KR20160077750A - Mass production method of recombinant trans glutaminase - Google Patents

Abstract

The present invention relates to a method of mass producing recombined transglutaminase, comprising: a step of transforming microorganisms to a first recombinant expression vector comprising a gene encoding a protein to induce soluble expression, a gene encoding activation inhibitive sequence within cells of glutaminase and a protease recognition site, and a gene encoding glutaminase, and to a second recombinant expression vector comprising a gene encoding the protein to induce soluble expression and a gene encoding the protease recognition site; and a step of culturing the transformed microorganisms to generate activity-type recombinant transglutaminase. Also, the present invention relates to a vector for producing the recombinant transglutaminase.

Description

MASS PRODUCTION METHOD OF RECOMBINANT TRANS GLUTAMINASE BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a recombinant transglutaminase,

The present invention relates to a vector for mass production of a recombinant transglutaminase and a method for mass-production of the recombinant transglutaminase using the same.

Transglutaminase (TGase; protein-glutamine? -Glutamyltransferase, EC2.3.2.13) is an acyl group between the? -Carboxyamide group of the glutamine residue of the peptide chain and the? -Amino group of the lysine residue It is an enzyme that catalyzes the acyl group transfer reaction and forms ε- (γ-glutamyl) lysine cross-linkage.

Transglutaminase has been widely used in the food and fish processing industries and has been developed in various fields such as medical engineering, material science, textiles, leather processing and so on.

Currently, transglutaminase is produced mostly by the conventional fermentation process from Streptomyces mobaraensis . Recently, genetic engineering technology has been used to produce transglutaminase in E. coli and Corynebacterium. However, the current production technology of transglutaminase is difficult to mass-produce due to low production yield (E. coli: 5 mg / l, S. lividans: 0.1 mg / l, Corynebacterium: 132 mg / Masayo Date, Yoshimi Kikuchi, < / RTI >< RTI ID = 0.0 > 1, < / RTI > Appl Environ Microbiol. May 2003; 69 (5): 3011-3014), it is necessary to dramatically improve the production yield.

In addition, since active transglutaminase induces cross-linking of proteins in cells, it is toxic, and in order to maintain an inactive form in a cell, a mature form of N-terminal ) Is attached to the pro-sequence, which is the activity inhibition sequence. The pro-TGase in which the pro is attached does not have an active form, but when the pro-sequence is removed by a specific protease, it has an active form. However, proteolytic enzymes that recognize a specific sequence for the removal of the activity-inhibiting sequence are not suitable for the mass production of expensive in vitro transglutaminase. In addition, the expression of transglutaminase in an insoluble state is not suitable for mass production because a complicated refolding process is required.

Therefore, the present inventors have established a mass expression method, purification and separation process of transglutaminase by using molecular genetics technology for the domestic mass production of transglutaminase, which solves the above problems and relies on the whole amount of the transglutaminase. Thereby completing the present invention.

1. Korean Patent Publication No. 2010-0029566 2. International Publication No. WO1996-006931

It is an object of the present invention to provide a mass production method of recombinant transglutaminase.

It is another object of the present invention to provide a recombinant expression vector for mass production of recombinant transglutaminase.

In order to accomplish the above object, the present invention provides a gene encoding a protein for inducing water-soluble expression, a cell activation inhibition sequence of a recombinant transglutaminase, a gene encoding a protease recognition site and a transglutaminase A first recombinant expression vector comprising a gene encoding the gene of interest; And a second recombinant expression vector comprising a gene encoding a protein for inducing water-soluble expression and a gene encoding a proteolytic enzyme; And

Culturing the transformed microorganism to produce an active recombinant transglutaminase; And a method for producing the recombinant transglutaminase.

The term "vector" of the present invention refers to a DNA construct containing an exogenous DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA within the appropriate host. The vector of the present invention can typically be constructed as a vector for expression. Preferably, the vector of the present invention is a vector for expressing a recombinant peptide or protein. In addition, the vector of the present invention can be constructed by using prokaryotic cells or eukaryotic cells as host cells. The recombinant expression vector of the present invention may be, for example, a bacteriophage vector, a cosmid vector, a yeast artificial chromosome (YAC) vector, or the like. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for such purposes include (a) a cloning start point that allows replication to be efficiently made to include several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector And (c) a restriction enzyme cleavage site into which the foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, the vector and the foreign DNA can be easily ligated using a synthetic oligonucleotide adapter or a linker according to a conventional method. The vectors used in the present invention can be constructed through various methods known in the art, and specific methods for this can be found in Sambrook et al. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press (2001), which is incorporated herein by reference.

The term "operably linked" of the present invention means that a nucleic acid sequence other than a nucleic acid expression control sequence (e.g., an array of promoter, signal sequence or transcription factor binding site) (e.g., transglutaminase- ), Whereby the regulatory sequence regulates transcription and / or translation of the other nucleic acid sequences.

The first recombinant expression vector of the present invention comprises a gene encoding a protein for inducing a water-soluble expression, an intracellular activity-inhibiting sequence of a recombinant transglutaminase, a gene encoding a protease recognition site, and a transglutaminase And may include, but is not limited to, the gene in turn.

The term " protein for inducing water-soluble expression " of the present invention refers to a protein capable of producing a recombinant protein as a water-soluble fusion protein in order to improve the disadvantage that the expression of the insoluble protein form is not suitable for mass production. In order to produce a recombinant protein from an insoluble form to a water-soluble form, a method of producing a recombinant protein in the form of a fusion protein, usually a binding form of a water-soluble promoting protein, is used. In addition, when expressed as a water soluble form in the form of a fusion protein, the intrinsic activity of the target protein may be lost, and furthermore, the troublesome task of removing the water soluble enhancing tag from the target protein may occur. In the present invention, β-galactosidase, chloramphenicol acetyltransferase (GST), glutathione S transferase (GST) and maltose (MBP) are used in order to maximize the expression of a water-soluble protein which does not require a complicated refolding process. binding protein may be used, but the present invention is not limited thereto, and MBP (maltose binding protein) can be most preferably used. In the embodiment of the present invention, a process for binding a maltose binding protein consisting of the amino acid sequence of SEQ ID NO: 1 to a water-soluble expression inducing protein and expressing it in the form of a fusion protein to induce the expression of the soluble protein . In the embodiment of the present invention, the expression of the soluble protein was found to be the same in both flask culture and 5L fermentation.

The " intracellular activity inhibition sequence of recombinant transglutaminase " of the present invention is intended to solve the problem that the active transglutaminase enzyme affects the intracellular mechanism and is difficult to express at the time of expression of the recombinant transglutaminase It is a combination. Specifically, the transglutaminase is expressed through the intracellular activity inhibition sequence (prosequence) of the recombinant transglutaminase, followed by further activity-inhibition sequencing in the enzyme purification step to affect the intracellular mechanism Can be solved. In an embodiment of the present invention, the intracellular activity inhibition sequence of the recombinant transglutaminase may be a proteolytic-resistant sequence (prosequence) sequence consisting of the amino acid sequence of SEQ ID NO: 2.

The " protease recognition site " of the present invention refers to an amino acid sequence of the amino acid sequence of the amino acid sequence of the amino acid sequence of the amino acid sequence of SEQ ID NO: It refers to the sequence region.

The second recombinant expression vector of the present invention may include a gene encoding a protein for inducing water-soluble expression and a gene encoding a protease, and the gene may be in turn included, but is not limited thereto.

The water-soluble expression inducing protein may be the same as the water-soluble expression inducing protein of the first recombinant expression vector of the present invention, but is not limited thereto, preferably beta-galactosidase, CAT ( chloramphenicol acetyltransferase (GST), glutathione S transferase (GST), and maltose binding protein (MBP). In particular, maltose binding protein (MBP) can be used.

The "protease" of the second recombinant expression vector is used for self-production of a protease which recognizes a specific sequence in order to overcome the problem of mass production by using an expensive protease for removing the activity inhibition sequence . Preferably, the protease is selected from the group consisting of thrombin, tobacco etch virus (TEV) protease, PreScission protease, Factor Xa, and Enterokinase. Preferably, TEV (tobacco etch virus) But are not limited thereto. In a specific example of the present invention, a proteinase (Protease) recognizing a specific amino acid sequence for the removal of the activity-inhibiting sequence is transformed into Tabacco etch virus-derived TEV protease consisting of the amino acid sequence of SEQ ID NO: 5 was selected.

The polynucleotides of the present invention comprise a nucleotide sequence having a sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% . "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

The first recombinant expression vector of the present invention may be represented by FIG. 1A, and the second recombinant expression vector may be represented by FIG. 1C.

The first recombinant expression vector and the second recombinant expression vector of the present invention may be co-expressed as a water soluble fusion protein, and in the embodiment of the present invention may be expressed as a maltose binding protein and a water soluble protein in the form of a fusion protein have.

The second recombinant expression vector of the present invention is transformed into a microorganism and expressed in the form of a fusion protein. Then, the second recombinant expression vector of the present invention recognizes a proteolytic enzyme cleavage site in the expression structure and then cleaves self-cleavage between the protein -cleavage).

In addition, the proteolytic enzyme expressed by the second recombinant expression vector of the present invention can be made into an active form by removing the inhibitory site of the soluble fusion protein expressed by the first recombinant expression vector. In an embodiment of the present invention, the expressed proteolytic enzyme can recognize the proteolytic enzyme cleavage site in the expression structure and remove the protein and the activity inhibition sequence for inducing the water-soluble expression.

In the embodiment of the present invention, the culturing of the transforming microorganism can be carried out by a fed-batch culture method, but is not limited thereto. The microorganism transformed with the recombinant expression vector of the present invention may be expressed as a 100% water-soluble fusion protein even at 28 ° C or higher, and more than 50% of the water-soluble fusion protein at 37 ° C or higher Lt; / RTI >

In an embodiment of the present invention, the transformed microorganism may be E. coli but is not limited thereto, and preferably E. coli MG1655 or BL21.

The production method of the recombinant transglutaminase of the present invention may further include a step of producing and secreting a recombinant transglutaminase, and the step of purifying and separating the produced and secreted transglutaminase may be performed May be included.

The present invention also relates to

A gene encoding a protein for inducing water-soluble expression, a proteolytic-resistant sequence of a recombinant transglutaminase, a gene encoding a protease recognition site, and a gene encoding a transglutaminase; There is provided a recombinant expression vector for the production of recombinant transglutaminase comprising in sequence a gene encoding a protein for inducing water-soluble expression and a gene encoding a protease.

In an embodiment of the present invention, the recombinant expression vector may be as shown in FIG. 9, but is not limited thereto.

The recombinant expression vector can simultaneously express transglutaminase and proteolytic enzyme in the cells.

In a specific example of the present invention, the pACYC MBP-proTGase :: MBP-TEV expression vector was transformed into E. coli MG1655 and BL21, and the cells were cultured in a flask. As a result, the TEV protein expressed in the cell was expressed as a water- Of the transglutaminase was decomposed at 100% and it was confirmed that it was produced as the active type transglutaminase.

The mass production method of the active transglutaminase according to the present invention does not affect the intracellular mechanism, so that the active enzyme can be mass-produced. In addition, the production method is simple since an additional refolding process is unnecessary.

Figure 1 shows the expression vector of the fusion protein form of the present invention (a: pKPM :: MBP-pro-TEV site-TGase vector; b: pKPM :: pro-TEV site-TGase vector; c: pET :: MBP- TEV site-TEV vector, T7: T7 promoter, MBP: maltolse-binding domain, linker: proteolytic-resistant sequences, TGase: transglutaminase codon-optimized gene, H6: 6XHistidine tag, TEV: codon -optimized gene; T7t: T7 terminator; through arrows, representing each recombinant protein band).
FIG. 2 is a Western blot result of Escherichia coli expressing the novel vector of FIG. 1 at different culture temperatures (a: pKPM :: pro-TEV site-TGase vector expression b: pKPM :: MBP-pro-TEV site-TGase Vector expression result; c: pET :: MBP-TEV site-TEV vector expression result).
FIG. 3 shows the results of a fed-batch culture of pKPM :: MBP-pro-TEV site-TGase vector using a 5 L fermenter.
4 is a schematic diagram of a mass production method of the active type transglutaminase of the present invention.
Figure 5 shows the results of western blot analysis of the expression of all the enzymes cloned in the vector for the production of the active transglutaminase of the present invention under in-vitro conditions.
Figure 6 is a schematic diagram of a method for mass production of the active form of transglutaminase of the present invention in an in-vivo system.
FIG. 7 is a schematic diagram of pACYC MBP-proTGase :: MBP-TEV expression vector for in vivo system application.
FIG. 8 shows the results of protein expression confirming the production of active transglutaminase after transformation of pACYC MBP-proTGase :: MBP-TEV expression vector into E. coli MG1655 and BL21 strain under in vivo expression conditions.
9 shows the result of purification of the active transglutaminase of the present invention by using a Ni column (lane 1 is a sample before purification and lanes 4 to 9 (E1 to E6) are purified form of activated transglutaminase refractory Quot;).
FIG. 10 shows the results of transglutaminase expression in an in-vivo system using a fermenter (the numbers represent the time after induction of IPTG expression, and 16I and 16S represent insoluble fractions and soluble fractions after 16 hours, respectively ).

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

< Example  1> Preparation of Recombinant Expression Vector

A vector capable of expressing in Escherichia coli was prepared as shown in Fig. 1 by codon-optimizing a gene coding for transglutaminase (hereinafter referred to as TGase) and TEV protease.

Based on known genetic information, codon optimization was performed in DNA2.0 of USA. The codon-optimized glutaminase (CpTgase-optEc) was amplified by EcoR I, by inserting the Xho I restriction enzyme site on the 3` end was fabricated by inserting the pJ204 vector, was named CpTgase-optEc-pJ204. Gene sequence 132th amino acid phenylalanine (F) was changed to valine (V), 142th amino acid alanine (A) was changed to aspartic acid (D) and 255th amino acid glycine (G) was changed to aspartic acid (D). The codon optimized TEV (CpTEVp-optEc) is the 5` end EcoR I, at the 3 'end Xho I restriction enzyme site and inserted into pJ204 vector, and designated as CpTEVp-optEc-pJ204. The amino acid sequence of the 17th amino acid threonine (T) is serine (S), the 56th amino acid leucine (L) is valine (V), the 68th amino acid asparagine (N) is aspartic acid (D), the 77th amino acid isoleucine (I) the amino acid serine (S) at the 135th position was substituted with glycine (G) and the amino acid serine (S) at position 219 was replaced with valine (V).

The optimized glutaminase and TEV plasmids were digested with EcoR I and Xho I restriction enzyme treatment, pKPM :: MBP vector and pKPM vector were digested with the same restriction enzymes. This plasmid was finally named pKPM :: pro-TEVsite-TGase, pKPM :: MBP-pro-TEVsite-TGase and pKPM :: MBP-TEV.

< Example  2> Result of protein expression in flask

E. coli was transformed with each vector according to Example 1 to induce expression.

The Escherichia coli used was B-type E. coli BL21 (DE3) ( E. coli B F- dcm We used opmT hsdS (rB- mB -a) gal λ, Novagen, USA) and E. coli K series of MG1655 (DE3) [F- λ- ilvG- rfb -50 rph -1] as a host cell for gene expression , And the transformants were cultured at 37 ° C, 28 ° C and 22 ° C for about 16 hours using an auto induction medium containing 50 μg / ml kanamycin (Table 1). Expression system generally induces overexpression of protein by activating T7 promoter using expensive IPTG. However, instead of using this auto induction medium used in this study, lactoose was replaced with inducer in place of IPTG, and the recombinant strain cell Concentration and protein overexpression were induced.

 Auto induction medium composition ingredient g / L Glucose 30 Glycerol 20 Lactose 15 MgSO ₄ -7H ₂ O 2 Yeast extract 20 Casein peptone 10 (NH _{4) 2} SO ₄ 10 NaCl 0.5 Trace element (ml) One Antiform (ml) 0.5 KH ₂ PO ₄ 3 Na ₂ HPO ₄ -12H ₂ O 3

As a result, the strain transformed with the pKPM :: pro-TEV site-TGase vector was expressed as an insoluble protein in all 37 ° cultures. In 28 ° culturing, only 50% of the protein was soluble and 100% Soluble (Fig. 2a). The strain transformed with pKPM :: MBP-pro-TEVsite-TGase vector was expressed in 50% of the proteins in a water-soluble state at 37 ° C and 100% in water at 28 ° C and 22 ° C (FIG. The strain transformed with the pET :: MBP-TEV site-TEV vector recognized the TEV site within the expression structure by expressing the TEV protein in the cell and self-cleavage between the MBP and the TEV. Western blot analysis revealed that the water soluble MBP protein band (42 kDa) and the TEV (25 kDa) protein band were detected in 37 ° culture (FIG. 2c).

< Example  3> Result of Protein Expression in Fermenter

The strain transformed with the pKPM :: MBP-pro-TEVsite-TGase vector was cultured in a 5 L fermenter to induce a large amount of protein expression. Table 2 shows the composition of the medium for fermentation. At an initial glucose concentration of 15 g / L, when the pH and DO are rapidly increased due to depletion of glucose, an alternative inducing substance, lactose, is supplied at a rate of 15 g / L and at the same time necessary for the survival of E. coli For a minimum supply of carbon, 600 g / L of glucose was continuously fed at 6 g / L / h. As a result of the culture, the cells were grown at a high concentration of about 155.2 OD. After analysis of the protein expression by electrophoresis after culture, the amount of TGase expressed at the end of the culture was 45% of the total protein and all the water was 12.62 g / L Respectively.

Fermenter culture medium composition ingredient g / L
(Early) g / L
(adding) Glucose 15 600 Lactose - 15 MgSO ₄ One - Yeast extract 20 - Casein peptone 15 - (NH _{4) 2} SO ₄ 8 - NaCl One - Trace element (ml) One - Antiform (ml) 0.5 - KH ₂ PO ₄ 1.6 - K ₂ HPO ₄ 4.4 -

< Example  4> In the fermentation tank, MBP - TGase  Confirm separation result

Cells expressed in Example 2 were disrupted by sonication, and pro-TGase, MBP-pro-TGase and TEV proteins were purified from the supernatant using Ni-NTA agarose resin. The purified protein was dialyzed with 50mM NaH ₂ PO _{4 and} 2H ₂ O, 250mM NaCl pH7.5 buffer. Pro-TGase and TEV proteins, MBP-pro-TGase and TEV proteins were mixed at 20 ug each and reacted at 37 ° C for 1 hour.

Lanes 1 and 4 of FIG. 5 show purified MBP-proTGase and proTGase proteins, lanes 3 and 6 of purified TEV protein, lane 2 of MBP-proTGase and TEV after mixing for 1 hour at 37 ° C, TEV mixed and reacted at 37 ° C for 1 hour. That is, the active TGase was isolated by TEV cleavage of proteins expressed in the form of MBP-pro-TGase and pro-TGase. As a result, active TGase was isolated by TEV (FIG. 5) .

< Example  5> in vivo Confirm activation of transglutaminase in conditions

In the present invention, a method established for producing active-type transglutaminase is a protein in which both types of TGase and TEV used as a substrate are purified. To minimize the active transglutaminase separation process step and to increase the efficiency of TEV protease, a vector expressing transglutaminase and TEV protein in vivo was developed (Fig. 7).

To obtain only active TGase, the tag was added to the C terminal of the TGase protein and the tag was not attached to the TEV protein. Primers were designed to include the T7 promoter and T7 terminator of the pKPM MBP-pro-TEV site-TGase plasmid constructed in Example 1, and HindIII restriction enzymes were introduced at both ends of the primers. The amplified DNA was inserted into pACYC184 digested with Hind III using the In-fusion ™ Advantage PCR cloning kit (Clontech, USA). The constructed plasmid was named pACYC MBP-pro-TGase.

pKPM The T7 promoter of MBP-TEV and the T7 terminator at both ends And amplified with a primer containing Sal I enzyme. The PCR product was Sal using the In-fusion ™ Advantage PCR cloning kit (Clontech, USA) I &lt; / RTI &gt; digested pACYC184 MBP-pro-TGase. The constructed plasmid was finally named pACYC MBP-pro-TGase :: MBP-TEV. The in vivo expression system of the present invention is illustrated in FIG.

Primer sequence information name Sequence (5'-3`) SEQ ID NO: Hind III For GTTTGACAGCTTATCATCGAT aagctt AATTAATACGACTCACTATAG 11 Hind III Rev CTGTGATAAACTACCGCATTA aagctt CAAAAAACCCCTCAAGACCCG 12 Sal I For CAGGAGTCGCATAAGGGAGAGC gtcgac AATTAATACGACTCACTATAG 13 Sal I Rev GAAGGCTCTCAAGGGCATCG gtcgac CAAAAAACCCCTCAAGACCCG 14

The expression vector prepared by the above method was transformed into E. coli MG1655 and BL21 strains. The transformants were cultured in LB medium containing 25 μg / ml of chloramphenicol for 3 hours at 37 ° C. (OD 0.4), after which 0.04 mM, 0.4 mM IPTG was added and incubated at 200 rpm and 25 ° C. for about 16 hours Lt; / RTI &gt;

As a result of the flask culture of the transformant, it was confirmed that the fusion protein was 100% degraded by TEV in MG1655 strain to generate active transglutaminase (FIG. 8).

The expression-confirmed cells were disrupted by sonication and purified from the supernatant using Ni-NTA agarose resin to isolate active TGase having a purity of 90% (FIG. 9).

The isolated active transglutaminase was subjected to N-terminal analysis by the Korea Basic Science Institute to confirm the protein sequence of the active transglutaminase. The protein activity was confirmed by using a microbial transglutaminase assay kit (Zedira), and it was confirmed that the activity was 31.17 U / mg.

Also, it was confirmed that TGase was activated in vivo by fed-batch culture (FIG. 10). Specifically, the MG1655 strain transformed with the pACYC MBP-pro-TGase :: MBP-TEV plasmid was cultured in a 5 L fermenter to induce a large amount of protein expression. Table 4 shows the composition of the medium for fermentation. At an initial glucose concentration of 15 g / L, and at the point when the pH and DO increase rapidly due to depletion of glucose, 600 g / L of glucose was added to the solution to obtain the minimum amount of carbon source necessary for the survival of E. coli. / L / h. When the cells reached 8 OD, 0.04 mM IPTG as an inducing substance was added. The culture temperature was lowered to 25 ° C to induce water-soluble protein expression. As a result of the culture, the cells were grown to about 26.48 OD. After the culture, the expression of TGase was 3.1% of the total protein at the end of the culture, and 156 mg / L was expressed as water soluble.

Fermenter culture medium composition ingredient g / L
(Early) g / L
(adding) Glucose 15 600 IPTG - 0.04 mM MgSO ₄ One - Yeast extract 20 - Casein peptone 15 - (NH _{4) 2} SO ₄ 8 - NaCl One - Trace element (ml) One - Antiform (ml) 0.5 - KH ₂ PO ₄ 1.6 - K ₂ HPO ₄ 4.4 -

<110> Korea Research Institute of Bioscience & Biotechnology <120> MASS PRODUCTION METHOD OF RECOMBINANT TRANS GLUTAMINASE <130> p14r16d1756 <160> 14 <170> Kopatentin 2.0 <210> 1 <211> 367 <212> PRT <213> Artificial Sequence <220> <223> maltose binding protein <400> 1 Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys   1 5 10 15 Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr              20 25 30 Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe          35 40 45 Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala      50 55 60 His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile  65 70 75 80 Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp                  85 90 95 Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu             100 105 110 Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys         115 120 125 Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly     130 135 140 Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro 145 150 155 160 Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys                 165 170 175 Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly             180 185 190 Leu Thr Phe Leu Val Asp Leu Ile Lys Asn Lys His Met Asn Ala Asp         195 200 205 Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala     210 215 220 Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys 225 230 235 240 Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser                 245 250 255 Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro             260 265 270 Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp         275 280 285 Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala     290 295 300 Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala 305 310 315 320 Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln                 325 330 335 Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala             340 345 350 Ser Gly Arg Gln Thr Val Asp Glu Ala Leu Lys Asp Ala Gln Thr         355 360 365 <210> 2 <211> 45 <212> PRT <213> Artificial Sequence <220> <223> proteolytic-resistant sequence <400> 2 Asp Asn Gly Ala Gly Glu Glu Thr Lys Ser Tyr Ala Glu Thr Tyr Arg   1 5 10 15 Leu Thr Ala Asp Asp Val Ala Asn Ile Asn Ala Leu Asn Glu Ser Ala              20 25 30 Pro Ala Ala Ser Ser Ala Gly Ser Ser Phe Arg Ser Pro          35 40 45 <210> 3 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Tobacco etch virus cleavage site <400> 3 Glu Asn Leu Tyr Phe Gln Gly   1 5 <210> 4 <211> 339 <212> PRT <213> Artificial Sequence <220> <223> Transglutaminase <400> 4 Asp Ser Asp Asp Arg Val Thr Pro Pro Ala Glu Pro Leu Asp Arg Met   1 5 10 15 Pro Asp Pro Tyr Arg Pro Ser Tyr Gly Arg Ala Glu Thr Val Val Asn              20 25 30 Asn Tyr Ile Arg Lys Trp Gln Gln Val Tyr Ser His Arg Asp Gly Arg          35 40 45 Lys Gln Gln Met Thr Glu Glu Gln Arg Glu Trp Leu Ser Tyr Gly Cys      50 55 60 Val Gly Val Thr Trp Val Asn Ser Gly Gln Tyr Pro Thr Asn Arg Leu  65 70 75 80 Ala Phe Ala Ser Phe Asp Glu Asp Arg Phe Lys Asn Glu Leu Lys Asn                  85 90 95 Gly Arg Pro Arg Ser Gly Glu Thr Arg Ala Glu Phe Glu Gly Arg Val             100 105 110 Ala Lys Glu Ser Phe Asp Glu Glu Lys Gly Phe Gln Arg Ala Arg Glu         115 120 125 Val Ala Ser Val Met Asn Arg Ala Leu Glu Asn Ala His Asp Glu Ser     130 135 140 Ala Tyr Leu Asp Asn Leu Lys Lys Glu Leu Ala Asn Gly Asn Asp Ala 145 150 155 160 Leu Arg Asn Glu Asp Ala Arg Ser Pro Phe Tyr Ser Ala Leu Arg Asn                 165 170 175 Thr Pro Ser Phe Lys Glu Arg Asn Gly Gly Asn His Asp Pro Ser Arg             180 185 190 Met Lys Ala Val Ile Tyr Ser Lys His Phe Trp Ser Gly Gln Asp Arg         195 200 205 Ser Ser Ser Ala Asp Lys Arg Lys Tyr Gly Asp Pro Asp Ala Phe Arg     210 215 220 Pro Ala Pro Gly Thr Gly Leu Val Asp Met Ser Arg Asp Arg Asn Ile 225 230 235 240 Pro Arg Ser Pro Thr Ser Pro Gly Glu Gly Phe Val Asn Phe Asp Tyr                 245 250 255 Gly Trp Phe Gly Ala Gln Thr Glu Ala Asp Ala Asp Lys Thr Val Trp             260 265 270 Thr His Gly Asn His Tyr His Ala Pro Asn Gly Ser Leu Gly Ala Met         275 280 285 His Val Tyr Glu Ser Lys Phe Arg Asn Trp Ser Glu Gly Tyr Ser Asp     290 295 300 Phe Asp Arg Gly Ala Tyr Val Ile Thr Phe Ile Pro Lys Ser Trp Asn 305 310 315 320 Thr Ala Pro Asp Lys Val Lys Gln Gly Trp Pro Leu Glu His His His                 325 330 335 His His His             <210> 5 <211> 241 <212> PRT <213> Artificial Sequence <220> <223> codon-optimized tobacco etch virus protease <400> 5 Gly Glu Ser Leu Phe Lys Gly Pro Arg Asp Tyr Asn Pro Ile Ser Ser   1 5 10 15 Ser Ile Cys His Leu Thr Asn Glu Ser Asp Gly His Thr Thr Ser Leu              20 25 30 Tyr Gly Ile Gly Phe Gly Pro Phe Ile Ile Thr Asn Lys His Leu Phe          35 40 45 Arg Arg Asn Asn Gly Thr Leu Val Val Gln Ser Leu His Gly Val Phe      50 55 60 Lys Val Lys Asp Thr Thr Thr Leu Gln Gln His Leu Val Asp Gly Arg  65 70 75 80 Asp Met Ile Ile Ile Arg Met Pro Lys Asp Phe Pro Pro Phe Pro Gln                  85 90 95 Lys Leu Lys Phe Arg Glu Pro Gln Arg Glu Glu Arg Ile Cys Leu Val             100 105 110 Thr Asn Phe Gln Thr Lys Ser Met Ser Ser Met Val Ser Asp Thr         115 120 125 Ser Cys Thr Phe Pro Ser Gly Asp Gly Ile Phe Trp Lys His Trp Ile     130 135 140 Gln Thr Lys Asp Gly Gln Cys Gly Ser Pro Leu Val Ser Thr Arg Asp 145 150 155 160 Gly Phe Ile Val Gly Ile His Ser Ala Ser Asn Phe Thr Asn Thr Asn                 165 170 175 Asn Tyr Phe Thr Ser Val Pro Lys Asn Phe Met Glu Leu Leu Thr Asn             180 185 190 Gln Glu Ala Gln Gln Trp Val Ser Gly Trp Arg Leu Asn Ala Asp Ser         195 200 205 Val Leu Trp Gly Gly His Lys Val Phe Met Val Lys Pro Glu Glu Pro     210 215 220 Phe Gln Pro Val Lys Glu Ala Thr Gln Leu Met Asn Arg Arg Arg Arg 225 230 235 240 Arg     <210> 6 <211> 1101 <212> DNA <213> Artificial Sequence <220> <223> maltose binding protein <400> 6 atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60 ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120 ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180 atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240 accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300 aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360 gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420 aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480 ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540 gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600 aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660 ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720 gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780 ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840 ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900 ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960 actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020 tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080 gccctgaaag acgcgcagac t 1101 <210> 7 <211> 135 <212> DNA <213> Artificial Sequence <220> <223> proteolytic-resistant sequence <400> 7 gacaatggcg cgggggaaga gacgaagtcc tacgccgaaa cctaccgcct cacggcggat 60 gacgtcgcga acatcaacgc gctcaacgaa agcgctccgg ccgcttcgag cgccggcccg 120 tcgttccggt ccccc 135 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> tobacco etch virus cleavage site <400> 8 gagaatcttt attttcaggg c 21 <210> 9 <211> 1020 <212> DNA <213> Artificial Sequence <220> <223> codon-optimized trans glutaminase <400> 9 gattctgatg accgcgtaac cccaccagct gaaccactcg atcgcatgcc agacccttat 60 cgcccgtcct atggtcgcgc ggaaacggtc gttaacaact atattcgtaa atggcaacaa 120 gtttacagcc atcgtgacgg tcgtaagcag cagatgacgg aagagcagcg cgagtggctg 180 agctacggtt gcgtcggtgt tacctgggtc aatagcggcc agtacccgac gaaccgtctg 240 gcgtttgcga gcttcgatga ggatcgtttt aagaacgagc tgaagaacgg tcgtccgcgt 300 agcggtgaaa cccgtgcgga gtttgagggc cgtgtcgcaa aagagtcgtt cgatgaagaa 360 aaaggcttcc aacgcgctcg tgaagtggcc agcgtgatga atcgtgcgct ggagaacgca 420 cacgacgaaa gcgcgtacct ggacaatttg aagaaagagc tggcgaatgg caatgatgcg 480 ctgcgtaacg aggatgcgcg cagcccgttt tactctgcct tgcgtaacac cccgtccttc 540 aaagagcgta acggtggtaa tcatgatccg agccgcatga aagcggtgat ctatagcaag 600 catttttgga gcggtcaaga tcgtagcagc agcgcagaca agcgcaaata cggcgacccg 660 gcgcgttcc gccctgcacc gggtaccggc ctggtggata tgagccgcga ccgtaatatc 720 ccgcgtagcc cgacctctcc gggcgaaggt ttcgttaact ttgactacgg ctggttcggt 780 gcccagactg aggcggacgc tgataaaacc gtgtggaccc acggtaatca ctatcacgcc 840 ccgaacggca gcctgggcgc aatgcacgtt tacgaaagca agttccgtaa ttggtccgag 900 ggttacagcg acttcgaccg tggtgcctat gttattacgt ttatcccgaa gtcctggaat 960 acggcaccgg acaaggtgaa acagggttgg ccgctcgagc accaccacca ccaccactga 1020                                                                         1020 <210> 10 <211> 729 <212> DNA <213> Artificial Sequence <220> <223> Tobacco etch virus protease <400> 10 ggtgaatcgc tgtttaaagg tccgcgcgac tataatccga ttagcagctc tatctgtcac 60 ctgacgaatg agagcgatgg tcacaccacc tctctgtacg gcatcggttt tggtccgttc 120 attatcacga ataaacactt gtttcgccgc aataatggca ccctggtcgt tcagagcctg 180 cacggtgtgt tcaaggttaa agacacgacc actctgcagc aacacttggt ggatggccgt 240 gatatgatta tcatccgtat gcctaaagat ttcccgccgt tcccgcagaa gctgaagttc 300 cgcgaaccac aacgtgaaga gcgtatctgc ctggttacga ccaattttca gaccaagagc 360 atgtccagca tggtgagcga cacgtcctgt accttcccga gcggtgatgg catcttttgg 420 aagcattgga ttcaaactaa ggacggtcag tgcggcagcc cgctggttag cacccgtgac 480 ggcttcattg tcggcattca ttcggcgagc aactttacga ataccaataa ctactttacc 540 agcgtcccga agaatttcat ggagttgctg acgaatcaag aggcacaaca atgggtaagc 600 ggttggcgtc tgaacgccga ctccgtgctg tggggtggtc ataaagtgtt catggttaaa 660 ccagaagagc cgtttcagcc ggtcaaagag gcgacccagc tgatgaatcg tcgtcgtcgc 720 cgttaataa 729 <210> 11 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Hind III Forward primer <400> 11 gtttgacagc ttatcatcga taagcttaat taatacgact cactatag 48 <210> 12 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Hind III Reverse primer <400> 12 ctgtgataaa ctaccgcatt aaagcttcaa aaaacccctc aagacccg 48 <210> 13 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Sal I Forward primer <400> 13 caggagtcgc ataagggaga gcgtcgacaa ttaatacgac tcactatag 49 <210> 14 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Sal I Reverse primer <400> 14 gaaggctctc aagggcatcg gtcgaccaaa aaacccctca agacccg 47

Claims (13)

A first recombinant expression vector comprising a gene encoding a protein for inducing water-soluble expression, an intracellular activity-inhibiting sequence of a recombinant transglutaminase, a gene encoding a protease recognition site, and a gene encoding a transglutaminase ; And a second recombinant expression vector comprising a gene encoding a protein for inducing water-soluble expression and a gene encoding a proteolytic enzyme; And
Culturing the transformed microorganism to produce an active recombinant transglutaminase; &Lt; RTI ID = 0.0 &gt; transglutaminase. &Lt; / RTI &gt; 2. The method for producing a recombinant transglutaminase according to claim 1, wherein the water-soluble expression inducing protein is a maltose binding protein comprising the amino acid sequence of SEQ ID NO: 1. 2. The recombinant transglutaminase according to claim 1, wherein the intracellular activity inhibition sequence of the recombinant transglutaminase is a proteolytic-resistant sequence consisting of the amino acid sequence of SEQ ID NO: 2. Production method. The method according to claim 1, wherein the protease is TEV (Tavacco Etch Virus) protease comprising the amino acid sequence of SEQ ID NO: 5. 2. The method for producing a recombinant transglutaminase according to claim 1, wherein the first recombinant expression vector is represented by Fig. 2. The method for producing a recombinant transglutaminase according to claim 1, wherein the second recombinant expression vector is shown in Fig. 2. The method according to claim 1, wherein the first recombinant expression vector and the second recombinant expression vector are co-expressed as a water soluble fusion protein. [Claim 7] The method according to claim 7, wherein the proteolytic enzyme expressed by the second recombinant expression vector is an active type of transglutaminase by removing the inhibitory site of the water soluble fusion protein expressed by the first recombinant expression vector Of the recombinant transglutaminase. The method for producing a recombinant transglutaminase according to claim 1, wherein the culturing temperature is 20 to 40 ° C. The method for producing a recombinant transglutaminase according to claim 1, wherein the transformed microorganism is E. coli. The method for producing a recombinant transglutaminase according to claim 1, further comprising the step of separating and purifying the produced recombinant transglutaminase. A gene encoding a protein for inducing water-soluble expression, a proteolytic-resistant sequence of a recombinant transglutaminase, a gene encoding a protease recognition site, and a gene encoding a transglutaminase; A recombinant expression vector for producing a recombinant transglutaminase comprising in sequence a gene encoding a protein for inducing water-soluble expression and a gene encoding a protease. 13. The recombinant expression vector for production of recombinant transglutaminase according to claim 12, wherein said recombinant expression vector is as shown in Fig.

Images