CN108018266B

CN108018266B - Marine-derived superoxide dismutase and coding gene and application thereof

Info

Publication number: CN108018266B
Application number: CN201810105875.6A
Authority: CN
Inventors: 董亮; 董志扬; 张山; 何永志; 全莉芳
Original assignee: Shenzhen Upfo Biotech Co ltd
Current assignee: Shenzhen Upfo Biotech Co ltd
Priority date: 2018-02-02
Filing date: 2018-02-02
Publication date: 2020-11-03
Anticipated expiration: 2038-02-02
Also published as: CN108018266A

Abstract

The invention discloses a marine superoxide dismutase and a coding gene and application thereof. The invention provides a protein which is (a1) or (a 2): (a1) a protein consisting of an amino acid sequence shown in a sequence 1 in a sequence table; (a2) and (b) the protein which is derived from the sequence 1 and has the same function, wherein the amino acid sequence of the sequence 1 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues. The Io-SOD1 is discovered and obtained by sequencing the metagenome of the Indian ocean sediment sample in southwest, the expression of the gene in escherichia coli is successfully realized, the expression method is simple and easy to implement, the expression product is easy to purify, the stability is good, the specific activity can reach 1315U/mg, and the enzyme has good stability, so the Io-SOD1 has wide industrial application prospect.

Description

Marine-derived superoxide dismutase and coding gene and application thereof

Technical Field

The invention relates to a marine superoxide dismutase and a coding gene and application thereof.

Background

Oxygen is extremely important for life activities, but at the same time, oxygen free radicals (so-called reactive oxygen species) are inevitably produced by the cells due to the oxygen. Reactive oxygen species can damage cellular macromolecules through oxidative stress, causing a series of deleterious biochemical reactions that result in protein damage, lipid peroxidation, DNA mutations, and enzyme inactivation. McCord and Fridovich discovered a cupredoxin that scavenges oxygen free radicals in cells as early as 1969 and named it as superoxide dismutase (SOD). Studies have shown that SOD enzymes convert oxygen radicals to H₂O₂，H₂O₂Then converted into water by catalase and oxidase, thereby achieving the purposes of eliminating oxygen free radicals in cells and protecting cells. It is because of the important role played by SOD enzymes in protecting cells from oxygen free radicals,SOD enzyme has wide application prospect in the fields of medicine, food and agriculture. The production of SOD mainly comprises two modes of natural extraction and microbial fermentation production. Especially, with the development of molecular cloning technology, the advantages of producing SOD by using genetically engineered bacteria are more and more embodied.

The ocean covers 70% of the area of the earth's surface. The microorganisms are distributed throughout the sea and even survive in an extreme marine environment with 11000 m deep sea, 100MPa pressure and 100 deg.c temperature. It is currently estimated that culturable microorganisms account for only 1% of the total microbial mass. Therefore, the marine environment contains a large amount of undeveloped microorganisms and enzyme resources. A great deal of unknown novel enzyme resources in the marine environment can be developed to a greater extent by combining the metagenome of microorganisms and high-throughput sequencing.

Disclosure of Invention

The invention aims to provide a marine superoxide dismutase and a coding gene and application thereof.

The invention provides a protein (named as Io-SOD1 protein) which is any one of the following (a1) - (a 5):

(a1) a protein consisting of an amino acid sequence shown in a sequence 1 in a sequence table;

(a2) a protein which is derived from the sequence 1 and has the same function by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence of the sequence 1;

(a3) a fusion protein comprising (a1) or (a 2);

(a4) a fusion protein obtained by connecting a tag-containing short peptide to the end of (a1) or (a 2);

(a5) and (c) a fusion protein obtained by attaching a tag to the end of (a1) or (a 2).

In order to facilitate the purification and detection of the protein of (a1), a tag as shown in Table 1 may be attached to the amino terminus or the carboxy terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 1 of the sequence Listing.

TABLE 1 sequences of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The protein of (a2) above may be synthesized artificially, or may be obtained by synthesizing the coding gene and then performing biological expression.

The invention also protects a gene (Io-SOD1 gene) for coding the Io-SOD1 protein.

The gene is a DNA molecule as described in any one of (b1) to (b4) below:

(b1) the coding region is a DNA molecule shown as a sequence 2 in a sequence table;

(b2) DNA molecule shown in sequence 2 in the sequence table;

(b3) a DNA molecule which hybridizes with the DNA sequence defined in (b1) or (b2) under stringent conditions and encodes superoxide dismutase;

(b4) a DNA molecule which has more than 90% of homology with the DNA sequence defined by (b1) or (b2) or (b3) and codes for superoxide dismutase.

The stringent conditions can be hybridization and membrane washing with 0.1 XSSPE (or 0.1XSSC), 0.1% SDS solution at 65 ℃ in DNA or RNA hybridization experiments.

The invention also protects a recombinant expression vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the Io-SOD1 gene.

The recombinant expression vector can be specifically a recombinant plasmid obtained by inserting a double-stranded DNA molecule shown in the 1 st-612 th site from the 5' end of a sequence table in a multiple cloning site (for example, between NdeI and HindIII enzyme cutting sites) of a pET28a (+) vector.

The invention also protects the application of the Io-SOD1 protein in serving as superoxide dismutase.

The invention also protects a recombinant bacterium, which is obtained by introducing the Io-SOD1 gene into a host bacterium.

The Io-SOD1 gene can be introduced into host bacteria through a recombinant expression vector containing the Io-SOD1 gene to obtain recombinant bacteria.

The host bacterium can be Escherichia coli, and specifically can be Escherichia coli BL21(DE 3).

The invention also provides a preparation method of the superoxide dismutase, which comprises the following steps: culturing the recombinant bacteria to obtain the superoxide dismutase from the recombinant bacteria.

The invention also protects the application of the Io-SOD1 protein or Io-SOD1 gene or the recombinant bacterium or the method in preparing superoxide dismutase products.

The Io-SOD1 is discovered and obtained by sequencing the metagenome of the Indian ocean sediment sample in southwest, the expression of the gene in escherichia coli is successfully realized, the expression method is simple and easy to implement, the expression product is easy to purify, the stability is good, the specific activity can reach 1315U/mg, and the enzyme has good stability, so the Io-SOD1 has wide industrial application prospect.

Drawings

FIG. 1 is an SDS-PAGE pattern of Io-SOD1 expression.

FIG. 2 is a graph showing the thermal stability analysis of Io-SOD1 at different temperatures.

FIG. 3 shows stability analysis of Io-SOD1 at room temperature.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Example 1 obtaining of Io-SOD1 and Gene encoding the same

Total DNA was extracted from the sediment derived from Indian ocean and subjected to a large number of genome sequencing analyses, from which a protein was found, as shown in sequence 1 of the sequence listing, which was named Io-SOD 1. The coding gene of the Io-SOD1 is named as Io-SOD1 and is shown as a sequence 2 in a sequence table.

Example 2 expression and purification of Io-SOD1

1. The small fragment between NdeI and HindIII restriction sites of pET28a (+) vector (Novagen company) was replaced by the double-stranded DNA molecule shown in the 1 st to 612 nd from the 5' end of the sequence 2 in the sequence table, and a recombinant expression vector pET28a (+)/Io-SOD1 (verified by sequencing) was obtained.

2. The recombinant expression vector pET28a (+)/Io-SOD1 obtained in step 1 was introduced into E.coli BL21(DE3) (Fujijin Biotechnology Co., Ltd., cat # CD601-01) to obtain a recombinant strain.

3. Inoculating the recombinant strain obtained in the step 2 into 50mL LB liquid culture medium containing 50ug/mL kanamycin, and culturing at 37 ℃ and 200rpm is shake cultured to bacterial liquid OD_600nmWhen IPTG was added to the bacterial suspension at a concentration of 1mM, the mixture was induced at 16 ℃ and 200rpm for 4 hours, and after the induction, the mixture was centrifuged at 12000rpm, and the pellet was collected and examined by SDS-PAGE (see lane 1 in FIG. 1).

4. Using PBS (135mM NaCl, 2.7mM KCl, 1.5mM KH)₂PO₄，8mM K₂HPO₄pH 7.2), carrying out ultrasonic treatment (150W, crushing for 10s, separating for 10s, and carrying out 20 cycles), collecting a whole cell lysate after crushing, centrifuging the whole cell lysate at 12000rpm for 10min, and respectively collecting a supernatant and a precipitate. The supernatant was subjected to SDS-PAGE (shown in lane 2 of FIG. 1) and the pellet was subjected to SDS-PAGE (shown in lane 3 of FIG. 1), which revealed that a protein having a molecular weight of about 25kD was expressed intracellularly by IPTG induction, and the molecular weight of the expressed protein was consistent with the theoretical molecular weight of a single SOD subunit, indicating that correctly expressed Io-SOD1 was obtained by the above method.

5. The expression product with His-Tag in the supernatant obtained in step 4 can be purified under non-denaturing conditions according to the operation method of SNBC 3S NTA Resin (Shanghai Productivity Bomby Biotech Co., Ltd.) to obtain a purified Io-SOD1 protein solution, the protein concentration is 0.12mg/mL, and the results of SDS-PAGE detection are shown in lanes 4-6 of FIG. 1. The SOD enzyme activity in the Io-SOD1 protein solution is measured by a pyrogallol autoxidation method (the determination of the activity of superoxide dismutase (SOD) in GB/T5009.171-2003 health-care food), the activity unit is about 198U/mL culture solution, and the specific activity is 1315U/mg.

Definition of SOD Activity units: the amount of SOD required to inhibit the 50% autoxidation rate of pyrogallol at 25 ℃ is one unit of activity.

Example 3 Io-SOD1 stability analysis

1. The Io-SOD1 protein solution prepared in example 2 was allowed to stand at 50 ℃ and 60 ℃ for 3 hours, respectively, and the enzyme activity of the residual enzyme in the Io-SOD1 protein solution was measured by a pyrogallol autoxidation method (determination of superoxide dismutase (SOD) activity in GB/T5009.171-2003 health food) in the process (the enzyme activity of SOD before heat treatment was set to 100%, and the percentage of the enzyme activity after heat treatment to the enzyme activity before treatment was the residual enzyme activity), and the results are shown in fig. 2. The result shows that more than 90% of enzyme activity can still be kept when the Io-SOD1 is treated for 3 hours at 50 ℃, and more than 80% of enzyme activity can still be kept when the Io-SOD1 is treated for 30 minutes at 60 ℃.

2. The Io-SOD1 protein solution prepared in example 2 was left at room temperature (25 ℃) for half a year, during which the enzyme activity in the Io-SOD1 protein solution was measured by the pyrogallol autoxidation method. The results are shown in FIG. 3. The results show that the Io-SOD1 can be preserved at room temperature for half a year and still can maintain more than 60 percent of enzyme activity

The above results indicate that Io-SOD1 has good stability.

<110> Shenzhen Zhongkexin Yangyang Biotech Co., Ltd

<120> ocean superoxide dismutase and coding gene and application thereof

<160>2

<210>1

<211>204

<212>PRT

<213> Artificial sequence

<220>

<223>

<400>1

Met Pro Thr His Thr Leu Pro Asp Leu Pro Tyr Asp His Glu Ala Leu

1 5 10 15

Ala Pro His Ile Asp Ala Arg Thr Met Glu Ile His His Gly Lys His

20 25 30

His Gln Gly Tyr Val Asn Asn Leu Asn Ala Ala Leu Glu Gly His Pro

35 40 45

Glu Leu Gln Ala Lys Ser Val Glu Glu Leu Val Ala Gly Ile Asp Ala

50 55 60

Val Pro Glu Ala Ile Arg Thr Ala Val Arg Asn Asn Gly Gly Gly His

65 70 75 80

Ala Asn His Ser Leu Phe Trp Leu Ser Met Ser Pro Gln Gly Gly Gly

85 90 95

Ala Pro Asp Gly Ala Leu Ala Thr Ala Leu Ala Asn Thr Phe Gly Ser

100 105 110

Phe Gly Asp Phe Lys Glu Gln Leu Thr Ala Ala Ser Leu Ala Arg Phe

115 120 125

Gly Ser Gly Trp Gly Trp Leu Val Val Thr Ser Gly Gly Glu Leu Gly

130 135 140

Val Tyr Ser Thr Ala Asn Gln Asp Asn Pro Tyr Met Gln Gly Asp Val

145 150 155 160

Pro Ile Leu Gly Val Asp Val Trp Glu His Ala Tyr Tyr Leu Asn Tyr

165 170 175

Gln Asn Arg Arg Pro Asp Tyr Leu Ala Ala Trp Trp Ser Val Val Asp

180 185 190

Trp Asp Glu Val Ala Arg Arg Phe Asp Ala Thr Arg

195 200

<210>2

<211>615

<212>DNA

<213> Artificial sequence

<220>

<223>

<400>2

atgccgactc acaccctgcc ggacctcccg tacgatcatg aagcgctggc accacacatc 60

gatgctcgca ctatggaaat ccaccacggc aaacaccacc agggttacgt gaacaacctg 120

aatgctgcac tggaaggtca cccggaactc caagctaaat ctgtggaaga actggttgca 180

ggtatcgacg cggttccgga agctattcgt accgcagtac gtaacaacgg cggtggtcat 240

gcaaatcaca gcctgttttg gctgtccatg tcgccgcagg gtggcggtgc accggacggc 300

gcactggcaa ctgcgctggc aaacactttc ggtagctttg gtgacttcaa agaacagctg 360

acggcggctt ccctggctcg ttttggctct ggttggggtt ggctggttgt tacctctggc 420

ggcgaactgggcgtgtactc caccgcgaac caagataatc catacatgca aggtgatgta 480

ccgattctgg gcgtggacgt gtgggagcac gcgtactacc tgaactacca gaaccgtcgt 540

ccggactatc tggcggcatg gtggtccgtt gttgattggg atgaagttgc gcgccgtttc 600

gatgcgaccc gttaa 615

Claims

1. A protein consisting of the amino acid sequence shown as SEQ ID No: 1 in the sequence table 1.

2. The gene for coding the protein of claim 1, wherein the gene is shown as SEQ ID No: 2.

3. A recombinant expression vector, expression cassette, transgenic cell line or recombinant bacterium comprising the gene of claim 1.

4. Use of the protein of claim 1 as superoxide dismutase.

5. A recombinant bacterium obtained by introducing the gene according to claim 2 into a host bacterium.

6. A method for preparing superoxide dismutase comprises the following steps: culturing the recombinant bacterium of claim 5 to obtain superoxide dismutase from the recombinant bacterium.

7. Use of the protein of claim 1 or the gene of claim 2 or the recombinant bacterium of claim 5 or the method of claim 6 for the preparation of a superoxide dismutase product.