CN109777796A - A kind of chitin deacetylation enzyme mutant and preparation method thereof that catalytic activity improves - Google Patents
A kind of chitin deacetylation enzyme mutant and preparation method thereof that catalytic activity improves Download PDFInfo
- Publication number
- CN109777796A CN109777796A CN201711125982.7A CN201711125982A CN109777796A CN 109777796 A CN109777796 A CN 109777796A CN 201711125982 A CN201711125982 A CN 201711125982A CN 109777796 A CN109777796 A CN 109777796A
- Authority
- CN
- China
- Prior art keywords
- ala
- chitin
- arg
- leu
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention, which discloses, provides a kind of chitin deacetylation enzyme mutant and preparation method thereof that catalytic activity improves, and belongs to technical field of bioengineering.Marine bacteria Roseivivax atlanticus chitin deacetylase as shown in SEQ ID NO.1, has been carried out following mutation by the present invention: 116 asparagine Q-spoilings are arginine R, 179 aspartic acid D sport glycine G, 194 hyte propylhomoserin H sport tyrosine Y, 254 valine V sport leucine I, 282 be that histidine H sports aspartic acid.Before mutation, the Rate activity of mutant enzyme is 2.63 times of wild-type enzyme.Chitin deacetylase catalytic efficiency provided by the invention is higher, is more suitable industrial production demand.
Description
Technical field
The invention belongs to technical field of bioengineering, and in particular to a kind of chitin deacetylase that catalytic activity improves
Mutant and gene containing the mutant, cell and preparation method thereof.
Background technique
Chitin (chitin) is also known as chitin, chitin etc., is logical by N- acetyl-D gucosamine (GlcNAc) monomer
Straight chain polymer compound made of β-Isosorbide-5-Nitrae glycosidic bond links is crossed, is the natural organic for being only second to cellulose and occupying the second in the world
Close object.Chitin is not soluble in water and common organic solvents, it is difficult to apply.The chitosan formed after chitin is deacetylated has good
Good biocompatibility and biodegradability, is widely used in the fields such as food, medicine, light industry, printing and dyeing, environmental protection and agricultural.
The deacetylated processing method for being converted into chitosan of chitin is divided into chemical heat alkaline process and biological enzyme.Chemical method is not only
It is seriously polluted, and reaction process is not easy to control, molecular weight product is unstable.What is be particularly acute is that emission causes huge ring
Border pollution, it is serious to periphery ecological disruption.Biological enzyme reaction is mild, environmental-friendly, can prepare the chitosan of high quality.
Chitin deacetylase (E.C.3.2.1.41) biological enzyme prepares the main of chitosan and uses enzyme, can be by the acetyl of chitin
Base directly removes, but does not degrade to the main chain of chitin molecule, and being used in combination to prepare with certain enzyme has spy
Determine the product of acetyl base location.
China is less for the correlative study report of chitin deacetylase, lacks chitin with independent intellectual property rights
Matter deacetylase, and the problems such as that there are producing enzyme vigor is low, deacetylated effect is poor.Since there are these problems, lead to chitin
Higher cost of the deacetylase in industrial application, biological enzyme prepare chitosan and are difficult to scale up scale.It is novel by screening
The chitin deacetylase producing strains with higher catalytic activity can alleviate the above problem.But with to chitin
The screening of deacetylase microorganism, bacterial strain repeat screening rate and increase, it is difficult to which screening obtains the novel higher chitin of catalytic efficiency
Matter deacetylase bacterial strain.
The fast development of the directed evolution technologies of enzyme engineering especially enzyme, to improve chitin deacetylase catalytic efficiency
It is filled with vigor and vitality.By the way that enzyme can be improved using technologies such as rite-directed mutagenesis, fixed point saturation mutation, DNA-shuffling
Catalysis characteristics, change enzyme includes the conditions such as most suitable catalytic temperature, most suitable catalytic pH and the catalysis effect that enzyme can be improved
Rate.China is concentrated mainly on strain improvement, the purifying of enzyme, expression and zymologic property, hair to the research of chitin deacetylase
In terms of the improvement of ferment technique, the higher chitin deacetylase of catalytic efficiency is rarely reported.
Summary of the invention
It is improved in view of the above existing problems in the prior art, the present invention provides the catalytic activity that a kind of catalytic activity improves
Chitin deacetylation enzyme mutant simultaneously provides the method for determining mutating acid, the chitin that the building catalytic activity improves
The method of deacetylation enzyme mutant and the de- second of chitin that the catalytic activity raising is produced using engineering bacteria fermentation
The method of acyl group enzyme mutant.The present invention is by marine bacteria Roseivivax atlanticus chitin deacetylase (amino
Acid sequence (GenBank indexed number: WP_043845084.1)) carry out following mutation: 116 asparagine Q-spoilings are smart ammonia
Sour R, 179 Aspartic acid mutations are glycine, 194 hyte propylhomoserin H sport tyrosine Y, 254 valine mutations are bright ammonia
Sour I, 282 sport aspartic acid for histidine H.Before mutation, the Rate activity of mutant enzyme is 2.63 times of wild-type enzyme.This
It is higher to invent the chitin deacetylase catalytic efficiency provided, is more suitable industrial production demand.
To achieve the goals above, the technical solution adopted by the present invention is that:
A kind of chitin deacetylation enzyme mutant that catalytic activity improves, by marine bacteria Roseivivax
Atlanticus chitin deacetylation enzyme amino acid sequence has carried out following mutation: 116 days as shown in SEQ ID NO.1
Winter amide Q-spoiling be arginine R, 179 aspartic acid D sport glycine G, 194 hyte propylhomoserin H sport tyrosine Y,
254 valine V sport isoleucine I, 282 and sport aspartic acid for histidine H.
Preferably, its amino acid sequence of chitin deacetylation enzyme mutant such as SEQ ID that catalytic activity improves
It is by marine bacteria Roseivivax atlanticus chitin deacetylation enzyme amino acid sequence such as SEQ ID shown in NO.2
116th asparagine Q-spoiling shown in NO.1 is arginine R, 179 Aspartic acid mutations are glycine, 194 hyte propylhomoserins
H sports tyrosine Y, 254 valine mutations are leucine I, 282 are that histidine H sports aspartic acid.
The present invention also provides a kind of gene for encoding the chitin deacetylation enzyme mutant that above-mentioned catalytic activity improves,
Nucleotide sequence is as shown in SEQ ID NO.3.
The present invention also provides a kind of carriers of, contain gene described above.
The present invention also provides a kind of cells of, contain gene described above.
The present invention also provides a kind of transgenic cell lines, contain gene described above.
The present invention also provides a kind of sides for obtaining the chitin deacetylation enzyme mutant that catalytic activity described above improves
Method is expressed after carrying out rite-directed mutagenesis by gene of the design primer to coding chitin deacetylase.
It preferably, is using plasmid pEtac-His6-rac as template design primer to carry out mutation and by the plasmid after mutation
Conversion enters E.coli DH5 α and is expanded, and then expresses the recombinant plasmid containing mutated gene with E.coli BL21 (DE3).
The present invention also provides a kind of chitin for producing catalytic activity raising described above using engineering bacteria fermentation is de-
The method of acetyl group enzyme mutant, being will be containing the recombinant bacterium E.coli of the gene of encoding mutant chitin deacetylase
It is inoculated into the fermentation medium containing ampicillin after BL21 (DE3) (pEtac-His6-racm) activation culture, culture is extremely
Bacterium solution OD600 reaches 0.6, and IPTG, induction fermentation is added.
Preferably, 100 μ g mL-1 ampicillins are contained in the fermentation medium, culture medium group becomes tryptose
Peptone 10g/L, yeast extract 5g/L, NaCl 10g/L.
The present invention makes encoded chitin deacetylase by Fixedpoint mutation modified chitin deacetylation enzyme gene
Catalytic activity increases；The Rate activity of mutant enzyme enzyme be wild-type enzyme 2.63 times (chitin deacetylase enzyme-activity unit definition:
The volume that chitin deacetylase catalysis substrate generates enzyme solution required for 1 μ g paranitroanilinum per hour is defined as an enzyme activity
Unit of force.) other catalysis characteristics of enzyme are basically unchanged, chitin deacetylase provided by the invention is more suitable industrial metaplasia
Production demand meets the requirement of social production.
The beneficial effects of the present invention are: providing the chitin deacetylation enzyme mutant and its system of a kind of catalytic activity raising
Preparation Method in Phage Antibody Library and is identified and obtains the single chain monoclonal antibody scFv of the anti-MLAA-34 of specificity, for the first time
Expression and purification has gone out MLAA-34 albumen, provides antigen protein for monoclonal antibody preparation.Conducive to the method for genetic engineering, in Quan Renyuan
Elutriation and the full Human monoclonal antibody of anti-MLAA-34 is identified in phage antibody library.Obtain the high expression MLAA-34's of specific binding
The full source of people single chain monoclonal antibody ScFv of tumor cell line.Full source of people single chain monoclonal antibody ScFv solves source of mouse antibody
Immunogenicity, single-chain antibody ScFv are formed by connecting by the heavy chain and light chain of antibody variable region by linker, and molecular weight is small, wears
Saturating power is strong, more conducively applies.
Specific embodiment
Recombination chitin deacetylation enzyme purification method in the present invention, according to Ni-NTA Purification System
(Invitrogen company, U.S. nvitrogenTMK95001) specification operates.The directly upper Ni-NTA column of cell membrane solubility object,
Successively with the elution of imidazoles containing various concentration (50mmol/l, 100mmol/l, 150mmol/l, 200mmol/l), collect
Eluting peak, synchronous collection sample and the measurement for carrying out enzyme activity and protein content.
Recombinant protein assay using modified form Lowry method determination of protein concentration kit (the raw work in Shanghai,
C504041-1000)。
The invention solves first technical problem be to provide the chitin deacetylase that a kind of catalytic activity improves
Mutant.
It is chitin deacetylase shown in WP_043845084.1 as base that the mutant, which is using GenBank indexed number,
116 asparagine Q-spoilings are that arginine R, 179 aspartic acid D sport glycine G, 194 hyte propylhomoserin H mutation by plinth
Isoleucine I is sported for tyrosine Y, 254 valine V, 282 hyte propylhomoserin H sport aspartic acid D.
The invention solves second technical problem method for being to provide determining mutating acid, compared by BLAST
Roseivivax atlanticus chitin deacetylation enzyme sequence and sequence similarity are higher than 80% chitin deacetylation
Enzyme sequence finds different amino acid sites, and it is several further to simulate Roseivivax atlanticus by SWISS-Model
The tertiary structure of fourth matter deacetylase finds that 179 aspartic acid D, 194 hyte propylhomoserin H, 254 valine V are located adjacent to
In the random coil structure of catalytic center, 116 asparagines, Q282 hyte propylhomoserin H be closer to catalytic center, can after mutation
Change catalyst structure domain, and changes substrate binding ability and catalytic efficiency.
The invention solves third technical problem be to provide that construct the chitin that the catalytic activity improves deacetylated
The method of base enzyme mutant is that table after rite-directed mutagenesis is carried out by gene of the design primer to coding chitin deacetylase
It reaches.The construction method, according to Roseivivax atlanticus chitin deacetylase DNA sequence dna (NZ_
JALZ01000017 biosynthesis) is carried out, expression plasmid pEtac-His6-rac is constructed, to contain chitin deacetylase matter
Grain be template, design primer carry out mutation and by after mutation plasmid conversion enter E.coli DH5 α expand, then with
E.coli BL21 (DE3) expresses the recombinant plasmid containing mutated gene, obtains the mutant of activity raising.
The invention solves the 4th technical problem be to provide and produce the catalytic activity using engineering bacteria fermentation
The method of the chitin deacetylation enzyme mutant of raising, being will be containing the weight of the gene of encoding mutant chitin deacetylase
Group bacterium E.coli BL21 (DE3) (pEtac-His6- racm) it is inoculated into containing 100 μ g mL-1 ampicillins after activation culture
Fermentation medium in, liquid amount 30mL/250mL, in 37 DEG C, 200r min-1 is cultivated to OD600It is 0.6, final concentration is added
0.5mM IPTG, 28 DEG C, induction fermentation is for 24 hours.Used medium composition are as follows: tryptone 10g/L, yeast extract 5g/L,
NaCl 10g/L, pH7.0.
The building of 1 mutation expression plasmid of embodiment and the acquisition of recombination bacillus coli
According to wild-type enzyme gene design primer, and restriction enzyme site is introduced, the primer is as follows: P1:5 '-
CGGAATTCATGAACCGTTACCCGCGTGAC-3 ' (introduces restriction enzyme site EcoR I)；P2:5 '-
CCCATTGTTAAGCCAGAGCTTCCAGACGC-3 ' (introduces Noc I restriction enzyme site).
PCR, PCR reaction system are as follows: ddH are carried out by template of the DNA sequence dna of synthesis2O (17.5 μ L), buffer (2.5 μ
L), Mg2+(2.5 μ L), dNTP (0.5 μ L), P1 (0.5 μ L), P2 (0.5 μ L), template (1 μ L), Taq enzyme (0.2 μ L).PCR program:
94 DEG C of initial denaturation 5min, then 94 DEG C of 30s, 54 DEG C of 40s, 72 DEG C of 70s, recycle 35 times；72 DEG C of extension 10min.Amplified production warp
1.0% agarose gel electrophoresis is sequenced after being detected.
By above-mentioned pcr amplification product through 1.0% agarose gel electrophoresis, purifying, E.coli is ligated and transformed into pMD18-T
DH5 α extracts recombinant plasmid pMD18-T-cad from positive bacterium colony.
After pMD18-T-rac and expression vector pEtac double digestion, 1% agarose gel electrophoresis recycles endonuclease bamhi, will
16 DEG C of connections are stayed overnight after glue recovery product mixing after digestion.
DH5a is converted, recombinant bacterial strain is coated in the kanamycins solid LB media containing 50ug/mL, 37 DEG C of inversions
Overnight incubation, selects several bacterium colonies in the LB liquid medium containing 50ug/mL kanamycins at random, 37 DEG C of shaking flask cultures
Overnight, plasmid pEtac-his6-rac, Transformed E .coli BL21 (DE3) after sequence verification are extracted.
Roseivivax atlanticus chitin deacetylation enzyme sequence is compared by BLAST and sequence similarity is high
In 80% chitin deacetylation enzyme sequence, different amino acid sites are found, are further simulated by SWISS-Model
The tertiary structure of Roseivivax atlanticus chitin deacetylase finds 179 aspartic acid D, 194 hyte ammonia
Sour H, 254 valine V are located adjacent in the random coil structure of catalytic center, 116 asparagines, Q282 hyte propylhomoserin H
It is closer to catalytic center, catalyst structure domain can be changed after mutation, and change substrate binding ability and catalytic efficiency.
To contain chitin deacetylase plasmid pEtac-his6- rac is template, and design primer be mutated and will dash forward
Plasmid conversion after change enters E.coli DH5 α and is expanded, and is then expressed with E.coli BL21 (DE3) containing mutated gene
Recombinant plasmid obtains the mutant of activity raising.And the plasmid conversion after mutation is entered into E.coli DH5 α and is expanded, so
The recombinant plasmid containing mutated gene is expressed with E.coli BL21 (DE3) afterwards, obtains the mutant of activity raising.
Primer described above for rite-directed mutagenesis is:
116primerS:AACAGCTCGAGGCGATGAGGCACGCC
116primerA:GGCGTGCCTCATCGCCTCGAGCTGTT
179primerS:CCGAGGCCGGCGGCTTTTCCTACGTCT
179primerA:AGACGTAGGAAAAGCCGCCGGCCTCGG
194primerS:ACGACCTGCCGTACTGGCGCCGCTTCGGCGACCG
194primerA:CGGTCGCCGAAGCGGCGCCAGTACGGCAGGTCGT
254primerS:CCATGATGAGCCTCGGCCTGCACAACCGCCT
254primerA:AGGCGGTTGTGCAGGCCGAGGCTCATCATGG
282primerS:ACCACGTGGCCGCCCACGACGACGTCTGGATC
282primerA:GATCCAGACGTCGTCGTGGGCGGCCACGTGGT
10mmol/L MgCl is added in PCR pipe22.5 μ L, 10 × PCR buffer 5 μ L, 2.5 μm of 4 μ of ol/L dNTP
0.25 μ L of L, Taq (5U/ μ l), upstream primer and downstream primer (10 μm of ol/L) each 1 μ L, 1 μ L of template DNA, finally plus distilled water
To 50 μ L, moment is centrifuged after mixing, is placed in 95 DEG C of denaturation 5min in PCR instrument, then 94 DEG C of denaturation 40s, 55 DEG C of annealing 40s, and 72
DEG C extend 1min, totally 35 circulations, last 72 DEG C of extensions 10min, which react, to be terminated.
Amplified production is sequenced after 1.0% agarose gel electrophoresis is detected.By above-mentioned pcr amplification product through 1.0%
Agarose gel electrophoresis, purifying, and with after expression vector pEtac double digestion, 1% agarose gel electrophoresis recycles digestion piece
Section, 16 DEG C of connections are stayed overnight after mixing by genetic fragment with the molar ratio of carrier for 3.DH5 α is converted, recombinant bacterial strain is coated on and is contained
Have in the kanamycins solid LB media of 50ug/mL, 37 DEG C of inversion overnight incubations, selects several bacterium colonies at random in containing
In the LB liquid medium of 50ug/mL kanamycins, 37 DEG C of shaking flask overnight incubations extract plasmid pEtac-his6-racm, sequencing
Transformed E .coli BL21 (DE3) after verifying.
The conversion of 2 mutant expression vector of embodiment
Used medium composition: tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, pH7.0.
By recombinant bacterium E.coli BL21 (DE3) (pEtac- of the gene containing encoding mutant chitin deacetylase
His6-cad it) is inoculated into after activation culture in the fermentation medium containing 100 μ g mE-1 ampicillins, liquid amount 30mL/
250mL, in 37 DEG C, 200r min-1 is cultivated；Thalli growth is added final concentration 0.5mM IPTG, 30 DEG C, lures to OD600=0.6
Lead fermentation for 24 hours.180r/min inducing expression 5h.4 DEG C, 10000r/min refrigerated centrifuge 5min collection thallus.
Thallus is resuspended in distilled water, is crushed thallus (200W, super 3s, stops 7s, altogether ultrasound 5min) with Ultrasonic cell smash,
4 DEG C, 10000r/min is centrifuged 20min, collects supernatant as crude enzyme liquid.
According to Ni-NTA Purification System (Invitrogen company, U.S. nvitrogenTMK95001 it) says
Bright one step of book purifies recombinase
Chitin deacetylase viability examination: the concentration that 35 DEG C of pre-incubations are added in colorimetric cylinder is the pH of 0.05mol/L
8.0 Tris-HCl buffer solution 3mL, 4- nitracetanilide solution 1mL, the chitin deacetylase that concentration is 200mg/L
Liquid 1mL, boiling water bath terminates enzymatic reaction after water-bath 15min at 35 DEG C, is settled to 10mL with distilled water, mixes,
3000r/min is centrifuged 10min, measures light absorption value (A400) of the supernatant at 400nm.Inactive enzyme solution is blank control.
It is compared with wild type recombinase, the Rate activity agent catalytic activity after mutation improves 2.63 times.
It is provided for the embodiments of the invention technical solution above to be described in detail, specific case used herein
The principle and embodiment of the embodiment of the present invention are expounded, the explanation of above embodiments is only applicable to help to understand this
The principle of inventive embodiments；At the same time, for those skilled in the art, according to an embodiment of the present invention, in specific embodiment party
There will be changes in formula and application range, in conclusion the contents of this specification are not to be construed as limiting the invention.
Sequence table
Sequence table
<110>Jiangsu Aoxin Biotechnology Co., Ltd.
<120>a kind of chitin deacetylation enzyme mutant and preparation method thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 471
<212> PRT
<213>marine bacteria chitin deacetylase (Roseivivax atlanticus)
<400> 1
Met Asn Arg Tyr Pro Arg Asp Met Ile Gly His Gly Pro Asp Arg Pro
1 5 10 15
Asp Pro Arg Trp Pro Gly Gly Ala Lys Ile Ala Ile Ser Leu Val Leu
20 25 30
Asn Tyr Glu Glu Gly Gly Glu Asn Ala Val Leu His Gly Asp Ala Ala
35 40 45
Ser Glu Ala Phe Leu Ser Asp Ile Ala Gly Ala Ala Ser Trp Pro Gly
50 55 60
Gln Arg His Trp Asn Met Glu Ser Ile Tyr Glu Tyr Gly Ala Arg Ala
65 70 75 80
Gly Phe Trp Arg Leu His Arg Met Phe Thr Glu Arg Ala Leu Pro Val
85 90 95
Thr Val Tyr Gly Val Ala Thr Ala Leu Ala Arg Ser Pro Glu Gln Leu
100 105 110
Glu Ala Met Asn His Ala Gly Trp Glu Ile Ala Ser His Gly Leu Lys
115 120 125
Trp Val Glu His Lys Asp Met Pro Pro Glu Glu Glu Arg Ala Ala Ile
130 135 140
Thr Glu Ala Ile Arg Leu His Glu Glu Val Thr Gly Ala Arg Pro Glu
145 150 155 160
Gly Trp Tyr Thr Gly Arg Cys Ser Asp Asn Thr Met Arg Leu Val Ala
165 170 175
Glu Ala Asp Gly Phe Ser Tyr Val Ser Asp Ala Tyr Asp Asp Asp Leu
180 185 190
Pro His Trp Arg Arg Phe Gly Asp Arg Asp Gln Leu Val Ile Pro Tyr
195 200 205
Thr Leu Glu Ala Asn Asp Met Arg Phe Ala Val Ala Pro Gly Trp Val
210 215 220
Thr Gly Arg Asp Phe Gly Asp Tyr Leu Ile Asp Thr Phe Asp Ala Leu
225 230 235 240
Tyr Ala Glu Gly Glu Ala Gly Arg Pro Ala Met Met Ser Val Gly Leu
245 250 255
His Asn Arg Leu Val Gly Arg Pro Gly Lys Ala Ala Gly Leu Ala Arg
260 265 270
Phe Leu Asp His Val Ala Ala His Asp His Val Trp Ile Ala Arg Arg
275 280 285
Ala Asp Ile Ala His His Trp Ala Ala Thr His Pro Pro Val Ala Arg
290 295 300
Gly Ala Arg Pro Ser Glu Met Asp Arg Asp Ser Phe Val Ala Arg Tyr
305 310 315 320
Gly Gly Ile Tyr Glu His Ser Pro Trp Val Ala Glu Arg Ala His Ala
325 330 335
Leu Glu Leu Gly Pro Ala His Asp Arg Pro Ala Gly Leu Ala Asn Ala
340 345 350
Leu Ala Arg Ala Phe Arg Thr Ala Ser Asp Asp Glu Arg Leu Ala Val
355 360 365
Leu Arg Ala His Pro Asp Leu Ala Gly Lys Leu Ala Ala Ala Ser Arg
370 375 380
Leu Thr Ala Glu Ser Thr Ala Glu Gln Ala Ser Ala Gly Leu Asp Ala
385 390 395 400
Leu Thr Asp Ala Glu Arg Ala Arg Phe Thr Glu Leu Asn Asp Arg Tyr
405 410 415
Thr Ala Lys His Gly Ile Pro Phe Ile Ile Ala Val Arg Asp His Asp
420 425 430
Lys Ala Ser Ile Leu Arg Ala Phe Glu Ala Arg Leu Asp Asn Asp Thr
435 440 445
Pro Thr Glu Ile Gly Thr Ala Cys Arg Gln Val Glu Arg Ile Ala Arg
450 455 460
Leu Arg Leu Glu Ala Leu Ala
465 470
<210> 2
<211> 471
<212> PRT
<213>chitin deacetylation enzyme mutant (artificial sequence)
<400> 2
Met Asn Arg Tyr Pro Arg Asp Met Ile Gly His Gly Pro Asp Arg Pro
1 5 10 15
Asp Pro Arg Trp Pro Gly Gly Ala Lys Ile Ala Ile Ser Leu Val Leu
20 25 30
Asn Tyr Glu Glu Gly Gly Glu Asn Ala Val Leu His Gly Asp Ala Ala
35 40 45
Ser Glu Ala Phe Leu Ser Asp Ile Ala Gly Ala Ala Ser Trp Pro Gly
50 55 60
Gln Arg His Trp Asn Met Glu Ser Ile Tyr Glu Tyr Gly Ala Arg Ala
65 70 75 80
Gly Phe Trp Arg Leu His Arg Met Phe Thr Glu Arg Ala Leu Pro Val
85 90 95
Thr Val Tyr Gly Val Ala Thr Ala Leu Ala Arg Ser Pro Glu Gln Leu
100 105 110
Glu Ala Met Arg His Ala Gly Trp Glu Ile Ala Ser His Gly Leu Lys
115 120 125
Trp Val Glu His Lys Asp Met Pro Pro Glu Glu Glu Arg Ala Ala Ile
130 135 140
Thr Glu Ala Ile Arg Leu His Glu Glu Val Thr Gly Ala Arg Pro Glu
145 150 155 160
Gly Trp Tyr Thr Gly Arg Cys Ser Asp Asn Thr Met Arg Leu Val Ala
165 170 175
Glu Ala Gly Gly Phe Ser Tyr Val Ser Asp Ala Tyr Asp Asp Asp Leu
180 185 190
Pro Tyr Trp Arg Arg Phe Gly Asp Arg Asp Gln Leu Val Ile Pro Tyr
195 200 205
Thr Leu Glu Ala Asn Asp Met Arg Phe Ala Val Ala Pro Gly Trp Val
210 215 220
Thr Gly Arg Asp Phe Gly Asp Tyr Leu Ile Asp Thr Phe Asp Ala Leu
225 230 235 240
Tyr Ala Glu Gly Glu Ala Gly Arg Pro Ala Met Met Ser Leu Gly Leu
245 250 255
His Asn Arg Leu Val Gly Arg Pro Gly Lys Ala Ala Gly Leu Ala Arg
260 265 270
Phe Leu Asp His Val Ala Ala His Asp Asp Val Trp Ile Ala Arg Arg
275 280 285
Ala Asp Ile Ala His His Trp Ala Ala Thr His Pro Pro Val Ala Arg
290 295 300
Gly Ala Arg Pro Ser Glu Met Asp Arg Asp Ser Phe Val Ala Arg Tyr
305 310 315 320
Gly Gly Ile Tyr Glu His Ser Pro Trp Val Ala Glu Arg Ala His Ala
325 330 335
Leu Glu Leu Gly Pro Ala His Asp Arg Pro Ala Gly Leu Ala Asn Ala
340 345 350
Leu Ala Arg Ala Phe Arg Thr Ala Ser Asp Asp Glu Arg Leu Ala Val
355 360 365
Leu Arg Ala His Pro Asp Leu Ala Gly Lys Leu Ala Ala Ala Ser Arg
370 375 380
Leu Thr Ala Glu Ser Thr Ala Glu Gln Ala Ser Ala Gly Leu Asp Ala
385 390 395 400
Leu Thr Asp Ala Glu Arg Ala Arg Phe Thr Glu Leu Asn Asp Arg Tyr
405 410 415
Thr Ala Lys His Gly Ile Pro Phe Ile Ile Ala Val Arg Asp His Asp
420 425 430
Lys Ala Ser Ile Leu Arg Ala Phe Glu Ala Arg Leu Asp Asn Asp Thr
435 440 445
Pro Thr Glu Ile Gly Thr Ala Cys Arg Gln Val Glu Arg Ile Ala Arg
450 455 460
Leu Arg Leu Glu Ala Leu Ala
465 470
<210> 3
<211> 1410
<212> DNA
<213>gene (artificial sequence) of chitin deacetylation enzyme mutant is encoded
<400> 3
tgaaccgcta tccccgcgac atgatcggcc acgggccgga ccgtccggat ccgcgctggc 60
ccggcggcgc gaagatcgcc atctcgctcg tgctcaacta cgaggagggc ggcgagaacg 120
cggtcctgca cggcgacgcg gcctccgagg cgtttctttc cgacatcgcc ggcgccgcct 180
cctggccggg ccagcggcac tggaacatgg agtcgatcta cgaatacggc gcccgcgccg 240
ggttctggcg gctgcaccgc atgttcaccg agcgggccct tcccgtcacc gtctacggcg 300
tggccaccgc gcttgcccgt tcgcccgaac agctcgaggc gatgaggcac gccgggtggg 360
agatcgcgag ccacggcctg aaatgggtcg agcacaagga tatgcccccc gaggaggaac 420
gcgccgcgat caccgaggcg atccgcctgc acgaagaggt caccggggcg cggcccgagg 480
gctggtacac cgggcgctgc tcggacaaca ccatgcgcct cgtcgccgag gccggcgctt 540
ttcctacgtc tcggacgcct atgacgacga cctgccgtac ggcgccgctt cggcgaccgc 600
gaccagctgg tgatccccta tactctcgag gccaacgaca tgcgcttcgc cgtagcgccg 660
ggctgggtca ccggccgcga cttcggcgac tacctgatcg acaccttcga tgcgctctat 720
gccgagggcg aggccggccg ccccgccatg atgagcctcg cctgcacaac cgcctggtcg 780
gccgccccgg caaggcggcg ggcctcgcgc gcttcctcga ccacgtggcc gcccacgacg 840
actctggatc gcccgccgcg cggacatcgc gcaccactgg gccgcgacgc atccgcccgt 900
cgccagggcg cgcgtccgtc cgagatggac cgcgacagct tcgtcgcccg ctacggcggc 960
atctacgagc actcgccctg ggtggccgaa cgcgcccacg cgctggaact gggcccggcc 1020
cacgaccgac cggcggggct cgccaacgcg ctggcgcggg cgttccgcac cgcctcggac 1080
gacgaacgcc tcgcggtcct gcgcgcccac cccgacctcg ccggcaagct tgccgccgcc 1140
agccggctga cggccgagtc caccgccgaa caggccagcg ccgggctcga cgccctgacc 1200
gacgccgaac gcgcgcggtt caccgaactc aacgaccgct acaccgccaa gcacggcatc 1260
ccgttcatca tcgcggtgcg cgaccacgac aaggcgtcga tcctgcgcgc cttcgaggcc 1320
cggctcgaca acgacacgcc gaccgagatc ggcaccgcct gccggcaggt ggagcgcatc 1380
gcccgccttc gactggaggc tctggcatga 1410
Claims (10)
1. the chitin deacetylation enzyme mutant that a kind of catalytic activity improves, which is characterized in that by marine bacteria
Roseivivax atlanticus chitin deacetylation enzyme amino acid sequence has carried out prominent as follows as shown in SEQ ID NO.1
Become: 116 asparagine Q-spoilings sport glycine G into arginine R, 179 aspartic acid D, 194 hyte propylhomoserin H are sported
Tyrosine Y, 254 valine V sport isoleucine I, 282 and sport aspartic acid for histidine H.
2. the chitin deacetylation enzyme mutant that a kind of catalytic activity improves according to claim 1, which is characterized in that its
Amino acid sequence is by marine bacteria Roseivivax atlanticus chitin deacetylase as shown in SEQ ID N0.2
Amino acid sequence the 116th asparagine Q-spoiling as shown in SEQ ID NO.1 is arginine R, 179 Aspartic acid mutations
Sport tyrosine Y for glycine, 194 hyte propylhomoserin H, 254 valine mutations be leucine I, 282 be histidine H mutation
For aspartic acid.
3. encoding the gene for the chitin deacetylation enzyme mutant that catalytic activity described in claim 2 improves, it is characterised in that:
Its nucleotide sequence is as shown in SEQ ID NO.3.
4. a kind of carrier, which is characterized in that it contains gene as claimed in claim 3.
5. a kind of cell, which is characterized in that it contains gene as claimed in claim 3.
6. a kind of transgenic cell line, which is characterized in that it contains gene as claimed in claim 3.
7. a kind of method for the chitin deacetylation enzyme mutant for preparing the raising of catalytic activity described in claim 1, is to pass through
Design primer is expressed after carrying out rite-directed mutagenesis to the gene of coding chitin deacetylase.
8. the method according to the description of claim 7 is characterized in that being with plasmid pEtac-His6- rac is template design primer
Mutation is carried out and the plasmid conversion after mutation is entered into E.coli DH5 α to expand, then with E.coli BL21 (DE3) table
Up to the recombinant plasmid containing mutated gene.
9. the chitin deacetylation enzyme mutant that catalytic activity described in application engineering bacteria fermentation production claim 1 improves
Method, be by recombinant bacterium E.coli BL21 (DE3) (pEtac- containing the gene of encoding mutant chitin deacetylase
His6-racm it) is inoculated into after activation culture in the fermentation medium containing ampicillin, culture to bacterium solution OD600Reach 0.6,
IPTG, induction fermentation is added.
10. according to the method described in claim 9, it is characterized in that, containing 100 μ g mL in the fermentation medium-1Ammonia benzyl is green
Mycin, culture medium group become tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711125982.7A CN109777796A (en) | 2017-11-13 | 2017-11-13 | A kind of chitin deacetylation enzyme mutant and preparation method thereof that catalytic activity improves |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711125982.7A CN109777796A (en) | 2017-11-13 | 2017-11-13 | A kind of chitin deacetylation enzyme mutant and preparation method thereof that catalytic activity improves |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109777796A true CN109777796A (en) | 2019-05-21 |
Family
ID=66494648
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711125982.7A Pending CN109777796A (en) | 2017-11-13 | 2017-11-13 | A kind of chitin deacetylation enzyme mutant and preparation method thereof that catalytic activity improves |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109777796A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111944793A (en) * | 2020-07-28 | 2020-11-17 | 江苏海洋大学 | Aspergillus nidulans chitin deacetylase mutant |
| CN111979218A (en) * | 2020-07-28 | 2020-11-24 | 江苏海洋大学 | Arthrobacter sp. AW19M34-1 chitin deacetylase mutant |
| CN111979215A (en) * | 2020-07-28 | 2020-11-24 | 江苏海洋大学 | Bacillus sphaericus organic solvent-resistant protease mutant |
| WO2021103295A1 (en) * | 2019-11-27 | 2021-06-03 | 中国极地研究中心(中国极地研究所) | Recombinant chitin deacetylase, and preparation method therefor and use thereof |
| CN112921019A (en) * | 2021-04-19 | 2021-06-08 | 中国农业科学院植物保护研究所 | Chitin deacetylase protein crystals |
| CN113637656A (en) * | 2021-08-05 | 2021-11-12 | 云南师范大学 | GDSL family deacetylation esterase mutant Est8-G45R and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105886487A (en) * | 2016-06-19 | 2016-08-24 | 江苏澳新生物工程有限公司 | Chitin histone deacetylase mutant |
-
2017
- 2017-11-13 CN CN201711125982.7A patent/CN109777796A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105886487A (en) * | 2016-06-19 | 2016-08-24 | 江苏澳新生物工程有限公司 | Chitin histone deacetylase mutant |
Non-Patent Citations (1)
| Title |
|---|
| YONG ZHAO ET AL.,: ""Chitin Deacetylases: Properties and Applications"", 《MAR. DRUGS》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021103295A1 (en) * | 2019-11-27 | 2021-06-03 | 中国极地研究中心(中国极地研究所) | Recombinant chitin deacetylase, and preparation method therefor and use thereof |
| CN111944793A (en) * | 2020-07-28 | 2020-11-17 | 江苏海洋大学 | Aspergillus nidulans chitin deacetylase mutant |
| CN111979218A (en) * | 2020-07-28 | 2020-11-24 | 江苏海洋大学 | Arthrobacter sp. AW19M34-1 chitin deacetylase mutant |
| CN111979215A (en) * | 2020-07-28 | 2020-11-24 | 江苏海洋大学 | Bacillus sphaericus organic solvent-resistant protease mutant |
| CN112921019A (en) * | 2021-04-19 | 2021-06-08 | 中国农业科学院植物保护研究所 | Chitin deacetylase protein crystals |
| CN113637656A (en) * | 2021-08-05 | 2021-11-12 | 云南师范大学 | GDSL family deacetylation esterase mutant Est8-G45R and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109777796A (en) | A kind of chitin deacetylation enzyme mutant and preparation method thereof that catalytic activity improves | |
| CN106148311B (en) | A kind of mutant of D-Psicose -3- epimerase and its application | |
| CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN110438136A (en) | The gene of beta-glucosidase and its mutant, amino acid sequence and application | |
| CN109777793B (en) | GDSL lipase, genetically engineered bacterium and application thereof | |
| CN112941052B (en) | Chitosanase OUC-T613 and application thereof | |
| CN105886487B (en) | A kind of chitin deacetylation enzyme mutant | |
| CN113862241A (en) | Chitosanase Csncv, mutant CsnB thereof and application of mutant CsnB | |
| CN110951803B (en) | Method for preparing neoagarobiose by combined utilization of agarase, recombinant host cell and application of recombinant host cell and expression vector | |
| CN114457057B (en) | Chitosan mutant and application thereof | |
| CN107603967B (en) | A kind of chitosan enzyme CSN4 and its encoding gene and application | |
| CN112195168B (en) | Thermophilic chitinase Chi304 mutant and preparation method and application thereof | |
| CN111187764B (en) | Deep-sea-derived chitosanase CSN5, and coding gene and application thereof | |
| CN104877979B (en) | A kind of its encoding gene of the β mannonases of first genomic source and its expression | |
| CN109609485B (en) | Chitin deacetylase and application thereof | |
| CN111500555A (en) | Chitosanase OUC-CsnCA and application thereof | |
| CN113481187B (en) | Algin lyase mutant and application thereof | |
| CN111471667B (en) | Chitosanase Csn-PT and application thereof | |
| CN104087604A (en) | Genetic expression sequence of inulin fructotransferase | |
| CN112725315B (en) | Application of chitosanase and mutant thereof in preparation of chitosan oligosaccharide | |
| CN105969751B (en) | Beta-glucosidase gene and application thereof | |
| CN111187795B (en) | Preparation method of diglucyl trehalose | |
| CN113046378A (en) | Incision alginate lyase, coding gene and application thereof | |
| CN111979218B (en) | Arthrobacter sp. AW19M34-1 chitin deacetylase mutant | |
| TW201237166A (en) | Glucanase having improved enzymatic activity and thermo-tolerance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190521 |