RU2504583C1 - PLASMID 40Gal DETERMINING SYNTHESIS OF α-GALACTOSIDASE α-PsGal, STRAIN Ecoli Rosetta(DE3)/40Gal - PRODUCER OF CHIMERIC PROTEIN CONTAINING AMINO-ACID SEQUENCE α-PsGal, AND METHOD FOR ITS PRODUCTION - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: invention represents plasmide determining synthesis of α-galactosidase α-PsGal, which includes Ncol/Sall - fragment of plasmid pET-40b(+) (Novagen) and DNA fragment, with the size of 2142 pairs of bases, which contains a chimeric gen consisting of structural part of gene α-PsGal, which is adapted on N-end for expression in E. coli cells, and a nucleotide coding a specific sequence for enteropeptidase. The invention also refers to strain E. coli Rosetta (DE3) transformed with the above plasmid - producer of chimeric protein containing amino-acid sequence of recombinant α-galactosidase α-PsGal and sequence specific for enteropeptidase. The invention also refers to a method for obtaining recombinant α-galactosidase α-PsGal, which involves the following stages: incubation of the above strain-producer in liquid nutritional medium LB during 12 hours at 16°C, deposition of bacterial cells by centrifugation, disintegration of a suspension of cells in a buffer, centrifugation of an extract, chromatography of above-deposit liquid on a column with metal affine resin, elution of protein, concentration of active fractions by means of ion-exchange resin, incubation with enteropeptidase and separation of a target product by gel-filtration.

EFFECT: invention allows obtaining more active and stable recombinant alpha-galactosidase with high efficiency degree.

3 cl, 1 dwg, 3 ex

Description

The invention relates to biotechnology, in particular to genetic engineering, and relates to a method for producing recombinant protein α-galactosidase of the marine bacteria Pseudoalteromonas sp. strain KMM 701 VKM B-2135D (α-PsGal), as well as a plasmid for its production and a recombinant strain of Escherichia coli. The invention allows the production of highly active recombinant α-galactosidase for use in transfusion and clinical medicine, genetic engineering and molecular biology.

α-D-galactosidase (E.C.3.2.1.22) catalyzes the hydrolysis of the α-galactoside bond in oligosaccharides such as raffinose, melibiosis, stachyose, and in polysaccharides such as galactomannans, as well as in glycoconjugates, including glycoproteins and glycolipids. α-PsGal is recommended for use in transfusion medicine as an enzyme capable of removing α-1,3-linked galactose residues from glycoproteins of group substances of B-blood with the conversion of the latter into substances of group H (O); in clinical medicine as a preventive and therapeutic antibacterial drug for the treatment of mucous and wound surfaces; in molecular biology as a tool for studying the structure of oligo- and polysaccharide matrices; in genetic engineering to obtain reference proteins, etc.

The development of an effective way to obtain erythrocytes universal in group properties for emergency transfusiological care for victims continues to be very relevant. α-Galactosidases that inactivate the serological activity of group B human erythrocytes (EC-B) are relatively rare enzymes. Clinical trials of converted red blood cells in volunteers have shown that the enzymatic conversion of EC-B is feasible, that the enzymes converted by the enzyme EC-B to EC-O are viable and can function in the same way as untreated ECs that are selected according to the blood group according to the rules accepted in clinical practice. transfusion medicine. However, the amount of enzyme (mg) in these studies, even with modern effective recombinant expression technology, constitutes an economic obstacle for their use in transfusion medicine, since 1-2 g of enzyme is required per package (200 ml) of red blood cells [Zhang YP, Gong F ., Bao GQ, Gao HW, Ji SP, Tan YP, Li SB, Li LL, Wang YL, Xu N., Xu LJ, Tian SG, Zhang ZX, Lu QS, Qiu Y., Bai JS Chen J.T. In to O 2 erythrocyte conversion by the recombinant α-galactosidase // Chin. Med. J. - 2007. - Vol. 120, N 13. - P.1145-1150]. In addition, the pH optimum of the enzyme and narrow substrate specificity are of great importance. So, all the enzymes described in the literature that effectively act on red blood cells have an optimum in the acidic pH range, which is extremely undesirable for red blood cells.

An analysis of numerous literature data showed that it is bacteria that contain enzymes, one of the properties of which satisfies the technological requirements (optimum action at pH 7.0) presented for the modification of red blood cells in physiological conditions.

Marine bacteria as sources of enzymes with unique specificity are attracting increasing attention of researchers. So it was found that α-galactosidase from the marine bacteria Pseudoalteromonas sp. KMM 701 in addition to the inactivating effect on the serological activity of B-erythrocytes has an antibacterial property to destroy the microbiological films of pathogenic strains formed on human mucous membranes. Treatment of human laryngeal epithelial cells with the preparation of such an enzyme significantly reduced the adhesion of the diphtheria pathogen C. diphtheriae [L.A. Balabanova, I.Y. Bakunina, O.I. Nedashkovskaya, I.D. Makarenkova, T.S. Zaporozhets, N.N. Besednova, T.N. Zvyagintseva and V.A. Rasskazov. Molecular Characterization and Therapeutic Potential of a Marine Bacterium Pseudoalteromonas sp.KMM 701 α-Galactosidase // Mar Biotechnol. - 2010 .-- Vol.12. P.111-120].

A known method of producing a natural protein of α-galactosidase from a wild producer strain Pseudoalteromonas sp. VKM V-2135D [RU 2113479 C1, 06/20/1998]. The main disadvantage of this method is the high technological costs during storage and cultivation of the wild strain.

The nucleotide sequence of the mature α-galactosidase protein Pseudoalteromonas sp. KMM 701 (GenBank Code DQ530422.1). However, methods for the preparation of an active recombinant analogue of α-galactosidase Pseudoalteromonas sp. VKM B-2135D (α-PsGal) are not yet known. Obtaining soluble highly active α-PsGal in heterologous bacterial systems is fraught with a number of difficulties, since the functional protein is psychrophilic and consists of two subunits.

The objective of the invention is the construction of a recombinant strain of E. coli, a plasmid encoding the synthesis of the recombinant protein α-PsGal, and the development of a method for its preparation.

The problem was solved by creating a genetic construct in the form of a recombinant 40Gal plasmid and E. coli Rosetta strain (DE3) / 40Gal, which provide inducible synthesis with high and stable yield of active soluble recombinant α-galactosidase into the periplasm of Escherichia coli cells.

The technical result of the claimed invention is the production of active recombinant α-galactosidase α-PsGal with a high yield and level of purification.

Plasmid 40Gal has 8306 base pairs (bp) and is characterized by the presence of an NcoI / SalI fragment of plasmid pET-40b (+) (Novagen) and a 2142 bp DNA fragment sequence adapted at the N-terminus for expression in cells E. coli, containing a chimeric gene, consisting of the structural part of the α-PsGal gene, and a specific sequence for enteropeptidase to remove additional amino acid residues from the N-terminal part of the recombinant protein molecule.

The drawing shows a physical map of the 40Gal plasmid and the plasmid region responsible for the expression of the recombinant α-PsGal protein.

The nucleotide sequence of a fragment of plasmid 40Gal flanked by Ncol and Sail sites contains a sequence of the α-PsGal structural gene with an adapted N-terminus for expression in E. coli, corresponding to the open reading frame for the α-PsGal protein, and an enteropeptidase-specific sequence (SEQ ID N 1).

The E. coli Rosetta (DE3) / 40Gal strain was obtained by transforming E. coli Rosetta (DE3) (Novagen) cells with a 40Gal plasmid using traditional genetic engineering technology [Sambrook J., Fritsch E.F., Maniatis T. // Molecular Cloning. A. Laboratory Manual. 2bd ed. Cold Spring Harbor, NY, 1989.].

The recombinant strain of E. coli Rosetta (DE3) / 40Gal is characterized by the following features.

Cultural and morphological features

The cells of the strain form large round with smooth edges, convex colonies up to 5 mm in diameter, the surface of the colonies is smooth, the mucous consistency. The pigment does not accumulate. Gram-negative, do not form a spore, do not have capsules. Colonies grow well on simple nutrient media (LB). When growing in liquid media, they form an intense smooth haze.

Physico-biological characteristics

The strain E. coli Rosetta (DE3) / 40Gal is speciesotypic in its biochemical properties. The strain does not have gelatinase activity, does not ferment lysine; breaks down glucose, lactose, mannitol, sucrose to acid and gas. It has a mutation in the lac gene, which provides control of the expression level, as well as the translation of rare codons. The optimum temperature for growth is 37 ° C, and for the production of psychrophilic α-PsGal 16 ° C.

Antibiotic resistance

The cells of the strain are resistant to chloramphenicol (34 μg / ml) and kanamycin (25 μg / ml).

Pathogenicity and toxicity

The recombinant strain of E. coli Rosetta (DE3) / 40Gal is neither pathogenic nor toxic to warm-blooded animals.

The strain is stored in the usual way in suspension with glycerol (30%) at -20 ° C. The inventive method for producing recombinant α-galactosidase α-PsGal consists in culturing cells of E. coli Rosetta (DE3) / 40Gal strain in LB nutrient medium containing kanamycin, separating biomass from the culture fluid, destroying microbial cells, followed by isolation of the target product by aqueous extraction and chromatographic purification of the enzyme preparation. Purification of the target product is carried out by chromatography on a metal-affinity resin and gel filtration.

The yield of recombinant α-PsGal as a result of the application of the described method is at least 10 mg of recombinant protein from 1 l of culture with a specific activity of more than 500 units / mg of protein, which exceeds the specific activity of the natural analog by 5 times.

The recombinant protein α-PsGal is a homodimer with a molecular weight of 160 kDa, has an optimal reaction temperature of 20-22 ° C and an optimum pH of 7.0-7.5, and its activity does not depend on the presence of divalent metal ions in the incubation medium. Recombinant α-PsGal can be successfully used to remove the group specificity of human erythrocytes of blood group B (III) and to obtain universal donor blood of group O (I), since after the end of the reaction it is easily inactivated already after 25 ° C. α-PsGal can also be used to treat human mucous epithelium for the prevention and treatment of infectious diseases.

The significant advantages of the proposed method are:

- the use of a producer strain of E. coli Rosetta (DE3) / 40Gal, which allows to obtain a large amount of full-size, two-subunit and highly active recombinant α-PsGal during biosynthesis;

- the use of two-stage chromatographic purification of the enzyme, which allows to obtain pure recombinant protein in a short time and with low losses.

A method of obtaining a functionally active protein based on the use of a gene encoding the α-galactosidase of the marine bacteria α-PsGal is illustrated by the following examples.

Example 1. Construction of plasmids 40Gal.

Recombinant 40Gal plasmid containing the α-PsGal structural gene encoding the mature form of α-galactosidase Pseudoalteromonas sp. KMM 701, and an esteropeptidase-specific sequence flanked by the NcoI and SaiI restriction sites, are constructed on the basis of the commercial plasmid pET-40b (+) (Novagen).

A DNA fragment containing the full-length α-PsGal gene is obtained by polymerase chain reaction using the genomic DNA of a strain of the marine bacterium Pseudoalteromonas sp.KMM 701, VKM B-2135D, as a matrix and primers G2-NcoI-for40 and G3-SalI-rev40 where G2-NcoI-for40 is a primer specific for the N-terminal sequence of α-PsGal, including the sequence for enteropetidase, G3-SalI-rev40 is a reverse primer specific for the C-terminal sequence of α-PsGal:

G2-NcoI-for40: 5'-

ATTACCATGGATGACGACGACAAGGCCGACACTAAATCATTTTATCGATTAGACA-3 '

G3-SalI-rev40: 5'-ACACGTCGACTTACGCTTTGTTGAGCTCAAATATAAGC-3 '

This reaction is carried out under the following conditions: 10x Encycio buffer, 50x Encycio polymerase mixture (Encycio PCR kit, Eurogen, Moscow), 50x dNTP mixture (10 mM each), primer mixture (5 μM each), 50 ng DNA. The amplification process consists of the following stages: heating at 95 ° C for 2.5 min, 35 cycles of PCR (15 sec 95 ° C, 2 min 72 ° C) and incubation for 10 min at 72 ° C. After amplification, the DNA fragment is purified electrophoretically in a 1% agarose gel. The fragment (1 μg) was treated with restriction enzymes NcoI and SaiI in optimal buffer (Fermentas) for 3 hours, then the enzymes were removed from the reaction medium according to the standard procedure with phenol (1: 1). 1/10 volume of 0.3 M Na acetate, pH 5.2, and 1/2 volume of isopropanol alcohol are added to the aqueous fraction containing the fragment and left at -20 ° C for 30 minutes. It is then centrifuged at 14,000 rpm for 20 minutes, the precipitate is washed with 75% ethanol and dried at room temperature. The precipitate was dissolved in 20 μl.

5 μg of plasmid DNA pET-40b (+) was treated with restriction enzymes NcoI and Sail in accordance with the procedure described above, and the vector part of the plasmid was isolated from the obtained hydrolyzate in a 1% low-melting agarose gel.

The resulting fragment and the vector part of the plasmid pET-40b (+) are crosslinked by ligase reaction in 50 μl of ligation buffer according to the instructions (Fermentas). 10 μl of the reaction mixture was used to transform competent E. coli Rosetta (DE3) cells. Transformants are plated on LB agar containing 25 μg / ml kanamycin. After incubation for 16 hours at 37 ° C, the clones are screened, plasmid DNA is isolated and analyzed for mutations using automatic sequencing. DNA was selected containing the desired sequence, which is a 40Gal plasmid of 8306 bp in size.

Example 2. Obtaining a strain of E. coli Rosetta (DE3) / 40Gal, transformed with plasmid 40Gal - producer of a chimeric protein containing the amino acid sequence of recombinant α-galactosidase α-PsGal and a sequence specific for enteropeptidase.

The producer strain is obtained by transforming cells of E. coli Rosetta strain (DE3) with a 40Gal recombinant plasmid. An overnight culture (0.5 ml LB) of the recombinant α-PsGal producer strain was grown in a liter flask in LB liquid medium containing 10 g bacto-tryptone, 5 g bacto-yeast extract and 10 g NaCl, 25 mg / ml kanamycin per liter , pH 7.7, on a shaker at 200 rpm at 37 ° C for 2 hours to an optical density of 0.6-0.8 (OD ₆₀₀ ), then an IPTG expression inducer is added to a final concentration of 0.2 mM and incubated further at 16 ° C for 12 hours. To determine the productivity of the strain, cellular aqueous extracts are analyzed by electrophoresis in 12% polyacrylamide gel with sodium dodecyl sulfate. The gel is stained with Coomassie R-250 by a standard method and the relative amount of protein in the strip of the target product is determined. The content of the recombinant protein in the soluble cell fraction is at least 30% of all proteins of this fraction.

Example 3. Isolation and characterization of recombinant α-galactosidase α-PsGal.

The strain producing recombinant α-galactosidase α-PsGal E. coli Rosetta (DE3) / 40Gal is incubated in a liter flask in LB liquid medium containing 10 g bacto-tryptone, 5 g bacto-yeast extract and 10 g NaCl, 0, 2 mM IPTG, 25 mg / ml kanamycin, pH 7.7, on a shaker at 250 rpm for 12 hours at 16 ° C. Bacterial cells are pelleted in a flow centrifuge at 5000 rpm for 10 minutes. The cell suspension is disintegrated in 100 ml of buffer A (0.01 M NaH ₂ PO ₄ , pH 7.7, 0.01% NaN ₃ ) for 5 × 30 sec, cooling in ice. Then centrifuged at 5000 rpm for 10 minutes The supernatant was collected and placed on a column of metal-affinity resin (Qiagen), previously equilibrated with buffer A. Elution of the protein was carried out with buffer A containing 50 mM EDTA. Active fractions were collected and concentrated to 3 ml in buffer A containing 0.4 mM NaCl on DEAE-toyoperl 650M ion exchange resin (TOYA SODA) and incubated with enteropeptidase (Invitrogen) at 21 ° C for 15 hours. The protein solution is applied to a column for gel filtration with Sephacryl S-200 HR (Sigma). The recombinant protein yield is about 10 mg per 1 liter of culture. The resulting recombinant polypeptide is determined by the first 10 amino acids on an automatic sequencer. The sequencing of the preparation of recombinant α-galactosidase α-PsGal isolated from cells of E. coli Rosetta (DE3) / 40Gal strain showed that the N-terminal amino acid sequence A1a-Asp-Thr-Lys-Ser-Phe-Tyr-Arg-Leu -Asp corresponds to the first 10 amino acids of the full-sized natural protein α-galactosidase Pseudoalteromonas sp. KMM 701, VKMV-2135D, α-PsGal analogue.

The activity of α-galactosidase is determined by the cleavage of p-nitrophenylgalactopyranoside (p-NPHP). The reaction mixture in a volume of 400 μl contains 10 mm NaH ₂ PO ₄ (pH 7.2), 3 mm substrate and the enzyme. After 20 min incubation at 20 ° C, the reaction is stopped by adding 0.6 ml of 1 M Na ₂ CO ₃ . The amount of product formed during the enzymatic reaction is determined spectrophotometrically at 400 nm. The unit of activity is the amount of enzyme that catalyzes the release of 1 μM p-UFH (E _{400 nm} = 18600) during 1 min of incubation. The specific activity is expressed in units of enzyme activity per 1 mg of protein. The protein concentration in the solution is determined by the Bradford method.

The obtained data on the physicochemical characteristics and enzymatic activity of the product of expression of the artificial chimeric α-PsGal gene in cells of the E. coli Rosetta (DE3) / 40Gal strain indicate that the studied polypeptide corresponds to its natural analogue.

As follows from the above examples, the claimed group of inventions allows to obtain active recombinant α-galactosidase α-PsGal in high yield with a relatively simple and reliable technology.

The claimed invention allows you to:

- using the producer strain E. coli Rosetta (DE3) / 40Gal to obtain active recombinant α-galactosidase α-PsGal;

- the use of the producer strain E. coli Rosetta (DE3) / 40Gal allows to obtain a large amount of full-size recombinant α-galactosidase α-PsGal during biosynthesis;

- the use of metal-affinity and gel filtration chromatography when cleaning the enzyme from the aqueous extract of the cells of the producer strain allows you to get the enzyme with a purity of more than 98%.

The list of nucleotide and amino acid sequences

<110> Balabanova L.A., Golotin V.A., Bakunina I.Yu., Rasskazov V.A.

<120> Plasmid 40Gal, which determines the synthesis of α-galactosidase α- Ps Gal, E. coli strain Rosetta (DE3) / 40Gal, the producer strain of recombinant α-galactosidase α- Ps Gal and the method for its preparation.

<160> 1

<210> 1

<211> 2156

<212> DNA

<213> Pseudoalteromonas sp. KMM 701 VKM V-2135D

<223> Nucleotide sequence of a 40Gal plasmid fragment containing the NcoI and SalI restriction sites, an enteropeptidase specific sequence, and an α- Ps Gal structural gene sequence corresponding to an open reading frame for α- Ps Gal protein including a stop codon.

Claims (3)

1. Plasmid 40Gal size 8306 base pairs (bp), which determines the synthesis of recombinant α-galactosidase of the marine bacteria Pseudoalteromonas sp. BKM B-2135D (α-PsGal) and characterized by the presence of the following fragments: NcoI / SalI fragment of the plasmid pET-40b (+) (Novagen) and a 2142 bp DNA fragment containing a chimeric gene consisting of the structural part of the α gene -PsGal adapted at the N-terminus for expression in E. coli cells, and a nucleotide encoding a specific sequence for enteropeptidase (SEQ ID N 1). 2. The E. coli Rosetta strain (DE3) transformed with the 40Gal plasmid according to claim 1 is a producer of a chimeric protein containing the amino acid sequence of the recombinant α-galactosidase α-PsGal and an enteropeptidase-specific sequence. 3. A method of producing a recombinant α-galactosidase α-PsGal, characterized in that the producer strain according to claim 2 is incubated in LB liquid medium for 12 hours at 16 ° C, then the bacterial cells are precipitated by centrifugation, the cell suspension is disintegrated in the buffer, then the extract is centrifuged, then the supernatant is placed on a column with a metal-affine resin, the protein is eluted, then the active fractions are concentrated on an ion-exchange resin, incubated with enteropeptidase and the target product is isolated by gel filtration.

Images