CN110846301A

CN110846301A - Recombinant chitin deacetylase and preparation method and application thereof

Info

Publication number: CN110846301A
Application number: CN201911183201.9A
Authority: CN
Inventors: 丁海涛; 陈波; 俞勇; 刘克振
Original assignee: China Polar Research Center (china Polar Research Institute)
Current assignee: China Polar Research Center (china Polar Research Institute)
Priority date: 2019-11-27
Filing date: 2019-11-27
Publication date: 2020-02-28
Also published as: WO2021103295A1

Abstract

The invention provides a recombinant chitin deacetylase and a preparation method and application thereof. The inventor separates and obtains a novel chitin deacetylase which can not only catalyze deacetylation of chitin, but also effectively inhibit pathogenic bacteria. The chitin deacetylase disclosed by the invention has good adaptability to low temperature, can be expressed under the condition of prokaryotic expression, and has the characteristic of higher low-temperature activity. Meanwhile, the invention also optimizes the recombinant expression method of the low-temperature chitin deacetylase, so that the low-temperature chitin deacetylase is efficiently expressed in host cells.

Description

Recombinant chitin deacetylase and preparation method and application thereof

Technical Field

The invention belongs to the fields of microbiology, molecular biology and biochemistry, and particularly relates to recombinant heterologous expression, preparation and application research of low-temperature chitin deacetylase; the low-temperature recombinant chitin deacetylase disclosed by the invention is mainly applied to the industries of medicines, foods, agriculture and the like.

Background

Chitin (Chitin) is a straight-chain polysaccharide formed by connecting β -N-acetyl-D-glucosamine monomers through β -1,4 glycosidic bonds, chitosan is a product of chitosan deacetylation, and generally, chitosan can be called as chitosan with the N-deacetylation degree of more than 55%.

In recent years, chitosan prepared from chitin has attracted increasing attention in the scientific and industrial fields because of its many unique biological activities. At present, chitosan is mainly applied to the fields of food, medicine, environmental protection and the like, and the application range of the chitosan is continuously expanded along with the deep research. In the industrial production process of chitosan, most of the methods adopt a hot alkali method, so that the method has the defects of high production cost, poor product uniformity, difficult control of reaction process and the like, and alkaline waste liquid is generated in the production process to pollute the environment. Therefore, the problems of high energy consumption and environmental pollution in the industrial preparation of chitosan are urgently needed to be solved.

Chitin Deacetylases (CDAs) are an enzyme species for preparing chitosan by catalyzing Chitin with an enzyme method, and can convert Chitin into chitosan by catalyzing β -N-acetyl-D-glucosamine deacetylation.

Therefore, there is a need in the art to find novel chitin deacetylases with low temperature and high activity, so as to improve the industrial production level and expand the application of the chitinase.

Disclosure of Invention

The invention aims to provide a recombinant chitin deacetylase and a preparation method and application thereof.

In a first aspect of the invention, there is provided an isolated polypeptide selected from the group consisting of: (a) polypeptide with an amino acid sequence shown as SEQ ID NO. 2; (b) a polypeptide having the function of the polypeptide (a) and formed by substitution, deletion or addition of one or more (e.g., 1 to 20, preferably 1 to 10; more preferably 1 to 5; more preferably 1 to 3) amino acid residues to the polypeptide (a); or (c) a polypeptide having a homology of 80% or more (preferably 85% or more; more preferably 90% or more; more preferably 95% or more, e.g., 98%, 99%) with the amino acid sequence of the polypeptide of (a) and having the function of the polypeptide of (a); (d) a polypeptide formed by adding a tag sequence to the N-or C-terminus of the polypeptide of (a) or (b) or (C), or a signal peptide sequence to the N-terminus thereof.

In a preferred embodiment, the polypeptide has high low temperature activity; preferably, the optimal reaction temperature is 15 ℃; preferably, it still has a catalytic activity of more than 65% at, for example, 5 ℃.

In another aspect of the invention, there is provided an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (1) a polynucleotide encoding the polypeptide; (2) a polynucleotide complementary to the polynucleotide (1).

In a preferred embodiment, the polynucleotide encodes a polypeptide having the amino acid sequence shown in SEQ ID NO. 2; preferably, the nucleotide sequence of the polynucleotide is shown in SEQ ID NO. 1.

In another aspect of the invention, there is provided a vector comprising said polynucleotide.

In another aspect of the invention, there is provided a genetically engineered host cell comprising said vector, or having said polynucleotide integrated into its genome.

In a preferred embodiment, the integration comprises directed integration or random integration.

In another preferred embodiment, the cell is not a plant propagating cell or an animal stem cell.

In another preferred embodiment, the host cell is a prokaryotic cell, such as but not limited to E.coli.

In another aspect of the present invention, there is provided a method for preparing the polypeptide, comprising: (i) culturing said host cell; (ii) collecting a culture containing said polypeptide; (iii) isolating said polypeptide from the culture.

Preferably, the culturing is carried out under the following conditions: the inducer IPTG (when the host cell is Escherichia coli) is used at a concentration of 0.05-0.3 mM, preferably 0.08-0.15 mM; the induction temperature is 16-35 ℃, and more preferably 18-30 ℃; more preferably 18 to 20 ℃; the induction time is 15-20 hours; preferably 16 to 18 hours.

In another aspect of the invention there is provided the use of said polypeptide for: catalyzing the deacetylation of chitin, or for preparing a composition that catalyzes the deacetylation of chitin; preferably, chitosan is produced after deacetylation.

In another aspect of the invention there is provided the use of said polypeptide for: inhibiting microorganisms, or for preparing a composition having a function of inhibiting microorganisms; preferably, the microorganism is a microorganism whose cell wall comprises chitin.

In another aspect of the present invention, there is provided a composition comprising: said polypeptide or said host cell; and an industrially or microbiologically acceptable carrier.

In a preferred embodiment, the composition is a pesticide composition for controlling plant diseases, preferably for controlling cotton verticillium wilt, cucumber fusarium wilt and the like.

In another aspect of the invention, there is provided a method of catalyzing the deacetylation of chitin comprising: treating chitin or chitin-containing material with said polypeptide, said host cell or said composition; preferably, chitosan is produced after deacetylation.

In another aspect of the present invention, there is provided a method of inhibiting a microorganism, comprising: treating a subject in need of microorganism inhibition (e.g., a locus, a substance, an animal or plant containing a microorganism or a processed product thereof) with said polypeptide, said host cell or said composition; preferably, the microorganism is a microorganism whose cell wall comprises chitin.

In a preferred embodiment, the treatment is carried out at a temperature of 0 to 35 ℃, preferably 5 to 25 ℃, more preferably 10 to 20 ℃ (e.g., 12, 14, 15, 16, 18 ℃).

In another preferred embodiment, the treatment is carried out at a pH of 5-10, preferably at a pH of 5.5-9, more preferably at a pH of 6.5-8.5 (e.g., pH7, 7.5, 8).

In another preferred embodiment, the treatment is performed under the condition of NaCl 0.01-0.5M, preferably 0.03-0.3M, more preferably 0.05-0.2M (such as 0.06, 0.08, 0.1, 0.12, 0.15M).

In another preferred embodiment, in the presence of Na⁺、K⁺、Mg²⁺、Zn²⁺And/or Ni²⁺(the metal ion content is, for example, 1. + -. 0.8mM, preferably 1. + -. 0.5mM, more preferably 1. + -. 0.3 mM).

In another preferred embodiment, the treatment is carried out in the presence of EDTA (in an amount of, for example, 1. + -. 0.5%).

In another preferred embodiment, the treatment is carried out in the presence of DTT (in an amount of, for example, 1. + -. 0.5%).

In another preferred example, the treatment is carried out without the reaction system containing: li⁺、NH₄ ⁺、Ca²⁺、Mn²⁺、Cu²⁺、Fe²⁺、Fe³⁺SDS and/or TritonX-100.

In another preferred example, the treatment is carried out without the reaction system containing: acetone, ethanol, methanol and/or acetonitrile.

In another preferred embodiment, the microorganisms comprise: fungi; preferably the fungi include: verticillium (Verticillium) fungi, Fusarium (Fusarium) fungi, Aspergillus (Aspergillus) fungi, Penicillium (Penicillium) fungi. More preferably, the Verticillium fungi include (but are not limited to): verticillium dahlia (Verticillium dahlia); the fusarium fungi include (but are not limited to): fusarium oxysporum cucumber specialization type (Fusarium oxysporum f.sp. cucumerinum); the aspergillus fungi include (but are not limited to): aspergillus niger (Aspergillus niger); the penicillium fungi include (but are not limited to): penicillium macrocephalum (Penicillium macroclorotium).

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, recombinant expression and condition optimization of chitin deacetylase of the present invention;

(a) variation in soluble expression levels of the enzyme at different induction temperatures; wherein Lane1 is an uninduced whole cell lysate, and Lane 2-6 sequentially has an induction temperature of 15 ℃, 20 ℃, 25 ℃, 30 ℃ and 35 ℃;

(b) variation in soluble expression levels of the enzyme at different inducer concentrations; wherein Lane1 is uninduced whole cell lysate, Lane 2-9 are IPTG concentration of 0mM, 0.01mM, 0.02mM, 0.05mM, 0.1mM, 0.15mM, 0.25mM, 0.3mM in sequence;

(c) when different amounts of recombinant bacteria are inoculated, the soluble expression amount of the enzyme is changed; wherein Lane1 is an uninduced whole cell lysate, and Lane 2-7 sequentially comprise inoculum sizes of 0.5%, 1%, 1.5%, 2%, 2.5% and 3%;

(d) variation in soluble expression levels of the enzyme at different induction times; wherein Lane1 is an uninduced whole cell lysate, and Lane 2-9 are sequentially induced for 4h, 8h, 12h, 16h, 20h, 24h, 28h and 32 h.

FIG. 2 purification of recombinant expression products of chitin deacetylases according to the invention;

(a) lane1 to Lane4 each represent: whole cells without IPTG induction or IPTG induction, supernatant induced by IPTG and purified chitin deacetylase;

(b) lane1 is chitin deacetylase which is stained with Coomassie Brilliant blue R-250 after active electrophoresis, and Lane2 is chitin deacetylase which is developed with Calcofluor White M2R after active electrophoresis.

FIG. 3, properties of chitinase of the invention;

(a) the optimal temperature research of the recombinant chitin deacetylase;

(b) temperature stability study of recombinant chitin deacetylase;

(c) the optimum pH research of the recombinant chitin deacetylase;

(d) researching the pH stability of the recombinant chitin deacetylase;

(e) the effect of sodium chloride on recombinant chitin deacetylase activity;

(f) effect of sodium chloride on the stability of recombinant chitin deacetylase.

FIG. 4 shows that the recombinant chitin deacetylase of the present invention can inhibit a plurality of plant pathogenic fungi

Detailed Description

Through large-scale screening and intensive research, the inventor separates a novel chitin deacetylase (low-temperature chitin deacetylase) from a strain from Antarctic, can catalyze deacetylation of chitin, can effectively inhibit pathogenic bacteria, and has a very good application prospect. The chitin deacetylase disclosed by the invention has good adaptability to low temperature, can be expressed at relatively high temperature of prokaryotic expression, and has relatively high low-temperature activity. Meanwhile, the invention also optimizes the recombinant expression method of the low-temperature chitin deacetylase, so that the low-temperature chitin deacetylase is efficiently expressed in host cells.

As used herein, the terms "polypeptide of the invention", "protein of the invention", "low temperature chitin deacetylase", "chitin deacetylase" and "chitinase" are used interchangeably and all refer to a protein or polypeptide having SEQ ID NO 2 or a fragment or variant or derivative thereof.

As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in its native state in a living cell is not isolated or purified, the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in its native state.

As used herein, "isolated polypeptide (low temperature chitin deacetylase in the present invention)" means that the chitin deacetylase is substantially free of other proteins, lipids, carbohydrates, or other materials with which it is naturally associated. One skilled in the art can purify the chitin deacetylase using standard protein purification techniques. Substantially pure polypeptides are capable of producing a single major band on a non-reducing polyacrylamide gel. The purity of the chitin deacetylase can be analyzed by amino acid sequence analysis.

As used herein, the "microorganism" refers to a microorganism whose cell wall contains chitin, including bacteria such as fungi, actinomycetes, bacteria, or the like; preferably, the "microorganism" is a "pathogenic microorganism".

As used herein, the "pathogenic microorganism" refers to a microorganism that is hazardous to humans, animals, plants, or the environment.

As used herein, the term "comprising" means that the various ingredients can be used together in the mixture or composition of the invention. Thus, the terms "consisting essentially of and" consisting of are encompassed by the term "comprising.

As used herein, an "industrially acceptable carrier" or a "microbiologically acceptable carrier" is a solvent, suspending agent or excipient for delivering the chitin deacetylase of the present invention to a subject in need of treatment, which is controllable in toxicity, side effects, environmentally friendly or harmless to humans and animals. The carrier may be a liquid or a solid, and is preferably a carrier capable of retaining the activity of the chitin deacetylase of the present invention to a high degree.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or using recombinant technology from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plant, insect and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. The polypeptides of the invention may or may not also include an initial methionine residue.

The invention also includes fragments, derivatives and analogues of the chitin deacetylases. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity of a native chitin deacetylase of the invention. A polypeptide fragment, derivative or analogue of the invention may be (i) a polypeptide in which one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide in which the mature polypeptide is fused to another compound, such as a compound that increases the half-life of the polypeptide, e.g. polyethylene glycol, or (iv) a polypeptide in which an additional amino acid sequence is fused to the sequence of the polypeptide (e.g. a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein with an antigenic IgG fragment). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the teachings herein.

In the present invention, the term "said chitin deacetylase" refers to a polypeptide having the sequence SEQ ID NO. 2 of said chitin deacetylase activity. The term also includes variants of the sequence of SEQ ID NO. 2 that have the same function as the chitin deacetylase. These variants include (but are not limited to): deletion, insertion and/or substitution of one or more (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, still more preferably 1 to 10, most preferably 1 to 5) amino acids, and addition or deletion of one or several (usually up to 20, preferably up to 10, more preferably up to 5) amino acids at the C-terminal and/or N-terminal. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. For example, addition or deletion of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the function of the protein; for another example, expression of only the catalytic domain of the protein, but not the carbohydrate-binding domain, can achieve the same catalytic function as the intact protein. The term therefore also includes active fragments and active derivatives of the chitin deacetylase. For example, the variation may occur outside of the conserved domain of SEQ ID NO. 2.

Variants of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridizes to the chitin deacetylase DNA under high or low stringency conditions, and polypeptides or proteins obtained using antibodies against the chitin deacetylase. The invention also provides other polypeptides, such as fusion proteins comprising the chitin deacetylase or fragments thereof. In addition to almost full-length polypeptides, fragments of the chitin deacetylases are also encompassed by the present invention. Typically, the fragment has at least about 10 contiguous amino acids, typically at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, and most preferably at least about 100 contiguous amino acids of the chitin deacetylase sequence.

The induced variants may be obtained by various techniques, such as random mutagenesis by radiation or exposure to a mutagenizing agent, site-directed mutagenesis, or other known molecular biological techniques.

In the present invention, the "conservative variant of chitin deacetylase" refers to the case where at most 30, preferably at most 20, more preferably at most 10, and still more preferably at most 5 amino acids are replaced with amino acids having similar or similar properties as compared with the amino acid sequence of SEQ ID NO. 2 to form a polypeptide. These conservative variant polypeptides are preferably generated by amino acid substitutions according to Table 1.

TABLE 1

Initial residue(s)	Representative substitutions	Preferred substitutions
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

The amino-terminus or the carboxy-terminus of the chitin deacetylases of the invention may also contain one or more polypeptide fragments as protein tags. Any suitable label may be used in the present invention. For example, the tag may be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty 1.

For secretory expression of the translated protein (e.g., extracellularly), a host-compatible signal peptide may be added to the amino-terminal end of the chitin deacetylase. The signal peptide may be cleaved off during secretion of the polypeptide from the cell.

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the native coding sequence of chitin deacetylase or to the coding sequence shown in SEQ ID NO. 1 or a degenerate variant. As used herein, "degenerate variant" refers herein to a nucleic acid sequence that encodes a protein having SEQ ID NO. 2, but differs from the native coding sequence of chitin deacetylase or the coding sequence shown in SEQ ID NO. 1.

The polynucleotide encoding the mature polypeptide of SEQ ID NO. 2 comprises: a coding sequence encoding only the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide. The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, and may also include additional coding and/or non-coding sequences.

The present invention also relates to variants of the above polynucleotides which encode polypeptides having the same amino acid sequence as the present invention or fragments, analogs and derivatives of the polypeptides. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polypeptide encoded thereby.

The present invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions (or stringent conditions) to the polynucleotides of the present invention. In the present invention, "stringent conditions" mean: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 XSSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 deg.C, etc.; or (3) hybridization occurs only when the identity between two sequences is at least 90% or more, preferably 95% or more. Moreover, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO. 2.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, more preferably purified to homogeneity.

The chitin deacetylase nucleotide full-length sequence or a fragment thereof can be obtained by a PCR amplification method, a recombinant method or an artificial synthesis method. At present, DNA sequences encoding the proteins of the present invention (or fragments or derivatives thereof) have been obtained completely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art.

The invention also provides a vector comprising the polynucleotide of the invention, a genetically engineered host cell transformed with the vector of the invention or the chitin deacetylase coding sequence, and a method for producing the polypeptide of the invention by recombinant techniques.

The polynucleotide sequences of the present invention may be used to express or produce recombinant chitin deacetylases as described by conventional recombinant DNA techniques. Generally, the following steps are performed:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding said chitin deacetylase, or with a recombinant expression vector containing the polynucleotide;

(2) a host cell cultured in a suitable medium;

(3) isolating and purifying the protein from the culture medium or the cells.

In the present invention, the chitin deacetylase polynucleotide sequence may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus, or other vectors well known in the art. Any plasmid or vector may be used as long as it can replicate and is stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translation control elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing the DNA sequence encoding the chitin deacetylase and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells. Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: escherichia coli, streptomyces; bacterial cells of salmonella typhimurium; fungal cells such as yeast; a plant cell; insect cells of Drosophila S2 or Sf 9; CHO, COS, 293 cells, or Bowes melanoma cells. In a preferred embodiment of the invention, the host cell is a prokaryotic cell.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

As a preferred mode of the present invention, Escherichia coli is used as a host cell for expressing the chitin deacetylase. The invention heterologously expresses the low-temperature chitin deacetylase in the escherichia coli by constructing an expression system.

In a preferred embodiment of the present invention, the culture is performed under the following conditions: the inducer IPTG (when the host cell is Escherichia coli) is used at a concentration of 0.05-0.3 mM, preferably 0.08-0.15 mM; the induction temperature is 16-35 ℃, and more preferably 18-30 ℃; more preferably 18 to 20 ℃; the induction time is 15-20 hours; preferably 16 to 18 hours. Under the above-mentioned preferable conditions, a recombinant chitin deacetylase having a high expression level and a high enzymatic activity can be obtained.

The application of the chitin deacetylase comprises the following steps: catalyzing the deacetylation of chitin, or for preparing a composition that catalyzes the deacetylation of chitin. Preferably, chitosan is produced after deacetylation of said chitin.

The application of the chitin deacetylase also comprises inhibiting microorganisms or preparing a composition with the function of inhibiting the microorganisms. Preferably, the microorganism is a microorganism whose cell wall comprises chitin.

After obtaining the chitin deacetylase of the present invention, the skilled person can, according to the teaching of the present invention, conveniently apply the enzyme to exert a substrate-degrading effect, in particular catalyzing the deacetylation of chitin as a substrate. As a preferred mode of the present invention, there is also provided a method for degrading chitin, the method comprising: the substrate to be degraded, in particular chitin, is treated with the chitin deacetylase according to the invention.

In some of the examples of the present invention, the activity of chitin deacetylase was investigated by catalyzing the production of p-nitroanilide to p-nitroanilide. After confirming that the chitin deacetylase can catalyze the extraction of natural substrate chitin deacetylation, the inventor selects p-nitroacetanilide as an artificial substrate to carry out the enzymological property research of the chitin deacetylase.

According to the teachings of the present invention, one skilled in the art may also apply the enzyme to act as an inhibitor of microorganisms, such as pathogenic microorganisms. Comprising treating a subject in need of microorganism inhibition with said chitin deacetylase. The microorganism includes a fungus. In a preferred mode of the present invention, preferably the fungi include: verticillium (Verticillium) fungi, Fusarium (Fusarium) fungi, Aspergillus (Aspergillus) fungi, Penicillium (Penicillium) fungi; more preferably, the Verticillium fungi include (but are not limited to): verticillium dahlia (Verticillium dahlia); the fusarium fungi include (but are not limited to): fusarium oxysporum cucumber specialization (Fusarium oxysporum cumf.sp. cucumerinum); the aspergillus fungi include (but are not limited to): aspergillus niger (Aspergillus niger); the penicillium fungi include (but are not limited to): penicillium macrocephalum (Penicillium macroclorotium). The inventors found that the chitin deacetylase has an excellent degrading effect on cell wall chitin of such fungi. Therefore, the chitin deacetylase of the present invention, or cells producing the same, can be used in agricultural microbial control, such as but not limited to cotton verticillium wilt and cucumber fusarium wilt.

The present inventors also optimized the reaction system for the treatment with the chitin deacetylase, and as a preferred embodiment of the present invention, the treatment was carried out under the following conditions: the temperature is 0-35 ℃, preferably 5-25 ℃, more preferably 10-20 ℃, such as 12, 14, 15, 16, 18 ℃; a pH of 5-10, preferably a pH of 5.5-9, more preferably a pH of 6.5-8.5, such as pH7, 7.5, 8.

The inventor also finds that the application of a small amount of NaCl is beneficial to providing a good reaction environment for the chitin deacetylase and improving the catalytic activity of the chitin deacetylase; therefore, in a preferred embodiment of the present invention, NaCl is added to the enzyme reaction system (treatment system) in an amount of 0.01 to 0.5M, preferably 0.03 to 0.3M, and more preferably 0.05 to 0.2M; such as 0.06, 0.08, 0.1, 0.12, 0.15M.

The inventionIt has also been found that Na is contained in the reaction system⁺、K⁺、Mg²⁺、Zn²⁺And/or Ni²⁺Is advantageous for promoting the enzymatic activity of the chitin deacetylase of the present invention. In a preferred mode, the metal ion content is, for example, 1. + -. 0.8mM, preferably 1. + -. 0.5 mM; more preferably 1. + -. 0.3 mM.

The present inventors have also found that EDTA or DTT is contained in the reaction system to facilitate the enzymatic activity of the chitin deacetylase of the present invention. In a preferable mode, the use amount of the EDTA is 0.1 to 5 percent; preferably 0.5% to 2%, such as 1%; or, the DTT dosage is 0.1% -5%; preferably 0.5% to 2%, such as 1%.

In a preferred embodiment of the present invention, the treatment is carried out without containing in the reaction system: li⁺、NH₄ ⁺、Ca²⁺、Mn² ⁺、Cu²⁺、Fe²⁺、Fe³⁺SDS and/or TritonX-100; nor does it contain: acetone, ethanol, methanol and/or acetonitrile.

The chitin deacetylase obtained by the invention has ideal enzyme activity, can be suitable for being recombined and expressed under the temperature condition of escherichia coli expression, and further can be suitable for enzyme reactions (including enzyme catalysis reaction or microorganism inhibition) under the low-temperature condition, thereby having wide industrial application potential.

According to the separated chitin deacetylase and the amino acid sequence thereof provided by the invention, the enzyme activity of the chitin deacetylase can be further improved or the applicable pH value range, temperature range, salt resistance, cold and heat stability and the like of the chitin deacetylase can be enlarged by means of protein molecule modification and the like by persons in the field, so that the chitin deacetylase has a good application prospect. Variants or derivatives produced by engineering the chitin deacetylases described herein using these techniques are also encompassed by the present invention.

The invention also provides a composition comprising an effective amount of the chitin deacetylase of the invention, and a dietetically or industrially acceptable carrier or excipient. Such vectors include (but are not limited to): water, buffer, glucose, glycerol, DMSO, or a combination thereof. One skilled in the art can determine the effective amount of the chitin deacetylase in the composition based on the actual use of the composition.

The composition may further comprise a substance for regulating the activity of the chitin deacetylase of the present invention. Any substance having a function of enhancing the enzymatic activity is usable. Preferably, the agent that increases the activity of the chitin deacetylase is selected from the group consisting of: na (Na)⁺、K⁺、Mg²⁺、Zn²⁺And/or Ni²⁺Or can be hydrolyzed to form Na upon addition to the substrate⁺、K⁺、Mg²⁺、Zn²⁺And/or Ni²⁺Such as sodium chloride. The substance that increases the chitin deacetylase activity may also be selected from: EDTA or DTT.

The chitin deacetylase of the present invention, the vector or host cell containing the enzyme, the composition containing the enzyme or host cell, may also be contained in a container or kit. Preferably, the kit further comprises instructions for use and the like, so as to be convenient for the application of the kit by the skilled person.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Example 1 Low temperature chitin deacetylase Source and sequence information

The low-temperature chitin deacetylase is derived from a strain Pseudomonas sp.GWSMS-1(CCTCC NO.M2019207), and the strain is preserved in China center for type culture Collection, and the name of the preservation unit is as follows: china center for type culture Collection, preservation date: and 3, 27 months in 2019, wherein the preservation number is CCTCC NO. M2019207.

After obtaining the Pseudomonas sp.GWSMS-1 strain, the inventor carries out a great deal of research and tests on various performances, gene characteristics and various proteins generated by the Pseudomonas sp.GWSMS-1 strain, and carries out an important research on important functional genes and proteins, thereby screening and obtaining the low-temperature chitin deacetylase disclosed by the invention. The amino acid sequence of the low-temperature chitin deacetylase is as follows (SEQ ID NO: 2):

MSADYPRDLIGYANNPPHPHWPNDARIALSFVLNYEEGGERNILHGDKESEAFLSEMVSAQPLQGQRNLCMESLYEYGSRAGVWRLLSLFQKHNIPLTIFAVAMAAQRHPDAIKAMADAGHEICSHGYRWIDYQNMSEAEEREHMHEAIRILTELTGQRPQGWYTGRTGPNTRRLVREEGGFLYDSDTYDDDLPYWDPASTAAKPHLVIPYTLDTNDMRFTQVQGFNTGDDFFQYLKDAFDVLYAEGVAGAPKMLTIGMHCRLLGRPARLASLARFIEYVQSHEQVWCARRVDIAKHWHATHPFNEQASKELSK

example 2 cloning, heterologous expression and optimization of chitin deacetylase

1. Materials and methods

(1) Culture medium

LB liquid medium: 5g/L of yeast extract, 10g/L of tryptone and 10g/L of sodium chloride.

LB solid medium: 20g/L agar powder is added into the LB liquid culture medium.

(2) Codon optimization, whole gene synthesis and cloning of chitin deacetylase gene

The present inventors first performed codon optimization according to the expression conditions to improve the expression efficiency and the stability of the DNA fragments. The optimized sequence is inserted into a plasmid pET28a (+) to obtain a recombinant plasmid pET28-CDA, and then the recombinant plasmid pET28-CDA is transformed into Escherichia coli BL21(DE3) for heterologous expression.

(3) Optimization of expression conditions for recombinant chitin deacetylase genes

Inoculation amount: the inoculum size was set at 0.5%, 1.0%, 1.5%, 2.0%, 2.5%, 3.0%. Inoculating the recombinant strain into a fresh LB liquid culture medium according to the setting, culturing at 37 ℃ and 200rpm, and obtaining the OD of the strain liquid₆₀₀When the concentration reached 0.6 to 0.8, IPTG (no IPTG added to the control group) was added to the medium at a final concentration of 0.1mM, and then the culture was continued at 20 ℃ and 150rpm for 10 hours, followed by collection of the cells.

Induction temperature: inoculating the recombinant strain into a fresh LB liquid culture medium according to the inoculation amount of 1%, culturing at 37 ℃ and 200rpm, and obtaining the OD of the strain liquid₆₀₀Adding into the culture medium when the content of the culture medium reaches 0.6-0.8Then, the cells were cultured at 150rpm for 10 hours in the presence of IPTG (control) at a final concentration of 0.1mM (no IPTG addition), and the cells were collected after the cells were incubated at 15 ℃, 20 ℃, 25 ℃, 30 ℃ and 35 ℃ respectively.

Inducer concentration: inoculating the recombinant strain into a fresh LB liquid culture medium according to the inoculation amount of 1%, culturing at 37 ℃ and 200rpm, and obtaining the OD of the strain liquid₆₀₀When the concentration reached 0.6 to 0.8, IPTG was added to the medium at final concentrations of 0.01, 0.02, 0.05, 0.1, 0.15, 0.2, 0.25 and 0.3mM, respectively (control group was not IPTG added), and then the culture was continued at 20 ℃ and 150rpm for 10 hours, and then the cells were collected.

Induction time: inoculating the recombinant strain into a fresh LB liquid culture medium according to the inoculation amount of 1%, culturing at 37 ℃ and 200rpm, and obtaining the OD of the strain liquid₆₀₀When the concentration reached 0.6 to 0.8, IPTG (no IPTG added to the control group) was added to the medium at a final concentration of 0.1mM, and then the cells were cultured at 20 ℃ and 150rpm for 0, 4, 8, 12, 16, 20, 24, and 32 hours, respectively, and then collected.

(4) Protein electrophoresis

Centrifuging at 10000g for 10min to collect thallus, washing with normal saline and suspending thallus, then ultrasonically breaking thallus cells, centrifuging at 15000g for 10min at 4 ℃ to collect supernatant, and taking 15 μ L of supernatant to perform SDS-PAGE electrophoresis.

2. Results

(1) Codon optimized sequence

The codon-optimized chitin deacetylase gene sequence is as follows (SEQ ID NO: 1):

ATGAGCGCGGATTATCCGCGTGATCTGATTGGCTACGCTAACAACCCGCCGCACCCGCACTGGCCGAACGATGCGCGTATCGCACTGAGCTTTGTTCTGAATTATGAAGAAGGTGGTGAACGTAACATTCTGCATGGTGATAAAGAATCTGAAGCATTCCTGTCTGAAATGGTTTCTGCTCAGCCGCTGCAAGGCCAGCGTAACCTGTGTATGGAATCTCTGTATGAATACGGTTCTCGTGCAGGCGTTTGGCGTCTGCTGAGCCTGTTCCAGAAACACAACATCCCGCTGACCATCTTCGCGGTTGCGATGGCGGCGCAGCGTCACCCGGATGCGATCAAAGCAATGGCGGATGCTGGCCACGAAATCTGCAGCCACGGTTACCGTTGGATCGATTACCAGAACATGAGCGAAGCGGAAGAACGTGAACACATGCACGAAGCGATCCGCATCCTGACCGAACTGACCGGCCAGCGTCCGCAGGGCTGGTACACCGGTCGTACCGGCCCGAACACCCGTCGTCTGGTTCGTGAAGAAGGCGGCTTCCTGTACGACTCTGACACCTACGATGATGATCTGCCGTACTGGGATCCGGCGAGCACCGCGGCGAAACCGCACCTGGTTATCCCGTACACCCTGGATACCAACGATATGCGTTTCACCCAGGTTCAGGGCTTCAACACCGGTGATGATTTCTTCCAGTACCTGAAAGATGCGTTCGATGTTCTGTACGCGGAAGGCGTTGCGGGCGCGCCGAAAATGCTGACCATCGGTATGCACTGCCGTCTGCTGGGTCGTCCGGCGCGTCTGGCGTCCCTGGCGCGTTTCATCGAATACGTTCAGAGCCACGAACAGGTTTGGTGCGCGCGTCGTGTGGATATCGCGAAACACTGGCACGCGACCCACCCGTTCAACGAACAGGCGTCTAAAGAACTGAGCAAATAA

(2) expression condition optimization

Induction temperature (fig. 1 a): when the induction temperature is 15 ℃, the soluble expression quantity of the recombinant chitin deacetylase is low; when the induction temperature is 20-35 ℃, the soluble expression quantity of the recombinant chitin deacetylase does not change obviously; therefore, the optimum induction temperature is 20 ℃.

Inducer concentration (fig. 1 b): when the concentration of the inducer is less than 0.1mM, the soluble expression amount of the recombinant chitin deacetylase is lower; when the concentration of the inducer IPTG is higher than 0.1mM, the soluble expression quantity of the recombinant chitin deacetylase does not change obviously; therefore, the optimal final concentration of inducer is 0.1 mM.

Inoculum size (fig. 1 c): when the inoculation amount is 0.5-1.5%, the soluble expression amount of the recombinant chitin deacetylase is gradually increased; when the inoculation amount is 1.5-3.0%, the soluble expression amount of the recombinant chitin deacetylase does not change obviously; therefore, the optimal inoculation amount is 1.5%.

Induction time (fig. 1 d): when the induction time is shorter than 16 hours, the soluble expression amount of the recombinant chitin deacetylase is low; when the induction time is longer than 16 hours, the soluble expression quantity of the recombinant chitin deacetylase does not change obviously; therefore, the optimal induction time is 16 hours.

Under the preferable expression conditions, the expression amount of the recombinant chitin deacetylase is 9.6 mg/L.

Example 3 preparation of recombinant chitin deacetylase

1. Materials and methods

(1) Preparation of crude enzyme solution

Inoculating the recombinant strain into a fresh LB liquid culture medium according to the inoculation amount of 1%, culturing at 37 ℃ and 200rpm, and obtaining the OD of the strain liquid₆₀₀When the concentration reached 0.6 to 0.8, IPTG was added to the medium at a final concentration of 0.1mM, and the cells were further cultured at 20 ℃ and 150rpm for 16 hours, respectively, and then centrifuged to collect the cells. The centrifuged thallus is fully suspended in a lysis buffer solution, cells are crushed by ultrasound, then cell debris is removed by centrifugation at 15000g and 4 ℃ for 10min, and the obtained supernatant is collected to be a crude enzyme solution.

(2) Preparation of pure enzyme

The preparation of pure enzyme was carried out by Ni-NTA affinity chromatography gravity column, crude enzyme solution was filtered with 0.45 μm filter before loading, after loading of crude enzyme solution and binding of filler, the bed volume was rinsed with rinsing buffer about 10-15 times to remove foreign proteins, and then pure enzyme was eluted by adding elution buffer. And desalting the eluted pure enzyme by ultrafiltration, switching into an enzyme storage buffer solution, subpackaging and storing in a refrigerator at the temperature of minus 80 ℃ for later use.

(3) Activity assay

The activity of the chitin deacetylase is determined by adopting a p-nitroacetanilide method, the method takes the p-nitroacetanilide as an action substrate, the chitin deacetylase can catalyze the p-nitroacetanilide to generate the p-nitroaniline, and the activity characterization of the chitin deacetylase is performed by determining the light absorption value of a product at 400 nm.

Drawing a standard curve: firstly, weighing 0.1g of paranitroaniline, diluting with distilled water to a constant volume of 1L, respectively diluting to appropriate concentrations, measuring the light absorption values of diluents with different concentrations at 400nm, using the distilled water as a reference, and drawing a standard curve by taking the concentration of the paranitroaniline as an abscissa and the light absorption value as an ordinate.

Determination of chitin deacetylase Activity: taking Tris-HCl 3mL of pH 8.00.05M, adding 1mL (200mg/L) of paranitroacetanilide solution, then adding recombinant chitin deacetylase, carrying out water bath heat preservation at 50 ℃ for 15min, then carrying out boiling water bath for 3-5min to terminate the reaction, adding distilled water to reach a constant volume of 10mL, oscillating and mixing uniformly, centrifuging 3500g for 10min, taking supernatant to measure the light absorption value at 400nm, adding 1mL of inactivated enzyme solution with corresponding concentration (carrying out boiling water bath inactivation) into a blank control experiment system, and measuring the light absorption value at 400nm of the supernatant, wherein the rest is the same as the above.

The amount of enzyme required to produce 1. mu.g of p-nitroaniline per hour under the above-mentioned conditions of the chitin deacetylase reaction system was defined as one unit of enzyme activity.

2. Results

The SDS-PAGE electrophoresis of the recombinant chitin deacetylase is shown in FIG. 2(a), and lanes 1 to 4 show the whole cells without IPTG induction and IPTG induction, the supernatant with IPTG induction and the purified chitin deacetylase, respectively, and it can be seen from the figure that the purified and ultrafiltered enzyme shows only a single band, which shows that the enzyme has been electrophoretically purified by Ni-NTA Agarose filler gravity column. Comparison with protein Marker showed that the size of the chitin deacetylase was around 40 kDa).

FIG. 2b shows the results of electrophoresis of active proteins of chitin deacetylase, with the left panel showing Coomassie Brilliant blue R-250 staining and the right panel showing the active staining of chitinase (see Trudel 1990), and with Calcofluor White M2R staining. The color reagent is a fluorescent whitening agent, can absorb specific ultraviolet light and reflect back blue light, and the fluorescence intensity of the color reagent after being combined with the reaction product chitosan is higher than that of the color reagent after being combined with the substrate chitin, so that a strip brighter than the background appears at the position with chitosan. Referring to FIG. 2, it is shown that Coomassie Brilliant blue and the active stained target band are identical in position on the gel, indicating that the active chitin deacetylase has deacetylation on chitin.

The specific activity of the purified recombinant chitin deacetylase is 150.5U/mg, and the total enzyme activity recovery rate is about 53%.

Example 4 chitin deacetylase Properties

1. Materials and methods

(1) Optimum temperature and temperature stability

Optimum temperature: the recombinant chitinase reacts for 30min at 0 deg.C, 5 deg.C, 10 deg.C, 15 deg.C, 20 deg.C, 25 deg.C, 30 deg.C, 35 deg.C, 40 deg.C, 45 deg.C, 50 deg.C, 55 deg.C and 60 deg.C respectively under standard reaction conditions, the control group is chitin deacetylase solution inactivated in boiling water bath for 5min, and the activity is measured according to the detection method of chitin deacetylase activity.

Temperature stability: the recombinant chitin deacetylase was treated under the above temperature conditions for 1 hour, and then the activity of the chitin deacetylase was measured at the optimum reaction temperature.

(2) Optimum pH and pH stability

Optimum pH: the recombinant chitinase reacts in buffers with pH of 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 and 11.0 respectively for 30min under standard reaction conditions, and the activity of the recombinant chitinase is detected according to a chitin deacetylase activity detection method.

pH stability: the recombinant chitinase was treated at 4 ℃ for 1 hour under the above pH conditions, and then the activity of chitin deacetylase was measured at the optimum reaction temperature.

(3) Effect of sodium chloride on recombinant chitin deacetylase Activity and stability

Activity: the recombinant chitinase is added with sodium chloride with final concentration of 0.1, 0.5, 1, 1.5, 2, 2.5, 3, 3.5 and 4M respectively under standard reaction conditions for reaction for 30min, and then the activity of the chitin deacetylase is measured.

Stability: the recombinant chitinase was treated at 4 ℃ for 1 hour under the above-mentioned sodium chloride concentration conditions, and then the activity of chitin deacetylase was measured at the optimum reaction temperature.

(4) Effect of Metal ions and the like on recombinant chitin deacetylase Activity

Respectively preparing a buffer system containing NaCl, KCl, LiCl and NH under the optimal pH₄Cl、MgCl₂、CaCl₂、MnCl₂、CuSO₄、NiSO₄·6H₂O、ZnSO₄、CoCl₂、FeSO₄·7H₂O、FeCl₃·6H₂O1 mM each, and 1% each of EDTA, DTT, TritonX-100, and SDS, and the activity of each was measured according to the method for measuring chitin deacetylase activity.

(5) Effect of organic solvents on recombinant chitin deacetylase Activity

The chitin deacetylase solution is respectively put into organic solvents with volume fractions of 10%, 20%, 30%, 40% and 50% such as methanol, ethanol, acetone and acetonitrile, and is subjected to heat preservation at 4 ℃ for 1 hour, and then the activity of the chitin deacetylase is determined.

2. Results

(1) Optimum temperature and temperature stability

Optimum temperature: as shown in FIG. 3a, the optimal reaction temperature of the recombinant chitin deacetylase is 15 ℃, the catalytic activity of the recombinant chitin deacetylase is over 80% when the catalytic temperature is between 10 ℃ and 20 ℃, the recombinant chitin deacetylase still has 68.89% catalytic activity when the reaction temperature is 5 ℃, and the chitin deacetylase activity is not detected when the catalytic temperature is 55 ℃. Indicating that the recombinant chitin deacetylase is a low-temperature enzyme.

Temperature stability: as shown in FIG. 3b, the enzyme activity decreased to 76% when the recombinant chitin deacetylase was treated at 15 ℃ for 1 hour, and substantially no enzyme activity was detected when the recombinant enzyme was treated at 40 ℃ for 1 hour, indicating that the recombinant chitin deacetylase is a low-temperature enzyme.

(2) Optimum pH and pH stability

Optimum pH: as shown in FIG. 3c, the optimal catalytic pH of the recombinant chitin deacetylase was 7.0, and the catalytic activity decreased rapidly when the pH was less than 6.0 or greater than 8.0, indicating that the enzyme is a neutral enzyme.

pH stability: as shown in fig. 3 d: the recombinant chitin deacetylase has the highest stability at pH 8.0.

Activity: as shown in FIG. 3e, the catalytic activity of recombinant chitin deacetylase was higher at sodium chloride concentrations of 0-0.5M than without sodium chloride, indicating that the recombinase had some sodium chloride tolerance and the catalytic efficiency was the highest at sodium chloride concentrations of 0.1M, while the recombinase was inhibited at sodium chloride concentrations above 0.5M. It can be seen that the low concentration of NaCl contributes to the improvement of the catalytic activity of the recombinase.

Stability: as shown in FIG. 3f, the relative enzyme activity of the recombinant chitin deacetylase was less than 50% after storage at 4 ℃ for 1 hour at a sodium chloride concentration of more than 1M, indicating that the recombinase has a general tolerance to sodium chloride.

(4) Effect of metal ions and the like on enzyme activity of recombinant chitin deacetylase

As shown in Table 2, 1mM of Na⁺、K⁺、Mg²⁺、Zn²⁺And Ni²⁺The recombinant enzyme has a promoting effect on the catalytic activity of the recombinant enzyme, wherein the promoting effect of nickel ions is most obvious, and other metal ions have inhibiting effects on recombinant chitin deacetylase to different degrees; 1% of EDTA and 1% of DTT have promotion effect on the catalytic activity of the chitin recombinase, and 1% of SDS and 1% of TritonX-100 have complete inhibition effect on the catalytic activity of the recombinase.

TABLE 2 Effect of Metal ions and other Compounds on recombinant chitin deacetylase Activity

(5) Effect of organic solvents on the stability of recombinant chitin deacetylases

As shown in Table 3, the recombinant chitin deacetylase had a relative enzyme activity of 76% after being stored in a 30% DMSO solution at 4 ℃ for 1 hour, indicating that the recombinase had good tolerance to DMSO; the recombinant enzyme still has 80% activity when being stored in 20% acetone solution for 1 hour at 4 ℃; the recombinase has poor tolerance in methanol, ethanol and acetonitrile with the concentration of more than 20 percent, and the relative enzyme activity is lower than 50 percent when the recombinase is stored in acetonitrile with the concentration of 10 percent for 1 hour at 4 ℃.

TABLE 3 Effect of organic solvents on the stability of recombinant chitin deacetylases

Example 5 antifungal experiment

1. Materials and methods

(1) Culture medium

The same as in example 2.

(2) Preparation of recombinant chitin deacetylase

The same as in example 3.

(3) Antifungal experiments

Soaking a filter paper sheet with the diameter of 6mm in the recombinant chitin deacetylase solution for 5min, punching a bacterium plate by using a puncher with the diameter of 0.5cm, and inoculating the bacterium plate to the central position of a new culture dish with a PDA culture medium; then 1 piece of soaked filter paper sheet is placed in the center of the bacteria tray, the inhibition condition is observed after the bacteria tray is cultured at 20 ℃, and 1 time of experimental solution is dripped on the filter paper sheet every 2 hours during the culture period.

(4) Fungal test strains

Verticillium dahlia CICC 2534 (Verticillium dahlia); fusarium oxysporum cumf.sp. cummerinum cic 2532 (Fusarium oxysporum cucumber specialization type); aspergillus niger CICC 2039 (Aspergillus niger); penicillium macrocrotorum CICC 40649 (Penicillium macrocarpum).

2. Results

As shown in fig. 4, the recombinant chitin deacetylase of the present invention can have a good inhibitory effect on plant pathogenic fungi Verticilliumdahlia CICC 2534, Fusarium oxysporum f.sp.cumerinum CICC 2532; also shows significant inhibitory effect on Aspergillus niger CICC 2039 and Penicillium macroxerostomium CICC 40649. The inhibition statistics are shown in table 4.

TABLE 4

Bacterial strains	Inhibition rate on day 6
		Verticillium dahlia CICC 2534	56％
Fusarium oxysporum f.sp.cucumerinum CICC 2532	43％
		Aspergillus niger CICC 2039	34％
Penicillium macrosclerotiorum CICC 40649	57％

Verticillium dahlia CICC 2534 and Fusarium oxysporum.sp.cucumerinum CICC 2532 are known to cause cotton Verticillium wilt and cucumber Fusarium wilt, respectively, indicating that the recombinant chitosanase of the present invention has the ability to be applied to biological control of the above two plant diseases.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> China polar research center (China polar research institute)

<120> recombinant chitin deacetylase and preparation method and application thereof

<130>198164

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>945

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221>misc_feature

<222>(1)..(945)

<223> codon optimized chitin deacetylase gene sequence

<400>1

atgagcgcgg attatccgcg tgatctgatt ggctacgcta acaacccgcc gcacccgcac 60

tggccgaacg atgcgcgtat cgcactgagc tttgttctga attatgaaga aggtggtgaa 120

cgtaacattc tgcatggtga taaagaatct gaagcattcc tgtctgaaat ggtttctgct 180

cagccgctgc aaggccagcg taacctgtgt atggaatctc tgtatgaata cggttctcgt 240

gcaggcgttt ggcgtctgct gagcctgttc cagaaacaca acatcccgct gaccatcttc 300

gcggttgcga tggcggcgca gcgtcacccg gatgcgatca aagcaatggc ggatgctggc 360

cacgaaatct gcagccacgg ttaccgttgg atcgattacc agaacatgag cgaagcggaa 420

gaacgtgaac acatgcacga agcgatccgc atcctgaccg aactgaccgg ccagcgtccg 480

cagggctggt acaccggtcg taccggcccg aacacccgtc gtctggttcg tgaagaaggc 540

ggcttcctgt acgactctga cacctacgat gatgatctgc cgtactggga tccggcgagc 600

accgcggcga aaccgcacct ggttatcccg tacaccctgg ataccaacga tatgcgtttc 660

acccaggttc agggcttcaa caccggtgat gatttcttcc agtacctgaa agatgcgttc 720

gatgttctgt acgcggaagg cgttgcgggc gcgccgaaaa tgctgaccat cggtatgcac 780

tgccgtctgc tgggtcgtcc ggcgcgtctg gcgtccctgg cgcgtttcat cgaatacgtt 840

cagagccacg aacaggtttg gtgcgcgcgt cgtgtggata tcgcgaaaca ctggcacgcg 900

acccacccgt tcaacgaaca ggcgtctaaa gaactgagca aataa 945

<210>2

<211>314

<212>PRT

<213> Pseudomonas sp (Pseudomonas sp.)

<400>2

Met Ser Ala Asp Tyr Pro Arg Asp Leu Ile Gly Tyr Ala Asn Asn Pro

1 5 10 15

Pro His Pro His Trp Pro Asn Asp Ala Arg Ile Ala Leu Ser Phe Val

20 25 30

Leu Asn Tyr Glu Glu Gly Gly Glu Arg Asn Ile Leu His Gly Asp Lys

35 40 45

Glu Ser Glu Ala Phe Leu Ser Glu Met Val Ser Ala Gln Pro Leu Gln

50 55 60

Gly Gln Arg Asn Leu Cys Met Glu Ser Leu Tyr Glu Tyr Gly Ser Arg

65 70 75 80

Ala Gly Val Trp Arg Leu Leu Ser Leu Phe Gln Lys His Asn Ile Pro

85 90 95

Leu Thr Ile Phe Ala Val Ala Met Ala Ala Gln Arg His Pro Asp Ala

100 105 110

Ile Lys Ala Met Ala Asp Ala Gly His Glu Ile Cys Ser His Gly Tyr

115 120 125

Arg Trp Ile Asp Tyr Gln Asn Met Ser Glu Ala Glu Glu Arg Glu His

130 135 140

Met His Glu Ala Ile Arg Ile Leu Thr Glu Leu Thr Gly Gln Arg Pro

145 150 155 160

Gln Gly Trp Tyr Thr Gly Arg Thr Gly Pro Asn Thr Arg Arg Leu Val

165 170 175

Arg Glu Glu Gly Gly Phe Leu Tyr Asp Ser Asp Thr Tyr Asp Asp Asp

180 185 190

Leu Pro Tyr Trp Asp Pro Ala Ser Thr Ala Ala Lys Pro His Leu Val

195 200 205

Ile Pro Tyr Thr Leu Asp Thr Asn Asp Met Arg Phe Thr Gln Val Gln

210 215 220

Gly Phe Asn Thr Gly Asp Asp Phe Phe Gln Tyr Leu Lys Asp Ala Phe

225 230 235 240

Asp Val Leu Tyr Ala Glu Gly Val Ala Gly Ala Pro Lys Met Leu Thr

245 250 255

Ile Gly Met His Cys Arg Leu Leu Gly Arg Pro Ala Arg Leu Ala Ser

260 265 270

Leu Ala Arg Phe Ile Glu Tyr Val Gln Ser His Glu Gln Val Trp Cys

275 280 285

Ala Arg Arg Val Asp Ile Ala Lys His Trp His Ala Thr His Pro Phe

290 295 300

Asn Glu Gln Ala Ser Lys Glu Leu Ser Lys

305 310

Claims

1. An isolated polypeptide selected from the group consisting of:

(a) polypeptide with an amino acid sequence shown as SEQ ID NO. 2;

(b) a polypeptide which is formed by substituting, deleting or adding one or more amino acid residues to the polypeptide of (a) and has the function of the polypeptide of (a); or

(c) A polypeptide having a homology of 80% or more with the amino acid sequence of the polypeptide of (a) and having a function of the polypeptide of (a);

(d) a polypeptide formed by adding a tag sequence to the N-or C-terminus of the polypeptide of (a) or (b) or (C), or a signal peptide sequence to the N-terminus thereof.

2. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:

(1) a polynucleotide encoding the polypeptide of claim 1;

(2) a polynucleotide complementary to the polynucleotide (1);

preferably, the polynucleotide encodes a polypeptide having an amino acid sequence as set forth in SEQ ID NO. 2; preferably, the nucleotide sequence of the polynucleotide is shown in SEQ ID NO. 1.

3. A vector comprising the polynucleotide of claim 2.

4. A genetically engineered host cell comprising the vector of claim 4, or having the polynucleotide of claim 2 integrated into its genome.

5. A method of making the polypeptide of claim 1, comprising: (i) culturing the host cell of claim 4; (ii) collecting a culture comprising the polypeptide of claim 1; (iii) isolating the polypeptide of claim 1 from the culture;

preferably, the culturing is carried out under the following conditions:

the concentration of inducer IPTG is 0.05-0.3 mM, preferably 0.08-0.15 mM;

the induction temperature is 16-35 ℃, and more preferably 18-30 ℃; more preferably 18 to 20 ℃;

the induction time is 15-20 hours; preferably 16 to 18 hours.

6. Use of the polypeptide of claim 1 for:

catalyzing the deacetylation of chitin, or for preparing a composition that catalyzes the deacetylation of chitin; preferably, chitosan is produced after deacetylation; or

Inhibiting microorganisms, or for preparing a composition having a function of inhibiting microorganisms; preferably, the microorganism is a microorganism whose cell wall comprises chitin.

7. A composition comprising an ingredient selected from the group consisting of: the polypeptide of claim 1; or the host cell of claim 5; and

an industrially or microbiologically acceptable carrier.

8. A method of catalyzing the deacetylation of chitin comprising: treating chitin or a chitin-containing material with the polypeptide of claim 1, the host cell of claim 5, or the composition of claim 8; preferably, chitosan is produced after deacetylation; preferably, the treatment is carried out under the following conditions:

the temperature is 0 to 35 ℃, preferably 5 to 25 ℃, more preferably 10 to 20 ℃;

a pH value of 5-10, preferably a pH value of 5.5-9, more preferably a pH value of 6.5-8.5;

NaCl 0.01-0.5M, preferably 0.03-0.3M, more preferably 0.05-0.2M;

containing Na⁺、K⁺、Mg²⁺、Zn²⁺And/or Ni²⁺；

Contains EDTA; and/or

Contains DTT.

9. A method of inhibiting a microorganism, comprising: treating a subject in need of inhibition of a microorganism with the polypeptide of claim 1, the host cell of claim 5, or the composition of claim 8; preferably, the microorganism is a microorganism whose cell wall comprises chitin; preferably, the treatment is carried out under the following conditions:

NaCl 0.01-0.5M, preferably 0.03-0.3M, more preferably 0.05-0.2M;

containing Na⁺、K⁺、Mg²⁺、Zn²⁺And/or Ni²⁺；

Contains EDTA; and/or

Contains DTT.

10. The method of claim 6, 7 or 9, wherein the microorganisms comprise: fungi; preferably the fungi include: verticillium (Verticillium) fungi, Fusarium (Fusarium) fungi, Aspergillus (Aspergillus) fungi, Penicillium (Penicillium) fungi;

more preferably, the Verticillium fungi include: verticillium dahlia (Verticillium dahlia); the fusarium fungi include: fusarium oxysporum cucumber specialization type (Fusarium oxysporum f.sp. cucumerinum); the Aspergillus fungi include: aspergillus niger (Aspergillus niger); the penicillium fungi include: penicillium macrocephalum (Penicillium macroclorotium).