring DNA encoding the desired protein 35 and a signal peptide, preparing a culture of the transformed ~ organism, growing the culture and recovering the protein from - the culture medium. The signal peptide may be the signal -, :
"s WO~7/ll378 PCT/D~91/00396 ;~ 3 ~ ~ 2 peptide of the desired protein itself, a heterologous signal peptide or a hybrid of native and heterologous signal peptide.
:., A problem encountered with the use of signal peptides hetero-~ 5 logous to yeast might be that the heterologous signal peptide ; does not ensure efficien~ translocation and/or cleavage after ; the signal peptide.
~ The S. cerevisiae MF~1 t~ factor) is synthesized as a prepro . ~ .
form of 165 amino acids comprising signal-or prepeptide of 19 amino acids followed by a "leader" or propeptide of 64 amino aicds, encompassing three N-linked glycosylation sites followed ;~ by (LysArg(Asp/Glu, Ala)23~-factor)4 (Kurjan, 3. and Herskowit2, I. Cell 30 (1982), 933-943). The signal-leader part of the preproMF~1 has been widely employed to obtain synthesis ~ and secretion of heterologous proteins in S. cerivisiae.
'~
Use of signal/leader peptides homologous to yeast is known from i.a. US patent specification No. 4,546,082, European published patent applications Nos. 11~ 201, 123 294, 123 544, 163 529, ;.~ and 123 289 and DK patent application No. 3614/83.
In EP 123 289 utilization of the S. cerevisiae a-factor pre-cursor is described whereas W0 84/01153 indicates utilization of the Saccharomyces cerevisiae invertase signal peptide and ~, DX 3614/83 utilization of the Saccharomyces cerevisiae PH05 signal peptide for secretion of foreign proteins.
.. ~
~: US patent specification No. 4,546,082, EP 16 201, 123 294, 123 544, and 163 529 describe processes by which the ~-factor ; signal-leader from SaccharomYces cerevisiae (MF~1 or MF~2) isutilized in the secretion process of expressed heterologous proteins in yeast. By fusing a DNA sequence encoding the S.
, cerevisiea MF~1 signal/leader sequence at the 5' end of the 3S gene for the desired protein secretion and processing of the desired protein was demonstrated.
. .
., : ,..
''.'.'' ..... ...... . . . . .
WOg~/l1318 PCT/~K91/00396 2 ~ n ~ 7~?l1 ` EP 206 783 discloses a system for the secretion of polypep~ides from S. cerevisiae whereby the ~-factor leader sequence has been truncated to eliminate the four ~-factor peptides present on the native leader sequence so as to leave the leader peptide : 5 itself fused to a heterologous polypeptide via the a-factor ~ processing site LysArgGluAlaGluAla. This construction is -. indicated to lead to an efficient process of smaller peptides (less than 50 amino acids). For the secretion and procassing ~i of larger polypep~ides, the native ~-factor leader sequence has ~ lO been truncated to leave one or two ~ factor peptides between `- the leader peptide and the polypeptide.
A number of secreted proteins are routed so as to be exposed . to a proteolytic processing system which can cleave the peptide 15 bond at the carboxy end of two consecutive basic amino acids.
This enzymatic activity is in S. cerevisiae encoded by the KEX
2 gene (Julius, D.A. et al., Cell 37 (198~b), 1075). Processing . of the product by the KEX 2 gene product is needed for the secretion of active S. cerevisiae mating factor ~l (MF~l or ~-20 factor) but is not involved in the secretion of active S.
cerevisiae mating factor a.
. . .
".;
,' Secretion and correct processing of a polypeptide intended to '~ be secreted is obtained in some cases when culturing a yeast :~ 25 organism which is transformed with a vector constructed as s indicated in the references ~iven above. In many cases, how-ever, the level of secretion is very low or there is no se-cretion, or the proteolytic processing may be incorrect or - incomplete. It is therefore the object of the present invention 30 to provide leader peptides which ensure a more efficient ~, expression and/or processing of heterologous polypeptides.
''''1 .- SUMMARY OF THE INVENTION `~
; - 35 It has surprisingly been found possible to replace the ~-factor . leader peptide by a variety of different DNA sequences, thereby obtaining secretion of a heterologous polypeptide in yeast. -. ;~, !.
~092/l1378 ?~ u ~ 3 PC~/DK91/00396 sased on this observation, a method has been developed by which ~ random DNA fragments are cloned into yeast vectors downstream : of a DNA se~uence coding for a signal peptide and upstream of a DNA sequence coding for a heterologous polypepti~e. A*ter transformation with the vectors, yeast cells are screened for secretion of the heterologous polypeptide in question.
~ More specifically, the present invention relates to a method `.`` of constructing a synthetic leader peptide sequence for secreting heterologous polypeptides in yeas~, the method ~` comprising : (a) inserting a random DNA fragment into a yeast expression ~: vector comprising the following sequence 5 1 ~SP~Xn 3 ~ -RS-5 1 ~Xm- (NZT)p-Xq-PS-*gene*-3 .
.: ~
.j wherein SP is a DNA sequence encoding a signal peptide, . Xn is a DNA sequence encoding n amino acids, wherein n is 0 or an integer of from 1 to about 10 amino acids, ,~ RS is a restriction endonuclease recognition site for insertion .~, of random DNA fragments, which site is provided at the junction .,~
of Xn and Xm, ~ Xm is a DNA sequence encoding m amino acids, wherein m is 0 or :; 25 an integer from 1 to about 10, (NZT)p is a DNA sequence encoding Asn-Xaa-Thr, wherein p is 0 ::~ or 1, ., .~ .
.. Xq is a DNA sequence encoding q amino acids, wherein q is 0 or ' an integer from 1 to about 10, PS is a DNA sequence encoding a peptide defining a yeast processing site, and *gene* is a DN~ sequence encoding a heterologous polypeptide;
(b) transforming a yeast host cell with the expression vector of step (a);
.'' -` (c) culturing the transformed host cell of step (b) under . . 1 , .
.
..,~
WO92/1137~ 2 ~ n ~, rl 3 L PCT/D~91/0~396 appropriate conditi~ns; and (d) screening the culture of step (c) for secretion of the heterologous polypeptide.
In the present context, the expression "leader peptide" is understood to indicate a peptide whose function is to allow the heterologous polypeptide to be directed from the endoplasmic reticulum to the Golgi apparatus and further to a secretory ve sicle for secretion into the medium, (i.e. exportation of the expressed polypeptide across the cell wall or at least through the cellular membrane into the periplasmic space of the cell).
The term "synthetic" used in connection with leader peptides is intended to indicate that the leader peptide constructed by lS the present method is one not found in nature.
The term "signal peptide" is understood to mean a presequence .~ ~
which is predominantly hydrophobic in nature and present as an N-terminal sequence of the precursor form of an extracellular protein expressed in yeast. The function of the signal peptide is to allow the heterologous protein to be secreted to enter ~, the endoplasmic reticulum. The signal peptide is normally ~< cleaved off in the course of this process. The signal peptide # may be heterologous or homologous to the yeast organism producing the protein but, as explained above, a more efficient cleavage of the signal peptide may be obtained when it is '~r homologous to the yeast organism in question.
:. :
The expression "hetero1ogous polypeptide" is intended to indicate a polypeptide which is not produced by the host yeast organism in nature. In the method of the invention, the - heterologous polypeptide is preferably one the secretion of which by transformed yeast cells may easily be detected, e.g.
by established standard methods such as by immunological screening by means of antibodies reactive with the polypeptide in question (cf. for instance Sambrook, Fritsch and Maniatis, Molecular Cloninq: A Laboratory Manual, Cold Spring Harbor, New ~
., .
: ~.
. .. :, - , . ~,:
WO92~ll378 PCT/DK91/00396 ~`York, 1989) or by screening for a specific biological activity : of the heterologous polypeptide. A positive result of the screening i~dicates that a leader peptide useful for the secretion of heterolo~ous polypeptides in yeast has been constructed.
The expression "a random DNA fragment" is intended to indicate any se~uence of DNA at least 3 nucleotides in length, for instance obtained by digesting genomic DNA (of any organism) ~lO with restriction endonuclease(s) or by preparing synthetic DNA, `~e.g. by the phosphoamidite method described by S.L. Beaucage and M.H. Caruthers, Tetrahedron Letters 22, 1981, pp. 1859-.1869.
. ~.
~15 The peptide Asn-Xaa-Thr encoded hy "(NZT)p" is an asparagine-".~linked glycosylation site. "Xaa" denotes any one of the known `~samino acids except Pro.
. . ~ ~;.
In another aspect, the present invention relates to a yeast expression cloning vector comprising the following sequence . .
5'-SP-Xn-3'-RS-5'-Xm- (NZT)p-Xq-PS-*gene*-3' wherein SP, Xn, RS, Xm, (NZT)p, Xq, PS and *gene~ are as defined 2S above.
~ G
~`This vector may be used in the construction of leader peptide sequences according to the method described above.
In a further aspect, the present invention relates to a yeast expression vector comprising the following sequence ..~
~5'-SP-Xn-ranDNA-Xm-(NZT)p-Xq-PS-*gene*-3' . .~ .
35 wherein SP, Xn, Xm, (NZT)p, Xq/ PS and *gene* are as defined ~`
;~above, and ranDNA is a random DNA fragment inserted in a ~-restriction endonuclease recognition site provided at the ,, ~.
.;, .
i , 2 Q (~ O r~ ~ I
junction of Xn and Xm.
In this vector, the leader peptide sequence (once identified by the method of the invention) will be composed of the sequence Xn-ranDNA-Xm-~NZT)p~Xq. Such a vector may be used in the production of a heterologous polypeptide of interest.
.
In a still further aspect, the present invention relates to a process for producing a heterologous polypeptide in yeast, the process comprising culturing a yeast cell, whlch is capable of expressing a heterologous polypeptide and which is transformed with a yeast expression vector as described above including a leader peptide sequence constructed by the method of the invention, in a suitable medium to obtain expression and secretion of the heterologous polypeptide, after which the heterologous polypeptide is recovered from the medium.
DETAILED DISCLOSURE OF THE INVENTION
: . :
;` 20 The length of the random DNA fragment inserted in theexpression vector is not particularly critical. However, in s order to be of a manageable length, the fragment preferably has : a length of from 16 to about 600 base pairs. More preferably,the fragment has a length of from about 15 to about 300 base / 25 pairs. It is at present considered that a suitable length of -~ the fragment is from about 30 to about 150 base pairs.
... .
- The random DNA fragment preferahly encodes a high proportion - of polar amino acids. These are selected from the group consisting of Glu, Asp, Lys, Arg, His, Thr, Ser, Asn and Gln.
-, In the present context, the term "a high proportion of" is understood to indicate that the DNA fragment encodes a larger number of polar amino acids than do other DNA sequences of a corresponding length. Independently hereof, or in addition hereto, it may be advantageous that the fragment encodes at least one proline.
, .i~
' ~' .
. s .,~
. ' ' , :
WO92tl1378 PCT/D~91/00396 ~ 1~ 3 ~
In the sequence 5'-SP-Xn-3'-RS-5'-Xm-(NZT)p-Xq-PS-*gene*-3', n and/or m and/or q are preferably >1. In particular, all of n, m and q are ~1.
There is some evidence (cf. WO 89~02463) to support that the presence of an asparagine-linked glycosylation site in the leader sequence may confer a higher secretion efficiency to the leader peptide. In the sequence 5l-SP-Xn-3'-RS-5'-Xm- (NZT) p~Xq~
PS-*gene~-3', p is therefore preferably 1.
The signal peptide sequence (SP) may encode any signal peptide ~which ensures an effective direction of the expressed - heterologous polypeptide into the secretory pathway of the cell. The signal peptide may be a naturally occurring signal `15 pep~ide or funccional parts thereof, or it may be a synthetic ~` peptide. Suitakle signal peptides have been found to be the ~-factor signal peptide, the signal peptide of mouse salivary amylase, a modified carboxypeptidase signal peptide, the yeast BAR1 signal peptide or the Humicola lanuqinosa lipase signal peptide, or a derivative thereof. The mouse salivary amylase ,signal sequence is described by O. Hagenbuchle et al., Nature ~289, 1981, pp. 643-646. The carboxypeptidase signal sequence is described by L.A. Valls et al., Cell 48, 1987, pp. 887-897.
lThe BAR1 signal peptide is disclosed in WO 87/02670. The H.
lanu~inosa lipase signal peptide is disclosed in EP 305 216.
, The yeast processing site encoded by the DNA sequence PS may suitably be any paired combination of Lys and Arg, such as Lys-Arg, Arg-Lys, Lys-Lys or Arg-Arg, which permits processing of the heterologous polypeptide by the KEX2 protease of - Saccharomvces cerevisiae or the equivalent protease in other ^ yeast species (D.A. Julius et al., Cell 37, 1984, 1075 ff.).
~'If KEX2 processing is not convenient, e.g. if it would lead to cleavage of the polypeptide product, a processing site for '35 another protease may be selected instead comprising an amino acid combination which is not found in the polypeptide product, e.g. the processing site for FXa, Ile-Glu-Gly-Arg (cf.
, ~ .
:.
:
WO92/1137X PCT/DK91/0~396 ?~ t3 ~
. ` , Sambro~k, F~i~sch and Maniatis, Molecular Cloninq: A Laboratory Manual, Cold Spring Harbor, New York, 1989).
, The heterolo~ous protein produced by the method of the inven-- 5 tion may be any protein which may advantayeously be produced ;in yeast. Examples of such proteins are aprotinin, tissue factor pathway inhibitor or other protease inhibitors, insulin or insulin precursors, human or bovine growth hormone, interleukin, glucagon, tissue plasminogen activator, transforming growth factor ~ or ~, platelet-derived growth ` factor, enzymes, or a functional analoyue thereof. In the present context, the term "functional analogue" is meant to indicate a polypeptide with a similar function as ~he native protein (this is intended to be understood as relating to the ,~A 15 nature rather than the level of biological activity of the native protein). The polypeptide may be structurally similar ` to the native protein and may be derived from the native protein by addition of one or more amino acids to either or both the C- and N-terminal end of the native protein, substitution of one or more amino acids at one or a number of different sites in the native amino acid sequence, deletion of one or more amino acids at either or both ends of the native protein or at one or several sites in the amino acid sequence, or insertion of one or more amino acids at one or more sites -~ 25 in the native amino acid sequence. Such modifications are well . . ., :
~known for several of the proteins mentioned above. ~
.. .~ . .:
"";JThe random DNA fragment and the sequence 5 ~-SP-Xn-31-RS-51~Xm~
6(NZT)p-Xq-PS-*gene* 3' may be prepared synthetically by 30 established standard methods, e.g. the phosphoamidite method described by S.L. Beaucage and M.H. Caruthers, Tetrahedron Letters 22, 1981~ pp. 1859-1869~ or the method described by Matthes et al., EMBO Journal 3 ~ 1984 ~ pp. 801-805. According to the phosphoamidite method, oligonucleotides are synthèsized, 35 e.g. in an automatic DNA synthesizer, purified, annealed, ligated and cloned into the yeast expression vector. It should be noted that the sequence 5'~SP~Xn~3'~RS~5'~Xm~(NZT)p~Xq~PS~
.,.' . .
',",'~
., : .: .: . .. . ~ ,: ,, ::: : .: : : : , -WO9~/ll37X PCT/DK91/00396 ~ iu~ 10 *gen~*-3' need n~t be prepared in a single operation, but may b~ assembled from ~wo or more oligonucleotides prepared synthetically in this fashion.
The random DNA fragment or one or more parts of the sequence 5'-SP-Xn-3'-RS-5'-Xm- (NZT)p-Xq-PS-*gene*-3' may also be of genomic or cDNA origin, for instance obtained by preparing a -` genomic or cDNA library and screening for DNA sequences coding for said parts (typically SP or *gene*) by hybridization using synthetic oligonucleotide probes in accordance with standard techniques (cf. Sambrook, Fritsch and Maniatis, Molecular Clon-inq: A Laboratorv Manual, Cold Spring Harbor, New York, 1989).
In this case, a genomic or cDNA sequence encoding a signal : peptide may be joined to a genomic or cDNA sequence encoding `~ 15 the heterologous protein, a~ter which the DNA sequence may be modified by the insertion of synthetic oligonucleotides encoding the sequence Xn~3'~RS~5l~Xm~~NZT)p~Xq~PS in accordance ~- with well-known procedures.
! l Finally, the random DNA fragment and/ or the sequence 5'-SP-X~-
3'-RS-5'-Xm-(NZT)p-Xq-PS-*gene*-3' may be of mixed synthetic and genomic, mixed synthetic and cDNA or mixed genomic and cDNA
origin prepared by annealing fragments of synthetic, genomic ~`~ or cDNA origin (as appropriate), the fragments corresponding to various parts of the entire DNA sequence, in accordance with ~-~ standard techniques. Thus, it may be envisaged that the DNA
sequence encoding the signal peptide or the heterologous ~; polypeptide may be of genomic or cDNA origin, while the ~ sequence Xn-3'-RS-5'-Xm-(N~T) -X -PS may be prepared ;~ 30 synthetically.
.~ `,!
Preferred DNA constructs encoding insulin precursors are as shown in Sequence Listings ID Nos. 1-13, or suitable modifica-`, tions thereof. Examples of suitable modifications of the DNA-3 35 sequence are nucleotide substitutions which do not give rise to another amino acid sequence of the protein, but which may correspond to the codon usage of the yeast organism into which ,. ~'' ' :
:
` r '.. .~ ' ~ . ~ :
WO9Z/I1378 PCT/D~91/00396 ~, n ~) ,,(,~ 7 3 1 the DNA construct is inserted or nucleotide substitutions which do give rise to a different amino acid sequence and therefore, possibly, a different protein structure~ Other examples of possible modifications are insertion of three ar multiples of three nucleotides into the sequence, addition of three or multiples of three nucleotides at either end of the sequence and deletion of three or multiples of three nucleotides at either end of or within the sequence.
The recombinant expression vector carrying the sequence 5'-SP-Xn-3'-RS-5'-Xm-(NZT)p-Xq-ps-*gene*-3~ or 5'-SP-Xn-ranDNA-Xm-(NZT)p-Xq-PS-*gene*-3' may be any vector which is capable of replicating in yeast organisms. In the vector, either DNA
sequence should be operably connected to a suitable promoter sequence. The promoter may be any DNA sequence which shows transcriptional activity in yeast and may be derived from genes encoding proteins either homologous or heterologous to yeast.
.,.'! The promoter is preferably derived from a gene encoding a ~, protein homologous to yeast. Examples of suitable promoters are ~ 20 the Saccharomyces cerevisiae MF~l, TPI, ADH or PGK promoters. ~
.,.~ .;.
i~` The sequences shown above should also be operably connected to ' a suitable terminator, e.g. the TPI terminator (cf. T. Alber : and G. Kawasaki, J._Mol. Ap~l. Gene*. 1, 1982, pp. 419-434).
The recombinant expression vector of the invention further ;. comprises a DNA sequence enabling the vector to replicate in yeast. Examples of such sequences are the yeast plasmid 2~
~:i replication genes REP 1-3 and origin of replication. The vector may also comprise a selectable marker, e.g. the Schizo-:
saccharomvces pombe TPI gene as described by P.R. Russell, Gene 40, 1985, pp. 125-130.
The procedures used to ligate the sequence 5'-SP-Xn-3'-RS-5'-Xm-(NZT)p-Xq-PS-*gene*-3', the random DNA fragment, the promoter and the terminator, respectively, and to insert them into suitable yeast vectors containing the information necessary for .. .. .
:, .
~:
WOg2/ll378 PCT/DK9t/00396 S ` 12 .
`~ yeast replication, are well known to persons skilled in the art (cf., for instance, Sambrook, Fritsch and Maniakis, oP~cit.).
It will be understood that the vector may be constructed either by first preparing a DNA construct containing the entire - 5 sequence 5 1 -SP-Xn-3 1 -RS-5 1 ~Xm~ (NZT) p-Xq-PS-*gene*-3~ and subsequently inserting this fragment into a suitable expression vector, or by sequentially inserting DNA fragments containing genetic information for the individual elements (such as the signal peptide, the sequence Xn-3'-RS-5'-Xm- (NZT) p~Xq or the lo heterologous polypeptide) follow2d by ligation.
'' The yeast organism used in the method of the invention may be any suitable yeast organism which, on cultivation, produces large amounts of the heterologous polypeptide in question.
15 Examples of suitable yeast organisms may be strains of the yeast species Saccharomyces cerevisiae, Sacch _ mYces kluyverl, Schizosaccharomvces Pombe or Saccharomvces uvarum. The transformation of the yeast cells may for instance be effected ~ by protoplast formation followed by transformation in a manner S,~ 20 known per se. The medium used to cultivate the cells may be any conventional medium suitable for growing yeast organisms. The secreted heterologous protein, a significant proportion of which will be present in the medium in correctly processed form, may be recovered from the medium by conventional pro-? 2~ cedures including separating the yeast cells ~rom the medium ~-' by centrifugation or filtration, precipitating the protein-.~, aceous components of the supernatant or filtrate by means of `. a salt, e.g. ammonium sulphate, followed by purification by a variety of chromatographic procedures, e.g. ion exchange 30 chromatography, affinity chromatography, or the like.
:, -BRIEF DESCRIPTION OF THE DRAWINGS
. :
The present invention is further illustrated with reference to ~ 35 the appended drawings wherein ;~ Fig. 1 schematically shows the construction of pMT742~; -.:
,: -"
.:
, .:
WO92/ll378 PCT/DK91/00396 2 0 9 . ~ 3 Fig. 2 schematically shows the construction of pLaC202;
, Fig. 3 shows the DNA sequence and derived amino acid sequence at the cloning site in pLaC202 for random DNA fragments (it should be noted that the sequence is cleaved in the unique ClaI
site and that ligation without insertion of r~ndom DN~ will lead to a change in the reading frame);
Fig. 4 schematically shows the construction of pLSC6315DX;
: 10 The invention is further described in the following examples which are not to be construed as limiting the scope of the invention as claimedO
..
; EXAMPLES
``. ` ;':
; Plasmids and DNA materials All expression plasmids are of the C-POT type. Such plasmids are described in EP patent application No. 171 142 and are characterized in containing the SchizosaccharomYces pombe triose phosphate isomerase gene (POT) for the purpose of plasmid selection and stabilization. A plasmid containing the POT-gene is available from a deposited E. coli strain (ATCC
39685)~ The plasmids furthermore contain the S. cerevisiae ~ triose phosphate isomerase promoter and terminator (PTp~and ., TTPI). They are identical to pMT742 (M. Egel-Mitani et al., Gene 73, 1988, pp. 113-120) (see fig. 1) except for the region defined by the Sph-XbaI restriction sites encompassing the PTPI
and the coding region for signal/leader/product.
' The PTPI has been modified with respect to the sequence found in pMT742, only in order to facilitate construction work. An internal SphI restriction site has been eliminated by SphI
cleavage, removel of single stranded tails and religation.
~ Furthermore, DNA sequences, upstream to and without any impact '', -WO92/ll378 PCT/DK91/00396 ~rl~ ~ 14 ; on the promoter, have be~n ramoved by Bal3~ exonuclease treatment followed by ad~i~ion of an SphI restriction site linker. This promoter construction present on a 373 bp SphI-EcoRI fragment is designated PTPI~ and when used in plasmids already described this promoter modification is indicated by the addition of a ~ to the plasmid name, e.g. pMT742~ (fig. 1).
`:~
`` The assembly of various DNA fragments have occasionally taken place in a smaller E. coli plasmid of the pT7 type previously 10 described ~cf. W0 89/02463) only modified with respect to the PTPI as described above, i.e. pT7~. For random cloning described ; below, genomic DNA of various origins have been employed. S.
cerevisiae DNA was isolated ~rom strain MT633 (deposited on 7 December 1990 in the ~eutsche Sammlung von Mikroorganismen und Zellkulturen under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure with the deposit number DSM
6278). A. oryzae DNA was isolated from strain A1560 (IF0 4177).
,.;;,.
`~i 20 -., Finally a number of synthetic DNA fragments have been employed ~:~ all of which were synthesized on an automatic DNA synthesizer i (Applied Biosystems model 380A) using phosphoramidite chemistry and commercially available reagents (S.L. Beaucage and M.H.
25 Caruthers (1981) Tetrahedron Letters 22, 1859-1869). The oligonucleotides were- purified by polyacrylamide gel `~ electrophoresis under denaturing conditions. Prior to annealing ~ complementary pairs of such DNA single strands these were ;i kinased by T4 polynucleotide kinase and ATP.
`^ 30 All other methods and materials used are common state of the art knowledge (J. Sambrook et al., Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor Laboratory Press) Cold Spring Harbor, N.Y. 1989).
` 35 .... .
, : j :
,, ~ .
:
....
WOg~ 378 PCT/DK91/0039fi ~ o n -3 ~J ~
xample 1 Construction of PLac2o2 The 490 bp SphI-ApaI of pT7 196~ ~cf. WO 89/02463, fig. 5) and the 179 bp HinfI-XbaI fragment of pT7.~MI3 (cf. WO 89/02~63, fig. 1) joined in the 11 kb XbaI-SphI fragment of pMT742 via ; the synthetic adaptor: ;
":
NOR367/373: CAACCATCGATAACACCACTTTGGCTAAGAG
CCGGGTTGGTAGCTATTGTGGTGAAACCGATTCTCTAA
'::
resulting in the plasmid pLaC202 (fig. 2 and 3 as well as Sequence Listing ID No. 1).
This vector containing a unique ClaI site constitutes one embodiment of the random DNA cloning vector in which the `~ product gene codes for the insulin precursor MI3 (B(1-29)-Ala-~ Ala-Lys-A(1-21)). The following examples concerns the leaders `~ 20 cloned via this construct.
`~i ExamPle 2 . ...
: .., i 25 Construction of ~LSC6315 and pLSC5210 "... ~ .
Total DNA was isolated from S. cerevisiae strain MT663, and digested by TaqI, HinPI or TaqI + HinP I. The digests were separated according to size on a 1% agarose gel, and fragments ` 30 smaller than 600 bp were isolated from each of the three . digestions.
:~
., pLaC202, previously digested with ClaI, prevented from self ligation with Calf Intestine Alkaline Phosphatase (CIAP), dephosphorylation, was mixed with the fragment pools described above and ligated. E. coli strain MT172 (MT172 = MC 1000 m r~
ara~ leuB-6; MC 1000 (cf. M. Casadaban and S. Cohen, ., p : .. .
~. - .
~092~l137~ ~ PCTtDK91/003g6 ~S~I~?J ~
J.Mol.Biol. 138, 1980, p. 179)) was transformed with above ligation mixture, and appr. S000 ApR transformants for each mixture were o~tained. Recombinant plasmids were prepared from each of the three types in pools encompassing all 5000 transformants. These plasmid pools were used to transform S.
cerevisiae strain MT663 and the resulting TPI transformants were immunoscreened for MI3 secretion.
Among the surprisingly large number of posltive transformants the eight apparently most efficient w~re reisolated and the plasmid content isolated therefrom.
:
As a result of ~his procedure, it is expected that most of the - yeast transformant obtalned have a heterogeneous population of plasmids and to obtain true clones, a step of plasmid reisolation was therefore performed. The plasmid preparations from each of the eight reisolated yeast transformants were used to transform E. coli strain MTl72 to ApR. Plasmids from 12 E.
~`- coli transformants for each of the eight yeast isolates, were individually used to transform yeast strain MT663, TPI, and MI3 secreting transformants were identified by immunoscreening.
~ Sequencing of the inserts of the eight isolated pLaC202 ; derivatives showed three different sequences, two of which, : - 25 pLSC6315 and pLSC5210, most efficiently support MI3 secretion.
The sequences of the cloned DNA and flanking regions are shown in Sequence Listings ID Nos. 2 and 4, respectively.
: ,;
: :-~
;- 30 Exam~le 3 . . .
, ......
.~ Modifications of PLSC6315 ::
;:~
~' pL5C6315 was chosen for further modification of the cloned 35 synthetic leader sequence.
'"' ~. pLSC6315 was digested with the ApaI endonuclease followed by .-,!
.:,-' .
:-,:,:
:i ... .
WO9~11378 PCT/DK91/00396 20n~7,~.1 treatment with the exonuclease Bal31. After phenol extraction the resulting DNA was digested with XbaI and DNA fragments smaller than the original 367 bp ApaI-XhaI fragment, were isolated.
pLaC202 was digested with ClaI, and the single stranded CG
tails generated were removed, followed by XbaI digestlon and " isolation of the 11 Kb XbaI-]ClaI~ fragment ("] [" indicates ; that the single-stranded t~ils have been trimmed off). This fragment was mixed with the pLSC6415 fragments isolated above and ligated (fig. 6).
The transformation and screening procedure described in example 2 was repeated, and pLSC6315D3 and pLSC6315D7 were isolated as plasmids supporting MI3 secretion more efficiently than the original pLSC6315 (cf. Sequence Listings ID Nos. 6 and 8, respectively).
.:!
.~....
Exam~le 4 : . ~ Construction of PLAOl - 5 :,, Total DNA from AsPerqillus or~zae strain A1560 was treated as - 25 previously described for S. cerevisiae DNA in example 2, and ..... ~ .
; cloning and recloning was performed exactly as described in . example 2, except that the number of E. coli transformants in the first cloning was reduced to approximately 3000 per :J, ligation mixture. This experiment resulted in the isolation of ` 30 five clones of A. orvzae DNA which in the pLaC202 context mediates secretion of the insulin precursor MI3, from S.
. . .
,!, cerevl~slae.
Sequencing of the inserts showed 5 different sequences, two of -~
which (pLAO2 and pLAO5) are more efficient where MI3 secretion is concerned. The sequences of the DNA inserts in pLAO2 and ~ pLAO5 are shown, together with the flanking regions, in ',A.
'' :
"s . ; .. . . . . . . .. . . . . . . . .
WO92/ll37X PCT/DK91/00396 ~rv~3s~ 3 ~ 18 sequence Listings ID Nos. lo and 12, respectively.
`: :
Example 5 :` :
Yeast strains harbouring plasmids as described above, were grown in YPD medium (Sherman, F. et al., Methods in Yeas~
Genetics, Cold Spring Harbor Laboratory 1981). For each strain 6 individual 5 ml cultures were shaken at 30C for 60 hours, with a final OD600 of approx. 15. After centrifugation the supernatant was removed for HPLC analysis by which method the concentration of secreted insulin precursor was measured by a method described by Leo Snel et al. (1987) Chromatographia 24, ~ 329-332.
., In table I the expression levels of insulin precursor, MI3, by ~` use of leader sequences isolated according to the present -` invention, are given as a percentage of the level obtained with ~ transformants of pMT7~2~, utilizing the MF~(1) leader o~ S.
'`:'iJ cerevisiae.
` Table I
pMI'742 100~
";;Ji 25 pLSC6315 100%
pLSC5210 60%
pLSC6315D3 175%
pLSC6315D7 120%
pLA02 120%
~` 30 pLAO5 60%
:
., ~
: .
.
''- .
:.
r Wo 92/1~378 PC~/DK~1/00396 2 ~ J ~ 7 3 ~
SEQUENCE LISTING
( 1 ) GENERAL INFORMATION:
` (i) APPLICANT: Novo Nordisk A/S
(ii) TITLE OF INVENTION: A Method of Constructing Synthetic Leader Sequences (iii) NUMBER OF SEQUENCES: 13 -: ( iv) CORF~ESPONDENCE ADDRESS:
(A) ADDRESSEE: Novo Nordisk A/S, Patent Department ; (B) STREET: Novo Alle ~ (C) CITY: Bagsvaerd :~` (E) COUNTRY: Denmark (F) ZIP: DK-2880 (v) COMPUTER READABLE FORM:
. (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Releas2 #1.0, Version #1.25 :. (vi) CURRENT APPLICATION DATA: ~--c~ (A) APPLICATION NUMBER:
. (B) FILING DATE: -(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATXON:
:~i (A) NAME: Thalsoe-Madsen, Birgit (C) REFERENCE/DOCKET NUMBER: 3540.204-WO
., .. ~. . .
i.~. (ix) TELECOMMUNICATION INFORMATION~
.~ (A) TELEPHONE: +45 4444 8888 (B) TELEFAX: +45 4449 3256 (C) TELEX: 37304 , ' , .~
' (2) INFORMATION FOR SEQ ID NO:l:
. .
(i) SEQUENCE CHARACTERISTICS:
~' (A) LENGTH: 335 base pairs (B) TYPE: nucleic acid :. (C) STRANDEDNESS: single . (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
, . ,j , : (xi) SEQUENCE DESCRIPTqON: SEQ ID NO:l: ~:
~i Ga~FKY~I~ AA~ T CA~ACA~GAA GATTAC~AAC TATCAATITC AIACAC~ATA 60 . ~ .
TA~AC~ATTA A~AT&AA AG~CFKX~G C~ CC TC~ATT CD3C~ 120 . ~ . . .
7~
WO 92/11378 PCr/VK91/00396 ~ 9~3~ 20 C~AC~ ~ACACCPCT TI~GCrAAGA GAl~GrrAA CC~ACACr~ ~ 180 ` ~ AC~A A~AC T~TI~ ~AGG TII~AC AC~G 240 c~crhAGGG ~7sOE~A C~5~R CC~c~ C~I~AC C~A 300 ACrACIr;CPA CrA~CGCA~ r~ 335 . :. -.
( 2 ) INFORM~ION FOR SE)Q ID N0: 2:
(i~ SEX2~TCE ~RACrERIST~CS:
(A) LE:~: 492 base pairs (B) TY~: nucleic acid (C) SrRANDElX~ESS: single (D) ~POL~: linear '' (ix) ~E:
~ (A) NP~/~CEY: CDS
: (B) ~)CAlICN: 76... 468 : ~ (ix) P~:
(A) N~ME/XEY: sig_peptide : (B) LOCATION: 76... 309 (ix) ~æ:
(A) NAME/KEY: mat_peptide ~: (B) LOC~IION: 310.. .468 . (xi) SEQUENCE DESCRIPqION: SEQ ID N0:2:
, :~ GPAITCaIrC AAGAA~AGTT CAAACAAGAA GAIIACAA~C ~C~AIrTC AIACACAATA 60 :
:~ IAAACGATIA A~A~A AIG AAA GTC TTC CTG CTG CrT TCC crc ATT GGA TTC lll ~`............................. Met ~ys Val Phe Leu Leu Leu Ser Leu Ile Gly Ph~
:- -78 -75 -70 ;~ TGC TGG GCC CAA CCA TCG A~A GAT GGA ACA CAT TTT CCG AAC AAC AAT 159 ~ Cys Trp Ala Gln Pr~ Ser Ile Asp Gly Thr His Phe Pro Asn Asn Asn ; -65 -60 -5S
Val Pro Ile Asp Thr Arg Lys Glu Gly Leu Gln ~is Asp Tyr Asp Thr . -50 -45 -40 -35 :::
. Glu Ile Leu Glu His Ile Gly Ser Asp Glu Leu Ile Leu Asn Glu Glu ~~ -30 -25 -20 .: lAr GTT AIT GAA AGA ACT TTG CAA GCC ATC GA~ AAC ACC ACT TIG GCT 303 Tyr Val Ile Glu Arg Ihr Leu Gln Ala Ile Asp Asn Thr Thr Leu Ala . -15 -10 -5 AAG AG~ TTC GTT AAC CAA CAC TTG TGC GGT TCC CAC TTG GTT GAA GCT 351 :~ Lys Arg Phe Val Asn Gln His Leu Cys Gly Ser His TPU Val Glu Ala ,, .
., :, .
: .. ~.. -.. . - . .
. ~ . . ~ . ~ . . . . .. .
2 ~ ~ S 7~ 1 TTG TAC TTG GIr TGC GGT GP~ AG~ GGT TTC TTC IAC AC~ CCT AAG GCT 399 Leu Tyr keu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Ala GCT A~ GGT ATT GTC GAA CAA TGC TGT ACC TCC ATC TGC TCC TTG TAC 447 Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr CAA TTG GAA AAC TAC TGC AAC TAG~CGCAGC CY3C~EGCTC TAGA 492 :~ Gln Leu Glu Asn Tyr Cys Asn ' 50 .
: (2) INFO~M~TqON FOR SEQ ID NO:3, .~
(i) SEQUEN OE CH~RACTERISl~lCS:
-~ (A) LÆNGTH: 131 am m o acids (B) TYPE: amlno acid ~.
.~ (D) TOPOLCGY: linear (ii) MOLECULE TYPE: protein (xi) SE2UENCE DESCRIPTION: SEQ ID NO:3:
. Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly Phe Cys Trp Ala Gln . -78 -75 -70 -65 .,:'!, Pro Ser Ile Asp Gly Thr His Phe Pro Asn Asn Asn Val Pro Ile Asp , -60 -55 ~50 `~ m r Arg Lys Glu Gly Leu Gln His Asp Iyr Asp Thr Glu Ile Leu Glu ~40 35 . His Ile Gly Ser Asp Glu Leu Ile Leu Asn Glu Glu Tyr Val Ile Glu ~
.$ -30 -25 -20 -15 - .
:~ Arg Thr Leu Gln Ala Ile Asp Asn Thr Thr Leu Ala Lys Arg Phe Val ~ 10 -5 : r, , Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val ' :;. Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Ala Ala Lys Gly Ile .. 20 25 30 ., Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn ' 35 40 45 50 Tyr Cys Asn ~ .
(2) INFORM~IION FOR SEQ ID NO:4: .;
. . (i) SEQUENCE CHARACTERI~llCS:
- (A) LENGTH: 420 kase paLrs .i (B) IYPE: nucleic acid :< (C) STRANDEDNESS: single : --~ (D) I~POLOGY: linear ; .
'~. :
, , , :
wo 92/11378 pcr/D~s1/oo3s6 '13~ 22 (ii) ~OL~:CUIE TYPE: cDNA
( ix~ F~UEæ:
(A) N~IE/KEY: cr~;
(B) L~TI~: 76. . 396 ( lX) FE~:
(A) NAME/KEY: sig peptide (B) ~CATION: 76. . 237 . (ix) F~E:
(A) NAME/KE~Y: mat_peptide (B) ~lION: 238 . . 396 (xi) S~CE DESCRIPrION: SEQ ID NO:4:
:~; G~ATIC~ AAG~A~T C~A~C~A GAITACA~AC TATCA~ITC AT~CACAA~A 60 . ~ Met Lys Val ~e L~3u ~u Leu Ser Leu Ile Gly l~e : --54 --50 --45 . ~
::` TGC IGG GCC CAA CCA TCG CTA TIG GAG TCA CTT AOG CTC Gl'l' GAr GTT 159 Cys Trp Ala Gln Pro Ser Leu Leu Glu Ser Leu Thr Leu Val Asp Val . -40 -35 -30 GAC GCA CIG TCG GAr ~IT G~r GrA CTT GqT GAG TCT GAA AOG CIr GrG 207 :~ Asp Ala Leu Ser Asp Ile Asp Val Ieu Val Glu Ser Glu l'hr Leu Val ; CTT GTC GAT AAC ACC ACT TTG GCT AAG AG~ TTC GTT AAC CAA CAC TTG 255 ~''A, Leu Val Asp Asn Thr Thr Leu Ala Lys Arg Phe Val Asn Gln His Leu .;
TGC GGT TCC CA~ TIG GTT GAA ~ TTG TAC TTG GTT TGC GG~ GAA A~A 303 :, Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Axg ~ 10 15 20 -A GGT TTC TIC TAC ACT ccr A~G GCT GCT AhG GGT ATT GIC GAA CAA TGC 351 Gly Phe Fhe Tyr Thr Pro Lys Ala Ala Lys ~ly Ile Val Glu Gln Cys ~:~' 25 30 35 :............... TGT ACC TCC ATC TGC TCC TTG TAC C~A TIG GAA AAC TAC TGC AAC 396 . Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn :. . 40 45 50 ~ TAGACGCAGC CCGC~GGCrC TAGA 420 . ~ .
~ (2) INFORMATION FOR SEQ ID NO:5:
'-`. (i) SEX~ CTERISTICS:
~ (A) LENGTH: 107 am m o acids : (B) TYPE: amino acid D) TOPOLCGY: linear ~ :
. .
.. ~
.... .
~ , , ,., ~
~VO 92/ll378 PCT/DK9l~00396 ~ ~ n (3 7 j 1 ~ ~LL~ULE TYPE: prote m (Xl) SEÇUENCE DESCRIPTION: SEO ID NO:5:
Met Lys Val Phe L_u Lu Leu Ser Leu Ile Gly Phe Cys Trp Ala Gln - -5~ -50 -45 -40 Pro Ser Leu Leu Glu S~r Leu Thr Leu Val Asp Val Asp Ala Leu Ser . -35 -30 -25 Asp Ile Asp Val Leu Val Glu Ser Glu Thr Leu Val L_u Val Asp Asn Thr Thr Leu Ala Lys Arg Phe Val Asn Gln His Leu Cys Gly Ser His -5 1 5 lO
Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Ty.r ` Thr Pro L~s Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser keu Tyr Gln Leu Glu Asn Tyr Cys Asn ~`, 45 50 (2) INFORMATION FOR SEO ID NO:6:
(i) SEQUENOE C~RA~ERISIICS:
(A) LENGTH: 453 base pairs (B~ TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLCGY: linear , . .
(ii) MoT~0LE TY~: cDNA
. . . ~
(lx) FEATURE:
;~ (A) N~ME/KEY: CDS -(B) L~C~IIGN: 76..420 (ix) FE~:
.. (A) N~ME/KEY: sig_peptide .
(B) LOCATION: 76..270 (lx) FEATURE:
- (A) NAME/KEY: mat_peptide (B) LOCATION: 271.. 420 .
(xi) SEQVENCE DESCRIPTION: SEQ ID NO:6:
GAATICATTC AAGAATAGTT CAAACAAGA~ GAIIACAAAC IP~CaPIqlC A~ACACAAT~ 60 ~ TAA~CGAITA A~AGA ATG AAA GTC TTC CTG CIG CTT TCC CTC ATT GGA TTC lll .::~ Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly Phe ~ -65 -60 -55 .;
. 's :: ~
. . .~. , .
. . !
' ' ', '' " '' ' ' ' ' ' w o 92~11378 PCT/DK91/003g6 q~ 3 3rl ~ ~ 24 GC T~G GCC CAA cc~ ATA GAC ACA AGA AAA GAA GGA CIA CAG CAT GAT l59 ~ Cys Trp Ala Gln Pro Ile Asp Thr Arg Lys Glu Gly Leu Gln His A~p : -50 -~5 -40 '~C GAT ACA GAA AIT rrTG GAG CAC AIT GGA AGC GAr GAG 'ITA ACC CCG 207 Tyr Asp Thr Glu Ile TPU Glu H~s Ile Gly Ser Asp Glu Leu Thr Pro AAr GAA GAG TAT GIT ATT GAA AGA ACT TI~, CAA GCC ATC GAT AAC ACC 255 Asn Glu Glu Tyr Val Ile Glu Ar~ rrhr Leu Gln Pla Ile Asp Asn Thr . -20 -15 -lO
: ~CT TTG GCT A~. AGA TTC GTT AAC CAA CAC ~rG TGC GGT ~rcc CAC TTG 303 :: ~ Thr Leu Ala Lys Ary Phe Val Asn Gln His Leu Cys Gly Ser His Leu -5 l 5 lO
GTT GAA GCT TTG ~r~c TrG GTT TGC GGT GA~ AGA GGT ~rr~ ITC TAC ACT 351 ~:. Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly E~e ~e l~rr Thr ~". CCI AAG GCT GCT AAG GGT All GTC G~A C~ C T~ ACC l~:C AI~ ~C 399 Pro Lys Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys `:: TCC TI~ IrAC CAA TI~ G~ AAC TACT~ACT AGACGCAGCC O~GGCI~ 450 .: Ser Leu Tyr Gln ~eu Glu Asn (2) ~FORM~lION F~R SEQ ID NO:7:
. .
` ~. (i) SEQIJ~CE ~RAcTERI~I~lcs:
(A) LENGTH: 115 am~no acids ~:. (B) I~: am~no acid ~ ~ (D) IOPO~GY: linear ;-:.............. (ii) ~IEa~LE TY~: protein : .
(xi) S~QI~ICE Dl~SCP~PlION: SEQ ID NO:7:
~ Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly l~e Cys Trp Ala Gln Pro Ile Asp Ihr Arg Lys Glu Gly Leu Gln His Asp ~r Asp Thr Glu
origin prepared by annealing fragments of synthetic, genomic ~`~ or cDNA origin (as appropriate), the fragments corresponding to various parts of the entire DNA sequence, in accordance with ~-~ standard techniques. Thus, it may be envisaged that the DNA
sequence encoding the signal peptide or the heterologous ~; polypeptide may be of genomic or cDNA origin, while the ~ sequence Xn-3'-RS-5'-Xm-(N~T) -X -PS may be prepared ;~ 30 synthetically.
.~ `,!
Preferred DNA constructs encoding insulin precursors are as shown in Sequence Listings ID Nos. 1-13, or suitable modifica-`, tions thereof. Examples of suitable modifications of the DNA-3 35 sequence are nucleotide substitutions which do not give rise to another amino acid sequence of the protein, but which may correspond to the codon usage of the yeast organism into which ,. ~'' ' :
:
` r '.. .~ ' ~ . ~ :
WO9Z/I1378 PCT/D~91/00396 ~, n ~) ,,(,~ 7 3 1 the DNA construct is inserted or nucleotide substitutions which do give rise to a different amino acid sequence and therefore, possibly, a different protein structure~ Other examples of possible modifications are insertion of three ar multiples of three nucleotides into the sequence, addition of three or multiples of three nucleotides at either end of the sequence and deletion of three or multiples of three nucleotides at either end of or within the sequence.
The recombinant expression vector carrying the sequence 5'-SP-Xn-3'-RS-5'-Xm-(NZT)p-Xq-ps-*gene*-3~ or 5'-SP-Xn-ranDNA-Xm-(NZT)p-Xq-PS-*gene*-3' may be any vector which is capable of replicating in yeast organisms. In the vector, either DNA
sequence should be operably connected to a suitable promoter sequence. The promoter may be any DNA sequence which shows transcriptional activity in yeast and may be derived from genes encoding proteins either homologous or heterologous to yeast.
.,.'! The promoter is preferably derived from a gene encoding a ~, protein homologous to yeast. Examples of suitable promoters are ~ 20 the Saccharomyces cerevisiae MF~l, TPI, ADH or PGK promoters. ~
.,.~ .;.
i~` The sequences shown above should also be operably connected to ' a suitable terminator, e.g. the TPI terminator (cf. T. Alber : and G. Kawasaki, J._Mol. Ap~l. Gene*. 1, 1982, pp. 419-434).
The recombinant expression vector of the invention further ;. comprises a DNA sequence enabling the vector to replicate in yeast. Examples of such sequences are the yeast plasmid 2~
~:i replication genes REP 1-3 and origin of replication. The vector may also comprise a selectable marker, e.g. the Schizo-:
saccharomvces pombe TPI gene as described by P.R. Russell, Gene 40, 1985, pp. 125-130.
The procedures used to ligate the sequence 5'-SP-Xn-3'-RS-5'-Xm-(NZT)p-Xq-PS-*gene*-3', the random DNA fragment, the promoter and the terminator, respectively, and to insert them into suitable yeast vectors containing the information necessary for .. .. .
:, .
~:
WOg2/ll378 PCT/DK9t/00396 S ` 12 .
`~ yeast replication, are well known to persons skilled in the art (cf., for instance, Sambrook, Fritsch and Maniakis, oP~cit.).
It will be understood that the vector may be constructed either by first preparing a DNA construct containing the entire - 5 sequence 5 1 -SP-Xn-3 1 -RS-5 1 ~Xm~ (NZT) p-Xq-PS-*gene*-3~ and subsequently inserting this fragment into a suitable expression vector, or by sequentially inserting DNA fragments containing genetic information for the individual elements (such as the signal peptide, the sequence Xn-3'-RS-5'-Xm- (NZT) p~Xq or the lo heterologous polypeptide) follow2d by ligation.
'' The yeast organism used in the method of the invention may be any suitable yeast organism which, on cultivation, produces large amounts of the heterologous polypeptide in question.
15 Examples of suitable yeast organisms may be strains of the yeast species Saccharomyces cerevisiae, Sacch _ mYces kluyverl, Schizosaccharomvces Pombe or Saccharomvces uvarum. The transformation of the yeast cells may for instance be effected ~ by protoplast formation followed by transformation in a manner S,~ 20 known per se. The medium used to cultivate the cells may be any conventional medium suitable for growing yeast organisms. The secreted heterologous protein, a significant proportion of which will be present in the medium in correctly processed form, may be recovered from the medium by conventional pro-? 2~ cedures including separating the yeast cells ~rom the medium ~-' by centrifugation or filtration, precipitating the protein-.~, aceous components of the supernatant or filtrate by means of `. a salt, e.g. ammonium sulphate, followed by purification by a variety of chromatographic procedures, e.g. ion exchange 30 chromatography, affinity chromatography, or the like.
:, -BRIEF DESCRIPTION OF THE DRAWINGS
. :
The present invention is further illustrated with reference to ~ 35 the appended drawings wherein ;~ Fig. 1 schematically shows the construction of pMT742~; -.:
,: -"
.:
, .:
WO92/ll378 PCT/DK91/00396 2 0 9 . ~ 3 Fig. 2 schematically shows the construction of pLaC202;
, Fig. 3 shows the DNA sequence and derived amino acid sequence at the cloning site in pLaC202 for random DNA fragments (it should be noted that the sequence is cleaved in the unique ClaI
site and that ligation without insertion of r~ndom DN~ will lead to a change in the reading frame);
Fig. 4 schematically shows the construction of pLSC6315DX;
: 10 The invention is further described in the following examples which are not to be construed as limiting the scope of the invention as claimedO
..
; EXAMPLES
``. ` ;':
; Plasmids and DNA materials All expression plasmids are of the C-POT type. Such plasmids are described in EP patent application No. 171 142 and are characterized in containing the SchizosaccharomYces pombe triose phosphate isomerase gene (POT) for the purpose of plasmid selection and stabilization. A plasmid containing the POT-gene is available from a deposited E. coli strain (ATCC
39685)~ The plasmids furthermore contain the S. cerevisiae ~ triose phosphate isomerase promoter and terminator (PTp~and ., TTPI). They are identical to pMT742 (M. Egel-Mitani et al., Gene 73, 1988, pp. 113-120) (see fig. 1) except for the region defined by the Sph-XbaI restriction sites encompassing the PTPI
and the coding region for signal/leader/product.
' The PTPI has been modified with respect to the sequence found in pMT742, only in order to facilitate construction work. An internal SphI restriction site has been eliminated by SphI
cleavage, removel of single stranded tails and religation.
~ Furthermore, DNA sequences, upstream to and without any impact '', -WO92/ll378 PCT/DK91/00396 ~rl~ ~ 14 ; on the promoter, have be~n ramoved by Bal3~ exonuclease treatment followed by ad~i~ion of an SphI restriction site linker. This promoter construction present on a 373 bp SphI-EcoRI fragment is designated PTPI~ and when used in plasmids already described this promoter modification is indicated by the addition of a ~ to the plasmid name, e.g. pMT742~ (fig. 1).
`:~
`` The assembly of various DNA fragments have occasionally taken place in a smaller E. coli plasmid of the pT7 type previously 10 described ~cf. W0 89/02463) only modified with respect to the PTPI as described above, i.e. pT7~. For random cloning described ; below, genomic DNA of various origins have been employed. S.
cerevisiae DNA was isolated ~rom strain MT633 (deposited on 7 December 1990 in the ~eutsche Sammlung von Mikroorganismen und Zellkulturen under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure with the deposit number DSM
6278). A. oryzae DNA was isolated from strain A1560 (IF0 4177).
,.;;,.
`~i 20 -., Finally a number of synthetic DNA fragments have been employed ~:~ all of which were synthesized on an automatic DNA synthesizer i (Applied Biosystems model 380A) using phosphoramidite chemistry and commercially available reagents (S.L. Beaucage and M.H.
25 Caruthers (1981) Tetrahedron Letters 22, 1859-1869). The oligonucleotides were- purified by polyacrylamide gel `~ electrophoresis under denaturing conditions. Prior to annealing ~ complementary pairs of such DNA single strands these were ;i kinased by T4 polynucleotide kinase and ATP.
`^ 30 All other methods and materials used are common state of the art knowledge (J. Sambrook et al., Molecular Cloning, A
Laboratory Manual, Cold Spring Harbor Laboratory Press) Cold Spring Harbor, N.Y. 1989).
` 35 .... .
, : j :
,, ~ .
:
....
WOg~ 378 PCT/DK91/0039fi ~ o n -3 ~J ~
xample 1 Construction of PLac2o2 The 490 bp SphI-ApaI of pT7 196~ ~cf. WO 89/02463, fig. 5) and the 179 bp HinfI-XbaI fragment of pT7.~MI3 (cf. WO 89/02~63, fig. 1) joined in the 11 kb XbaI-SphI fragment of pMT742 via ; the synthetic adaptor: ;
":
NOR367/373: CAACCATCGATAACACCACTTTGGCTAAGAG
CCGGGTTGGTAGCTATTGTGGTGAAACCGATTCTCTAA
'::
resulting in the plasmid pLaC202 (fig. 2 and 3 as well as Sequence Listing ID No. 1).
This vector containing a unique ClaI site constitutes one embodiment of the random DNA cloning vector in which the `~ product gene codes for the insulin precursor MI3 (B(1-29)-Ala-~ Ala-Lys-A(1-21)). The following examples concerns the leaders `~ 20 cloned via this construct.
`~i ExamPle 2 . ...
: .., i 25 Construction of ~LSC6315 and pLSC5210 "... ~ .
Total DNA was isolated from S. cerevisiae strain MT663, and digested by TaqI, HinPI or TaqI + HinP I. The digests were separated according to size on a 1% agarose gel, and fragments ` 30 smaller than 600 bp were isolated from each of the three . digestions.
:~
., pLaC202, previously digested with ClaI, prevented from self ligation with Calf Intestine Alkaline Phosphatase (CIAP), dephosphorylation, was mixed with the fragment pools described above and ligated. E. coli strain MT172 (MT172 = MC 1000 m r~
ara~ leuB-6; MC 1000 (cf. M. Casadaban and S. Cohen, ., p : .. .
~. - .
~092~l137~ ~ PCTtDK91/003g6 ~S~I~?J ~
J.Mol.Biol. 138, 1980, p. 179)) was transformed with above ligation mixture, and appr. S000 ApR transformants for each mixture were o~tained. Recombinant plasmids were prepared from each of the three types in pools encompassing all 5000 transformants. These plasmid pools were used to transform S.
cerevisiae strain MT663 and the resulting TPI transformants were immunoscreened for MI3 secretion.
Among the surprisingly large number of posltive transformants the eight apparently most efficient w~re reisolated and the plasmid content isolated therefrom.
:
As a result of ~his procedure, it is expected that most of the - yeast transformant obtalned have a heterogeneous population of plasmids and to obtain true clones, a step of plasmid reisolation was therefore performed. The plasmid preparations from each of the eight reisolated yeast transformants were used to transform E. coli strain MTl72 to ApR. Plasmids from 12 E.
~`- coli transformants for each of the eight yeast isolates, were individually used to transform yeast strain MT663, TPI, and MI3 secreting transformants were identified by immunoscreening.
~ Sequencing of the inserts of the eight isolated pLaC202 ; derivatives showed three different sequences, two of which, : - 25 pLSC6315 and pLSC5210, most efficiently support MI3 secretion.
The sequences of the cloned DNA and flanking regions are shown in Sequence Listings ID Nos. 2 and 4, respectively.
: ,;
: :-~
;- 30 Exam~le 3 . . .
, ......
.~ Modifications of PLSC6315 ::
;:~
~' pL5C6315 was chosen for further modification of the cloned 35 synthetic leader sequence.
'"' ~. pLSC6315 was digested with the ApaI endonuclease followed by .-,!
.:,-' .
:-,:,:
:i ... .
WO9~11378 PCT/DK91/00396 20n~7,~.1 treatment with the exonuclease Bal31. After phenol extraction the resulting DNA was digested with XbaI and DNA fragments smaller than the original 367 bp ApaI-XhaI fragment, were isolated.
pLaC202 was digested with ClaI, and the single stranded CG
tails generated were removed, followed by XbaI digestlon and " isolation of the 11 Kb XbaI-]ClaI~ fragment ("] [" indicates ; that the single-stranded t~ils have been trimmed off). This fragment was mixed with the pLSC6415 fragments isolated above and ligated (fig. 6).
The transformation and screening procedure described in example 2 was repeated, and pLSC6315D3 and pLSC6315D7 were isolated as plasmids supporting MI3 secretion more efficiently than the original pLSC6315 (cf. Sequence Listings ID Nos. 6 and 8, respectively).
.:!
.~....
Exam~le 4 : . ~ Construction of PLAOl - 5 :,, Total DNA from AsPerqillus or~zae strain A1560 was treated as - 25 previously described for S. cerevisiae DNA in example 2, and ..... ~ .
; cloning and recloning was performed exactly as described in . example 2, except that the number of E. coli transformants in the first cloning was reduced to approximately 3000 per :J, ligation mixture. This experiment resulted in the isolation of ` 30 five clones of A. orvzae DNA which in the pLaC202 context mediates secretion of the insulin precursor MI3, from S.
. . .
,!, cerevl~slae.
Sequencing of the inserts showed 5 different sequences, two of -~
which (pLAO2 and pLAO5) are more efficient where MI3 secretion is concerned. The sequences of the DNA inserts in pLAO2 and ~ pLAO5 are shown, together with the flanking regions, in ',A.
'' :
"s . ; .. . . . . . . .. . . . . . . . .
WO92/ll37X PCT/DK91/00396 ~rv~3s~ 3 ~ 18 sequence Listings ID Nos. lo and 12, respectively.
`: :
Example 5 :` :
Yeast strains harbouring plasmids as described above, were grown in YPD medium (Sherman, F. et al., Methods in Yeas~
Genetics, Cold Spring Harbor Laboratory 1981). For each strain 6 individual 5 ml cultures were shaken at 30C for 60 hours, with a final OD600 of approx. 15. After centrifugation the supernatant was removed for HPLC analysis by which method the concentration of secreted insulin precursor was measured by a method described by Leo Snel et al. (1987) Chromatographia 24, ~ 329-332.
., In table I the expression levels of insulin precursor, MI3, by ~` use of leader sequences isolated according to the present -` invention, are given as a percentage of the level obtained with ~ transformants of pMT7~2~, utilizing the MF~(1) leader o~ S.
'`:'iJ cerevisiae.
` Table I
pMI'742 100~
";;Ji 25 pLSC6315 100%
pLSC5210 60%
pLSC6315D3 175%
pLSC6315D7 120%
pLA02 120%
~` 30 pLAO5 60%
:
., ~
: .
.
''- .
:.
r Wo 92/1~378 PC~/DK~1/00396 2 ~ J ~ 7 3 ~
SEQUENCE LISTING
( 1 ) GENERAL INFORMATION:
` (i) APPLICANT: Novo Nordisk A/S
(ii) TITLE OF INVENTION: A Method of Constructing Synthetic Leader Sequences (iii) NUMBER OF SEQUENCES: 13 -: ( iv) CORF~ESPONDENCE ADDRESS:
(A) ADDRESSEE: Novo Nordisk A/S, Patent Department ; (B) STREET: Novo Alle ~ (C) CITY: Bagsvaerd :~` (E) COUNTRY: Denmark (F) ZIP: DK-2880 (v) COMPUTER READABLE FORM:
. (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Releas2 #1.0, Version #1.25 :. (vi) CURRENT APPLICATION DATA: ~--c~ (A) APPLICATION NUMBER:
. (B) FILING DATE: -(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATXON:
:~i (A) NAME: Thalsoe-Madsen, Birgit (C) REFERENCE/DOCKET NUMBER: 3540.204-WO
., .. ~. . .
i.~. (ix) TELECOMMUNICATION INFORMATION~
.~ (A) TELEPHONE: +45 4444 8888 (B) TELEFAX: +45 4449 3256 (C) TELEX: 37304 , ' , .~
' (2) INFORMATION FOR SEQ ID NO:l:
. .
(i) SEQUENCE CHARACTERISTICS:
~' (A) LENGTH: 335 base pairs (B) TYPE: nucleic acid :. (C) STRANDEDNESS: single . (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
, . ,j , : (xi) SEQUENCE DESCRIPTqON: SEQ ID NO:l: ~:
~i Ga~FKY~I~ AA~ T CA~ACA~GAA GATTAC~AAC TATCAATITC AIACAC~ATA 60 . ~ .
TA~AC~ATTA A~AT&AA AG~CFKX~G C~ CC TC~ATT CD3C~ 120 . ~ . . .
7~
WO 92/11378 PCr/VK91/00396 ~ 9~3~ 20 C~AC~ ~ACACCPCT TI~GCrAAGA GAl~GrrAA CC~ACACr~ ~ 180 ` ~ AC~A A~AC T~TI~ ~AGG TII~AC AC~G 240 c~crhAGGG ~7sOE~A C~5~R CC~c~ C~I~AC C~A 300 ACrACIr;CPA CrA~CGCA~ r~ 335 . :. -.
( 2 ) INFORM~ION FOR SE)Q ID N0: 2:
(i~ SEX2~TCE ~RACrERIST~CS:
(A) LE:~: 492 base pairs (B) TY~: nucleic acid (C) SrRANDElX~ESS: single (D) ~POL~: linear '' (ix) ~E:
~ (A) NP~/~CEY: CDS
: (B) ~)CAlICN: 76... 468 : ~ (ix) P~:
(A) N~ME/XEY: sig_peptide : (B) LOCATION: 76... 309 (ix) ~æ:
(A) NAME/KEY: mat_peptide ~: (B) LOC~IION: 310.. .468 . (xi) SEQUENCE DESCRIPqION: SEQ ID N0:2:
, :~ GPAITCaIrC AAGAA~AGTT CAAACAAGAA GAIIACAA~C ~C~AIrTC AIACACAATA 60 :
:~ IAAACGATIA A~A~A AIG AAA GTC TTC CTG CTG CrT TCC crc ATT GGA TTC lll ~`............................. Met ~ys Val Phe Leu Leu Leu Ser Leu Ile Gly Ph~
:- -78 -75 -70 ;~ TGC TGG GCC CAA CCA TCG A~A GAT GGA ACA CAT TTT CCG AAC AAC AAT 159 ~ Cys Trp Ala Gln Pr~ Ser Ile Asp Gly Thr His Phe Pro Asn Asn Asn ; -65 -60 -5S
Val Pro Ile Asp Thr Arg Lys Glu Gly Leu Gln ~is Asp Tyr Asp Thr . -50 -45 -40 -35 :::
. Glu Ile Leu Glu His Ile Gly Ser Asp Glu Leu Ile Leu Asn Glu Glu ~~ -30 -25 -20 .: lAr GTT AIT GAA AGA ACT TTG CAA GCC ATC GA~ AAC ACC ACT TIG GCT 303 Tyr Val Ile Glu Arg Ihr Leu Gln Ala Ile Asp Asn Thr Thr Leu Ala . -15 -10 -5 AAG AG~ TTC GTT AAC CAA CAC TTG TGC GGT TCC CAC TTG GTT GAA GCT 351 :~ Lys Arg Phe Val Asn Gln His Leu Cys Gly Ser His TPU Val Glu Ala ,, .
., :, .
: .. ~.. -.. . - . .
. ~ . . ~ . ~ . . . . .. .
2 ~ ~ S 7~ 1 TTG TAC TTG GIr TGC GGT GP~ AG~ GGT TTC TTC IAC AC~ CCT AAG GCT 399 Leu Tyr keu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Ala GCT A~ GGT ATT GTC GAA CAA TGC TGT ACC TCC ATC TGC TCC TTG TAC 447 Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr CAA TTG GAA AAC TAC TGC AAC TAG~CGCAGC CY3C~EGCTC TAGA 492 :~ Gln Leu Glu Asn Tyr Cys Asn ' 50 .
: (2) INFO~M~TqON FOR SEQ ID NO:3, .~
(i) SEQUEN OE CH~RACTERISl~lCS:
-~ (A) LÆNGTH: 131 am m o acids (B) TYPE: amlno acid ~.
.~ (D) TOPOLCGY: linear (ii) MOLECULE TYPE: protein (xi) SE2UENCE DESCRIPTION: SEQ ID NO:3:
. Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly Phe Cys Trp Ala Gln . -78 -75 -70 -65 .,:'!, Pro Ser Ile Asp Gly Thr His Phe Pro Asn Asn Asn Val Pro Ile Asp , -60 -55 ~50 `~ m r Arg Lys Glu Gly Leu Gln His Asp Iyr Asp Thr Glu Ile Leu Glu ~40 35 . His Ile Gly Ser Asp Glu Leu Ile Leu Asn Glu Glu Tyr Val Ile Glu ~
.$ -30 -25 -20 -15 - .
:~ Arg Thr Leu Gln Ala Ile Asp Asn Thr Thr Leu Ala Lys Arg Phe Val ~ 10 -5 : r, , Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val ' :;. Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Ala Ala Lys Gly Ile .. 20 25 30 ., Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn ' 35 40 45 50 Tyr Cys Asn ~ .
(2) INFORM~IION FOR SEQ ID NO:4: .;
. . (i) SEQUENCE CHARACTERI~llCS:
- (A) LENGTH: 420 kase paLrs .i (B) IYPE: nucleic acid :< (C) STRANDEDNESS: single : --~ (D) I~POLOGY: linear ; .
'~. :
, , , :
wo 92/11378 pcr/D~s1/oo3s6 '13~ 22 (ii) ~OL~:CUIE TYPE: cDNA
( ix~ F~UEæ:
(A) N~IE/KEY: cr~;
(B) L~TI~: 76. . 396 ( lX) FE~:
(A) NAME/KEY: sig peptide (B) ~CATION: 76. . 237 . (ix) F~E:
(A) NAME/KE~Y: mat_peptide (B) ~lION: 238 . . 396 (xi) S~CE DESCRIPrION: SEQ ID NO:4:
:~; G~ATIC~ AAG~A~T C~A~C~A GAITACA~AC TATCA~ITC AT~CACAA~A 60 . ~ Met Lys Val ~e L~3u ~u Leu Ser Leu Ile Gly l~e : --54 --50 --45 . ~
::` TGC IGG GCC CAA CCA TCG CTA TIG GAG TCA CTT AOG CTC Gl'l' GAr GTT 159 Cys Trp Ala Gln Pro Ser Leu Leu Glu Ser Leu Thr Leu Val Asp Val . -40 -35 -30 GAC GCA CIG TCG GAr ~IT G~r GrA CTT GqT GAG TCT GAA AOG CIr GrG 207 :~ Asp Ala Leu Ser Asp Ile Asp Val Ieu Val Glu Ser Glu l'hr Leu Val ; CTT GTC GAT AAC ACC ACT TTG GCT AAG AG~ TTC GTT AAC CAA CAC TTG 255 ~''A, Leu Val Asp Asn Thr Thr Leu Ala Lys Arg Phe Val Asn Gln His Leu .;
TGC GGT TCC CA~ TIG GTT GAA ~ TTG TAC TTG GTT TGC GG~ GAA A~A 303 :, Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Axg ~ 10 15 20 -A GGT TTC TIC TAC ACT ccr A~G GCT GCT AhG GGT ATT GIC GAA CAA TGC 351 Gly Phe Fhe Tyr Thr Pro Lys Ala Ala Lys ~ly Ile Val Glu Gln Cys ~:~' 25 30 35 :............... TGT ACC TCC ATC TGC TCC TTG TAC C~A TIG GAA AAC TAC TGC AAC 396 . Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn :. . 40 45 50 ~ TAGACGCAGC CCGC~GGCrC TAGA 420 . ~ .
~ (2) INFORMATION FOR SEQ ID NO:5:
'-`. (i) SEX~ CTERISTICS:
~ (A) LENGTH: 107 am m o acids : (B) TYPE: amino acid D) TOPOLCGY: linear ~ :
. .
.. ~
.... .
~ , , ,., ~
~VO 92/ll378 PCT/DK9l~00396 ~ ~ n (3 7 j 1 ~ ~LL~ULE TYPE: prote m (Xl) SEÇUENCE DESCRIPTION: SEO ID NO:5:
Met Lys Val Phe L_u Lu Leu Ser Leu Ile Gly Phe Cys Trp Ala Gln - -5~ -50 -45 -40 Pro Ser Leu Leu Glu S~r Leu Thr Leu Val Asp Val Asp Ala Leu Ser . -35 -30 -25 Asp Ile Asp Val Leu Val Glu Ser Glu Thr Leu Val L_u Val Asp Asn Thr Thr Leu Ala Lys Arg Phe Val Asn Gln His Leu Cys Gly Ser His -5 1 5 lO
Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Ty.r ` Thr Pro L~s Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser keu Tyr Gln Leu Glu Asn Tyr Cys Asn ~`, 45 50 (2) INFORMATION FOR SEO ID NO:6:
(i) SEQUENOE C~RA~ERISIICS:
(A) LENGTH: 453 base pairs (B~ TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLCGY: linear , . .
(ii) MoT~0LE TY~: cDNA
. . . ~
(lx) FEATURE:
;~ (A) N~ME/KEY: CDS -(B) L~C~IIGN: 76..420 (ix) FE~:
.. (A) N~ME/KEY: sig_peptide .
(B) LOCATION: 76..270 (lx) FEATURE:
- (A) NAME/KEY: mat_peptide (B) LOCATION: 271.. 420 .
(xi) SEQVENCE DESCRIPTION: SEQ ID NO:6:
GAATICATTC AAGAATAGTT CAAACAAGA~ GAIIACAAAC IP~CaPIqlC A~ACACAAT~ 60 ~ TAA~CGAITA A~AGA ATG AAA GTC TTC CTG CIG CTT TCC CTC ATT GGA TTC lll .::~ Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly Phe ~ -65 -60 -55 .;
. 's :: ~
. . .~. , .
. . !
' ' ', '' " '' ' ' ' ' ' w o 92~11378 PCT/DK91/003g6 q~ 3 3rl ~ ~ 24 GC T~G GCC CAA cc~ ATA GAC ACA AGA AAA GAA GGA CIA CAG CAT GAT l59 ~ Cys Trp Ala Gln Pro Ile Asp Thr Arg Lys Glu Gly Leu Gln His A~p : -50 -~5 -40 '~C GAT ACA GAA AIT rrTG GAG CAC AIT GGA AGC GAr GAG 'ITA ACC CCG 207 Tyr Asp Thr Glu Ile TPU Glu H~s Ile Gly Ser Asp Glu Leu Thr Pro AAr GAA GAG TAT GIT ATT GAA AGA ACT TI~, CAA GCC ATC GAT AAC ACC 255 Asn Glu Glu Tyr Val Ile Glu Ar~ rrhr Leu Gln Pla Ile Asp Asn Thr . -20 -15 -lO
: ~CT TTG GCT A~. AGA TTC GTT AAC CAA CAC ~rG TGC GGT ~rcc CAC TTG 303 :: ~ Thr Leu Ala Lys Ary Phe Val Asn Gln His Leu Cys Gly Ser His Leu -5 l 5 lO
GTT GAA GCT TTG ~r~c TrG GTT TGC GGT GA~ AGA GGT ~rr~ ITC TAC ACT 351 ~:. Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly E~e ~e l~rr Thr ~". CCI AAG GCT GCT AAG GGT All GTC G~A C~ C T~ ACC l~:C AI~ ~C 399 Pro Lys Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys `:: TCC TI~ IrAC CAA TI~ G~ AAC TACT~ACT AGACGCAGCC O~GGCI~ 450 .: Ser Leu Tyr Gln ~eu Glu Asn (2) ~FORM~lION F~R SEQ ID NO:7:
. .
` ~. (i) SEQIJ~CE ~RAcTERI~I~lcs:
(A) LENGTH: 115 am~no acids ~:. (B) I~: am~no acid ~ ~ (D) IOPO~GY: linear ;-:.............. (ii) ~IEa~LE TY~: protein : .
(xi) S~QI~ICE Dl~SCP~PlION: SEQ ID NO:7:
~ Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly l~e Cys Trp Ala Gln Pro Ile Asp Ihr Arg Lys Glu Gly Leu Gln His Asp ~r Asp Thr Glu
4 5 -4 0 --3 5 . :
Ile Leu Glu His Ile Gly Ser Asp Glu Leu l'hr Pro Asn Glu Glu l~r Val Ile Glu Arg qhr Leu Gln Ala Ile Asp Asn l'hr mr Leu Ala Lys . ~ -15 --10 --5 , ; Arg Phe Val Asn Gln His Leu Cys Gly Ser Hls Leu Val Glu Ala Leu , . ,~ ., . :.
:: .
:-i:~, ~: i ";;
~ "
, .
, , .~ . : , , : :
WO 92~11378 PCr/DK91/00396 2~9~t373l 25 l~r Leu Val Cys Gly Glu A~ Gly Phe Phe I~r Ihr ~ro IJYS Ala Ala ` 20 25 30 Lys Gly Ile Val Glu Gln Cys Cys Ihr Ser Ile Cys Ser Leu l~r Gln Leu Glu Asn . 50 .. .
(2) INFORMATqON FOR SEQ ID NO:8:
`` (i) S~\TCE C~PRACIERISlICS:
(A) ~: 459 base pa~rs (B) IYP~: nudeic acid : (C) S~ANDE~lESS: single D) IOPO~GS~: linear , ' (ii) MOLEC~E T~: c~NA , .
.
. .
(~x) ~E:
(A) N~ME/KEY: CDS
(B) L~CATION: 76..435 (lx) ~A~:
.; (A) N~ME/KEY: sig_peptide ``` (B) LDC~IION: 76... 276 :`', (ix) ~AIURE: '~.`.
: ~: (A) ~/KEY: mat_peptide ' (B) LDC~TION: 277.. 435 ' , (xi) SEQUENCE DESCRIPTION: SEO ID NO:8:
. :, .
. GAATICAITC A~AATAGTT C~AACAAGAA GAII~CAAAC IaIYa~IrIC ATACACAATA 60 .-;; lAAAOGAlrA AAAGA ATG AAA GTC TTC CTG CTG CIT TCC CTC A~T GGA TTC lll ~, . Met Lys Val Phe L~u Leu Leu Ser L~u Ile Gly Phe `. TGC TGG GCC C~A CCT GTC CCA ATA GAC ACA AGA AAA GAA GGA cr~ C~G 159 . Cys Trp Ala Gln Pro Val Pro Ile Asp Thr Arg Lys Glu Gly Leu Gln ~ ,r .
~,:', CAT GAr TAC GAT ACA GA~ ATT TTG GAG CAC ATT GGA AGC GA~ GAG TTA 207 .1 His Asp Tyr Asp Thr Glu Ile Leu Glu His Ile Gly Ser Asp Glu Leu , r -35 -30 -25 ACC CCG AAT GAA GAG IA~ GTT ATT GAA AGA ACT TTG CAA GCC AIC GAT 255 ~ Thr Pro Asn Glu Glu Tyr Val Ile Glu Arg Thr Leu Gln Ala Ile Asp i~ -20 -15 -lO
AAC ACC ACT TTG GCT AAG AGA Trc GIT AAC CAA CAC TT~ TGC GGT TCC 303 ~:
: Asn Thr Thr Leu Ala Lys Arg Phe Val Asn Gln His Leu Cys Gly Ser ~ -5 ~ 5 - .
.... , '~
.,, `.,,-''' .; ' ~ . . ' ' ' , , : ' ' ., .
"`,'. ~' ' . , . ', ' ' ' `.""".' ' ' ' ' ' ~ ' ~ ' . . . '''' 1 . ' ~ ' ' '''' ' ' "'. ' .' ' . ' '" : ' . ' , , '. , ,Q i 3 ~ 26 CAC TTG GIT G~A GCT 1~; TAC TTG Gl T TGC GGI` GAA AGA GGT TTC 11~ 351 His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe TAC A ~ CCT AAG G ~ GCr A ~ GGr ATT GTC GAA CAA I~C T~ ACC TCC 399 Tyr Thr Pro Lys Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser .~ 30 35 4U
. .
~TC TGC TCC TIG ~AC C~A T~G GAA AAC IAC TGC A~C TAPCGCAEC 445 :~ Ile Cys Ser Leu ~yr Gln Leu Glu Asn Tyr Cys Asn :, CC~C~EGCIC IAGA 459 (2) INFORMAIION FOR SEO ID NO:9:
:~ (i) SEQUENOE CHARACTEFI~FlCS: :
(A) LENC~I: 120 ~mino acids (B) TYPE: am m o acid ~ (D) TOPOLCGY: linear : (ii) ~LECULE TYPE: protein `. (xi) SEQUEN OE DESCRIPTION: SEO ID NO:9:
.~ Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly ~e Cy5 Trp Ala Gln ro Val ~ Ile Asp Thr Arg Lys Glu Gly Leu Gln His Asp l~r ~sp . ,`, .
. mr Glu Ile Leu Glu ~is Ile Gly Ser Asp Glu Leu Thr ~ro Asn Glu .. --35 --30 --25 --20 , " ~
;lu Tyr Val Ile Glu Ar~ mr Leu Gln Ala Ile Asp Asn Thr Thr Leu ..,~, .. ,: Ala Lys Arg F~e Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu 1 5 10 . Ala Leu l~r Leu Val Cys Gly Glu Arg Gly l~e F~e Tyr ~r ~o Lys ' 15 20 25 Ala Ala 1ys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu .;
Tyr Gln Leu Glu Asn l~r Cys Asn ::~ 50 ; (2) ~FO~.lION F~R SE:Q ID NO:10: ;
`.~, (i) SE~EN~ CH~ ERISlqCS: . '~'~
'. (A) LENGIH: 408 base pairs ~. (B) TY~: nucleic acid :. (C) SIR~ NESS: single (D) ~)po~: linear .~ (ii) MOT~CULE TY~: cDN~
., .
.:.-, . . . . . . . ` .
... .. -,: . .. : i , ,. , . : ," ~ - : ., W o 9~11378 PC~ 91/003~6 2u "3731 ` (A~ N~ME/KEY~ CDS
. (B) IOCATION: 76.. 384 :
' ' ~ (ix) ~IURE:
(A) N~ME/KEY: sig_peptide (B) ~0~'1: 76..225 :. (lX) E~IU~:
(A) N~ME ~ : mat_peptide (B) LDCAIqCN: 226..384 ., (xi) SEQUENCE ~SCRIPqION: SEQ ID NO:lO:
G~TTC~IIC AAGAA~GIT C~AACAAGAA GATTAC~AAC TATCAATTTC ATAC~CAATA 60 IAAAO~ATrA A~AGA ATG AAA GTC TTC CT~, CTG CTT TCC CTC ATT GGA TTC lll Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly Phe -50 -45 -40 :
.. . ..
TGC I~G GCC CAA CCA TCG AIC TTG GAr TA~ GTT GAC TTG GGT GCG G~A 159 Cys Trp Ala Gln Pro ser Ile Leu Asp Iyr Val Asp ~eu Gly Ala Glu -35 -30 -25 :.
i CqG ATC TCC AIr CGT GGG TA~ GAr AAC CTC AAC GAC GOG A~C GAr AAC 207 .~ Leu Ile Ser Ile Arg Gly Tyr Asp Asn Leu A~sn Asp Ala Ile Asp Asn . -20 -15 -10 ~. ACC ACT TTG GCT AAG AGA TTC GTT AAC CAA CAC TIG TGC GGT TCC CAC 255 .' Thr Thr Le~ Ala Lys Arg ~he Val Asn Gln His Leu Cys Gly Ser His :
TTG GTT GAA GCT TTG TAC TTG GTT TGC GGT GA~ AGA GGT TrC TTC TAC 303 ;~ Leu Val Glu Ala Leu I~r Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr ~-~ ACT CCT AAG GCT GCT AAG GGT AIT GTC GA~ CAA TGC TGT A ~ TCC ATC 351 ::~ Thr Pro Lys Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile ; 30 35 4Q
TGC TCC TTG TAC ChA TTG GAA AAC TAC TGC AAC TAGAOGCA~C COGCAGGCTC 404 .
:i Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn ~ 45 50 :~ , .~. IAGA 408 (2) INFORMAIION FOR SEQ ID NO:11:
....
::: (i) SEQUEN OE CH~RA~ KlsTIcs:
.; (A) TFNGqH: 103 amino acids (B) TYPE: amino acid ~:~, (D) TOPO~OGY: linear LECULE TYPE: protein , .,., ~ .
.-............................................... .
W O 92/11378 PCT/DK91tO0396 (xi) SEQUENCE DESCRIPTICN: SEQ ID N0~
Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly Phe Cys Trp Ala Gln : -50 -45 -40 -35 Pr~ Ser Ile TPU Asp Tyr Val Asp Leu Gly Ala Glu Leu Ile Ser Ile Arg Gly Tyr Asp Asn Leu Asn A~p Ala Ile Asp Asn Thr Thr Leu Ala `; Lys Arg Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pr~ Lys Ala ` 15 20 25 30 ` Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys 5er Leu Tyr :~ ~5 40 45 Gln Leu Glu Asn Tyr Cys Asn :~
.
(2) INFOR~IIOM FOR 5EQ ID NO:12:
~:' .:
~,i (A) ~ : 372 base pairs ;,. (B) TYPE: nucleic acid (C) SrRANDEr~SS: single ,' (D) ~PO~GY: linear ., (ix) F~æ:
. (A) NAME/KEY: CDS
'` (B) ~C~IION: 76... 348 (ix) FEATUgE:
.~, (A) NAME/XEY: sig_peptide ~ (B) L0CAIION: 76... 189 , :, (ix) FEATURE:
(A) NAME/KEY: mat_peptide ` `
(B) L0CAII~N: 190.. .348 ;~
~' (Xl) SEQUEN OE DESCRIPIION: SEO ID NO:12:
.
`N; G2~WrrCATTC PA~u~C~3Tr CAAACAAG~A Ci~rrACAAAC ~IY~4~rrrC AI~CACAAIA 60 : .-, q~AACGAllA AAAGA ATG A~A GTC TIC CI~ ~G CIT TCC CTC Aql~ GGA TTC 111 Met Lys Val Phe Leu Leu leu Ser Leu Ile Gly Phe :
C ~ GCC C~A CCP~ T~ CAC ACT ACC ATC GGC ACC GCA ACI GAC AAA 159 ys Trp Ala Gln l~ro Ser His Thr Thr Ile Gly Thr Ala ~r ~sp Lys : --25 --20 --15 '`''a ~
. ~.;' , , ~ .
WO 92/ l 1378 P~/DK91/00396 21~ n ~
AAC ~ GAI A~C ACC ACT 1~ GC~ A~ ACA :L~ GIT A~C C~ C~C I~ 207 Asn Ile Asp Asn Ihr Ihr Leu Ala Lys Ar~ Phe Val Asn G~n His I~u -10 5 ~ 5 T~C G~ TCC CAC IIG OET G~A GC~ qlG TAC 1~ GIT I~ GGr G~A A~ 255 Cys Gly Ser His Leu Val Glu Ala Leu l~r I,eu Val Cys Gly &lu Arg GGT l~C TTC TAC ACT CCT A~; GCr GCI AhG GGr All (~C G~A CAA I~C 303 Gly ~e }~e Tyr Thr ~ro Lys Ala Ala Lys Gly Ile Val Glu GJn (~ys TGT A~C TCC A~ TGC TCC TTG TAC CAA TTG GAA AAC ~AC TGC AAC 348 Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn l~r Cys Asn . ~ .
: TAGAOGCAGC COGCA3GCIC TAA 372 .`. (2) INFORM~IION FOR SEQ ID NO:13:
, ~ :.
-~ (i) SEQVENCE C~RACIERISTICS:
A) LENGTH: 91 am m o acids ' (B) TYPE: amlno acid : (D) TO~OLOGY: linear ~; (ii) M~LECULE TYPE~ prote m ;~ (xi) SEQUEN OE DESCRIPIION: SEQ ID NO:13:
Met Lys Val Phe ~eu Leu ~eu Ser Leu Ile Gly Phe Cys Trp Ala Gln .~ -38 -35 -30 -25 :~ Pro Ser His Thr Thr Ile Gly qhr Ala Thr Asp Lys Asn Ile Asp Asn ,ii Thr Thr Leu Ala Lys Arg Phe Val Asin Gln His Leu Cys Gly Ser His . -5 1 5 10 ~:
,.
~ Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Iyr ~ .
.. ~ 15 20 25 : ~ :
-~-' . Thr Pro Lys Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile : 30 35 40 :
.,; .
Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn .....
."~ :
: . .?
. ',';
~' ;~ , : .
.:-:,''. :' ~ ' ' - ` :: ', .. `
:':: , . -:' : . . :
, -:.: , . . ::.
:, ' ~
. , , , - ~ . .
WO 92~11378 r ~) PCr/DK91/00396 2 Q ~ 1 3 0 4 ~ 3 ~ ~t 1~ ~ t ~ b~ U~ O~
_ _ __ _ ._ _ ~ ~,td~7~
. DSM Deutsche Sammlung von Mikroorganismen und Zellkulturen -. ~ _ ~ _.
~ r~ 71 ~4~.7 ~ 0~ _ r~ ~ e~
~ Mascheroder Weg lB
.:~ D-33DO Braunschweig ~; ¦ Ac~t ~_ ~ ~~
7 December 1990 DSM 6278 :' _ _ ~ ~
In respect of those designations in which a European ~; patent i5 sought, a sample of the deposited microorga--~ nism will be made available until the publication of ~. the mention of the grant of the European patent or untll .:. the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the ~` issue of such a sample to an expert nominated by the : person requesting the sample (Rule 28(4) EPC).
; .
,.,,~ _ . .
.~ . ':''', . ." ~'"~':"'' -. .
.;~
U. ~ ARAr11 ~un~ CA~t~ ~7o Uu~lt 11~ r~Uc-~
Tt .r~Clc~ to~ h~tr~ t~ .,ll ~ s~lt7r~Rtr~ 9 ~lltto~l ~rrltt~ l~r t (~ ~ ~I r~ d 1?~ I~Stc4Uon7 ~.
Acr~7~on ~ te r ol Dr.~907~1-'l : ' ~ :
~ E~ T~ ~ ~ 7r~ O~ DDUtal~Or~ r~ hl~ t~o >- t~lcl~ b~ 7 r~ 01~
~,, /~' fi) . :,., .. ~. ._. .. ~q _______ . _ -; 'i tA~o~ 0~/ ~
.~ O T~ --`7 ~ rrK~ r~ r~ or~ l ~UrW~ . .
,.,~ ~
:~ ~ _______ _. _.. ___________ _ ___ .~
,~ ~ '~ ~
.S ~ I~ u~ 1~) . J
''`~
Ile Leu Glu His Ile Gly Ser Asp Glu Leu l'hr Pro Asn Glu Glu l~r Val Ile Glu Arg qhr Leu Gln Ala Ile Asp Asn l'hr mr Leu Ala Lys . ~ -15 --10 --5 , ; Arg Phe Val Asn Gln His Leu Cys Gly Ser Hls Leu Val Glu Ala Leu , . ,~ ., . :.
:: .
:-i:~, ~: i ";;
~ "
, .
, , .~ . : , , : :
WO 92~11378 PCr/DK91/00396 2~9~t373l 25 l~r Leu Val Cys Gly Glu A~ Gly Phe Phe I~r Ihr ~ro IJYS Ala Ala ` 20 25 30 Lys Gly Ile Val Glu Gln Cys Cys Ihr Ser Ile Cys Ser Leu l~r Gln Leu Glu Asn . 50 .. .
(2) INFORMATqON FOR SEQ ID NO:8:
`` (i) S~\TCE C~PRACIERISlICS:
(A) ~: 459 base pa~rs (B) IYP~: nudeic acid : (C) S~ANDE~lESS: single D) IOPO~GS~: linear , ' (ii) MOLEC~E T~: c~NA , .
.
. .
(~x) ~E:
(A) N~ME/KEY: CDS
(B) L~CATION: 76..435 (lx) ~A~:
.; (A) N~ME/KEY: sig_peptide ``` (B) LDC~IION: 76... 276 :`', (ix) ~AIURE: '~.`.
: ~: (A) ~/KEY: mat_peptide ' (B) LDC~TION: 277.. 435 ' , (xi) SEQUENCE DESCRIPTION: SEO ID NO:8:
. :, .
. GAATICAITC A~AATAGTT C~AACAAGAA GAII~CAAAC IaIYa~IrIC ATACACAATA 60 .-;; lAAAOGAlrA AAAGA ATG AAA GTC TTC CTG CTG CIT TCC CTC A~T GGA TTC lll ~, . Met Lys Val Phe L~u Leu Leu Ser L~u Ile Gly Phe `. TGC TGG GCC C~A CCT GTC CCA ATA GAC ACA AGA AAA GAA GGA cr~ C~G 159 . Cys Trp Ala Gln Pro Val Pro Ile Asp Thr Arg Lys Glu Gly Leu Gln ~ ,r .
~,:', CAT GAr TAC GAT ACA GA~ ATT TTG GAG CAC ATT GGA AGC GA~ GAG TTA 207 .1 His Asp Tyr Asp Thr Glu Ile Leu Glu His Ile Gly Ser Asp Glu Leu , r -35 -30 -25 ACC CCG AAT GAA GAG IA~ GTT ATT GAA AGA ACT TTG CAA GCC AIC GAT 255 ~ Thr Pro Asn Glu Glu Tyr Val Ile Glu Arg Thr Leu Gln Ala Ile Asp i~ -20 -15 -lO
AAC ACC ACT TTG GCT AAG AGA Trc GIT AAC CAA CAC TT~ TGC GGT TCC 303 ~:
: Asn Thr Thr Leu Ala Lys Arg Phe Val Asn Gln His Leu Cys Gly Ser ~ -5 ~ 5 - .
.... , '~
.,, `.,,-''' .; ' ~ . . ' ' ' , , : ' ' ., .
"`,'. ~' ' . , . ', ' ' ' `.""".' ' ' ' ' ' ~ ' ~ ' . . . '''' 1 . ' ~ ' ' '''' ' ' "'. ' .' ' . ' '" : ' . ' , , '. , ,Q i 3 ~ 26 CAC TTG GIT G~A GCT 1~; TAC TTG Gl T TGC GGI` GAA AGA GGT TTC 11~ 351 His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe TAC A ~ CCT AAG G ~ GCr A ~ GGr ATT GTC GAA CAA I~C T~ ACC TCC 399 Tyr Thr Pro Lys Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser .~ 30 35 4U
. .
~TC TGC TCC TIG ~AC C~A T~G GAA AAC IAC TGC A~C TAPCGCAEC 445 :~ Ile Cys Ser Leu ~yr Gln Leu Glu Asn Tyr Cys Asn :, CC~C~EGCIC IAGA 459 (2) INFORMAIION FOR SEO ID NO:9:
:~ (i) SEQUENOE CHARACTEFI~FlCS: :
(A) LENC~I: 120 ~mino acids (B) TYPE: am m o acid ~ (D) TOPOLCGY: linear : (ii) ~LECULE TYPE: protein `. (xi) SEQUEN OE DESCRIPTION: SEO ID NO:9:
.~ Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly ~e Cy5 Trp Ala Gln ro Val ~ Ile Asp Thr Arg Lys Glu Gly Leu Gln His Asp l~r ~sp . ,`, .
. mr Glu Ile Leu Glu ~is Ile Gly Ser Asp Glu Leu Thr ~ro Asn Glu .. --35 --30 --25 --20 , " ~
;lu Tyr Val Ile Glu Ar~ mr Leu Gln Ala Ile Asp Asn Thr Thr Leu ..,~, .. ,: Ala Lys Arg F~e Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu 1 5 10 . Ala Leu l~r Leu Val Cys Gly Glu Arg Gly l~e F~e Tyr ~r ~o Lys ' 15 20 25 Ala Ala 1ys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu .;
Tyr Gln Leu Glu Asn l~r Cys Asn ::~ 50 ; (2) ~FO~.lION F~R SE:Q ID NO:10: ;
`.~, (i) SE~EN~ CH~ ERISlqCS: . '~'~
'. (A) LENGIH: 408 base pairs ~. (B) TY~: nucleic acid :. (C) SIR~ NESS: single (D) ~)po~: linear .~ (ii) MOT~CULE TY~: cDN~
., .
.:.-, . . . . . . . ` .
... .. -,: . .. : i , ,. , . : ," ~ - : ., W o 9~11378 PC~ 91/003~6 2u "3731 ` (A~ N~ME/KEY~ CDS
. (B) IOCATION: 76.. 384 :
' ' ~ (ix) ~IURE:
(A) N~ME/KEY: sig_peptide (B) ~0~'1: 76..225 :. (lX) E~IU~:
(A) N~ME ~ : mat_peptide (B) LDCAIqCN: 226..384 ., (xi) SEQUENCE ~SCRIPqION: SEQ ID NO:lO:
G~TTC~IIC AAGAA~GIT C~AACAAGAA GATTAC~AAC TATCAATTTC ATAC~CAATA 60 IAAAO~ATrA A~AGA ATG AAA GTC TTC CT~, CTG CTT TCC CTC ATT GGA TTC lll Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly Phe -50 -45 -40 :
.. . ..
TGC I~G GCC CAA CCA TCG AIC TTG GAr TA~ GTT GAC TTG GGT GCG G~A 159 Cys Trp Ala Gln Pro ser Ile Leu Asp Iyr Val Asp ~eu Gly Ala Glu -35 -30 -25 :.
i CqG ATC TCC AIr CGT GGG TA~ GAr AAC CTC AAC GAC GOG A~C GAr AAC 207 .~ Leu Ile Ser Ile Arg Gly Tyr Asp Asn Leu A~sn Asp Ala Ile Asp Asn . -20 -15 -10 ~. ACC ACT TTG GCT AAG AGA TTC GTT AAC CAA CAC TIG TGC GGT TCC CAC 255 .' Thr Thr Le~ Ala Lys Arg ~he Val Asn Gln His Leu Cys Gly Ser His :
TTG GTT GAA GCT TTG TAC TTG GTT TGC GGT GA~ AGA GGT TrC TTC TAC 303 ;~ Leu Val Glu Ala Leu I~r Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr ~-~ ACT CCT AAG GCT GCT AAG GGT AIT GTC GA~ CAA TGC TGT A ~ TCC ATC 351 ::~ Thr Pro Lys Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile ; 30 35 4Q
TGC TCC TTG TAC ChA TTG GAA AAC TAC TGC AAC TAGAOGCA~C COGCAGGCTC 404 .
:i Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn ~ 45 50 :~ , .~. IAGA 408 (2) INFORMAIION FOR SEQ ID NO:11:
....
::: (i) SEQUEN OE CH~RA~ KlsTIcs:
.; (A) TFNGqH: 103 amino acids (B) TYPE: amino acid ~:~, (D) TOPO~OGY: linear LECULE TYPE: protein , .,., ~ .
.-............................................... .
W O 92/11378 PCT/DK91tO0396 (xi) SEQUENCE DESCRIPTICN: SEQ ID N0~
Met Lys Val Phe Leu Leu Leu Ser Leu Ile Gly Phe Cys Trp Ala Gln : -50 -45 -40 -35 Pr~ Ser Ile TPU Asp Tyr Val Asp Leu Gly Ala Glu Leu Ile Ser Ile Arg Gly Tyr Asp Asn Leu Asn A~p Ala Ile Asp Asn Thr Thr Leu Ala `; Lys Arg Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pr~ Lys Ala ` 15 20 25 30 ` Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys 5er Leu Tyr :~ ~5 40 45 Gln Leu Glu Asn Tyr Cys Asn :~
.
(2) INFOR~IIOM FOR 5EQ ID NO:12:
~:' .:
~,i (A) ~ : 372 base pairs ;,. (B) TYPE: nucleic acid (C) SrRANDEr~SS: single ,' (D) ~PO~GY: linear ., (ix) F~æ:
. (A) NAME/KEY: CDS
'` (B) ~C~IION: 76... 348 (ix) FEATUgE:
.~, (A) NAME/XEY: sig_peptide ~ (B) L0CAIION: 76... 189 , :, (ix) FEATURE:
(A) NAME/KEY: mat_peptide ` `
(B) L0CAII~N: 190.. .348 ;~
~' (Xl) SEQUEN OE DESCRIPIION: SEO ID NO:12:
.
`N; G2~WrrCATTC PA~u~C~3Tr CAAACAAG~A Ci~rrACAAAC ~IY~4~rrrC AI~CACAAIA 60 : .-, q~AACGAllA AAAGA ATG A~A GTC TIC CI~ ~G CIT TCC CTC Aql~ GGA TTC 111 Met Lys Val Phe Leu Leu leu Ser Leu Ile Gly Phe :
C ~ GCC C~A CCP~ T~ CAC ACT ACC ATC GGC ACC GCA ACI GAC AAA 159 ys Trp Ala Gln l~ro Ser His Thr Thr Ile Gly Thr Ala ~r ~sp Lys : --25 --20 --15 '`''a ~
. ~.;' , , ~ .
WO 92/ l 1378 P~/DK91/00396 21~ n ~
AAC ~ GAI A~C ACC ACT 1~ GC~ A~ ACA :L~ GIT A~C C~ C~C I~ 207 Asn Ile Asp Asn Ihr Ihr Leu Ala Lys Ar~ Phe Val Asn G~n His I~u -10 5 ~ 5 T~C G~ TCC CAC IIG OET G~A GC~ qlG TAC 1~ GIT I~ GGr G~A A~ 255 Cys Gly Ser His Leu Val Glu Ala Leu l~r I,eu Val Cys Gly &lu Arg GGT l~C TTC TAC ACT CCT A~; GCr GCI AhG GGr All (~C G~A CAA I~C 303 Gly ~e }~e Tyr Thr ~ro Lys Ala Ala Lys Gly Ile Val Glu GJn (~ys TGT A~C TCC A~ TGC TCC TTG TAC CAA TTG GAA AAC ~AC TGC AAC 348 Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn l~r Cys Asn . ~ .
: TAGAOGCAGC COGCA3GCIC TAA 372 .`. (2) INFORM~IION FOR SEQ ID NO:13:
, ~ :.
-~ (i) SEQVENCE C~RACIERISTICS:
A) LENGTH: 91 am m o acids ' (B) TYPE: amlno acid : (D) TO~OLOGY: linear ~; (ii) M~LECULE TYPE~ prote m ;~ (xi) SEQUEN OE DESCRIPIION: SEQ ID NO:13:
Met Lys Val Phe ~eu Leu ~eu Ser Leu Ile Gly Phe Cys Trp Ala Gln .~ -38 -35 -30 -25 :~ Pro Ser His Thr Thr Ile Gly qhr Ala Thr Asp Lys Asn Ile Asp Asn ,ii Thr Thr Leu Ala Lys Arg Phe Val Asin Gln His Leu Cys Gly Ser His . -5 1 5 10 ~:
,.
~ Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Iyr ~ .
.. ~ 15 20 25 : ~ :
-~-' . Thr Pro Lys Ala Ala Lys Gly Ile Val Glu Gln Cys Cys Thr Ser Ile : 30 35 40 :
.,; .
Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn .....
."~ :
: . .?
. ',';
~' ;~ , : .
.:-:,''. :' ~ ' ' - ` :: ', .. `
:':: , . -:' : . . :
, -:.: , . . ::.
:, ' ~
. , , , - ~ . .
WO 92~11378 r ~) PCr/DK91/00396 2 Q ~ 1 3 0 4 ~ 3 ~ ~t 1~ ~ t ~ b~ U~ O~
_ _ __ _ ._ _ ~ ~,td~7~
. DSM Deutsche Sammlung von Mikroorganismen und Zellkulturen -. ~ _ ~ _.
~ r~ 71 ~4~.7 ~ 0~ _ r~ ~ e~
~ Mascheroder Weg lB
.:~ D-33DO Braunschweig ~; ¦ Ac~t ~_ ~ ~~
7 December 1990 DSM 6278 :' _ _ ~ ~
In respect of those designations in which a European ~; patent i5 sought, a sample of the deposited microorga--~ nism will be made available until the publication of ~. the mention of the grant of the European patent or untll .:. the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the ~` issue of such a sample to an expert nominated by the : person requesting the sample (Rule 28(4) EPC).
; .
,.,,~ _ . .
.~ . ':''', . ." ~'"~':"'' -. .
.;~
U. ~ ARAr11 ~un~ CA~t~ ~7o Uu~lt 11~ r~Uc-~
Tt .r~Clc~ to~ h~tr~ t~ .,ll ~ s~lt7r~Rtr~ 9 ~lltto~l ~rrltt~ l~r t (~ ~ ~I r~ d 1?~ I~Stc4Uon7 ~.
Acr~7~on ~ te r ol Dr.~907~1-'l : ' ~ :
~ E~ T~ ~ ~ 7r~ O~ DDUtal~Or~ r~ hl~ t~o >- t~lcl~ b~ 7 r~ 01~
~,, /~' fi) . :,., .. ~. ._. .. ~q _______ . _ -; 'i tA~o~ 0~/ ~
.~ O T~ --`7 ~ rrK~ r~ r~ or~ l ~UrW~ . .
,.,~ ~
:~ ~ _______ _. _.. ___________ _ ___ .~
,~ ~ '~ ~
.S ~ I~ u~ 1~) . J
''`~
Claims (29)
1. A method of constructing a synthetic leader peptide sequence for secreting heterologous polypeptides in yeast, the method comprising (a) inserting a random DNA fragment into a yeast expression vector comprising the following sequence 5'-SP-Xn-3'-RS-5'-Xm-(NZT)p-Xq-PS-*gene*-3' wherein SP is a DNA sequence encoding a signal peptide, Xn is a DNA sequence encoding n amino acids, wherein n is 0 or an integer of from 1 to about 10 amino acids, RS is a restriction endonuclease recognition site for insertion of random DNA fragments, which site is provided at the junction of Xn and Xm, Xm is a DNA sequence encoding m amino acids, wherein m is 0 or an integer from 1 to about 10, (NZT)p is a DNA sequence encoding Asn-Xaa-Thr, wherein p is 0 or 1, Xq is a DNA sequence encoding q amino acids, wherein q is 0 or an integer from 1 to about 10, PS is a DNA sequence encoding a peptide defining a yeast processing site, and *gene* is a DNA sequence encoding a heterologous polypeptide;
(b) transforming a yeast host cell with the expression vector of step (a);
(c) culturing the transformed host cell of step (b) under appropriate conditions; and (d) screening the culture of step (c) for secretion of the heterologous polypeptide.
(b) transforming a yeast host cell with the expression vector of step (a);
(c) culturing the transformed host cell of step (b) under appropriate conditions; and (d) screening the culture of step (c) for secretion of the heterologous polypeptide.
2. A method according to claim 1, wherein the random DNA
fragment inserted in the vector is of genomic or synthetic origin.
fragment inserted in the vector is of genomic or synthetic origin.
3. A method according to claim 1 or 2, wherein the random DNA
fragment has a length of from 6 to about 600 base pairs.
fragment has a length of from 6 to about 600 base pairs.
4. A method according to any of claims 1-3, wherein the random DNA fragment encodes a high proportion of polar amino acids.
5. A method according to any of claims 1-4, wherein the random DNA fragment encodes at least one proline.
6. A method according to claim 1, wherein n and/or m and/or q are 21.
7. A method according to claim 1, wherein p is 1.
8. A method according to claim l, wherein SP is a DNA sequence encoding the .alpha.-factor signal peptide, the signal peptide of mouse salivary amylase, the carboxypeptidase signal peptide, the yeast BAR1 signal peptide, or the Humicola lanuginosa lipase signal peptide, or a derivative thereof.
9. A method according to claim 1, wherein PS is a DNA sequence encoding Lys-Arg, Arg-Lys, Lys-Lys, Arg-Arg or Ile-Glu-Gly-Arg.
10. A method according to claim 1, wherein the heterologous polypeptide is selected from the group consisting of aprotinin, tissue factor pathway inhibitor or other protease inhibitors, insulin or insulin precursors, human or bovine growth hormone, interleukin, glucagon, tissue plasminogen activator, transforming growth factor .alpha. or .beta., platelet-derived growth factor, enzymes, or a functional analogue thereof.
11. A yeast expression cloning vector comprising the following sequence 5'-SP-Xn-3'-RS-5'-Xm-(NzT)p-Xq-PS-*gene*-3' wherein SP is a DNA sequence encoding a signal peptide, Xn is a DNA sequence encoding n amino acids, wherein n is 0 or an integer of from 1 to about 10 amino acids, RS is a restriction endonuclease recognition site provided at the junction of Xn and Xm, Xm is a DNA sequence encoding m amino acids, wherein m is 0 or an integer from 1 to about 10, (NZT)p is a DNA sequence encoding Asn-Xaa-Thr, wherein p is 0 or 1, Xq is a DNA sequence encoding q amino acids, wherein q is 0 or an integer from 1 to about 10, PS is a DNA sequence encoding a peptide defining a yeast processing site, and *gene* is a DNA sequence encoding a heterologous polypeptide.
12. A vector according to claim 11, wherein n and/or m and/or q are ?1.
13. A method according to claim 11, wherein p is 1.
14. A method according to claim 11, wherein SP is a DNA
sequence encoding the .alpha.-factor signal peptide, the signal peptide of mouse salivary amylase, the carboxypeptidase signal peptide or the yeast BAR1 signal peptide.
sequence encoding the .alpha.-factor signal peptide, the signal peptide of mouse salivary amylase, the carboxypeptidase signal peptide or the yeast BAR1 signal peptide.
15. A method according to claim 11, wherein PS is a DNA
sequence encoding Lys-Arg, Arg-Lys, Arg-Arg, Lys-Lys or Ile-Glu-Gly-Arg.
sequence encoding Lys-Arg, Arg-Lys, Arg-Arg, Lys-Lys or Ile-Glu-Gly-Arg.
16. A method according to claim 11, wherein the heterologous polypeptide is selected from the group consisting of aprotinin, extrinsic pathway inhibitor or other protease inhibitors, insulin or insulin precursors, human or bovine growth hormone, interleukin, glucagon, tissue plasminogen activator, transforming growth factor .alpha. or .beta., platelet-derived growth factor, enzymes, or a functional analogue thereof.
17. A yeast expression vector comprising the following sequence 5'-SP-Xn-ranDNA-Xm-(NZT)p-Xq-PS-*gene*-3' wherein SP is a DNA sequence encoding a signal peptide, Xn is a DNA sequence encoding n amino acids, wherein n is 0 or an integer of from 1 to about 10 amino acids, ranDNA is a random DNA fragment inserted in a restriction endonuclease recognition site provided at the junction of Xn and Xm, Xm is a DNA sequence encoding m amino acids, wherein m is 0 or an integer from 1 to about 10, (NZT)p is a DNA sequence encoding Asn-Xaa-Thr, wherein p is 0 or 1, Xq is a DNA sequence encoding q amino acids, wherein q is 0 or an integer from 1 to about 10, PS is a DNA sequence encoding a peptide defining a yeast processing site, and *gene* is a DNA sequence encoding a heterologous polypeptide, the sequence Xn-Xq encoding a leader peptide sequence.
18. A method according to claim 17, wherein the random DNA
fragment inserted in the vector is of genomic or synthetic origin.
fragment inserted in the vector is of genomic or synthetic origin.
19. A method according to claim 17 or 18, wherein the random DNA fragment has a length of from 6 to about 600 base pairs.
20. A method according to any of claims 17-19, wherein the random DNA fragment encodes a high proportion of polar amino acids.
21. A method according to any of claims 17-20, wherein the random DNA fragment encodes at least one proline.
22. A method according to claim 17, wherein n and/or m and/or q are ?1.
23. A method according to claim 17, wherein p is 1.
24. A method according to claim 17, wherein SP is a DNA
sequence encoding the .alpha.-factor signal peptide, the signal peptide of mouse salivary amylase, the carboxypeptidase signal peptide, the yeast BAR1 signal peptide, or the Humicola lanuginosa lipase signal peptide, or a derivative thereof.
sequence encoding the .alpha.-factor signal peptide, the signal peptide of mouse salivary amylase, the carboxypeptidase signal peptide, the yeast BAR1 signal peptide, or the Humicola lanuginosa lipase signal peptide, or a derivative thereof.
25. A method according to claim 17, wherein PS is a DNA
sequence encoding Lys-Arg, Arg-Lys, Arg-Arg, Lys-Lys or Ile-Glu-Gly-Arg.
sequence encoding Lys-Arg, Arg-Lys, Arg-Arg, Lys-Lys or Ile-Glu-Gly-Arg.
26. A method according to claim 1, wherein the heterologous polypeptide is selected from the group consisting of aprotinin, tissue factor pathway inhibitor or other protease inhibitors, insulin or insulin precursors, human or bovine growth hormone, interleukin, glucagon, tissue plasminogen activator, transforming growth factor .alpha. or .beta., platelet-derived growth factor, enzymes, or a functional analogue thereof.
27. A yeast cell which is capable of expressing a heterologous polypeptide and which is transformed with a yeast expression vector according to any of claims 11-16.
28. A yeast cell which is capable of expressing a heterologous polypeptide and which is transformed with a yeast expression vector according to any of claims 17-26.
29. A process for producing a heterologous polypeptide in yeast, the process comprising culturing a yeast cell, which is capable of expressing a heterologous polypeptide and which is transformed with a yeast expression vector according to any of claims 17-26 including a leader peptide sequence constructed by the method of claim 1, in a suitable medium to obtain expression and secretion of the heterologous polypeptide, after which the heterologous polypeptide is recovered from the medium.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DK3000/90 | 1990-12-19 | ||
| DK300090A DK300090D0 (en) | 1990-12-19 | 1990-12-19 | PROCEDURE FOR PREPARING LEADER SEQUENCES |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2098731A1 true CA2098731A1 (en) | 1992-06-19 |
Family
ID=8118017
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002098731A Abandoned CA2098731A1 (en) | 1990-12-19 | 1991-12-18 | Method of constructing synthetic leader sequences |
Country Status (17)
| Country | Link |
|---|---|
| EP (1) | EP0563175A1 (en) |
| JP (1) | JPH06503957A (en) |
| KR (1) | KR930703450A (en) |
| AU (1) | AU660161B2 (en) |
| CA (1) | CA2098731A1 (en) |
| CZ (1) | CZ119293A3 (en) |
| DK (1) | DK300090D0 (en) |
| FI (1) | FI932831A (en) |
| HU (1) | HUT68751A (en) |
| IE (1) | IE914433A1 (en) |
| IL (1) | IL100408A0 (en) |
| MX (1) | MX9102684A (en) |
| NZ (1) | NZ241011A (en) |
| PT (1) | PT99848A (en) |
| SK (1) | SK62593A3 (en) |
| WO (1) | WO1992011378A1 (en) |
| ZA (1) | ZA919932B (en) |
Families Citing this family (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FI92601C (en) * | 1992-03-11 | 1994-12-12 | Marja Makarow | Procedure for secretion of yeast beneficial proteins |
| US5538863A (en) * | 1993-07-01 | 1996-07-23 | Immunex Corporation | Expression system comprising mutant yeast strain and expression vector encoding synthetic signal peptide |
| US5639642A (en) * | 1994-06-16 | 1997-06-17 | Novo Nordisk A/S | Synthetic leader peptide sequences |
| ZA954983B (en) * | 1994-06-17 | 1996-02-14 | Novo Nordisk As | N-terminally extended proteins expressed in yeast |
| US6500645B1 (en) | 1994-06-17 | 2002-12-31 | Novo Nordisk A/S | N-terminally extended proteins expressed in yeast |
| HRP940432B1 (en) * | 1994-08-05 | 2003-10-31 | Pliva Pharm & Chem Works | Dna sequences encoding biosynthetic insulin precursors and process for preparation of insulin |
| CN102080070B (en) | 1995-03-17 | 2016-01-20 | 诺沃奇梅兹有限公司 | new endoglucanase |
| EP1231218B1 (en) | 1996-03-01 | 2008-05-14 | Novo Nordisk A/S | An appetite-suppressing peptide, its compositions and use |
| WO1998025963A1 (en) | 1996-12-13 | 1998-06-18 | Chiron Corporation | Analysis and separation of platelet-derived growth factor proteins |
| JP2003525570A (en) | 1998-01-23 | 2003-09-02 | ノボ ノルディスク アクティーゼルスカブ | Method for producing desired polypeptide in yeast |
| CN1415019A (en) | 1999-12-29 | 2003-04-30 | 诺沃挪第克公司 | Method for making insulin precursors and insulin precursor analogus having improved fermentation yield in yeast |
| AT410217B (en) * | 2000-06-15 | 2003-03-25 | Cistem Biotechnologies Gmbh | VECTOR AND A METHOD FOR THE EXPRESSION AND SELECTION OF RANDOMIZED PEPTIDE SEQUENCES |
| AU2002249096B2 (en) | 2001-03-22 | 2007-06-28 | Novo Nordisk Health Care Ag | Coagulation factor VII derivatives |
| CA2461003A1 (en) | 2001-09-27 | 2003-04-03 | Novo Nordisk Health Care Ag | Human coagulation factor vii polypeptides |
| ATE547519T1 (en) | 2003-09-09 | 2012-03-15 | Novo Nordisk Healthcare Ag | CLOTTING FACTOR VII POLYPEPTIDES |
| EP1687428A1 (en) | 2003-11-14 | 2006-08-09 | Novo Nordisk A/S | Processes for making acylated insulin |
| WO2005054291A1 (en) | 2003-12-03 | 2005-06-16 | Novo Nordisk A/S | Single-chain insulin |
| WO2005078116A1 (en) * | 2004-01-16 | 2005-08-25 | Qiuyun Liu | A method of isolating antibacterial peptides and the isolated peptides thereof |
| US8034326B2 (en) | 2005-04-18 | 2011-10-11 | Novo Nordisk A/S | IL-21 variants |
| ES2368500T3 (en) | 2005-08-16 | 2011-11-17 | Novo Nordisk A/S | METHOD FOR PRODUCING MATURE INSULIN POLYPEPTIDES. |
| EP2316930A1 (en) | 2005-09-14 | 2011-05-04 | Novo Nordisk Health Care AG | Human coagulation factor VII polypeptides |
| ATE482977T1 (en) | 2006-02-27 | 2010-10-15 | Novo Nordisk As | INSULIN DERIVATIVES |
| JP5503968B2 (en) | 2006-09-27 | 2014-05-28 | ノボ・ノルデイスク・エー／エス | Method for producing mature insulin polypeptide |
| ES2558930T3 (en) | 2007-08-13 | 2016-02-09 | Novo Nordisk A/S | Fast-acting insulin analogs |
| WO2009022013A1 (en) | 2007-08-15 | 2009-02-19 | Novo Nordisk A/S | Insulin analogues with an acyl and aklylene glycol moiety |
| JP5721432B2 (en) | 2007-08-15 | 2015-05-20 | ノボ・ノルデイスク・エー／エス | Insulin having an acyl moiety containing an amino acid-containing alkylene glycol repeating unit |
| WO2010103038A1 (en) | 2009-03-11 | 2010-09-16 | Novo Nordisk A/S | Interleukin-21 variants having antagonistic binding to the il-21 receptor |
| KR102184713B1 (en) | 2009-07-17 | 2020-12-01 | 오메로스 코포레이션 | Masp isoforms as inhibitors of complement activation |
| WO2011064282A1 (en) | 2009-11-25 | 2011-06-03 | Novo Nordisk A/S | Method for making polypeptides |
| ES2583259T3 (en) | 2009-12-01 | 2016-09-20 | Novo Nordisk A/S | New alpha-amidant peptidyl alpha-hydroxyglycine liases |
| EP2526117B1 (en) | 2010-01-22 | 2015-05-06 | Novo Nordisk A/S | Process for preparing fgf-21 with low degree of o-glycosylation |
| JP6148013B2 (en) | 2010-03-05 | 2017-06-14 | リグショスピタレト | Chimera inhibitor molecule of complement activation |
| EP2598527A4 (en) * | 2010-07-28 | 2014-01-08 | Smartcells Inc | Recombinantly expressed insulin polypeptides and uses thereof |
| DK2812024T3 (en) | 2012-02-09 | 2018-07-23 | Var2 Pharmaceuticals Aps | TARGET ORIENTATION OF CHONDROITIN-SULPHATE GLYCANES |
| US20150307865A1 (en) | 2012-10-15 | 2015-10-29 | Novo Nordisk Health Care Ag | Coagulation factor vii polypeptides |
| JP2016521701A (en) | 2013-06-07 | 2016-07-25 | ノヴォ ノルディスク アー／エス | Methods for making mature insulin polypeptides |
| EP3110834B1 (en) * | 2014-02-28 | 2018-11-07 | Novo Nordisk A/S | Mating factor alpha pro-peptide variants |
| CN112789504A (en) | 2018-07-13 | 2021-05-11 | 瓦克特诊断有限责任公司 | Isolation of fetal-derived circulating cells using the recombinant malaria protein VAR2CSA |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK463887D0 (en) * | 1987-09-07 | 1987-09-07 | Novo Industri As | GAERLEADER |
| CA1340772C (en) * | 1987-12-30 | 1999-09-28 | Patricia Tekamp-Olson | Expression and secretion of heterologous protiens in yeast employing truncated alpha-factor leader sequences |
| WO1990001063A1 (en) * | 1988-07-23 | 1990-02-08 | Delta Biotechnology Limited | New secretory leader sequences |
| DK105489D0 (en) * | 1989-03-03 | 1989-03-03 | Novo Nordisk As | POLYPEPTIDE |
-
1990
- 1990-12-19 DK DK300090A patent/DK300090D0/en not_active Application Discontinuation
-
1991
- 1991-12-17 NZ NZ241011A patent/NZ241011A/en unknown
- 1991-12-18 KR KR1019930701890A patent/KR930703450A/en not_active Application Discontinuation
- 1991-12-18 EP EP92901668A patent/EP0563175A1/en not_active Ceased
- 1991-12-18 ZA ZA919932A patent/ZA919932B/en unknown
- 1991-12-18 PT PT99848A patent/PT99848A/en not_active Application Discontinuation
- 1991-12-18 JP JP4502056A patent/JPH06503957A/en not_active Expired - Lifetime
- 1991-12-18 HU HU9301801A patent/HUT68751A/en unknown
- 1991-12-18 AU AU91348/91A patent/AU660161B2/en not_active Ceased
- 1991-12-18 CZ CS931192A patent/CZ119293A3/en unknown
- 1991-12-18 SK SK62593A patent/SK62593A3/en unknown
- 1991-12-18 IL IL100408A patent/IL100408A0/en unknown
- 1991-12-18 IE IE443391A patent/IE914433A1/en not_active Application Discontinuation
- 1991-12-18 CA CA002098731A patent/CA2098731A1/en not_active Abandoned
- 1991-12-18 WO PCT/DK1991/000396 patent/WO1992011378A1/en not_active Application Discontinuation
- 1991-12-19 MX MX9102684A patent/MX9102684A/en unknown
-
1993
- 1993-06-18 FI FI932831A patent/FI932831A/en not_active Application Discontinuation
Also Published As
| Publication number | Publication date |
|---|---|
| SK62593A3 (en) | 1993-10-06 |
| HU9301801D0 (en) | 1993-10-28 |
| CZ119293A3 (en) | 1994-02-16 |
| EP0563175A1 (en) | 1993-10-06 |
| PT99848A (en) | 1993-06-30 |
| FI932831A0 (en) | 1993-06-18 |
| MX9102684A (en) | 1992-06-01 |
| NZ241011A (en) | 1993-04-28 |
| DK300090D0 (en) | 1990-12-19 |
| IL100408A0 (en) | 1992-09-06 |
| FI932831A (en) | 1993-06-18 |
| AU9134891A (en) | 1992-07-22 |
| JPH06503957A (en) | 1994-05-12 |
| IE914433A1 (en) | 1992-07-01 |
| HUT68751A (en) | 1995-07-28 |
| ZA919932B (en) | 1992-08-26 |
| KR930703450A (en) | 1993-11-30 |
| WO1992011378A1 (en) | 1992-07-09 |
| AU660161B2 (en) | 1995-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2098731A1 (en) | Method of constructing synthetic leader sequences | |
| AU693569B2 (en) | Synthetic leader peptide sequences | |
| EP0792367B1 (en) | A dna construct encoding the yap3 signal peptide | |
| US5162498A (en) | Synthetic yeast leader peptides | |
| JP3730255B2 (en) | N-terminal extended protein expressed in yeast | |
| US6500645B1 (en) | N-terminally extended proteins expressed in yeast | |
| EP0868523B1 (en) | Vector for expression of n-terminally extended proteins in yeast cell | |
| CA2192942C (en) | Synthetic leader peptide sequences |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Discontinued | ||
| FZDE | Discontinued |
Effective date: 19981218 |