CN108251400B

CN108251400B - Lipase and application thereof

Info

Publication number: CN108251400B
Application number: CN201611244004.XA
Authority: CN
Inventors: 戴小军; 徐正军; 周美凤; 牛其文
Original assignee: Wilmar Shanghai Biotechnology Research and Development Center Co Ltd
Current assignee: Wilmar Shanghai Biotechnology Research and Development Center Co Ltd
Priority date: 2016-12-29
Filing date: 2016-12-29
Publication date: 2022-11-29
Anticipated expiration: 2036-12-29
Also published as: CN108251400A

Abstract

The invention relates to lipase and application thereof. In particular, the present invention provides a polypeptide selected from the group consisting of: (1) A polypeptide having substitution mutations at least one of positions 150, 222, 285 and 291 of the amino acid sequence shown in SEQ ID NO. 2; and (2) a polypeptide consisting of the polypeptide shown in (1) and a polypeptide which promotes the expression and purification of the polypeptide shown in (1). The invention also provides polynucleotide sequences encoding the polypeptides, nucleic acid constructs comprising the polynucleotide sequences, host cells, and related uses. The polypeptide is lipase, and can be used in oil refining, oil processing, oil chemical industry, feed modifier, food industry, biodiesel preparation and medical industry.

Description

Lipase and application thereof

Technical Field

The present invention relates to lipase variants and uses thereof.

Background

Lipase (EC 3.1.1.3), also called triacylglycerol acylhydrolase, is an enzyme that can hydrolyze long-chain ester compounds in aqueous phase and can also catalyze ester synthesis reaction or transesterification reaction in non-aqueous phase. Lipases are widely distributed in nature, and lipases are reported in microorganisms, animals and plants, wherein microbial lipase resources are most abundant, so that microbial lipases become main sources of industrial lipases.

The lipase has wide application, including wide application in the fields of oil processing, oil chemical industry, food industry, medicine and health, chemical industry and the like. In the oil industry, deacidification steps are generally required for high-acid-value oil, the common alkali refining deacidification and physical deacidification methods have the problem of high loss, a large amount of nutrient components such as oryzanol in the oil are also lost, and in addition, a large amount of organic wastewater is generated to pollute the environment. The deacidification by the lipase method is a novel deacidification method for grease. The method utilizes specific lipase to catalyze the esterification reaction of Free Fatty Acid (FFA) in grease and glycerol under certain conditions, so that most of the FFA is converted into glyceride, and the FFA content in the rice bran oil is reduced.

The biodiesel is a renewable clean fuel prepared by taking oils and fats containing carboxylic acid group compounds, such as animal and vegetable oils and fats, acidified oil and the like, as raw materials through an esterification or ester exchange process, and belongs to one of biomass energy. Compared with the traditional petrochemical diesel oil, the biodiesel has good fuel performance, higher safety performance, high low-temperature starting performance of an engine and good lubricating performance, can prolong the service life of the engine, is a real green energy source, and is widely paid high attention by countries in the world. At present, chemical methods are mostly used for producing biodiesel industrially, although the yield is high, the defects of high alcohol consumption, difficult product recovery, high environmental pollution and the like exist, and the enzymatic method for preparing the biodiesel by using lipase has the advantages of mild reaction conditions, strong specificity, easy product separation, no environmental pollution and the like, and becomes the mainstream development direction of the biodiesel preparation technology at present.

The lipase for preparing the biodiesel also has difference in catalytic properties, and Candida Antarctica Lipase B (CALB) has no position specificity and can simultaneously act on ester bonds at 1,2,3 of triglyceride. CALB lipase has high catalytic activity to water-soluble and water-insoluble substances, and is most widely applied. However, natural CALB still has certain drawbacks, such as poor thermal stability, poor water content tolerance, etc. CalB was successfully cloned in 1995 and expressed efficiently in Aspergillus oryzae (Aspergillus oryzae) and successfully commercialized by Novoxin. CalB is mainly applied in the form of adsorbing/binding CalB enzyme protein on a medium to form immobilized enzyme, such as the field of biodiesel preparation. The immobilized CalB often cannot be reused for the required times due to factors such as methanol, impurities and the like. Therefore, there is a need for CalB mutants that are more stable, react faster or have higher esterification rates.

Reports of increased enzymatic properties of CalB by mutation are: CN102660517A discloses that CALB mutant containing D223G, L M and their combination has improved thermal stability; KR20120114129 discloses that mutation of mutant V139 and/or I255 to E or D or R or K can enhance the activity of CalB. CN102612557A discloses a T40A, T V or T40S; one or double mutated CalB mutants of a281V, A281E, A282L, A282T, A282C, A282P, A282I, A D, A282V, A282M, A R and I285F increased the selectivity of the lipase for the mono-acylation of the polyol). CN103881992a discloses mutants exhibiting higher activity and selectivity to ester derivatives of ibuprofen compounds. CN104745550A discloses CalB mutant A141S-A283V, CALB-Lost, S201D, A S, S N-Q106H, T S-S47N, and (R) -3-substituted glutaric acid monoalkyl ester compounds can be prepared in a non-aqueous phase in a catalytic manner. From these disclosures, it can be seen that CalB is widely used in the synthesis of carboxyl and hydroxyl groups and is not limited to the preparation of fatty acid methyl or ethyl esters.

There remains a need in the art for CALB lipase mutants with further improved enzymatic properties. Compared with wild CalB lipase, the CALB lipase mutant provided by the application has the advantages that the esterification specific activity is improved, the hydrolysis preference of methyl ester is reduced, the tolerance capability of methanol is improved, and the CALB lipase mutant is suitable for directional application such as esterification reaction and hydrolysis reaction.

Disclosure of Invention

The object of the present application is to provide lipase CALB mutants. Specifically, the CALB lipase mutant has improved esterification specific activity, reduced hydrolysis preference of methyl ester and improved tolerance to methanol, and is suitable for directional applications such as esterification, hydrolysis, transesterification and the like, especially for biodiesel preparation, oil deacidification refining and the like.

Accordingly, in a first aspect the invention provides a polypeptide selected from the group consisting of:

(1) The polypeptide of the amino acid sequence shown in SEQ ID NO. 4 or 6, or the polypeptide obtained when conservative substitution is carried out on the amino acid sequence shown in SEQ ID NO. 4 or 6 by amino acids with similar or similar performance; and

(2) The polypeptide consists of the polypeptide shown in (1) and the polypeptide for promoting the expression and purification of the polypeptide shown in (1).

In one or more embodiments, the amino acid sequence of the polypeptide is as set forth in SEQ ID NO:4 or 6.

In one or more embodiments, the polypeptide is a lipase.

In a second aspect, the present invention provides a polynucleotide selected from:

(1) A polynucleotide encoding a polypeptide of the invention;

(2) A polynucleotide complementary to the polynucleotide sequence of (1); and

(3) A fragment of the polynucleotide of (1) or (2) which is 10 to 40 bases, preferably 15 to 30 bases in length.

In one or more embodiments, the polynucleotide has a sequence as set forth in SEQ ID NO:3 or 5.

In a third aspect, the invention provides a polynucleotide construct comprising a polynucleotide according to the invention.

In one or more embodiments, the polynucleotide construct is an expression vector or a cloning vector.

In a fourth aspect, the invention provides a genetically engineered host cell which:

(1) Expressing the polypeptide of the invention; and/or

(2) Comprising a polynucleotide or polynucleotide construct of the invention.

The fifth aspect of the present invention also provides a composition, which comprises the polypeptide of the present invention and optionally an adjuvant, preferably, the adjuvant is a buffer (liquid enzyme) or an adsorbing material (immobilized enzyme) selected from resin, activated carbon, alumina, diatomaceous earth, porous ceramic, porous glass, etc.

The sixth aspect of the invention provides the use of the polypeptide, nucleic acid molecule, vector, cell, composition of the present application in oil refining, oil processing, oil chemical industry, feed improvement, food industry, biodiesel production, and pharmaceutical industry.

The seventh aspect of the present invention provides a method for producing biodiesel, which is characterized by comprising a step of synthesizing biodiesel using the polypeptide of the present invention, and may be an esterification reaction or a transesterification reaction.

In one or more embodiments, the step of performing an esterification reaction or transesterification reaction in the presence of water and the polypeptide of the present invention is performed using an oil or fat containing a carboxylic acid group-containing compound and a hydroxyl group-containing compound as raw materials.

In one or more embodiments, the hydroxyl containing compound is an organic alcohol.

In one or more embodiments, the organic alcohol is selected from the group consisting of glycerol, methanol, ethanol, and mixtures of one or more thereof.

In one or more embodiments, the fat or oil containing a carboxylic acid group-containing compound refers to an edible fat or oil having an acid value exceeding national standards; preferably the grease containing carboxylic acid group-containing compound is selected from: crude oil, partially refined fats and oils, waste cooking oil, crude oleic acid, acidified oil, or a mixture of PFAD and fatty acid esters; preferably the PFAD and the fatty acid ester are present in a mixture of PFAD and fatty acid ester, the PFAD content being 1 to 80% by weight and the fatty acid ester content being 20 to 99% by weight; more preferably, the fatty acid ester is a fatty acid methyl ester or a fatty acid ethyl ester.

In one or more embodiments, the organic alcohol is added in a batch or fed-batch manner.

In one or more embodiments, the molar amount of the organic alcohol is more than 1 time of the molar number of the carboxylic acid groups in the grease containing the carboxylic acid group-containing compound.

In one or more embodiments, the amount of polypeptide is 0.01% or more, e.g., between 0.01 and 0.3% by weight of the carboxylic acid group-containing compound-containing oil;

in one or more embodiments, water is optionally added in an amount of 1% or more, for example, 1 to 30%, 2 to 20%, or 2 to 5% by weight of the carboxylic acid group containing compound-containing fat or oil;

in one or more embodiments, the pH of the reactants is adjusted by the addition of a base, preferably the base is NaOH, more preferably the base is added in an amount of 0.005% or more, for example between 0.005 and 0.15% or between 0.005 and 0.1% by weight of the carboxylic acid group containing compound based on the weight of the oil or fat; and

in one or more embodiments, the temperature of the reaction is in the range of 35 ± 5 ℃.

In one or more embodiments, the polypeptide used is a polypeptide having an amino acid sequence shown in SEQ ID NO. 4, which is used in an amount of 0.01% or more, preferably 0.01 to 0.3% by weight of the carboxylic acid group-containing compound-containing fat and oil; or

In one or more embodiments, the polypeptide used is a polypeptide having an amino acid sequence as shown in SEQ ID NO. 6, in an amount of 0.01% or more, preferably between 0.01 and 0.3% by weight of the lipid containing a carboxylic acid group-containing compound.

An eighth aspect of the present invention provides a method for deacidifying fats and oils, which is characterized by comprising a step of catalyzing esterification of fatty acids in fats and oils using the polypeptide of the present invention.

In one or more embodiments, the grease is a grease containing a carboxylic acid group-containing compound that is a fatty acid.

In one or more embodiments, the step of performing an esterification reaction in the presence of the polypeptide of the present invention is performed using an oil or fat and a hydroxyl group-containing compound as raw materials.

In one or more embodiments, the hydroxyl containing compound is an organic alcohol or monoglyceride.

In one or more embodiments, the hydroxyl containing compound is added in portions or streams.

In one or more embodiments, the hydroxyl group-containing compound is used in an amount of 1 or more times the number of moles of carboxylic acid groups in the carboxylic acid group-containing compound-containing oil or fat;

in one or more embodiments, the polypeptide of the present invention is used in an amount of 0.01% by weight or more, preferably, 0.01 to 0.3% by weight of the carboxylic acid group-containing compound;

In one or more embodiments, the polypeptide used is a polypeptide having an amino acid sequence shown in SEQ ID No. 4, which is used in an amount of 0.01% or more, preferably between 0.01 and 0.3% by weight of the lipid containing carboxylic acid group-containing compound; or

In a ninth aspect, the present invention provides a reaction mixture comprising: oils and fats containing carboxylic acid group-containing compounds; a hydroxyl group-containing compound; and a polypeptide of the invention; optionally also containing water.

In one or more embodiments, the fat or oil containing a carboxylic acid group-containing compound refers to an edible fat or oil having an acid value exceeding national standards.

In one or more embodiments, the lipid containing carboxylic acid group-containing compound may be selected from: crude oil, edible oil with higher acid value, partially refined edible oil, waste cooking oil, crude oleic acid, acidified oil, or a mixture of PFAD and fatty acid ester; preferably, the fatty acid ester is a fatty acid methyl ester or a fatty acid ethyl ester.

In one or more embodiments, the fats and oils containing carboxylic acid group-containing compounds refer to crude oils, decolorized vegetable fats and oils, deacidified vegetable fats and oils.

In one or more embodiments, the hydroxyl-containing compound is an organic alcohol or monoglyceride, such as glycerol, methanol, or ethanol; preferably, the total molar amount of the hydroxyl group-containing compound is 1 or more times the molar amount of the carboxylic acid groups in the oil or fat containing the carboxylic acid group-containing compound.

In one or more embodiments, the amount of the polypeptide is 0.01% or more, for example, 0.01% to 0.3% by weight of the carboxylic acid group-containing compound based on the oil or fat.

In one or more embodiments, water is optionally included, preferably in an amount greater than 1%, such as between 1 and 30%, 2 and 20%, or 2 and 5% by weight of the carboxylic acid group-containing compound-containing oil or fat.

The lipase provided by the application has the advantages that the enzymatic properties are greatly improved, and compared with wild CalB lipase, the esterification specific activity is improved, the hydrolysis preference of methyl ester is reduced, the tolerance capacity to methanol is improved, and the lipase can be used for preparing biodiesel or deacidifying grease and the like.

Drawings

FIG. 1 shows the results of esterification plate rescreening. Ori is a recombinant yeast containing pAOCalB gene, and is a wild type control. The rest numbers, including A-H and 1-4, are recombinant yeasts containing pEPCalB mutant library gene plasmids with higher activity. The two arrows indicate mutant # 3 and mutant # G, respectively.

FIG. 2 shows the PAGE of wild type gene, mutant # 3, mutant # G and commercial enzyme CalB preparation. Horizontal arrows indicate CalB bands from the home-made enzyme preparation, and vertical arrows indicate CalB bands from the commercial enzyme preparation.

FIG. 3 shows the relative esterification activities of wild-type gene, mutant # 3, mutant # G at different temperatures.

FIG. 4 shows the relative hydrolytic activity of wild-type gene, mutant # 3, mutant # G at different pH.

FIG. 5 shows the relative hydrolytic activity of wild-type gene, mutant # 3, mutant # G at different ions.

Detailed Description

Definition of

One example of a CALB lipase for use herein is lipase B from Candida Antarctica (Candida Antarctica), herein designated by the abbreviation CALB. It is understood that herein it also refers to mutants obtained in the present application based on this wild-type CALB.

The international common single or three letter abbreviations for amino acids are used herein.

As used herein, the terms "polypeptide", "peptide" and "protein" are used interchangeably to refer to a polymer of multiple amino acids joined by peptide bonds. The amino acids may be naturally occurring or synthetic analogs.

The terms "nucleic acid" and "polynucleotide" as used herein are used interchangeably and include, but are not limited to, DNA, RNA, and the like. Nucleotides may be naturally occurring or synthetic analogs.

The cells herein may be eukaryotic cells or prokaryotic cells, such as, but not limited to, bacterial cells, fungal cells, yeast cells, mammalian cells, insect cells or plant cells.

Polypeptides having lipase activity

The invention provides one or more lipase mutants, and also comprises the construction of expression vectors of the mutants, a preparation method of the variant lipase, the enzymatic properties of the variant lipase and the like. The variant lipase polypeptide provided by the invention has lipase activities of glyceride hydrolysis, esterification and ester exchange, and the variant lipase can have application prospects in various fields of biodiesel preparation, food processing, oil refining, medicines and the like.

The invention also provides a polypeptide with an amino acid sequence shown as SEQ ID NO. 4 or 6. The invention also includes polypeptides obtained when conservative substitutions are made on the basis of the amino acid sequences shown in SEQ ID NO. 4 or 6 with amino acids with similar or similar properties. Such conservative substitutions do not generally alter the function of the protein or polypeptide.

"amino acids with similar or analogous properties" include, for example, families of amino acid residues with analogous side chains, including amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

Alternatively, the "amino acids having similar or similar properties" include aliphatic amino acids such as alanine, valine, leucine, isoleucine, methionine, aspartic acid, glutamic acid, lysine, arginine, glycine, serine, threonine, cysteine, asparagine, and glutamine, according to their chemical structures; aromatic amino acids such as phenylalanine and tyrosine; heterocyclic amino acids such as histidine and tryptophan; and heterocyclic imino acids such as proline.

Thus, in certain embodiments, a conservative substitution at position 150 may be a substitution of serine with an amino acid selected from the group consisting of alanine, valine, leucine, methionine, aspartic acid, glutamic acid, lysine, arginine, glycine, isoleucine, threonine, cysteine, asparagine, and glutamine; alternatively, the conservative substitution may be a substitution of serine with an amino acid selected from glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine.

In certain embodiments, the conservative substitution at position 222 or 285 may be a substitution of isoleucine with an amino acid selected from the group consisting of alanine, valine, leucine, methionine, aspartic acid, glutamic acid, lysine, arginine, glycine, serine, threonine, cysteine, asparagine, and glutamine; alternatively, the conservative substitution may be a substitution of isoleucine with an amino acid selected from the group consisting of alanine, valine, leucine, proline, phenylalanine, methionine and tryptophan.

In certain embodiments, the conservative substitution at position 291 may be a substitution of glutamine with an amino acid selected from the group consisting of glycine, asparagine, serine, threonine, tyrosine, and cysteine; or glutamine is substituted with an amino acid selected from the group consisting of alanine, valine, leucine, isoleucine, methionine, aspartic acid, glutamic acid, lysine, arginine, glycine, serine, threonine, cysteine and asparagine.

In certain embodiments, the amino acid used to replace the serine at position 150 is an amino acid belonging to the same class of amino acids as threonine, including glycine, asparagine, glutamine, serine, tyrosine, and cysteine, as well as alanine, valine, leucine, isoleucine, methionine, aspartic acid, glutamic acid, lysine, and arginine.

In certain embodiments, the amino acid used to replace isoleucine at position 222 is an amino acid belonging to the same class of amino acids as valine, including alanine, leucine, isoleucine, threonine, methionine, aspartic acid, glutamic acid, lysine, arginine, glycine, serine, threonine, cysteine, asparagine, and glutamine, as well as proline, phenylalanine, tryptophan.

In certain embodiments, the amino acid used to replace isoleucine at position 285 is an amino acid belonging to the same amino acid class as threonine, including glycine, asparagine, glutamine, serine, tyrosine, and cysteine, as well as alanine, valine, leucine, isoleucine, methionine, aspartic acid, glutamic acid, lysine, and arginine.

In certain embodiments, the amino acid used to replace glutamine at position 291 is an amino acid of the same class of amino acids as leucine, including alanine, valine, isoleucine, proline, phenylalanine, methionine, and tryptophan; and aspartic acid, glutamic acid, lysine, arginine, glycine, serine, threonine, cysteine, asparagine, and glutamine.

In certain embodiments, the polypeptide of the invention has the substitution at least 1 position or at least 2 positions selected from the group consisting of positions 150, 222, 285, and 291.

In certain embodiments, the polypeptide has the mutation at positions 150 and 291.

In certain embodiments, the polypeptide has the mutation at positions 222 and 285.

In certain embodiments, the polypeptide of the invention has at least one, at least two, or at least three of the following mutations: S150T, Q L, I V and I285T.

In certain embodiments, the mutations present in the polypeptide at positions 150 and 291 are S150T and Q291L.

In certain embodiments, the mutations present in the polypeptide at positions 222 and 285 are I222V and I285T.

In certain embodiments, the polypeptide of the invention comprises an amino acid sequence as set forth in

SEQ ID NO

4 or 6. The invention also includes the amino acid sequences shown in SEQ ID NO. 4, which are substituted, deleted or added with one or more amino acids at other positions except the positions 150 and 291, and simultaneously the amino acid sequences shown in SEQ ID NO:4, and a polypeptide having lipase activity derived from SEQ ID No. 4. The number of the units is usually 10 or less, preferably 8 or less, and more preferably 5 or less.

The invention also comprises the amino acid sequence shown in SEQ ID NO. 6, which is substituted, deleted or added with one or more amino acids at other positions except the positions 222 and 285, and simultaneously retains the amino acid sequence shown in SEQ ID NO:6 and a polypeptide derived from SEQ ID NO 6 having lipase activity. The number of the units is usually 10 or less, preferably 8 or less, and more preferably 5 or less.

Knowing the sequence and biological function of SEQ ID NO. 4 or 6, one skilled in the art can determine which amino acid residues in the amino acid sequence shown in SEQ ID NO. 4 or 6 can be substituted or deleted using conventional techniques. For example, by aligning sequences from different species, having the same or similar or significantly different activities, it can be determined which amino acid residues in the sequences can be substituted or deleted. Such sequences can be verified for enzymatic activity according to the present invention using methods conventional in the art, including those disclosed herein.

Furthermore, it is well known to those skilled in the art that in gene cloning procedures, it is often necessary to design appropriate cleavage sites, which may necessitate the introduction of one or more irrelevant residues at the ends of the expressed protein, which do not affect the activity of the protein of interest. Also, for example, to construct a fusion protein, to facilitate expression of a recombinant protein, to obtain a recombinant protein that is automatically secreted outside of a host cell, or to facilitate purification of a recombinant protein, it is often necessary to add some amino acids to the N-terminus, C-terminus, or other suitable regions within the recombinant protein, for example, including, but not limited to, a suitable linker peptide, signal peptide, leader peptide, terminal extension, glutathione S-transferase (GST), maltose E binding protein, protein a, or factor Xa or the proteolytic enzyme site of thrombin or enterokinase. The amino-terminus or carboxy-terminus of the amino acid sequence of the invention may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used in the present invention. For example, the tag can be FLAG, HA, HA1, c-Myc, poly-His, poly-Arg, strep-TagII, AU1, EE, T7,4A6, ε, B, gE, and Ty1. These tags can be used to purify proteins. Examples of labels used include Poly-Arg, such as RRRRR (SEQ ID NO: 11); poly-His 2-10 (usually 6), such as HHHHHHHHHH (SEQ ID NO: 12); FLAG, DYKDDDDK (SEQ ID NO: 13); strep-TagII, WSHPQFEK (SEQ ID NO: 14); and C-myc, i.e., WQKLISEEDL (SEQ ID NO: 15). It is understood that the presence of these amino acid sequences does not affect the activity of the resulting polypeptide. Thus, the invention also includes polypeptides obtained by adding one or several amino acids to the C-terminus and/or N-terminus of a polypeptide of the invention, which polypeptides still have lipase activity as described herein.

Thus, the present invention also includes amino acid sequences having at least 90%, preferably at least 95%, more preferably at least 98%, more preferably at least 99% sequence identity to the amino acid sequences depicted in SEQ ID NO. 4 or 6. In a more preferred embodiment, such amino acid sequences are also from Candida antarctica, preferably having lipase enzyme activity identical or similar to that of

SEQ ID NO

4 or 6 herein.

Sequence identity can be calculated for two sequences aligned by conventional means, for example, using BLASTP provided by NCBI and using default parameters for alignment.

Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated.

The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or using recombinant technology from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plant, insect and mammalian cells).

Coding sequence

The present application includes the coding sequence of the polypeptides of the invention. Examples of coding sequences for the polypeptides of the invention are shown in

SEQ ID NO

3 and 5. The "coding sequence" includes sequences that are highly homologous to

SEQ ID NO

3 or 5 or sequences that are homologous to SEQ ID NO:3 or 5 or a family gene molecule highly homologous to the above molecules. The sequence encoding the polypeptide of the invention may be identical to, for example, SEQ ID NO:3 or 5, or a degenerate variant thereof. As used herein, "degenerate variants" refers in the present invention to nucleotide sequences that encode the same amino acid sequence but differ in nucleotide sequence.

Sequences encoding the polypeptides of the invention include: a coding sequence encoding only the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide.

The coding sequence of the polypeptide of the present invention or a fragment thereof can be obtained by PCR amplification, recombination, or artificial synthesis.

For the PCR amplification method, the genomic DNA can be obtained from Enterobacter (Enterobacter sp.) by conventional techniques, and then primers can be designed according to the nucleotide sequences disclosed in the present invention, especially the open reading frame sequences, for amplifying lipase genes from the genomic DNA.

Thus, the present invention also includes fragments of the coding sequences of the present invention, which fragments are generally 10 to 40 bases, preferably 15 to 30 bases in length, and can be used as primers or probes. "fragment" as used herein refers to a contiguous portion of the full-length sequence.

The invention also relates to nucleic acid constructs comprising a coding sequence of the invention and one or more control sequences operably linked to the coding sequence and directing the expression of the coding sequence in a host cell under suitable conditions. Polynucleotides encoding the polypeptides of the invention may be manipulated in various ways to ensure expression of the polypeptides. Manipulation of the polynucleotide sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

The control sequence may be an appropriate promoter sequence, a nucleotide sequence recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter sequence comprises transcriptional regulatory sequences linked to the expression of the polypeptide. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. Examples of promoter sequences suitable for use in the present invention include bacterial promoters and fungal promoters, and the like.

The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The check-in sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

The control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino acid terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding sequence of the nucleotide sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region that encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may comprise a signal peptide coding region foreign to the coding region. Where the coding sequence does not naturally contain a signal peptide coding region, a foreign signal peptide coding region may be required. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide. However, any signal peptide coding region that directs the expressed polypeptide into the secretory pathway of a host cell of choice, i.e., into the culture medium, may be used in the present invention.

Carrier

The invention also relates to cloning or expression vectors comprising a polynucleotide of the invention. These vectors may contain various regulatory sequences as described previously.

The expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleotide sequence of interest. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.

The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may comprise any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids, or a transposon, which together contain the total DNA to be introduced into the genome of the host cell, may be used.

The vectors of the invention preferably comprise one or more selectable markers that allow for easy selection of transformed, transfected, transduced, or the like cells. Selectable markers are genes whose products provide resistance to antibiotics or viruses, resistance to heavy metals, prototrophy to auxotrophs, and the like.

The vectors of the present invention preferably contain elements that permit integration of the vector into the host cell genome or autonomous replication of the vector in the cell independent of the genome.

More than one copy of a polynucleotide of the invention may be inserted into the host cell to increase the yield of the gene product. An increase in the copy number of a polynucleotide can be obtained by integrating at least one additional copy of the sequence into the genome of the host cell or by including an amplifiable selectable marker gene with the polynucleotide, wherein cells containing amplified copies of the selectable marker gene and, thus, additional copies of the polynucleotide can be screened for by culturing the cells in the presence of the appropriate selectable agent.

The vectors of the present invention preferably comprise a synthetic sequence containing multiple restriction enzyme recognition sites to provide multiple sites or insertion schemes for foreign DNA. The expression vector of the invention preferably contains small peptides with 6 consecutive histidine sequences, which is beneficial to the extraction and purification of protein.

The expression vector of the present invention is more preferably selected from vectors that can be used for expression in pichia pastoris. The vector of the present invention is preferably a series of vectors such as pPIC, pPICZ, pAO, pGAP or pGAPZ, which are used in commercially available Pichia pastoris.

Cloning vectors containing the polynucleotide sequences of the present invention are useful for replicating a sufficient number of plasmids of interest. Therefore, the cloning vector of the present invention has strong self-replicating elements such as replication initiation sites and the like. Typically, the cloning vectors of the present invention do not have expression elements.

Host cell

The invention also relates to recombinant host cells comprising a polynucleotide of the invention which are used for the recombinant production of the polypeptide. The vector comprising the polynucleotide of the present invention is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as an extrachromosomal self-replicating vector as described earlier. The choice of host cell will depend to a large extent on the gene encoding the polypeptide and its source.

The host cell may be a unicellular microorganism or a non-unicellular microorganism. Unicellular microorganisms such as gram-positive bacteria, including but not limited to bacillus cells, e.g., bacillus alkalophilus, bacillus amyloliquefaciens, bacillus brevis, bacillus megaterium, bacillus subtilis, bacillus licheniformis, bacillus coagulans, bacillus stearothermophilus, bacillus thuringiensis, and the like; or a streptomyces cell, such as streptomyces lividans; or gram-negative bacteria such as E.coli and Pseudomonas. In a preferred aspect, the bacterial host is a Bacillus subtilis, escherichia coli, bacillus licheniformis, bacillus stearothermophilus, and Escherichia coli cell.

The host cell may also be a eukaryote, such as a mammalian, insect, plant, yeast, or fungal cell. In a preferred aspect, the host cell is a eukaryotic cell, and as used herein, "eukaryotic" includes Ascomycota, basidiomycota, chytridiomycota, zygomycota, oomycota, and others.

In a more preferred aspect, the host cell is a cell of the phylum Ascomycota, such as Saccharomyces (Saccharomyces), pichia (Pichia), yarrowia (Yarrowia), candida (Candida), and Komagataella, among others.

In a most preferred aspect, the host cell is Pichia pastoris (Pichia pastoris), saccharomyces cerevisiae (Saccharomyces cerevisiae), yarrowia lipolytica (Yarrowia lipolytica), and the like. In a further most preferred aspect, the host cell is a Pichia pastoris (Pichia pastoris) cell.

Production method

After obtaining the coding sequence for the polypeptide, the polypeptide of the present invention can be produced by a method comprising: (a) Culturing a host cell comprising an expression vector that expresses a polypeptide under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.

Nucleic acid constructs comprising a polynucleotide sequence of the invention can be transferred into host cells using conventional transfection procedures. Transfection is generally divided into transient transfection and stable transfection. The former exogenous DNA/RNA does not integrate into the host chromosome, so multiple copy numbers can be present in a host cell, resulting in high levels of expression, but usually only over a few days. In stable transfection, the foreign DNA may be either integrated into the host chromosome or may be present as an episome. The technical means of transfection include chemical transfection such as DEAE-dextran method, calcium phosphate method and artificial liposome method, and physical transfection such as microinjection, electroporation, gene gun, etc.

The amino acid and coding polynucleotide sequence information of the polypeptide of the invention can be obtained by screening lipase activity and then by cloning and expressing and other technologies. And analyzing the mutant and wild gene expression strain fermentation enzyme liquid through protein SDS-PAGE electrophoresis and comparing with a commercial enzyme preparation to determine the relation between the expression and the relative content of the target protein.

In the production methods of the present invention, the cells can be cultured in a medium suitable for production of the polypeptide using methods known in the art. For example, a cell may be cultured by shake flask culture and small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. Cultivation takes place in a suitable medium comprising carbon and nitrogen sources and inorganic salts using methods known in the art. Suitable media are available from commercial suppliers or may be prepared according to the disclosed compositions. If the polypeptide is secreted into the culture medium, the polypeptide can be recovered directly from the culture medium. If the polypeptide is not secreted into the culture medium, it can be recovered from the cell lysate.

Alternatively, chemical synthesis methods known in the art may also be used to synthesize the polypeptides of the invention. The chemical synthesis method of polypeptide includes solid phase synthesis method and liquid phase synthesis method.

The polypeptide can be detected using methods known in the art that are specific for the polypeptide. These detection methods may include the use of specific antibodies, the formation of an enzyme product, or the disappearance of an enzyme substrate. For example, an enzymatic activity assay can be used to determine the activity of a polypeptide as described herein.

The polypeptides described herein can be recovered using methods known in the art. For example, the polypeptide can be recovered from the culture medium by conventional methods, including but not limited to centrifugation, filtration, ultrafiltration, extraction, chromatography, spray drying, freeze drying, evaporation, or precipitation, and the like.

The polypeptides of the invention can be purified by a variety of methods known in the art, including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobicity, chromatofocusing, size exclusion), electrophoresis (e.g., isoelectric focusing), differential solubility (e.g., salting-out precipitation), SDS-PAGE, or extraction to obtain a substantially pure polypeptide.

Properties and uses of polypeptides

The polypeptide of the application can be applied to various aspects such as biodiesel preparation, grease deacidification, grease hydrolysis, feed improvement agents, food industry, medicine industry and the like, and comprises but is not limited to production of fatty acid methyl ester, fatty acid glyceride and the like.

The polypeptides of the invention may be provided as pure enzyme preparations, or may be provided in the form of compositions. The composition may be a powder composition, a liquid composition, or a paste composition. When provided in a composition, the composition may contain different adjuvants depending on the intended use of the enzyme-containing composition. Adjuvants known in the art may be added to the compositions of the present invention, such adjuvants including, but not limited to, one or more of resins, activated carbon, alumina, diatomaceous earth, porous ceramics, porous glass, etc., adsorbent materials, sorbitol, potassium sorbate, methyl benzoate, ethyl benzoate, sucrose, mannose, trehalose, starch, sodium chloride, calcium chloride, etc., stabilizers, or other substances.

The amount of the polypeptide of the present invention used in the method of the present invention can be determined according to the actual circumstances.

Preparation of biodiesel

The invention also provides a method for oil and fat refining, biodiesel preparation, improved feed, food preparation and medicine preparation by using the polypeptide, wherein the method comprises the step of synthesizing biodiesel by using the polypeptide.

Biodiesel refers to fatty acid monoalkyl esters, most typically fatty acid methyl esters, obtained by esterification and transesterification of oils and fats containing carboxylic acid group-containing compounds with organic alcohols (e.g., methanol, ethanol, glycerol). In the present invention, the oil containing carboxylic acid group compounds can be animal and vegetable oils and fats well known in the art for producing biodiesel, such as edible oils and fats with acid value exceeding national standard; including but not limited to crude oil, partially refined fats and oils, used cooking oil, crude oleic acid, acidified oil, mixtures of PFAD and fatty acid esters, and used cooking oil.

Therefore, the method for producing biodiesel according to the present invention includes a step of catalyzing, using the polypeptide of the present invention, an esterification or transesterification reaction of a carboxylic acid group-containing compound, such as animal or vegetable fat and oil (fatty acid triglyceride), with an organic alcohol (e.g., glycerol, methanol, or ethanol), thereby producing a fatty acid monoalkyl ester. The preparation method of the biodiesel also comprises a step of catalyzing the carboxylic acid group (such as fatty acid) in the grease containing the carboxylic acid group-containing compound to perform esterification reaction with organic alcohol (such as glycerol, methanol and ethanol) by using the polypeptide, so as to prepare the fatty acid monoalkyl ester.

In certain embodiments, the methods of producing biodiesel of the present invention comprise producing biodiesel using the polypeptides of the present invention starting from crude oleic acid, acidified oil, or PFAD (palm fatty acid distillate) and a mixture of fatty acid esters and an organic alcohol. Optionally, water may be present.

The crude oleic acid may be crude oleic acid conventionally used in the art to produce biodiesel. The acidified oil is oil obtained by acidifying a byproduct soapstock produced by a grease refinery. The acidified oil is essentially a fatty acid, and contains various components such as pigments and non-acidified triglycerides, diglycerides, and monoglycerides (neutral oils). The fatty acid is typically a long chain fatty acid, typically with a carbon chain of between 12 and 24, predominantly 16 to 18.

In certain embodiments, the present invention utilizes a mixture of PFAD and fatty acid esters as a feedstock for transesterification or esterification reactions with organic alcohols. In these embodiments, it is preferred that the organic alcohol forming the fatty acid ester is the same as the organic alcohol as the starting material. For example, when Fatty Acid Methyl Esters (FAME) are used, the organic alcohol is preferably methanol. In these embodiments, the mixture of PFAD and fatty acid ester has a PFAD content of 1 to 80%, such as 3 to 80%, and a fatty acid ester content of 20 to 99%, such as 20 to 97%. For example, the mixture of PFAD and FAME has a PFAD content of 70 to 80% and a FAME content of 20 to 30%.

In certain embodiments, the polypeptide of the invention, or a composition comprising the polypeptide of the invention, may be switched to be used in the middle of a biodiesel reaction, where the content of free fatty acids in the system may be between 0 and 80%, preferably between 1 and 80%, more preferably between 3 and 80%, as is well known to those skilled in the art. In this case, the content of free fatty acid in the system may be 0 to 20%, for example 1 to 10%. As is well known to those skilled in the art, when the polypeptide is applied in immobilized form with excipients, the starting materials will be contacted with the polypeptide in a mobile phase which, in addition to the carboxylic compounds, hydroxyl compounds, also contains solvents such as hexane, pentane, etc.

In the transesterification or esterification, the organic alcohol can be added batchwise or in a fed-batch manner. The total amount of the organic alcohol is usually 1 or more times the number of fatty acid molecules contained in the carboxylic acid group-containing compound-containing fat or oil.

The amount of the enzyme of the polypeptide of the present invention (i.e., lipase) is 0.01% or more, for example, 0.02% or more, 0.05% or more, or 0.1% or more, for example, 0.01 to 1.0% or 0.01 to 0.3% by weight of the fat or oil containing a carboxylic acid group-containing compound (e.g., crude oleic acid, acidified oil, or a mixture of PFAD (palm fatty acid distillate) and a fatty acid ester).

In certain embodiments, water is optionally added. In certain embodiments, water is typically added in an amount of greater than 1%, such as 1 to 30%, 2 to 20%, or 2 to 5% by weight of the carboxylic acid group-containing compound-containing fat or oil (e.g., crude oleic acid, acidified oil, or PFAD (palm fatty acid distillate) and fatty acid ester mixture). In certain embodiments, a base such as NaOH is used to adjust the pH of the reactants. For example, in certain embodiments, naOH is added in an amount of greater than 0.005%, such as between 0.005% and 0.15% or between 0.005% and 0.1% by weight of the carboxylic acid group containing compound-containing fat and oil (e.g., crude oleic acid, acidified oil, or a mixture of PFAD (palm fatty acid distillate) and fatty acid ester). NaOH may be formulated as an aqueous solution and then added to the reaction mixture. For example, in certain embodiments, the amount of NaOH may be formulated as an aqueous NaOH solution having a concentration of 1 to 10%. It is understood that the water in the aqueous NaOH solution is not included in the amount of water added as described above.

In certain embodiments, the carboxylic acid group-containing compound-containing lipids, such as crude oleic acid, acidified oil, or PFAD (palm fatty acid distillate) and fatty acid ester mixture, are first mixed with a base, the enzyme and optionally water are added, and finally methanol is added to effect the reaction. Methanol is added in a batch mode or a feeding mode during the reaction process. The reaction time is not limited and can be stopped when the desired fatty acid conversion is achieved.

The invention therefore also comprises a reaction mixture for the preparation of the biodiesel according to the invention, which reaction mixture comprises: oils and fats containing carboxylic acid group-containing compounds; an organic alcohol; and a polypeptide of the invention; optionally also containing water. The types and amounts of the carboxylic acid group-containing compound-containing oils, organic alcohols, water and polypeptides in the reaction mixture may be as described above.

Deacidifying oil and fat

The invention also provides a method for refining oil by using the polypeptide, in particular a step for deacidifying oil by using the polypeptide.

In the grease process, the purpose of deacidification of grease is to remove non-triglyceride components, mainly including free fatty acid, substances with viscosity (gum impurity), phospholipid and pigment. The enzyme deacidification utilizes specific lipase to catalyze Free Fatty Acid (FFA) in the grease to perform esterification or ester exchange reaction with glycerol or monoglyceride under certain conditions, so that most of the FFA is converted into glyceride, the FFA content of the grease is reduced, the acid value is reduced, and the amount of neutral glyceride is increased. The content of free fatty acid in the oil can be reduced to a few percent by controlling the types of lipase, the addition amount of glycerol and monoglyceride, reaction conditions and the like.

Therefore, the method for deacidifying the grease comprises the step of catalyzing the grease containing the carboxylic acid group compound, such as crude oil or partially refined grease, and the grease containing the hydroxyl group compound to perform esterification or ester exchange reaction by using the polypeptide to obtain the deacidified grease.

In one or more embodiments, the method for deacidifying oil and fat of the present invention comprises deacidifying oil and fat using the polypeptide of the present invention in the presence of water, using crude oil or partially refined oil and fat or high acid value oil and fat as a raw material.

In one or more embodiments, the hydroxyl containing compound of the present invention is an organic alcohol (e.g., glycerol) or a monoglyceride.

Suitable crude or partially refined oils for use in the present method include, but are not limited to, soybean oil, sunflower oil, peanut oil, rapeseed oil, rice bran oil, corn oil, olive oil, palm kernel oil, palm olein, canola oil, castor oil, coconut oil, coriander oil, cottonseed oil, hazelnut oil, hemp oil, linseed oil, mango kernel oil, meadowfoam oil, neatsfoot oil, safflower oil, camellia oil, tall oil, cedrela sinensis oil, and other vegetable oils.

In one or more embodiments, the present invention uses soybean oil as the deacidified feedstock to undergo an esterification or transesterification reaction with an organic alcohol or monoglyceride. In these embodiments, it is preferable that the organic alcohol forming the fatty acid ester is the same as the organic alcohol as the raw material. For example, the organic alcohol is preferably glycerol.

In one or more embodiments, the hydroxyl containing compound can be added in portions or streams. Generally, the total amount of hydroxyl group-containing compounds used is 1 or more times the number of fatty acid molecules contained in the carboxylic acid group-containing compound-containing oil or fat.

The amount of the enzyme of the polypeptide of the present invention (i.e., lipase) is 0.01% or more, for example, 0.02% or more, 0.05% or more, or 0.1% or more, for example, 0.01 to 1.0% or 0.01 to 0.3% by weight of the carboxylic acid group-containing compound-containing fat or oil (e.g., crude oil or partially refined fat or oil).

In one or more embodiments, water is optionally added. In one or more embodiments, water is added in an amount of 1% or more, for example 1 to 30%, 2 to 20%, or 2 to 5% by weight of the carboxylic acid group-containing compound-containing fat or oil (e.g., crude oil or partially refined fat or oil) and the fatty acid ester.

In certain embodiments, a base such as NaOH is used to adjust the pH of the reactants. For example, in certain embodiments, the amount of NaOH added is greater than 0.005%, such as between 0.005 and 0.15% or between 0.005 and 0.1% by weight of the mixture of the carboxylic acid group-containing compound-containing oil (e.g., crude oil or partially refined oil) and the fatty acid ester. NaOH may be formulated as an aqueous solution and then added to the reaction mixture. For example, in certain embodiments, the amount of NaOH may be formulated as an aqueous NaOH solution having a concentration of 1 to 10 weight percent. It is understood that the water in the aqueous NaOH solution is not included in the amount of water added as described above.

In certain embodiments, fats and oils containing carboxylic acid group-containing compounds (e.g., crude or partially refined fats and oils) are reacted by first mixing with a base, adding an enzyme and optionally water, and finally adding glycerol or monoglycerides. The glycerol or monoglyceride is added in a batch mode or a fed-batch mode during the reaction process. The reaction time is not limited and can be stopped when the desired fatty acid conversion is achieved.

The invention therefore also includes a reaction mixture for deacidifying fats and oils, which reaction mixture contains: oils and fats containing carboxylic acid group-containing compounds; a hydroxyl group-containing compound; and a polypeptide of the invention; optionally also containing water. The types and amounts of the carboxylic acid group-containing compound-containing oil, the hydroxyl group-containing compound, water and the polypeptide in the reaction mixture may be as described above.

The present invention will be illustrated below by way of specific examples. Experimental procedures without specific conditions noted in the following examples, generally following conventional conditions such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989, N.Y., USA) or according to the manufacturer's recommendations. For the use and amounts of the reagents, the conventional use and amounts are used unless otherwise indicated. Unless otherwise indicated, the chemical reagents used in the present invention are commercially available from Biotechnology (Shanghai) Inc. as analytical grade.

Test materials and methods

1. Experimental strains and plasmids

Strain: pichia pastoris GS115 (Invitrogen), E.coli DH5a (TAKARA).

Plasmid: pAO815 plasmid (Invitrogen).

2. Culture media and solutions

LB liquid medium: 0.5% yeast extract, 1% tryptone, 1% NaCl, pH7.0.

LB solid medium: agar was added to LB liquid medium at a concentration of 1.5%.

YPD liquid medium: 1% yeast extract, 2% peptone, 2% glucose.

YPD solid Medium: agar was added to LB liquid medium at a concentration of 2%.

Esterification plate solid medium: 3% oleic acid emulsified with polyvinyl alcohol, 2% peptone, 1% yeast powder, 1% methanol, 4X 10-5% biotin, 2% agar, 0.1% bromophenol blue (mother liquor concentration 1%). Wherein the emulsified oleic acid is oleic acid emulsified with 2% polyvinyl alcohol at a final concentration of 30%, and added to the culture broth at a ratio of 0.1% before being poured onto a plate with a final pH of 6.5.

The modified Bradford method protein concentration determination kit is purchased from Shanghai Bioengineering Co., ltd.

Restriction enzyme EcoRI was purchased from Neuro Biotechnology (Beijing) Ltd.

PCR enzyme: the TaKaRa Taq is prepared by the following steps of,

HS DNA Polymerase was purchased from Bao bioengineering (Dalian) Co., ltd.

T4 DNA ligase (T4 DNA ligase) was purchased from Funzea, inc.

3. FFA detection method

(1) The oil sample must be liquid and well mixed before weighing.

(2) About 1-20g of oil sample (the relation between the sample amount and the acid value is shown in the following formula (1)) is weighed according to the acid value, and the oil sample is accurately weighed to 0.01g and placed in a 250mL conical flask.

(3) 50-150 mL of neutral isopropanol (3 mL of 1% phenolphthalein indicator was added, titrated with KOH until pink color appeared and no discoloration occurred within 30 seconds) was added, and shaken to dissolve the oil well (heating if necessary).

(4) Titrating with 0.05mol/L potassium hydroxide standard solution while shaking until pink appears, and keeping the solution from fading within 30 seconds, thus obtaining the titration end point.

(5) The volume V of potassium hydroxide consumed by titration is recorded and the result is calculated.

In the formula:

v-volume of potassium hydroxide solution used, ml;

c-exact concentration of the potassium hydroxide standard solution used, mol/L;

m-sample mass, g;

56.1-molar mass of potassium hydroxide, g/mol.

FFA% = acid value/2%

4. The formula for the esterification activity is as follows:

U(umol/(min*ml))＝ΔFFA*10 ⁴ /t/282/V

Δ FFA — difference of initial FFA% minus reacted FFA%;

t- - - -reaction time min;

v- -amount of enzyme used in ml.

5. Reagent

Crude oleic acid was purchased from Shanghai Bioengineering, inc.

Refined soybean oil was purchased from shanghai jiali grain oil ltd.

The commercial enzyme CALB is Novozymes Lipozyme CALB L from Novozymes.

Example 1: construction of CalB mutant library

The amino acid sequence of CALB is based on the amino acid sequence of wild Candida antarctica lipase, the wild amino acid sequence is from NCBI, genBank Accession: ACI06118.1. Selecting the polypeptide shown as SEQ NO: 2. the mature protein sequence is expressed, the DNA sequence is designed according to the pichia pastoris codon preference and is shown as SEQ ID NO:1, and a leader peptide pro sequence of alpha-factor (a DNA sequence from a commercial vector pPIC 9K) is added and sent to Shanghai biological engineering company Limited for whole gene synthesis.

PCR was carried out using nucleic acid supplied from Gene Synthesis as a template, calBU/CalBepD using Ex-Taq DNA polymerase and primers from Takara. The primer sequences are as follows:

CalBU(SEQ NO：7)：aaagaattcccgaaacgatgagatttcc，

CalBepD(SEQ NO：8):aaagaattcttatggagtaacaataccagaac。

the PCR system comprises 36. Mu.l of water, 5. Mu.l of 10 XEx-Taq buffer, 4. Mu.l of dNTPs, 2. Mu.l of each primer (20. Mu.M of mother solution concentration), 0.5. Mu.l of template and 0.5. Mu.l of Ex-Taq; the PCR program is 95 ℃ for 5min;30 cycles of 95 ℃ 40s,55 ℃ 40s,72 ℃ 1min30s; 10min at 72 ℃. The PCR product was recovered using the Omega Cycle-Pure kit. The recovered nucleic acid was double-digested with EcoRI single enzyme from NEB, and purified and recovered again using Cycle-Pure kit from Omega. The EcoRI was used to cut the purchased pAO815 empty vector plasmid solution in a single-enzyme double-cutting manner, and purified and recovered by using the Omega Cycle-Pure kit. The PCR-cut fragment and the pAO815 vector-cut fragment were ligated using Fermentas T4 DNA ligase, in a linker system of 9.5. Mu.l water, 1.5. Mu.l 10 Xbuffer, 1. Mu.l T4 DNA ligase, 1. Mu.l vector fragment, and 2. Mu.l gene fragment. The ligation reaction was carried out at 22 ℃ for 4 hours, and then the ligations were transformed into DH 5. Alpha. Competent cells by heat shock method, spread on LB plate containing 50. Mu.g/ml ampicillin (purchased from Shanghai, ltd.), and cultured overnight at 37 ℃. And (4) selecting an antibiotic positive escherichia coli clone for sequencing verification. And inoculating escherichia coli with correct sequencing verification into LB culture solution for culture, extracting plasmid solution pAOCalB by using an Axygen plasmid extraction kit, and storing at 4 ℃.

Error-prone PCR amplification was performed on CalBU/CalBepD using Takara rTaq DNA polymerase and primers using the pAOCalB plasmid as a template. The amplification system comprises 33 μ l of water, 5 μ l of 10 XrTaq buffer, 4 μ l of dNTPs, 2 μ l of each primer (mother solution concentration 20 μ M), 0.5 μ l of template, 0.5 μ l of rTaq, and 3 μ l of 5mM MnCl ₂ (ii) a The PCR program is 95 ℃ for 5min;30 cycles of 95 ℃ 40s,55 ℃ 40s,72 ℃ 1min30s; 10min at 72 ℃. The PCR product was purified and recovered using the Omega Cycle-Pure kit. The recovered nucleic acid was double-cleaved with HindIII and EcoRI by NEB, and purified and recovered again by using the Omega Cycle-Pure kit to obtain a mutant gene bank EPCalB. Meanwhile, hindIII and EcoRI double-cut pAOCalB plasmid solution is used, the enzyme digestion product is separated by 1 percent agarose gel electrophoresis, pAOCalB plasmid is recovered, the residual vector framework part (about 7.8 k) of the CalB gene fragment is removed, and then the pAOHE vector fragment is obtained by purification and recovery by using an Omega gel recovery kit. The EPCalB fragment and pAOHE vector fragment were ligated using Fermentas T4 DNA ligase using a ligation system of 9.5. Mu.l water, 1.5. Mu.l 10 Xbuffer, 1. Mu.l T4 DNA ligase, 1. Mu.l vector fragment, and 2. Mu.l gene fragment. The ligation reaction was carried out at 22 ℃ for 4 hours, and then the ligations were transformed into DH 5. Alpha. Competent cells by heat shock method, spread on LB plate containing 50ug/ml of ampicillin, and cultured overnight at 37 ℃ in an incubator. The next day, colonies on the plate were washed with physiological saline, and the cells were collected by centrifugation, and then plasmid pEPCalB was extracted using a plasmid extraction kit from Axygen, and single-cut with SalI restriction enzyme from NEB, and the enzyme-cleaved product was purified and recovered using a Cycle-Pure kit from Omega to obtain a mutant vector library.

Example 2: obtaining CalB mutants

Pichia pastoris GS115 competent cells were prepared according to the method described in the literature (Shixuan Wu and Geoffrey J.Letchworth. High efficiency transformation by electrophoresis with Pichia acetate and dithio reitol. Drug Discovery and Genomic Technologies,2004,36 (1): 152-154), and the CalB mutant vector library was then transferred to Pichia pastoris GS115 using a Bio-Rad electrotransformer according to the pre-set Pichia transformation program parameters.The transformant was coated on MD plate (1.34% YNB ^-5 % biotin, 2% glucose, 2% agar), and incubated in an incubator at 30 ℃ for 48 hours. The grown colonies were transferred to an esterification plate, sealed with a sealing film, and placed in an incubator at 30 ℃ until significant activity was observed. Similarly, the vector pAOCalB of the wild type gene is transformed into Pichia pastoris, screened for auxotrophy, and coated with an esterification plate for esterification activity detection. The best active bacteria were selected and pooled on an esterification plate for rescreening, and the culture results are shown in FIG. 1. As can be seen from FIG. 1, most of the rescreened mutants had significantly larger esterification circles around colonies than the wild-type gene-expressing strains, indicating that the CalB enzyme produced by these yeasts exhibited better esterification than the parent enzyme.

Example 3: obtaining CalB mutants

Two yeasts # 3 and # G in FIG. 1 were picked, colony PCR was performed using KOD-FX DNA polymerase from TOYOBO, primers 5'AOX and 3' AOX, and the sequences were as follows:

5’AOX(SEQ NO：9):attagcttactttcataattgcgac；

3’AOX(SEQ NO：10):gcaaatggcattctgacatcc。

the amplification system comprises 6 mul of water, 25 mul of 2 XKOD-FX buffer solution, 4 mul of dNTPs, 2 mul of each primer (20 mul of mother solution concentration), 10 mul of bacterial solution and 1 mul of KOD; the PCR program is 95 ℃ for 5min;30 cycles of 95 ℃ 40s,55 ℃ 40s,72 ℃ 1min30s; 10min at 72 ℃. The PCR product was purified and recovered using the Omega Cycle-Pure kit. The recovered nucleic acid was double-digested with HindIII and EcoRI by NEB, and purified and recovered again by using the Omega Cycle-Pure kit. The recyclate was ligated between the HindIII and EcoRI sites of the pAO815 vector and then transformed into DH 5. Alpha. Competent cells. Each of 5 E.coli colonies was randomly selected, plasmids were extracted, and subjected to sequencing using an α -factor universal sequencing primer by Biotechnology engineering (Shanghai) Ltd. Through sequencing analysis, the two CalB mutants respectively have mutations of CalB-3: S150T and Q291L; calB-G: I222V and I285T.

Example 4: analysis of enzyme Properties

Mutants produce larger esterification loops, possible causes include increased protein expression or similar amounts of protein but increased specific activity; or a reduced ability to hydrolyze the esterification reaction substrate; or increased protein stability. The analysis was performed below to generalize the properties of the mutants.

Yeast colonies were picked, inoculated into 50ml YPD medium, and cultured overnight at 30 ℃ with shaking at 200 rpm. The OD600 value of the culture is measured the next day, the proper bacterial liquid is taken for centrifugal collection of the bacterial body, 50ml of sterile water is used for washing the bacterial body, the supernatant is removed through centrifugation, then 50ml of BMMY culture liquid is used for heavy suspension of the bacterial body, and the final bacterial liquid OD600 is controlled to be 1.0. The methanol-induced fermentation was carried out in a shaker at 30 ℃ and 200rpm, supplemented with 500. Mu.l of anhydrous methanol each day in the morning and evening. After 72 hours of expression, the supernatant was collected by centrifugation at 8000rpm at 4 ℃ for 10min, filtered through a 0.22. Mu.M filter, and about 45ml of the crude enzyme solution was concentrated by ultrafiltration using a 10KD ultrafiltration membrane of Milipore corporation and replaced twice with a total of 25ml of 50mM sodium citrate buffer solution having a pH of 6.5, and the final volume of the enzyme solution was controlled to 700. Mu.l. Protein concentrations were determined using the Shanghai Biotechnology-modified Bradford protein concentration assay kit and SDS-PAGE analysis was performed with the same total protein, indicating the target band with the commercial CalB enzyme. CalB lipase target bands are displayed by Coomassie brilliant blue dyeing and decoloration of decoloration liquid, and band content analysis is carried out by using Bandscan software. The content of the target protein of the mutant 3# is about 25 percent of that of the wild-type gene expression product, and the content of the target protein of the mutant G is about 25 percent of that of the wild-type gene expression product.

The hydrolytic activity of the enzyme solution was measured using tributyrin (30% concentration) emulsified with 2% acacia as a substrate, and the reaction system was 400. Mu.l tributyrin, 50. Mu.l pH7.5 mM Tris-HCl buffer, 750. Mu.l water, and the enzyme solution. The reaction conditions were 30 ℃ and reaction was carried out with an Eppendorf shaking and mixing machine at 13000rpm for 1h. The entire reaction was transferred to a 100ml Erlenmeyer flask, quenched by addition of 5ml absolute ethanol and then titrated with 50mM potassium hydroxide under phenolphthalein indication. The negative control is a system without the enzyme solution, and the potassium hydroxide consumption of each enzyme solution system is calculated by taking the consumed potassium hydroxide amount as a base line. The activity unit is defined as the amount of enzyme required to release 1. Mu. Mol of free acid per minute.

Table 1: enzyme activity analysis of mutant and wild type genes (Tributyrin as substrate)

As can be seen from the above table 1, the specific activity of the mutant is significantly improved, the specific activity of CalB-3 is improved by 67% compared with the wild type, and the specific activity of CalB-G is improved by 113% compared with the wild type. The activity of the mutant CalB-G enzyme is higher than that of the mutant CalB-3 enzyme.

The activity of CalB lipase to hydrolyze methyl esters was determined using methyl decanoate as substrate. The reaction system comprises 400 μ L of methyl ester, 50 μ L of Tris-HCl buffer solution with pH7.5 mM, 40 μ L of water and enzyme solution. The reaction condition is that 30 ℃ Eppendorf shaking blending instrument 13000rpm reacts for 1h. The entire reaction was transferred to a 100mL Erlenmeyer flask, quenched by addition of 5mL of absolute ethanol, and then titrated with 50mM potassium hydroxide under phenolphthalein indication. And the negative control is a system without adding the enzyme solution, and the potassium hydroxide consumption of each enzyme solution system is calculated by taking the consumed potassium hydroxide amount as a baseline. The activity unit is defined as the amount of enzyme required to release 1. Mu. Mol of free acid per minute.

Table 2: enzyme activity analysis of mutant and wild type genes (methyl decanoate as substrate)

As can be seen from table 2 above, the specific hydrolysis activity of CalB and both mutants on methyl decanoate was higher than that on tributyrin. The hydrolysis specific activity of the mutant to methyl ester is higher than that of the wild type gene, the specific activity of CalB-3 is improved by 58 percent compared with that of the wild type gene, and the specific activity of CalB-G is improved by 33 percent compared with that of the wild type gene. From the hydrolysis activities of the two substrates, the activity of the mutant CalB-3 and the mutant CalB-G is increased by a lower range than that of the wild type gene, which indicates that the mutant has reduced hydrolysis capability on methyl ester or reduced tolerance on methyl ester hydrolysate methanol.

Mixing the enzyme solution with anhydrous methanol in equal volume, incubating in30 deg.C water bath for 3h, taking out one portion per hour, and detecting enzyme activity by p-nitrophenol palmitate. The enzyme activity assay system is 360 ul 50mM Tris-HCl buffer solution with pH7.5, 40 ul p-nitrophenol palmitate isopropanol solution (3 mg/ml) and enzyme solution. The reaction was carried out in a water bath at 40 ℃ for 10min. The activity of the enzyme solution without methanol treatment is 100%. And calculating the residual enzyme activity value after methanol treatment for different time.

Table 3: mutant and wild type methanol stability

As can be seen from Table 3 above, methanol has a weakening effect on the hydrolytic activity of wild-type CalB-O. The stability of the mutant CalB-3 and CalB-G to methanol is improved compared with that of the wild gene.

Combining the data of tables 2 and 3, the changes in mutants with reduced preference for methyl ester hydrolysis result from structural changes in the enzyme itself-changes in substrate preference.

Example 5: esterification reaction

Esterification was performed using oleic acid as a substrate. The reaction system comprises 400 mul of oleic acid, 50 mul of deionized water, 40 mul of methanol and 200ppm of sodium hydroxide. The reaction condition is 30 ℃, after an Eppendorf oscillating and mixing instrument reacts for 1h at 13000rpm, the centrifugation is carried out for 2min at 12000rpm, 100 mu l of upper oil phase is taken out and put into a 100ml triangular flask, the weight is calculated, and then 5ml of absolute ethyl alcohol is added for dispersion. Acid value was titrated using 50mM potassium hydroxide and enzyme activity was calculated.

Table 4: esterification activities of mutant and wild-type CALB

	CalB-O	CalB-3	CalB-G
				Specific activity (U/mg)	246	948	680

Under the condition of certain total protein content of the added enzyme solution, the esterification specific enzyme activity of the two mutants is obviously improved compared with that of the parent enzyme CalB-O.

The esterification reaction and the methyl ester hydrolysis reaction activity at the temperature of 30 ℃ are integrated, and the whole reaction direction of the wild type gene and the mutant is the esterification direction. The activity of the mutant in the esterification direction is higher than that of the wild type gene.

Table 5: comprehensive comparison of methyl ester formation and methyl ester hydrolysis Activity

	CalB-O	CalB-3	CalB-G
				Hydrolytic methyl ester vitality (U/ml)	611	250	210
Esterification activity (U/ml)	762	759	544
				Activity of esterification Direction (U/ml)	151	509	334

Example 6: influence of temperature on enzyme Activity

The esterification activities of the variant and parent CalB enzymes were determined at a series of temperatures of 20 ℃,30 ℃, 40 ℃ and 50 ℃ respectively. The activity at 20 ℃ is 100%, the enzyme activities of other temperature points are divided by the highest enzyme activity, so that the relative enzyme activities of the temperature points are obtained, the relative enzyme activities are used as ordinate and temperature as abscissa, the relative enzyme activities of the temperature points are sequentially connected by a smooth curve, and the relative enzyme activities are connected by the smooth curve, and the result is shown in figure 3.

As shown in FIG. 3, the optimum temperature for the wild-type CalB-O enzyme and the two mutant enzymes was 30 ℃ and elevated temperatures negatively affected both the parent and the variant enzymes.

Example 7: effect of pH on enzyme Activity

0.2M buffer solutions with pH values of 3.0, 4.0, 5.0, 6.0, 7.0 and 8.0 are prepared, and the hydrolase activity of the parent CalB, the variant CalB-3 and the variant CalB-G on tributyrin is detected by using the system described in example 4 under the different pH conditions. The hydrolysis activity of the enzyme solution was determined using 2% acacia gum emulsified tributyrin (30% concentration) as a substrate, 400. Mu.l tributyrin as a reaction system, 50. Mu.l each buffer, 750. Mu.l water, and enzyme solution. The reaction condition is that 30 ℃ Eppendorf shaking blending instrument 13000rpm reacts for 1h. The entire reaction was transferred to a 100ml Erlenmeyer flask, quenched by addition of 5ml absolute ethanol and then titrated with 50mM potassium hydroxide under phenolphthalein indication. The negative control is a system without the enzyme solution, and the potassium hydroxide consumption of each enzyme solution system is calculated by taking the consumed potassium hydroxide amount as a base line. The unit of activity is defined as 1. Mu. Mol free acid released per ml enzyme solution per minute. The relative activity values at each pH were calculated with the activity at pH7 as 100%, and connected by a smooth curve, and the results are shown in fig. 4. The optimal pH of the wild CalB is 6-8, the optimal pH range of the mutant 3 is much wider than that of the wild CalB, and the enzyme activity is higher between 4 and 8; whereas the optimum pH range for mutant G was similar to that of the wild type, between 6 and 8.

Example 8: effect of Metal ions on enzyme Activity

Preparing 0.25M of various ionic solutions (concentration is calculated according to cation) such as calcium chloride, magnesium chloride, zinc sulfate, manganese chloride, nickel sulfate, sodium chloride, ammonium sulfate and EDTA-sodium. The above ion was added to the tributyrin hydrolysis system described in example 4 above to a final concentration of 5mM, and the hydrolysis activity was measured at 40 ℃. The relative activity of each system was calculated with the activity of the system with only water added as 100%, and the results are shown in fig. 5. The activity of the wild parent enzyme is affected by various ions which are detected, wherein the inhibition effect of sodium and calcium is the maximum, and correspondingly, the EDTA which has chelation effect on the ions eliminates the inhibition effect. The action of the ions on the mutant is obviously changed, and zinc, manganese, nickel and ammonium ions have promotion effect on the enzyme activity of the mutant; calcium and magnesium have inhibitory effects but have less inhibitory effect on the CalB-3# mutant than the parent enzyme. After EDTA chelating ions is added into the reaction system, the enzyme activity is promoted, which indicates that calcium, magnesium and other ions exist in the original substrate, and the weakening effect is eliminated after the EDTA is chelated.

Example 9: catalyzing oil to reduce acid

The method comprises the steps of mixing 400 mu L of crude oil (a mass mixing simulation of crude oleic acid with an acid value of 170mgKOH/G and refined soybean oil with an acid value of 0.1 mgKOH/G) and 100 mu L of glycerol, adding a self-made enzyme solution (the addition amount of a commercial enzyme solution is 4mg, the calculated total protein amount is 50 mu G, calB-0, calB-3 and CalB-G) accounting for 1.2% of the weight of the crude oil, calculating the proportion of the total protein content data in Table 1, adding the enzyme solution with the same total protein amount, adding water with a weight of 20% of the weight of the crude oil, carrying out shaking table shaking reaction at 30 ℃ and 200rpm for 16h, measuring the percentage of FFA remaining in the system, using a commercial enzyme B (Novozymes Lipozyme CALB L from Novovern Inc.) as a positive control, and obtaining the results shown in the following Table 6.

Table 6: mutant and wild type enzyme liquid catalyzed grease deacidification

Enzyme	CalB-O	CalB-3	CalB-G	Commercial enzyme solution
					FFA% remained after the reaction	84％	62％	63％	42％

Example 10: preparation of biodiesel

The parent enzyme and the mutant enzyme are used for catalyzing the reaction for preparing the biodiesel. Mu.l of crude oleic acid was mixed with 100. Mu.l of methanol, and added with a self-made enzyme solution (the amount of each enzyme solution added was calculated as in example 8) in an amount of 1.2% by weight based on the crude oleic acid and water in an amount of 20% by weight based on the crude oleic acid, followed by shaking reaction at 30 ℃ and 200rpm for 16 hours. The residual FFA% in the system was measured. The commercial enzyme CALB was used as a positive control. The results are shown in Table 7 below. The transformation effect of the two mutants is better than that of the wild-type CalB-O. It is reasonable to speculate by those skilled in the art that the acid reducing effect is better when the amount of the enzyme is increased.

Table 7: mutant and wild enzyme liquid catalyzed fatty acid methyl esterification reaction

Enzyme	CalB-O	CalB-3	CalB-G	Commercial enzyme solution
					FFA% remained after the reaction	70％	68％	66％	44％

SEQUENCE LISTING

<110> Feng Yi (Shanghai) Biotechnology research and development center, inc

<120> lipase and use thereof

<130> 2016CALBVariant

<160> 15

<170> PatentIn version 3.5

<210> 1

<211> 1221

<212> DNA

<213> Artificial sequence

<400> 1

atgagatttc cttcaatttt tactgcagtt ttattcgcag catcctccgc attagctgct 60

ccagtcaaca ctacaacaga agatgaaacg gcacaaattc cggctgaagc tgtcatcggt 120

tactcagatt tagaagggga tttcgatgtt gctgttttgc cattttccaa cagcacaaat 180

aacgggttat tgtttataaa tactactatt gccagcattg ctgctaaaga agaaggggta 240

tctcttgaga aaagagaggc tgaagctttg ccatctggtt ccgatccagc cttctctcaa 300

cctaagtctg ttctggatgc tggtcttact tgtcaaggtg cttctccatc ctctgtctct 360

aagccaattc tgttggttcc aggtactgga accactggtc cacaatcttt cgactccaac 420

tggattccat tgtctactca attgggttac actccatgtt ggatttctcc tcctccattt 480

atgttgaacg atactcaagt taacactgag tacatggtta atgctattac tgctctgtac 540

gctggatctg gtaataacaa gttgccagtt ctgacttggt ctcaaggtgg acttgttgct 600

caatggggtc ttaccttctt cccatctatt agatccaaag ttgatagatt gatggcattt 660

gctccagact acaaaggtac tgttcttgct ggtccattgg acgcattggc tgtctctgct 720

ccatctgtct ggcaacaaac cactggttct gctctgacca ctgctctgag aaatgctgga 780

ggtctgactc agattgttcc taccactaac ttgtactctg ctactgatga gattgttcaa 840

cctcaagtct ccaactctcc attggactcc tcttacttgt tcaacggtaa gaacattcaa 900

gctcaagctg tctgtggtcc attgttcgtt attgatcatg ctggttctct gacttctcaa 960

ttctcctacg tcgttggtcg ttctgctctg agatccacca ctggtcaagc tagatccgct 1020

gactatggta ttactgactg taatccattg ccagctaacg acttgactcc agagcagaag 1080

gttgctgcag ccgctcttct ggctccagag gctgcagcca ttgttgctgg tcctaagcag 1140

aactgtgagc cagacttgat gccatatgct agaccatttg ctgttggtaa gagaacttgt 1200

tctggtattg ttactccata a 1221

<210> 2

<211> 406

<212> PRT

<213> Candida antarctica

<400> 2

Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser

1 5 10 15

Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln

20 25 30

Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe

35 40 45

Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu

50 55 60

Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val

65 70 75 80

Ser Leu Glu Lys Arg Glu Ala Glu Ala Leu Pro Ser Gly Ser Asp Pro

85 90 95

Ala Phe Ser Gln Pro Lys Ser Val Leu Asp Ala Gly Leu Thr Cys Gln

100 105 110

Gly Ala Ser Pro Ser Ser Val Ser Lys Pro Ile Leu Leu Val Pro Gly

115 120 125

Thr Gly Thr Thr Gly Pro Gln Ser Phe Asp Ser Asn Trp Ile Pro Leu

130 135 140

Ser Thr Gln Leu Gly Tyr Thr Pro Cys Trp Ile Ser Pro Pro Pro Phe

145 150 155 160

Met Leu Asn Asp Thr Gln Val Asn Thr Glu Tyr Met Val Asn Ala Ile

165 170 175

Thr Ala Leu Tyr Ala Gly Ser Gly Asn Asn Lys Leu Pro Val Leu Thr

180 185 190

Trp Ser Gln Gly Gly Leu Val Ala Gln Trp Gly Leu Thr Phe Phe Pro

195 200 205

Ser Ile Arg Ser Lys Val Asp Arg Leu Met Ala Phe Ala Pro Asp Tyr

210 215 220

Lys Gly Thr Val Leu Ala Gly Pro Leu Asp Ala Leu Ala Val Ser Ala

225 230 235 240

Pro Ser Val Trp Gln Gln Thr Thr Gly Ser Ala Leu Thr Thr Ala Leu

245 250 255

Arg Asn Ala Gly Gly Leu Thr Gln Ile Val Pro Thr Thr Asn Leu Tyr

260 265 270

Ser Ala Thr Asp Glu Ile Val Gln Pro Gln Val Ser Asn Ser Pro Leu

275 280 285

Asp Ser Ser Tyr Leu Phe Asn Gly Lys Asn Ile Gln Ala Gln Ala Val

290 295 300

Cys Gly Pro Leu Phe Val Ile Asp His Ala Gly Ser Leu Thr Ser Gln

305 310 315 320

Phe Ser Tyr Val Val Gly Arg Ser Ala Leu Arg Ser Thr Thr Gly Gln

325 330 335

Ala Arg Ser Ala Asp Tyr Gly Ile Thr Asp Cys Asn Pro Leu Pro Ala

340 345 350

Asn Asp Leu Thr Pro Glu Gln Lys Val Ala Ala Ala Ala Leu Leu Ala

355 360 365

Pro Glu Ala Ala Ala Ile Val Ala Gly Pro Lys Gln Asn Cys Glu Pro

370 375 380

Asp Leu Met Pro Tyr Ala Arg Pro Phe Ala Val Gly Lys Arg Thr Cys

385 390 395 400

Ser Gly Ile Val Thr Pro

405

<210> 3

<211> 954

<212> DNA

<213> Artificial sequence

<400> 3

ttgccatctg gttccgatcc agccttctct caacctaagt ctgttctgga tgctggtctt 60

acttgtcaag gtgcttctcc atcctctgtc tctaagccaa ttctgttggt tccaggtact 120

ggaaccactg gtccacaatc tttcgactcc aactggattc cattgtctac tcaattgggt 180

tacactccat gttggatttc tcctcctcca tttatgttga acgatactca agttaacact 240

gagtacatgg ttaatgctat tactgctctg tacgctggat ctggtaataa caagttgcca 300

gttctgactt ggtctcaagg tggacttgtt gctcaatggg gtcttacctt cttcccatct 360

attagatcca aagttgatag attgatggca tttgctccag actacaaagg tactgttctt 420

gctggtccat tggacgcatt ggctgtcact gctccatctg tctggcaaca aaccactggt 480

tctgctctga ccactgctct gagaaatgct ggaggtctga ctcagattgt tcctaccact 540

aacttgtact ctgctactga tgagattgtt caacctcaag tctccaactc tccattggac 600

tcctcttact tgttcaacgg taagaacatt caagctcaag ctgtctgtgg tccattgttc 660

gttattgatc atgctggttc tctgacttct caattctcct acgtcgttgg tcgttctgct 720

ctgagatcca ccactggtca agctagatcc gctgactatg gtattactga ctgtaatcca 780

ttgccagcta acgacttgac tccagagcag aaggttgctg cagccgctct tctggctcca 840

gaggctgcag ccattgttgc tggtcctaag ctgaactgtg agccagactt gatgccatat 900

gctagaccat ttgctgttgg taagagaact tgttctggta ttgttactcc ataa 954

<210> 4

<211> 317

<212> PRT

<213> Artificial sequence

<400> 4

Leu Pro Ser Gly Ser Asp Pro Ala Phe Ser Gln Pro Lys Ser Val Leu

1 5 10 15

Asp Ala Gly Leu Thr Cys Gln Gly Ala Ser Pro Ser Ser Val Ser Lys

20 25 30

Pro Ile Leu Leu Val Pro Gly Thr Gly Thr Thr Gly Pro Gln Ser Phe

35 40 45

Asp Ser Asn Trp Ile Pro Leu Ser Thr Gln Leu Gly Tyr Thr Pro Cys

50 55 60

Trp Ile Ser Pro Pro Pro Phe Met Leu Asn Asp Thr Gln Val Asn Thr

65 70 75 80

Glu Tyr Met Val Asn Ala Ile Thr Ala Leu Tyr Ala Gly Ser Gly Asn

85 90 95

Asn Lys Leu Pro Val Leu Thr Trp Ser Gln Gly Gly Leu Val Ala Gln

100 105 110

Trp Gly Leu Thr Phe Phe Pro Ser Ile Arg Ser Lys Val Asp Arg Leu

115 120 125

Met Ala Phe Ala Pro Asp Tyr Lys Gly Thr Val Leu Ala Gly Pro Leu

130 135 140

Asp Ala Leu Ala Val Thr Ala Pro Ser Val Trp Gln Gln Thr Thr Gly

145 150 155 160

Ser Ala Leu Thr Thr Ala Leu Arg Asn Ala Gly Gly Leu Thr Gln Ile

165 170 175

Val Pro Thr Thr Asn Leu Tyr Ser Ala Thr Asp Glu Ile Val Gln Pro

180 185 190

Gln Val Ser Asn Ser Pro Leu Asp Ser Ser Tyr Leu Phe Asn Gly Lys

195 200 205

Asn Ile Gln Ala Gln Ala Val Cys Gly Pro Leu Phe Val Ile Asp His

210 215 220

Ala Gly Ser Leu Thr Ser Gln Phe Ser Tyr Val Val Gly Arg Ser Ala

225 230 235 240

Leu Arg Ser Thr Thr Gly Gln Ala Arg Ser Ala Asp Tyr Gly Ile Thr

245 250 255

Asp Cys Asn Pro Leu Pro Ala Asn Asp Leu Thr Pro Glu Gln Lys Val

260 265 270

Ala Ala Ala Ala Leu Leu Ala Pro Glu Ala Ala Ala Ile Val Ala Gly

275 280 285

Pro Lys Leu Asn Cys Glu Pro Asp Leu Met Pro Tyr Ala Arg Pro Phe

290 295 300

Ala Val Gly Lys Arg Thr Cys Ser Gly Ile Val Thr Pro

305 310 315

<210> 5

<211> 954

<212> DNA

<213> Artificial sequence

<400> 5

ttgccatctg gttccgatcc agccttctct caacctaagt ctgttctgga tgctggtctt 60

acttgtcaag gtgcttctcc atcctctgtc tctaagccaa ttctgttggt tccaggtact 120

ggaaccactg gtccacaatc tttcgactcc aactggattc cattgtctac tcaattgggt 180

tacactccat gttggatttc tcctcctcca tttatgttga acgatactca agttaacact 240

gagtacatgg ttaatgctat tactgctctg tacgctggat ctggtaataa caagttgcca 300

gttctgactt ggtctcaagg tggacttgtt gctcaatggg gtcttacctt cttcccatct 360

attagatcca aagttgatag attgatggca tttgctccag actacaaagg tactgttctt 420

gctggtccat tggacgcatt ggctgtctct gctccatctg tctggcaaca aaccactggt 480

tctgctctga ccactgctct gagaaatgct ggaggtctga ctcagattgt tcctaccact 540

aacttgtact ctgctactga tgagattgtt caacctcaag tctccaactc tccattggac 600

tcctcttact tgttcaacgg taagaacatt caagctcagg ctgtctgtgg tccattgttc 660

gttgttgatc atgctggttc tctgacttct caattctcct acgtcgttgg tcgttcagct 720

ctgagatcca ccactggtca agctagatcc gctgactatg gtattactga ctgtaatcca 780

ttgccagcta acgacttgac tccagagcag aaggttgctg cagccgctct tctggctcca 840

gaggctgcag ccactgttgc tggtcctaag cagaactgtg agccagactt gatgccatat 900

gctagaccat ttgctgttgg taagagaact tgttctggta ttgttactcc ataa 954

<210> 6

<211> 317

<212> PRT

<213> Artificial sequence

<400> 6

Leu Pro Ser Gly Ser Asp Pro Ala Phe Ser Gln Pro Lys Ser Val Leu

1 5 10 15

Asp Ala Gly Leu Thr Cys Gln Gly Ala Ser Pro Ser Ser Val Ser Lys

20 25 30

Pro Ile Leu Leu Val Pro Gly Thr Gly Thr Thr Gly Pro Gln Ser Phe

35 40 45

Asp Ser Asn Trp Ile Pro Leu Ser Thr Gln Leu Gly Tyr Thr Pro Cys

50 55 60

Trp Ile Ser Pro Pro Pro Phe Met Leu Asn Asp Thr Gln Val Asn Thr

65 70 75 80

Glu Tyr Met Val Asn Ala Ile Thr Ala Leu Tyr Ala Gly Ser Gly Asn

85 90 95

Asn Lys Leu Pro Val Leu Thr Trp Ser Gln Gly Gly Leu Val Ala Gln

100 105 110

Trp Gly Leu Thr Phe Phe Pro Ser Ile Arg Ser Lys Val Asp Arg Leu

115 120 125

Met Ala Phe Ala Pro Asp Tyr Lys Gly Thr Val Leu Ala Gly Pro Leu

130 135 140

Asp Ala Leu Ala Val Ser Ala Pro Ser Val Trp Gln Gln Thr Thr Gly

145 150 155 160

Ser Ala Leu Thr Thr Ala Leu Arg Asn Ala Gly Gly Leu Thr Gln Ile

165 170 175

Val Pro Thr Thr Asn Leu Tyr Ser Ala Thr Asp Glu Ile Val Gln Pro

180 185 190

Gln Val Ser Asn Ser Pro Leu Asp Ser Ser Tyr Leu Phe Asn Gly Lys

195 200 205

Asn Ile Gln Ala Gln Ala Val Cys Gly Pro Leu Phe Val Val Asp His

210 215 220

Ala Gly Ser Leu Thr Ser Gln Phe Ser Tyr Val Val Gly Arg Ser Ala

225 230 235 240

Leu Arg Ser Thr Thr Gly Gln Ala Arg Ser Ala Asp Tyr Gly Ile Thr

245 250 255

Asp Cys Asn Pro Leu Pro Ala Asn Asp Leu Thr Pro Glu Gln Lys Val

260 265 270

Ala Ala Ala Ala Leu Leu Ala Pro Glu Ala Ala Ala Thr Val Ala Gly

275 280 285

Pro Lys Gln Asn Cys Glu Pro Asp Leu Met Pro Tyr Ala Arg Pro Phe

290 295 300

Ala Val Gly Lys Arg Thr Cys Ser Gly Ile Val Thr Pro

305 310 315

<210> 7

<211> 28

<212> DNA

<213> Artificial sequence

<400> 7

aaagaattcc cgaaacgatg agatttcc 28

<210> 8

<211> 32

<212> DNA

<213> Artificial sequence

<400> 8

aaagaattct tatggagtaa caataccaga ac 32

<210> 9

<211> 25

<212> DNA

<213> Artificial sequence

<400> 9

attagcttac tttcataatt gcgac 25

<210> 10

<211> 21

<212> DNA

<213> Artificial sequence

<400> 10

gcaaatggca ttctgacatc c 21

<210> 11

<211> 5

<212> PRT

<213> Artificial sequence

<400> 11

Arg Arg Arg Arg Arg

1 5

<210> 12

<211> 6

<212> PRT

<213> Artificial sequence

<400> 12

His His His His His His

1 5

<210> 13

<211> 8

<212> PRT

<213> Artificial sequence

<400> 13

Asp Tyr Lys Asp Asp Asp Asp Lys

1 5

<210> 14

<211> 8

<212> PRT

<213> Artificial sequence

<400> 14

Trp Ser His Pro Gln Phe Glu Lys

1 5

<210> 15

<211> 10

<212> PRT

<213> Artificial sequence

<400> 15

Trp Gln Lys Leu Ile Ser Glu Glu Asp Leu

1 5 10

Claims

1. A polypeptide, wherein said polypeptide is selected from the group consisting of:

the amino acid sequence is shown as SEQ ID NO:4 or 6; or the polypeptide is as set forth in SEQ ID NO:4 or 6 and one or more sequences selected from the group consisting of signal peptide, GST, maltose E binding protein, protein a, 6His or Flag.

2. A polynucleotide molecule, wherein said polynucleotide molecule is: a polynucleotide encoding the polypeptide of claim 1.

3. The polynucleotide molecule of claim 2, wherein the sequence of said polynucleotide is as set forth in SEQ ID NO:3 or 5.

4. A polynucleotide construct comprising the polynucleotide molecule of claim 2 or 3.

5. The polynucleotide construct of claim 4, wherein said polynucleotide construct is an expression vector or a cloning vector.

6. A genetically engineered host cell, wherein the host cell:

(1) Expressing the polypeptide of claim 1; or

(2) Comprising a polynucleotide molecule according to claim 2 or 3 or a polynucleotide construct according to claim 4 or 5.

7. A composition comprising the polypeptide of claim 1 or the genetically engineered host cell of claim 6 and optionally an adjuvant.

8. The composition of claim 7, wherein the adjunct is an adsorbent material selected from the group consisting of resins, activated carbon, alumina, diatomaceous earth, porous ceramics, and porous glass.

9. Use of the polypeptide of claim 1, the polynucleotide molecule of claim 2 or 3, the polynucleotide construct of claim 4 or 5, the genetically engineered host cell of claim 6, or the composition of claim 7 or 8 in esterification reactions, hydrolysis reactions of esters.

10. Use according to claim 9, in the food industry or in the chemical industry.

11. Use according to claim 10, in the refining of oils and fats or in the chemical industry of oils and fats.

12. The use according to claim 11 for deacidification of fats & oils or for biodiesel production.

13. A method for deacidifying a fat, comprising the step of performing an esterification reaction using the polypeptide of claim 1.

14. The method of claim 13, comprising the step of mixing a carboxylic acid group-containing compound-containing oil and fat with a hydroxyl group-containing compound, and reacting in the presence of the polypeptide of claim 1 and optionally water.

15. The method of claim 14, wherein the hydroxyl containing compound is an organic alcohol or monoglyceride; and/or the grease containing carboxylic acid group compounds is selected from: mixtures of PFAD with fatty acid esters, crude oil, waste cooking oil, crude oleic acid or acidified oil.

16. The method of claim 15, wherein the deacidification of fats and oils is performed by one or more of the following:

(1) The hydroxyl-containing compound is added in a batch or fed-batch manner;

(2) The molar consumption of the hydroxyl-containing compound is more than 1 time of the molar number of the carboxylic acid groups in the grease containing the carboxylic acid group-containing compound;

(3) The organic alcohol is one or more of glycerol, methanol and ethanol;

(4) The polypeptide has an amino acid sequence shown as SEQ ID NO. 4 or SEQ ID NO. 6;

(5) The dosage of the polypeptide is more than 0.01 percent of the weight of the grease containing the carboxylic acid group-containing compound;

(6) Adding alkali to adjust the pH of the reactant, wherein the addition amount of the alkali is more than 0.005 percent of the weight of the grease containing the carboxylic acid group compound;

(7) The temperature of the reaction is within the range of 35. + -. 5 ℃.

17. The method according to claim 16, wherein the amount of the polypeptide is 0.01 to 0.3 percent of the weight of the grease containing the carboxylic acid group-containing compound; the alkali added for adjusting the pH of the reactant is NaOH, and the addition amount of the alkali is 0.005-0.15% of the weight of the grease containing the carboxylic acid group-containing compound.

18. A method for producing biodiesel, which comprises the step of carrying out an esterification reaction using the polypeptide of claim 1.

19. The method of claim 18, comprising the step of mixing a carboxylic acid group-containing compound-containing oil and fat with a hydroxyl group-containing compound, and reacting in the presence of the polypeptide of claim 1 and optionally water.

20. The method of claim 19, wherein the hydroxyl containing compound is an organic alcohol or monoglyceride; and/or the grease containing the carboxylic acid group-containing compound is selected from: mixtures of PFAD with fatty acid esters, crude oil, waste cooking oil, crude oleic acid or acidified oil.

21. The method of claim 20, wherein the method of producing biodiesel has one or more of the following characteristics:

(1) In the mixture of the PFAD and the fatty acid ester, the PFAD content is 1-80% by weight, and the fatty acid ester content is 20-99% by weight;

(2) The organic alcohol is one or more of glycerol, methanol and ethanol;

(3) The organic alcohol is added in batch or fed-batch mode;

(4) The molar consumption of the organic alcohol is more than 1 time of the molar number of the carboxylic acid groups in the grease containing the carboxylic acid group compounds;

(5) The polypeptide is a polypeptide with an amino acid sequence shown as SEQ ID NO. 4 or SEQ ID NO. 6;

(6) The dosage of the polypeptide is more than 0.01 percent of the weight of the grease containing the carboxylic acid group-containing compound;

(7) The temperature of the reaction is in the range of 35. + -. 5 ℃.

22. The method of claim 21, wherein in the mixture of PFAD and fatty acid ester, the fatty acid ester is a fatty acid methyl ester or a fatty acid ethyl ester; the dosage of the polypeptide is 0.01-0.3% of the weight of the grease containing the carboxylic acid group compound.

23. A reaction mixture, comprising:

oils and fats containing carboxylic acid group-containing compounds;

a hydroxyl group-containing compound;

the polypeptide of claim 1; and

optionally, water.

24. The reaction mixture of claim 23, wherein the mixture has one or more of the following characteristics:

(1) The grease containing carboxylic acid group compounds is selected from: mixtures of PFAD and fatty acid esters, crude oil, waste cooking oil, crude oleic acid or acidified oil;

(2) The hydroxyl-containing compound is an organic alcohol or monoglyceride;

(3) The dosage of the polypeptide is more than 0.01 percent of the weight of the grease containing the carboxylic acid group-containing compound;

(4) The amount of water is more than 1% of the weight of the grease containing carboxylic acid group compound.

25. The reaction mixture of claim 24, wherein the mixture has one or more of the following characteristics:

(1) In the grease containing the carboxylic acid group compound, the fatty acid ester is fatty acid methyl ester or fatty acid ethyl ester;

(2) The hydroxyl-containing compound is methanol, ethanol or glycerol;

(3) The total molar quantity of the hydroxyl-containing compound is more than 1 time of the molar quantity of the carboxylic acid groups in the grease of the carboxylic acid group-containing compound;

(4) The dosage of the polypeptide is 0.01-0.3% of the weight of the grease containing the carboxylic acid group compound;

(5) The amount of water is 1-30% of the weight of the grease containing carboxylic acid group compound.