RU2447151C1 - ALKALINE PHOSPHATASE CmAP SYNTHESIS-DETERMINING 40Ph PLASMID, E. coli rosetta(DE3)/40Ph STRAIN - PRODUCER OF CHIMERIC PROTEIN, CONTAINING AMINO ACID SEQUENCE OF RECOMBINANT ALKALINE PHOSPHATASE CmAP, AND PRODUCTION METHOD THEREOF - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: disclosed is a plasmid which determines synthesis of alkaline phosphatase CmAP, containing a NcoI/SacI-fragment of plasmid pET-40b(+) (Novagen) and a DNA fragment of 1530 base pairs, which contains a chimeric gene consisting of a CmAP gene structural part which is adapted at the N-end for expression in E.coli cells, and a nucleotide which codes a specific sequence for TEV protease. Described is an E.coli Rosetta(DE3) strain which is transformed by said plasmid, and is a producer of chimeric protein, which contains an amino acid sequence of recombinant alkaline phosphatase CmAP. Disclosed is a method of obtaining recombinant alkaline phosphatase CmAP, comprising steps for: incubating said producer strain in a liquid broth LB for 12 hours at 20°C, depositing bacterial cells by centrifuging, disintegration of the cell suspension in a buffer, centrifuging the extract, chromatography of the supernatant fluid on a column with a metal affinity resin, elution of the protein, concentrating active fractions by ultrafiltration, incubation with protease TEV, concentrating the protein solution and extracting the end product by gel filtration.

EFFECT: improved method.

3 cl, 1 dwg, 3 ex

Description

The invention relates to biotechnology, in particular to genetic engineering, and relates to a method for producing a recombinant phosphatase protein of the marine bacteria Cobetia marina (CmAP), as well as a plasmid for its preparation and a recombinant strain of Escherichia coli. The invention allows the production of highly active recombinant alkaline phosphatase for use in medicine, genetic engineering and molecular biology.

Alkaline phosphatase is an enzyme that catalyzes the removal of the 5'-terminal phosphate group from linear DNA or RNA at high pH. Used in genetic engineering to dephosphorylate DNA before ligation; obtaining conjugates with oligonucleotides for chemiluminescent labeling of genes in a hybridization technique; in medicine for immunoconjugates; to obtain recombinant diagnostic antibodies to cell receptors with the aim of creating reference proteins for diagnosis, etc.

Today, the alkaline phosphatase of the marine bacteria Cobetia marina, which has been widely used in laboratory research and immunodiagnostics, continues to be the most highly active commercial alkaline phosphatase in the world - 11000-14000 units / mg [Plisova EY, Balabanova LA, Ivanova ER, Kozhemyako V.V., Mikhailov VV, Agafonova EV, Rasskazov VA A Highly active alkaline phosphatase from the marine bacterium Cobetia // Marine Biotechnology. - 2005. - Vol.7, N 3. - P.173-178.]. Thus, the most active commercial preparation of alkaline phosphatase from calf intestine, proposed by the manufacturer, has a maximum activity of 7500 u / mg (http: www.bbienzymes.com/), the activity of the recombinant alkaline phosphatase preparation from the yeast fungus Pichia pastoris is 7000 units / mg (http : www.roche-biochem.jp/).

Known methods for producing a natural protein of alkaline phosphatase from a producer strain of Cobetia marina [RU 2077577 C1, 04/20/1997]. The main disadvantages of this production method are the high technological costs during storage and cultivation of the wild strain and purification of the target protein in four stages.

Methods for preparing the active recombinant alkaline phosphatase protein Cobetia marina (CmAP) are not yet known.

The nucleotide sequence of the CmAP precursor has recently been established (GenBank code ABD92772.1). However, obtaining highly active CmAP in heterologous bacterial systems has a number of problems. It was found that overproduction of highly active CmAP in the cell has an adverse effect on the cells of the host bacterial strains. Moreover, the heterologous expression of CmAP does not contribute to the correct folding of the protein, which leads to the loss of an inactive recombinant protein in inclusion bodies.

The objective of the invention is the construction of a recombinant strain of E. coli, a plasmid encoding the synthesis of the recombinant CmAP protein, and the development of a method for its preparation.

The problem was solved by creating a genetic construct in the form of a recombinant plasmid 40Ph and a strain of E.coli Rosetta (DE3) / 40Ph, which provide inducible synthesis with high and stable yield of active soluble recombinant alkaline phosphatase into the periplasm of Escherichia coli cells.

The technical result of the claimed invention is the production of active recombinant alkaline phosphatase CmAP with high yield and level of purification.

Plasmid 40Ph has 7699 base pairs (bp) and is characterized by the presence of an NcoI / SacI fragment of plasmid pET-40b (+) (Novagen) and a 1530 bp DNA fragment sequence containing a chimeric gene consisting of the structural part of the gene CmAP adapted at the N-terminus for expression in E. coli cells, and a specific sequence for the TEV protease to remove histidines from the C-terminal portion of the recombinant protein molecule.

The figure shows the physical map of the 40Ph plasmid and the plasmid region responsible for the expression of the recombinant CmAP protein.

The nucleotide sequence of a 40Ph plasmid fragment flanked by the NcoI and SacI sites contains a sequence of the CmAP structural gene with an adapted N-terminus for expression in E. coli, corresponding to the open reading frame for the CmAP protein, and a sequence specific for TEV protease (SEQ ID N 1) .

The E. coli Rosetta (DE3) / 40Ph strain was obtained by transforming E.coli Rosetta (DE3) (Novagen) cells with the 40Ph plasmid using traditional genetic engineering technology [Sambrook J., Fritsch E.F., Maniatis T. // Molecular Cloning. A. Laboratory Manual. 2bd ed. Cold Spring Harbor, NY, 1989.].

The recombinant E. coli Rosetta (DE3) / 40Ph strain is characterized by the following features.

Cultural and morphological characters.

The cells of the strain form large round with smooth edges, convex colonies up to 5 mm in diameter, the surface of the colonies is smooth, the mucous consistency. The pigment does not accumulate. Gram-negative, do not form a spore, do not have capsules. Colonies grow well on simple nutrient media (LB). When growing in liquid media, they form an intense smooth haze.

Physico-biological signs.

The strain E.coli Rosetta (DE3) / 40Ph is speciesotypical in its biochemical properties. The strain does not have gelatinase activity, does not ferment lysine; breaks down glucose, lactose, mannitol, sucrose to acid and gas. It has a mutation in the lac gene, which provides control of the expression level, as well as the translation of rare codons. The optimum temperature for growth is 37 ° С, and for СmАР production - 20 ° С. Antibiotic resistance.

The cells of the strain are resistant to chloramphenicol (34 μg / ml) and kanamycin (25 μg / ml).

Pathogenicity and toxicity.

The recombinant E. coli Rosetta (DE3) / 40Ph strain is neither pathogenic nor toxic to warm-blooded animals.

The strain is stored in the usual way in suspension with glycerol (30%) at -20 ° C.

The inventive method for producing recombinant alkaline phosphatase CmAP consists in culturing cells of the E. coli Rosetta (DE3) / 40Ph strain in LB nutrient medium containing kanamycin, separating biomass from the culture fluid, destroying microbial cells, followed by isolation of the target product by aqueous extraction and chromatographic purification of the enzyme preparation . Purification of the target product is carried out by chromatography on a metal-affinity resin and gel filtration.

The yield of recombinant CmAP as a result of the application of the described method is at least 10 mg of recombinant protein with 1 l of culture with a specific activity of more than 12000 units / mg of protein.

The recombinant CmAP protein has a molecular weight of 56 kDa, the optimum reaction temperature is 37-45 ° C and its activity does not depend on the presence of divalent metal ions in the incubation medium. Recombinant СmАР can be successfully used for cleavage of terminal 5'-phosphate groups in nucleic acid molecules, as well as for labeling nucleic acids, since after the end of the reaction it is easily inactivated by heating at 60 ° C for 10 min.

A significant advantage of the proposed method are:

- the use of the producer strain E. coli Rosetta (DE3) / 40Ph, which allows to obtain a large amount of full-size and highly active recombinant CmAP during biosynthesis;

- the use of two-stage chromatographic purification of the enzyme, which allows to obtain pure recombinant protein in a short time and with low losses.

A method of obtaining a functionally active protein based on the use of a gene encoding the alkaline phosphatase of the marine bacteria C. marina is illustrated by the following examples.

Example 1. Construction of plasmids 40Ph.

A recombinant 40Ph plasmid containing the CmAP structural gene without a leader peptide encoding the mature form of alkaline phosphatase Cobetia marina and a sequence specific for TEV peptidases flanked by the NcoI and SacI restriction sites are constructed on the basis of the commercial plasmid pET-40b (+) (Novagen).

The DNA fragment containing the full-sized CmAP gene is obtained by polymerase chain reaction using the genomic DNA of the marine bacteria strain Cobetia marina KMM 296 as a template and primers Pho_F and Pho_R, where Pho_F is a primer specific for the N-terminal sequence of CmAP, Pho_R - reverse primer specific for the C-terminal sequence of CmAP, including a sequence specific for TEV peptidase:

Pho_F: 5'TTAACCATGGCAGAGATCAAGAATGTCATTCTGAT3 '

Pho_R: 5'TTAACTCGAGGGAACTTTCATCTCTAAGAGCTTCGCTACCACTGTCTT CAG3 '

This reaction is carried out under the following conditions: 10x Encyclo buffer, 50x Encyclo polymerase mixture (Encycio PCR kit, Eurogen, Moscow), 50x dNTP mixture (10mM each), primer mixture (5 µM each), 100 ng DNA. The amplification process consists of the following stages: heating at 95 ° C for 3 min, 35 PCR cycles (15 sec - 95 ° C, 1 min 30 sec - 72 ° C) and incubation for 10 min at 72 ° C. After amplification, the DNA fragment is purified electrophoretically in 1% agarose gel. The fragment (1 μg) was treated with restriction enzymes NcoI and SacI in the optimal buffer (Fermentas) for 3 hours, then the enzymes were removed from the reaction medium according to the standard procedure with phenol (1: 1) [3]. 1/10 volume of 0.3 M Na acetate, pH 5.2, and 1/2 volume of isopropanol alcohol are added to the aqueous fraction containing the fragment and left at -20 ° C for 30 minutes. It is then centrifuged at 14,000 rpm for 20 minutes, the precipitate is washed with 75% ethanol and dried at room temperature. The precipitate was dissolved in 20 μl.

5 μg of plasmid DNA pET-40b (+) is treated with restriction enzymes NcoI and SacI in accordance with the procedure described above, and the vector part of the plasmid is isolated from the obtained hydrolyzate in a 1% low-melting agarose gel.

The resulting fragment and the vector part of the plasmid pET-40b (+) are crosslinked by ligase reaction in 50 μl of ligation buffer according to the instructions (Fermentas). 10 μl of the reaction mixture was used to transform competent E. coli Rosetta cells (DE3). Transformants are plated on LB agar containing 25 μg / ml kanamycin. After incubation for 16 hours at 37 ° C, the clones are screened, plasmid DNA is isolated and analyzed for mutations using automatic sequencing. DNA containing the desired sequence, which is a 40Ph plasmid of size 7699 bp, is selected.

Example 2. Obtaining a strain of E. coli Rosetta (DE3) / 40Ph transformed with plasmid 40Ph, a producer of a chimeric protein, including the amino acid sequence of recombinant alkaline phosphatase CmAP.

The producer strain is obtained by transforming cells of the E. coli Rosetta strain (DE3) with a 40Ph recombinant plasmid. An overnight culture (0.5 ml LB) of the recombinant CmAP producer strain was grown in a liter flask in LB liquid medium containing per liter 10 g bacto-tryptone, 5 g bacto-yeast extract and 10 g NaCl, 25 mg / ml kanamycin, pH 7.7, on a shaker at 200 rpm at 37 ° C for 2 hours to an optical density of 0.6-0.8 (OD ₆₀₀ ), then an IPTG expression inducer is added to a final concentration of 0.5 mM and incubated further at 20 ° C for 12 hours.

To determine the productivity of the strain, cellular aqueous extracts are analyzed by electrophoresis in 12% polyacrylamide gel with sodium dodecyl sulfate. The gel is stained with Coomassie R-250 by a standard method and the relative amount of protein in the strip of the target product is determined. The content of the recombinant protein in the soluble cell fraction is at least 50% of all proteins of this fraction.

Example 3. Isolation and characterization of a recombinant alkaline protein

phosphatase CmAP.

The strain producing recombinant E. coli Rosetta (DE3) / 40Ph CmAP is incubated in a liter flask in LB liquid medium containing 10 g bacto-tryptone, 5 g bacto-yeast extract and 10 g NaCl, 0.5 g IPCl, 0.5 mM IPTG, 25 mg / ml kanamycin, pH 7.7, on a shaker at 200 rpm for 12 hours at 20 ° C. Bacterial cells are pelleted in a flow centrifuge at 5000 rpm for 10 minutes. The cell suspension is disintegrated in 20 ml of buffer A (0.02 M Tris-HCl, pH 9.5, 0.1 M NaCl, 0.01% NaN ₃ ) for 5 × 30 sec, cooling in ice. Then centrifuged at 5000 rpm for 10 minutes The supernatant was collected and placed on a column with a metal-affinity resin (TALON, Clontech), previously equilibrated with buffer A. Protein elution was carried out with 20 mM Tris-HCl, 0.5 M NaCl, 100 mM EDTA, pH 9.5. Active fractions were collected, concentrated by ultrafiltration on an Amicon Ultra 50k membrane (Millipore) and transferred to a buffer of 50 mM Tris-HCl, pH 8.0, 0.1 M NaCl, 5 mM EDTA for incubation with TEV protease (Invitrogen) at room temperature in within 12 hours. The protein solution was concentrated on an Amicon Ultra 50k membrane (Millipore) and applied to a Sephadex G-75 gel filtration column. The recombinant protein yield is 10 mg per 1 liter of culture.

The resulting recombinant polypeptide is determined by the first 10 amino acids on an automatic sequencer. The sequencing of the recombinant alkaline phosphatase CmAP preparation isolated from cells of the E. coli Rosetta (DE3) / 40Ph strain revealed the amino acid sequence Ala-Glu-Ile-Lys-Asn-Val-Ile-Leu-Met-Ile corresponding to the first 10 amino acids of the full-sized native CmAP protein with a molecular weight of 56 kDa.

Alkaline phosphatase activity is determined by the cleavage of p-NFF. A standard incubation mixture in a volume of 500 μl contains 15 mm paranitrophenyl phosphate (p-NFF), 1 M diethanolamine (DEA), pH 10.3 and the enzyme. After 30 min incubation at 37 ° C, the reaction is stopped by adding 2 ml of 0.5 M NaOH. The amount of p-NFF formed during the enzymatic reaction is determined spectrophotometrically at 400 nm. The unit of alkaline phosphatase activity is the amount of an enzyme that catalyzes the release of 1 μM p-NFF (E400 nm 18600) during 1 min of incubation. The specific activity is expressed in units of enzyme activity per 1 mg of protein. The protein concentration in the solution is determined by the Bradford method.

The obtained data on the characteristics and enzymatic activity of the expression product of the artificial chimeric CmAP gene in E. coli Rosetta (DE3) / 40Ph strain cells indicate that the studied polypeptide corresponds to its natural counterpart.

As follows from the above examples, the claimed group of inventions allows to obtain active recombinant alkaline phosphatase CmAR in high yield with a relatively simple and reliable technology.

The claimed invention allows you to:

- using the producer strain E. coli Rosetta (DE3) / 40Ph to obtain active recombinant alkaline phosphatase CmAP;

- the use of a producer strain of E. coli Rosetta (DE3) / 40Ph allows to obtain a large amount of full-size recombinant alkaline phosphatase CmAP during biosynthesis;

- the use of metal-affinity and gel filtration chromatography when cleaning the enzyme from the aqueous extract of the cells of the producer strain allows you to get the enzyme with a purity of more than 98%.

Claims (3)

1. Plasmid 40Ph with a size of 7699 base pairs (bp), which determines the synthesis of the recombinant alkaline phosphatase of the marine bacteria Cobetia marina (CmAP) and is characterized by the presence of the following fragments: NcoI / SacI fragment of plasmid pET-40b (+) (Novagen) and fragment 1530 bp DNA containing a chimeric gene consisting of a structural part of a CmAP gene adapted at the N-terminus for expression in E. coli cells and a nucleotide encoding a specific sequence for the TEV protease (SEQ ID N 1). 2. The E. coli Rosetta strain (DE3), transformed with the 40Ph plasmid according to claim 1, is a producer of a chimeric protein comprising the amino acid sequence of the recombinant alkaline phosphatase CmAP. 3. A method of producing a recombinant alkaline phosphatase CmAP, characterized in that the producer strain according to claim 2 is incubated in LB liquid medium for 12 hours at 20 ° C, then the bacterial cells are precipitated by centrifugation, the cell suspension is disintegrated in buffer, then the extract is centrifuged then the supernatant is placed on a column with a metal-affinity resin, then the protein is eluted, then the active fractions are concentrated by ultrafiltration, transferred to a buffer and incubated with TEV protease, then the protein solution is concentrated and isolated Appropriate gel filtration.