KR102026836B1 - Novel lipase gene Lip-1420 derived from soil metagenome and use thereof - Google Patents

Abstract

The present invention relates to a novel lipase gene Lip-1420 derived from a soil metagenome, and a use thereof. A transformant having Lip-1420-sub-ORF3, which is recombined from the novel lipase gene Lip-1420 derived from the soil metagenome, exhibits potent lipase activities against tributyrin, and furthermore, a novel lipase protein isolated and purified from the transformant also exhibits potent lipase activity, and a novel lipase protein may be mass-produced from the transformant. Accordingly, the novel lipase gene of the present invention, a vector comprising the same, and a transformant having the same may be beneficially used in an industrial mass-production of novel lipase proteins having potent activities.

Description

New lipase gene Lip-1420 derived from soil metagenome and use thereof

The present invention relates to a novel lipase gene Lip-1420 derived from soil metagenome and its use.

Research on the industrial use of proteins produced from microorganisms has been extensively performed in various fields for the last 100 years. These studies have been carried out mainly on cultureable microorganisms and various microbial enzymes found therefrom are being used industrially. However, recent molecular microbiology studies have found that more than 99% of the microorganisms in nature are not cultured in typical media. Therefore, unlike attempts to find new enzymes from a large number of cultureable microorganisms, it is a metanome that enables the discovery of new enzymes through the recombinant expression of most microorganisms that have not been identified and cultured.

Metagenome is defined as the genome of all microorganisms existing in nature, and can be analyzed by separating metagenomes from natural samples without culturing the microorganisms, and preparing them into libraries and introducing them into cultivable Escherichia coli. have. This is a method for securing useful products from microorganisms that have not been cultured, but it is difficult to obtain information on the microorganism from which the gene is derived. A team of researchers from the University of Wisconsin, USA, for the first time successfully isolated a large metagenome and cloned it into a bacterial artificial chromosome (BAC) vector to build a metagenomic library from which a wide range of antibiotics and genes related to their biosynthesis were isolated. Gillespie et al., 2002, Appl. Environ. Microbiol. 68: 4301-4306; Rondon et al., 2000, Appl. Environ. Microbiol. 66: 2541-2547. The Institute for Genomic Research (TIGR) team is also building a total microbial metagenomic library of marine microorganisms in BAC vectors to explore the genetic resources of microorganisms that are not cultured from marine ecosystems. Recently, studies have been conducted to produce and purify lipases from various metagenomes and to characterize them (Gupta et al., 2004, Appl. Microbiol. Biotechnol., 64: 763-781).

Lipase is an enzyme that hydrolyzes ester bonds of triglycerides and is known to be produced by many kinds of animals and plants, and biochemical properties and genes have been actively studied. In addition, due to its unique characteristics such as high substrate specificity, optical activity specificity and position specificity, various fine chemicals and detergents are not only converted into oils and fats but also through hydrolysis in aqueous solution and (trans) esterification in organic solvents. It is very useful in food, chemical and pharmaceutical industries, and is particularly known as an enzyme useful for the production of optically active pharmaceuticals. Recently, lipase, which is used to produce biodiesel, is relatively cheaper than other enzymes and does not require coenzymes. Therefore, lipase is widely used as a biocatalyst in biopharmaceuticals because of its industrial advantages. It is getting more noticeable.

Thus, the present inventors completed the present invention by separating the novel lipase gene from the domestic soil metagenome and confirming that the protein produced therefrom exhibits excellent lipase activity.

An object of the present invention is to provide a new lipase gene and protein derived from soil metagenome, a vector comprising the new lipase gene, a transformant having the same, and a method for preparing a lipase protein using the same.

In order to achieve the above object, the present invention provides a lipase protein consisting of the amino acid sequence of SEQ ID NO: 1.

The present invention also provides a gene encoding the lipase protein.

The present invention also provides a recombinant vector comprising the gene.

The present invention also provides a transformant in which the recombinant vector is introduced into a host cell.

In addition, the present invention 1) culturing the transformant; 2) provides a method for producing a lipase protein comprising the step of recovering the lipase protein from the cultured transformant or its culture supernatant.

A transformant incorporating the recombinant Lip-1420-sub-ORF3 gene from a new lipase clone Lip-1420 derived from soil metagenome according to the present invention exhibits strong lipase activity against tributyrin, The new lipase protein isolated and purified from also exhibits strong lipase activity and can mass produce new lipase proteins from the transformants. Therefore, the novel lipase gene of the present invention, a vector comprising the same, and a transformant having the same, can be usefully used for industrial mass production of a novel lipase protein having strong activity.

1 is a diagram confirming the cleavage pattern for restriction enzymes Bam HI, Pst I, Eco RI, Xba I Sph I, Hind III, and Sma I of plasmid DNA isolated from E. coli introduced subclonal Lip-1420 ), And colonies showing lipase activity in Escherichia coli incorporating a subclone of Lip-1420 (B).
2 is a diagram showing the structure of a plasmid (pET21a (+)-ORF3-6H) comprising a Lip-1420-sub-ORF3 sequence.
3 is a diagram confirming the expression of a novel lipase protein in E. coli introduced Lip-1420-sub-ORF3.
4 is a chromatogram (A) for purification of a new lipase protein isolated from Escherichia coli introduced with Lip-1420-sub-ORF3 by FPLC, and confirming the expression of new lipase protein in each fraction obtained through FPLC (B), And a photograph (C) of a container containing the isolated and purified new lipase protein.
5 is a diagram confirming the lipase activity of the novel lipase protein isolated from Escherichia coli Lip-1420-sub-ORF3 introduced.

Hereinafter, the present invention will be described in detail.

The present invention provides a lipase protein consisting of the amino acid sequence of SEQ ID NO: 1.

The lipase protein, variant thereof or fragment thereof may be isolated from nature, including soil metagenome, or synthesized by conventional chemical synthesis methods (WH Freeman and Co., Proteins; structures and molecular principles, 1983). . Specifically, it can be synthesized by liquid phase peptide synthesis (Solution Phase Peptide synthesis), solid-phase peptide syntheses, fragment condensation and F-moc or T-BOC chemistry, more specifically solid phase peptide synthesis Can be synthesized.

The lipase protein may be a variant of an amino acid having a different sequence by deletion, insertion, substitution, or a combination of amino acid residues within a range that does not affect the function of the protein. Amino acid exchange in proteins or peptides that do not alter the activity of the molecule as a whole is known in the art. In some cases, it may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, or farnesylation. Accordingly, the present invention may include a protein, variant or fragment thereof having an amino acid sequence substantially the same as the protein consisting of the amino acid sequence of SEQ ID NO: 1. A protein having substantially the same amino acid sequence may have homology with at least 80%, specifically at least 90%, more specifically at least 95% of the proteins of the invention.

The present invention also provides a gene encoding the lipase protein.

The gene may be composed of the nucleotide sequence of SEQ ID NO: 2, specifically Lip-1420-sub-ORF3. In one embodiment of the invention, Lip-1420-sub-ORF3 gene was derived and registered in GenBank (MH628529).

The gene encoding the lipase protein may be derived from soil metagenome.

The gene encoding the lipase protein may be a variant having a different sequence by deletion, insertion, substitution, or a combination of one or more nucleic acid bases within a range encoding a protein having an activity equivalent to that of the lipase protein of the present invention. . Accordingly, the present invention may include a polynucleotide having a nucleotide sequence substantially identical to a gene consisting of the nucleotide sequence of SEQ ID NO: 2, a variant or a fragment thereof. The polynucleotide having substantially the same base sequence may have homology with the gene of the present invention at least 80%, specifically at least 90%, more specifically at least 95%.

The present invention also provides a recombinant vector comprising the gene.

As used herein, the term "vector" refers to DNA fragment (s), nucleic acid molecules that are delivered into a cell, and the vector can replicate DNA and be independently reproduced in a host cell.

As used herein, the term “recombinant vector” refers to a gene construct that is capable of expressing a target protein or RNA of interest in a particular host cell and includes essential regulatory elements operably linked to express the gene insert.

As used herein, the term “operably linked” means that the sequence that regulates the expression of the nucleic acid and the nucleic acid sequence that encodes the protein or RNA of interest are functionally linked. For example, a promoter and a nucleic acid sequence encoding a protein or RNA can be operably linked to affect expression of the nucleic acid sequence encoding. Fractional linkage with recombinant vectors can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation employs enzymes or the like generally known in the art.

The recombinant vector may be a plasmid vector, a cosmid vector, a fosmid vector, a bacteriophage vector or a viral vector, but is not limited thereto.

In one embodiment of the invention, the recombinant vector may be a phosphid vector having the schematic structure of FIG.

The recombinant vector may include expression control sequences such as promoters, operators, initiation codons, termination codons, polyadenylation signals, and enhancers, and signal sequences or leaders for membrane targeting or secretion. The sequence may be included and variously prepared according to the purpose.

The signal sequence may include a PhoA signal sequence or an OmpA signal sequence if the host cell is Escherichia, or an α-amylase signal sequence or a subtilicin signal sequence if the host cell is a Bacillus bacterium. If the host cell is a yeast, MFα signal sequence or SUC2 signal sequence, etc. If the host cell is an animal cell, an insulin signal sequence, α-interferon signal sequence, or an antibody molecule signal sequence, etc. may be used. It is not limited.

In addition, the recombinant vector may include a selection marker for selecting a host cell containing the recombinant vector, and in the case of a replicable recombinant vector, may include an origin of replication.

In one embodiment of the present invention, the transformant introduced into the host cell a recombinant vector containing the gene encoding the lipase protein according to the present invention is expressed when the lipase protein is expressed in the host cell, so that the host cell By adding a lipase substrate such as tributyrin to the culture medium, it is possible to select a transformed host cell without a selection marker.

In addition, the recombinant vector may include a sequence for facilitating purification of the expression, in one embodiment of the present invention, the histidine-tag (His-taq) is located at the C-terminal to facilitate the purification of lipase protein It was made.

The present invention also provides a transformant in which the recombinant vector is introduced into a host cell.

As used herein, the term “transformation” is used in the same sense as “introduction” and means the delivery of a foreign polynucleotide to a host cell, regardless of the method used.

The host cell is a cell having the ability to introduce a foreign gene to express the trait of the foreign gene, may be a prokaryotic cell or eukaryotic cell, specifically, the prokaryotic cell may be E. coli.

In one embodiment of the present invention, the transformant may be a BL21 (DE3) / pET21a + ORF3-6H strain.

The method of transforming the recombinant vector into a host cell is not particularly limited as long as the recombinant vector is inserted into the host cell. For example, any one of CaCl ₂ , electroporation, and microinjection may be used.

In addition, the present invention 1) culturing the transformant; 2) provides a method for producing a lipase protein comprising the step of recovering the lipase protein from the cultured transformant or its culture supernatant.

The step of culturing the transformant in step 1) may be cultured in LB (Luria broth) medium, and specifically, the transformant may be cultured in LB medium containing an antibiotic capable of selectively propagating the transformant. In one embodiment of the present invention, the transformant may be cultured in LB medium containing ampicillin.

In addition, the step of culturing the transformant in step 1) may be cultured by treating an inducer such as IPTG (isopropyl-α-D-thiogalacto pyranoside) that induces lipase protein expression, specifically, the final concentration of IPTG May be cultured by treating 0.01 to 1 mM, or 0.05 to 0.5 mM.

Recovering the lipase protein in step 2) may be performed in a conventional manner in the art. For example alone or in combination with techniques such as salting out (ammonium sulfate precipitation, sodium phosphate precipitation, etc.), solvent precipitation (eg, protein fraction precipitation using acetone, ethanol, etc.), dialysis, gel filtration, ion exchange, chromatography and ultrafiltration It may be performed by applying, but is not limited thereto.

The method for preparing lipase protein may further include purifying the recovered lipase protein of step 2).

Purifying the lipase protein may be carried out by conventional protein purification methods in the art, for example, ion exchange chromatography, gel-permeation chromatography, reverse phase-high performance liquid chromatography (HPLC). It may be performed by a method such as sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and affinity column chromatography for preparation, but is not limited thereto. In one embodiment of the present invention, purification of the lipase protein may be performed using a Ni-NTA column.

In a specific embodiment of the present invention, the inventors constructed a soil metagenome library, and selected 52 active clones having lipase activity from which the Lip-1420 gene having the best lipase activity was derived. After the subclones were prepared using this, lipase activity was selected for strong subclonal Lip-1420-sub while the size of the inserted DNA was small (see FIG. 1). The nucleotide sequence of Lip-1420-sub was analyzed to derive an ORF3 having lipase activity, and an E. coli transformant having a recombinant vector containing Lip-1420-sub-ORF3 gene was introduced (see FIG. 2). . In addition, lipase protein expression was confirmed from E. coli transformants introduced with Lip-1420-sub-ORF3, the protein was isolated and purified, and the novel lipase protein exhibited hydrolytic activity against tributyrin. (See Figures 3-5). Therefore, the novel lipase gene of the present invention, a vector comprising the same, and a transformant having the same, can be usefully used for industrial mass production of a novel lipase protein having strong activity.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited by the following examples.

Isolation of Soil Metagenomic DNA and Size Identification

Soil collected from the reed marsh of Sinseong-ri, Chungcheongnam-do was filtered through a 1.4 mm mesh sieve to remove particles and plant residues of 1.5 mm or more in diameter. 5 g of the soil sample were taken in 15 ml buffer (100 mM Tris-HCl, pH 8.0; 100 mM EDTA (Ethylenediaminetetraacetic acid), pH 8.0; 100 mM sodium-phosphate, pH 8.0; 1.5 M sodium chloride; and 1 It was suspended in% CTAB (cetyl trimethylammonium bromide). 100 μl of proteinase K (Sigma) at a concentration of 100 mg / ml was added to the suspension, followed by shaking for 30 minutes at a speed of 150 rpm in a 37 ° C. shaking incubator, and adding 1.5 ml of 20% SDS. Shake and mix. The mixture was maintained for 2 hours while mixing once every 30 minutes in a 65 ℃ constant temperature water bath. Then, the supernatant was separated by centrifugation at 7,000 rpm for 10 minutes, and the same volume of chloroform / isoamyl alcohol (24: 1) was added and mixed, followed by centrifugation at 8,000 rpm for 10 minutes. Only supernatant containing DNA was transferred to a new tube. Isopropanol (isopropanol) corresponding to 0.6 times the volume of the supernatant was added and mixed, followed by centrifugation at 11,000 rpm for 10 minutes to obtain a DNA precipitate. The DNA precipitate was washed with 70% ethanol and then centrifuged to remove ethanol. The precipitate obtained therefrom was dried, dissolved in 0.5 ml of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at 4 ° C.

The amount and size of the isolated DNA was confirmed by PFGE (pulsed field gel electrophoresis). PFGE was performed for 6 hours at a switch time of 1 to 6 seconds at a fixed angle of 120 ° at 6 V / cm. As a result, about 1 to 1.5 μg of the soil sample per 1 g. It was confirmed that the metagenome DNA was separated, and the size of the separated DNA was confirmed to be about 20 to 100 kb.

Creating a Metagenome Library

After electrophoresis on a low melting point agarose gel using the metagenome isolated in Example 1, only an agarose gel block containing 20 kb or more of DNA was recovered. The recovered gel block was treated with gelase (GeLase, Epicentre, USA) to purify DNA, and remove humic acid. Both ends of the purified DNA fragment were treated with DNA end-repair enzymes to obtain more than 20 kb of metagenome DNA with blunt ends, which were treated with the restriction enzyme Eco 72I. ) The vector pEpiFOS-5 (Epicentre) was ligation. The vector was introduced into Escherichia coli using a commercial packaging extract (Epicentre), followed by screening for transformants that grew on LB (Luria broth) agar medium supplemented with 50 μg / ml chloramphenicol. It was. Plasmid DNA isolated from the selected transformants by SDS-alkali lysis was digested with restriction enzyme Bam HI and subjected to electrophoresis. As a result, all 50 transformants selected contained recombinant plasmids. It was confirmed that the library was well prepared, and the average size of the inserted metagenome DNA was confirmed to be 35 to 40 kb. The selected transformants were diluted in the medium and stored at -80 ° C.

Experimental Example 1. Selection of lipase active clone from metagenome library

In order to select clones showing lipase activity from the metagenome library prepared in Example 2, 50 μg / ml of chloramphenicol and 1% tributyrin were added to the LB agar medium to homogenize, and then aliquoted and solidified. The library stored as a pool at -80 ° C (Pool) was diluted appropriately so that an amount of about 300 to 400 colonies could be cultured in the medium. This was incubated at 37 ° C. for 2 days to select colonies showing a halo around the colonies. The lipase activity of the selected active clones was retested by the above method to finally isolate 52 species and stored them at -80 ° C.

Construction of Subclones from Lipase-Activated Clones (Lip-1420)

Subcloning was performed secondly from the clone (Lip-1420) having the highest lipase activity among 52 clones showing lipase activity isolated in Experimental Example 1.

3-1. Derivation of Optimal Restriction Enzyme for Construction of Subclone

Plasmid DNA of Lip-1420 was isolated in large quantities using a plasmid separation kit (Bionia, South Korea), and then digested with restriction enzymes Bam HI, Pst I, Eco RI, Xba I, Sph I, Hind III or Sma I. The cleaved DNA was confirmed by electrophoresis on the agarose gel.

As a result, when Pst I was used, it was confirmed that the DNA was cut several times, and Pst I was derived as an optimal restriction enzyme (FIG.

3-2. Preparation of Subclones from Lip-1420

The plasmid DNA of Lip-1420 isolated in Example 3-1 was digested with restriction enzyme Pst I to make a reaction of insert DNA Lip-1420, and reacted at 37 ° C. for 2 hours to purify the inserted DNA. 250 ng / μl of vector DNA (pUC119) was digested with restriction enzyme Pst I to make a reactant, and then purified by treating with alkaline alkaline phosphatase (SAP) to prevent the vector from sticking to itself. The purified Lip-1420 DNA and vector DNA (pUC119, Vieira and Messing, Methods Enzymol. 153: 3-11, 1987) were mixed with a buffer, ATP and ligase at room temperature for 2 hours. After the reaction, the reaction was overnight at 4 ° C. to produce a subclone.

Experimental Example 2 Derivation of Lip-1420-sub out of Lip-1420 Subclone

2-1. Preparation of transformants into which subclone of Lip-1420 was introduced and screening of transformants with lipase activity

The subclone prepared in Example 3 was mixed with 100 μl of commercial E. coli cells JM109, and left on ice for 20 minutes, heat treated at 42 ° C. for 45 seconds to introduce the subclone into the cells, and then antibiotics were added. 400 μl of untreated LB medium was added thereto, followed by incubation at 37 ° C. for 45 minutes. In order to select transformants therefrom, the culture solution was plated on LB plates containing 1% tributyrin and 100 μg / ml ampicillin and incubated at 37 ° C. for 16 hours. Tributyrin was hydrolyzed from the cultured plates to select colonies showing a strong halo (FIG. 1B).

2-2. Verification of introduction of subclones into selected transformants

In the colonies selected in Experimental Example 2-1, plasmid DNA was isolated using a plasmid separation kit (Bionia) and treated with restriction enzyme Pst I, and the cleaved DNA was confirmed by electrophoresis. As a result, a DNA fragment having the same size as the DNA fragment of Lip-1420 was confirmed, and it was confirmed that a subclone of Lip-1420 was well introduced into the DNA of the transformant.

2-3. Derivation of Lip-1420-sub from Subclones

From the results of Experimental Examples 2-1 and 2-2, a subclonal having a small lipase activity with the smallest insertion DNA size of the subclones introduced into the transformant was selected, and the base sequence was analyzed to have a size of 5,513 bp. Confirmed. The selected subclones were named Lip-1420-sub (SEQ ID NO: 3).

Experimental Example 3 Identification of ORF with Lipase Activity in ORF of Lip-1420-sub

3-1. ORF analysis of Lip-1420-sub

An open reading frame (ORF) was analyzed from the nucleotide sequence of Lip-1420-sub analyzed in Experimental Example 2-3, and it was confirmed that four ORFs of 500 bp or more among various ORFs (Table 1).

ORF Length
(bp / aa) Comparative protein Protein name Strain name (% homology) Reference number ORF1 1590/529 Protein of unknown function Thiocapsa roseopersicina (48%) SDW97003.1 ORF2 1236/411 LLM class flavin-dependent oxidoreductase Blastopirellula marina (50%) WP_002655372.1 ORF3 885/294 esterase / lipase protein uncultured organism (78%) AFQ30768.1 ORF4 825/274 alpha / beta hydrolase Pseudorhodoplanes sinuspersici (37%) WP_086087576.1 ORF5 495/164 PREDICTED: 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial-like Polistes dominula (26%) XP_015178720.1

3-2. Identification of ORFs with Lipase Activity in ORFs of Lip-1420-sub

DNA of Lip-1420-sub subclone selected in Experimental Example 2 was isolated and used as a template, and primers for the four ORFs analyzed in Experimental Example 3-1 were prepared (Table 2), and polymerase chains were prepared. A polymerase chain reaction (PCR) was performed. PCR reaction was performed by mixing 20 μl of 5 × PCR buffer solution, 10 μl of N-solution, 2 μl of each primer of 100 pM, 1 μl of template DNA, 1 μl of pfu DNA polymerase, and 64 μl of sterile distilled water. 30 cycles of 30 seconds at 95 ° C., 30 seconds at 58 ° C. and 40 seconds at 72 ° C. were repeated 30 times (Thermal Cycler, Bio-Rad, USA). Each pET21a (+) vector was digested with restriction enzymes corresponding to the primers listed in Table 2 below, and then each PCR product was linked to commercial water-soluble E. coli cells JM109 and introduced into the commercially available E. coli cell JM109 by the same method as described in Experiment 2-1. Each transformant was plated in LB medium added with 1% tributyrin and incubated at 37 ° C. for 2 days to examine lipase activity.

Primer Name Sequence (5 '→ 3') Restriction enzyme SEQ ID NO: ORF1 F GCGTCAGGACATATGAGATGGCTATCTGCTCT NdeI 4 ORF1 R GCGTCAGGTCTCGAGCAGTCCCAAGAGGTTGGTC XhoI 5 ORF2 F GCGTCAGGCCATATGAAATTCTGGATGGATGTTTCAT NdeI 6 ORF2 R GCGTCAGGTCTCGAGTGCGTGAGCTTCCGTCTG XhoI 7 ORF3 F GCGACAGGCCATATGAGTCAGATTCCGGCTGA NdeI 8 ORF3 R GCGTCAGGACTCGAGGTGTTTGAGATGTTTGTCG XhoI 9 ORF4 F GCGACATCACATATGGCCTTACAAACCGACA NdeI 10 ORF4 R GCACTAGCAGTCGACGCGCTTGAGAAATTGGCTGA SalI 11

As a result, only the transformants into which ORF3 was introduced showed lipase activity.

Construction of Lip-1420-sub-ORF3 Plasmid

Lip-1420-sub subclonal DNA selected in Experimental Example 2 was isolated and used as a template, and PCR was performed using primer pairs (SEQ ID NOs. 8 and 9) corresponding to ORF3 in Table 2 to Lip-1420. A plasmid (pET21a (+)-ORF3-6H) was prepared comprising an ORF3 site of -sub and restriction sites ( NdeI and XhoI ).

Specifically, using the DNA of Lip-1420-sub as a template, PCR was performed in the same manner as described in Experiment 3-2 using primer pairs (SEQ ID NOs: 8 and 9) corresponding to ORF3 in Table 2. . The amplified PCR products were analyzed by 1.5% (w / v) agarose gel electrophoresis and purified using a PCR purification kit (Bionia). The sequence of the purified DNA was analyzed and plasmid generated by ligation into pET21a (+) digested with restriction enzymes Nde I and Xho I was named pET21a (+)-Lip1420-6H (FIG. 2).

Mass Production of New Lipase Proteins

5-1. Induction of expression of new lipase protein

Lipase protein expression was induced in E. coli using the plasmid prepared in Example 4.

Specifically, the plasmid was introduced into the expression host E. coli BL21 (DE3) [F-omp T hsdS _B (r _B- m _B- ) gal dcm (DE3)] (Stratagen, USA) and plated on LB plates. . Single colonies grown in fresh medium were harvested and inoculated into 100 mL of LB medium containing 100 μg / ml ampicillin and incubated at 37 ° C., until the absorbance at 600 nm was 0.6. This was inoculated again in 5,000 ml LB medium containing ampicillin and incubated with shaking at 37 ℃, it was grown until the absorbance at 600 nm was 0.6. Thereafter, 1 mM IPTG (isopropyl-α-D-thiogalacto pyranoside, GibcoBRL, USA) was added to induce protein overexpression and further incubated at 20 ° C. for 16 hours.

5-2. Isolation of Expressed New Lipase Proteins

The culture solution was centrifuged at 6,000 × g, 4 ° C. for 10 minutes to remove the supernatant, and the precipitate was washed three times with 10 ml of cold buffer (50 mM Tris-HCl, 1 mM EDTA, pH 8.0). This was resuspended in lysis buffer (pH 7.0, 50 mM Tris-HCl, 200 mM sodium chloride) and then crushed with an ultrasonic grinder (CosmoBio Co., LTD, Japan). The crushed cells were centrifuged at 12,000 × 4 ° C. for 30 minutes to remove supernatant to obtain precipitated protein. The protein was mixed with Laemmli sample buffer, followed by SDS-PAGE and stained with Coomassie Brilliant Blue R250 to confirm the presence of 34 kDa lipase protein (FIG. 3).

5-3. Purification of Isolated New Lipase Proteins

The lipase protein isolated in Example 5-1 was purified using a metal ion attachment column.

Specifically, Ni-NTA (nickel-nitrilotriacetic acid (QIAGEN, Germany)) was added to a chromatography column (bed volume, 15 mL, Millipore, USA) to saturate the column with nickel ions, and a 50 mM nickel solution in the form of sulfate It was added to remove the unbound metal ion. A solution containing the separated lipase protein was added to the column, the column was washed with a buffer solution (50 mM Tris-HCl, 0.15 M sodium chloride, pH 7.4), and the buffer was placed in a continuous imidazole gradient. The solution was passed through and purified by fast protein liquid chromatography (FPLC) (FIG. 4A) and purified lipase protein was obtained in each fraction. Using each fraction, electrophoresis was performed in the same manner as described in Example 7-2 to confirm that 34 kDa lipase protein was present (FIG. 4B). As described above, the mass-produced lipase protein was diluted in the buffer solution at a concentration of 1 mg / ml and stored at -70 ° C in a container (FIG. 4C).

Experimental Example 4. Confirmation of Lipase Protein Expression and Extracellular Secretion of E. coli with Lip-1420-sub-ORF3

It was confirmed by SDS-PAGE analysis whether the new lipase protein is expressed in the cells of Escherichia coli Lip-1420-sub-ORF3 prepared in Example 5-1 and secreted out of the cells.

Specifically, Escherichia coli into which Lip-1420-sub-ORF3 was introduced was suspended and cultured in LB liquid medium for 2 days. The culture solution was centrifuged at 14,000 rpm to separate the supernatant, and the filtered cells and the culture medium from which the cells were removed were obtained through membrane filtration. The cells were concentrated 10-fold, and the culture was not concentrated, and the expression of the protein was confirmed by 12% SDS-PAGE analysis.

As a result, it was confirmed that the 34 kDa protein of the expected size was strongly expressed compared to E. coli having only the pUC119 vector and secreted well into the medium.

Experimental Example 5. Confirmation of the lipase activity of the novel lipase protein

Lipase activity of the novel lipase protein expressed in Escherichia coli Lip-1420-sub-ORF3 prepared in Example 5-1 was examined.

Specifically, homogenized by adding 1% tributyrin to LB agar medium, 40 μl of the novel lipase protein purified in Example 5-3 was injected onto a paper disc of 3 mm in diameter, which was then heated at 37 ° C. Incubated for 5 days.

As a result, it was confirmed that there was a transparent halo around the colonies above (FIG. 5), which suggests that the new lipase protein strongly exhibits the activity of hydrolyzing tributyrin.

<110> KOREA RESEARCH INSTITUTE OF CHEMICAL TECHNOLOGY <120> Novel lipase gene Lip-1420 derived from soil metagenome and use          about <130> 2018P-08-001 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 302 <212> PRT <213> Artificial Sequence <220> <223> lipase <400> 1 Met Ser Gln Ile Pro Ala Asp Leu Leu Glu Phe Met Glu Thr Leu Arg   1 5 10 15 Val Pro Lys Gly Val Asn Pro Ala Asp Met Leu Leu Arg Tyr Asp Ser              20 25 30 Leu Met Asn Gly Asn Pro Pro Pro Val Gly Ala Val His Asp Gly Val          35 40 45 Leu Leu His Glu Val Ala Gly Trp Arg Leu Thr Ala Asp Ile Ala Val      50 55 60 Pro Ser Gly Thr Gly Pro His Pro Val Leu Val Tyr Phe His Gly Gly  65 70 75 80 Gly Trp Thr Met Gly Ser Pro Lys Thr His Leu Arg Leu Gly Arg Glu                  85 90 95 Phe Ala Ala Ala Gly Tyr Leu Thr Ile Asn Leu Asp Tyr Arg Arg Ala             100 105 110 Pro Lys Tyr Arg Phe Pro Ala Ala Phe Asp Asp Cys Val Phe Ala Thr         115 120 125 Arg Trp Ala Val Glu Asn Ala Ala Arg Tyr Gly Gly Asp Ala Lys Arg     130 135 140 Leu Ala Val Gly Gly Asp Ser Ala Gly Gly Asn Leu Ala Ala Ala Val 145 150 155 160 Leu Ala Glu Gly Thr Gln Lys Gly Gly Pro Lys Ile Ser Thr Gly Val                 165 170 175 Leu Leu Tyr Gly Val Phe Asp Tyr His Gln Ala Met Thr Ser Leu Gly             180 185 190 Gly Thr Gly Pro Asn Thr Gln Phe Tyr Leu Pro Glu Asp Gln Tyr Glu         195 200 205 Ala Leu Arg Gln Asp Tyr Arg Val Ser Pro Phe Tyr Ala Cys Ala Lys     210 215 220 Phe Pro Pro Cys Tyr Ile Gly Val Gly Thr Lys Asp Pro Leu Leu Pro 225 230 235 240 Gln Ser Leu Glu Leu Ala Arg Ala Leu Gln Ala Ala Gly Ile Glu His                 245 250 255 Asp Leu His Val Val Glu Gly Ala Pro His Ala Phe Phe Gln Leu Pro             260 265 270 Pro Leu Ser Ala Tyr Ser Glu Gly Tyr Arg Arg Ala Thr Ala Phe Leu         275 280 285 Asp Lys His Leu Lys His Leu Glu His His His His His His     290 295 300 <210> 2 <211> 909 <212> DNA <213> Artificial Sequence <220> <223> Lip-1420-sub-ORF3 <400> 2 atgagtcaga ttccggctga tctgcttgaa tttatggaaa ccctgcgcgt gcctaagggg 60 gtgaacccgg cggatatgct gctgcgctac gatagtctga tgaacggcaa tccgccgccc 120 gtgggcgctg tgcatgacgg ggtactgttg cacgaggtgg caggctggcg gctgaccgcc 180 gatattgccg tgccgtctgg tacgggacca cacccggtgt tggtttattt ccacggcggt 240 ggctggacga tggggagccc gaagactcat ctgcgcctcg gccgggagtt tgccgccgca 300 ggttatctca ccatcaacct cgattaccgc cgcgcgccca agtacagatt tcccgccgcc 360 tttgatgact gtgtgtttgc cacacggtgg gcggtggaga acgccgcgcg ctatggcgga 420 gatgccaagc gcttagccgt aggcggagac tcggcgggtg gcaatctggc ggccgcagtt 480 ttggcggaag gcacgcagaa aggcggacct aagatcagca ccggagtatt gctctacggc 540 gtcttcgact atcaccaagc catgacatct ctgggtggga ctggaccgaa cacgcaattc 600 tacctaccgg aagaccaata cgaggcgcta cgtcaggact atcgggttag cccgttctat 660 gcctgtgcga aattcccgcc gtgctatatc ggggtgggta cgaaggatcc gcttttgccg 720 caatcgttag aactagccag ggcattgcag gcggcaggaa ttgagcatga cctccacgtc 780 gtcgaaggcg cgccgcacgc cttcttccaa ctcccgccat tgtcggcgta tagcgaaggc 840 taccggcgag cgacggcgtt tctcgacaaa catctcaaac acctcgagca ccaccaccac 900 caccactga 909 <210> 3 <211> 5513 <212> DNA <213> Artificial Sequence <220> <223> Lip-1420-sub <400> 3 ggctaaatgt ttttctccct ttccgtccga tcgctaaagt gttgccaaaa gttcggcagg 60 cttgatgaat caagttggtt tgtgggtttt tcagcggttt gccaatgcag gtattgtgga 120 agcgcaggca ctttgtctgc cgtagtatgc tgtcaagctc taaactttag gtctttctca 180 gacgcaggct ccgcctctag cggttggcac ttgaatgtat cctgggagcg cgcccatctt 240 gggcgctttt cgggcgggcg ggacgcccgc gctcccagca ggggggaccc atccaactga 300 aaactgctat aggtctgccg tgtagcgatg gatctgccac tcctggggtt tgcgttccca 360 ggcagagcct gggaacgagg tcgacgactt gcgaaatacc cgagtgcgaa gtgctaggag 420 gaattggcgg gggaatgacg agcggcaagc cttcacgcgg cttagcgctt gagaaattgg 480 ctgactattt ctgctgtgcg ctgaggttgc tcgagcagca gcgcatgggc tgcgccgggt 540 acaagcgcag tctcggcgcc ggcgatgcct cctttaaaca cttcagcgag agccggcggg 600 gcaagcttgt cctcaccggc ccagacgatg agagtgggca cttgtatacg gaacaaacgc 660 tctttcaggc gcgggttgta cagatagggt ggtttccagc ccagccgggc tgcaaccatt 720 tgggctttgt agaagagcat gtaggcgtca gggggcatct ggtcggatac cgcgcccata 780 gccaactccg agttaggatc gcgaaagagc aactcgcgcg cctcgtgttg tccgccttcc 840 gctttcgggg ttacggtgta gaagaaattg ccaatccggg cttgcggagt cgagatgccg 900 agcggatcga tcagcaccaa tttgtctaag cggtgcgagt agcgggtggc gaattcagtc 960 gcaacccatc ctccgagaga actgccgact acactcacct tggccaattg cagcgcgtcg 1020 agcacatcga gacaaaagaa cactgcgtct tcaatggttt ccagatcatc gaacccttcg 1080 ctgtcagcgt agccaggcaa ggccggcgca tacagcgaga aggaggcagc taaggcatcg 1140 tggaaagtgg taaagccggc cttggcaggc agactataga tatcagccgc aagcccgtgc 1200 agatacaaca ggggtttgcc gttgccgcca cgtaggagtt ggattttttt accacgaatc 1260 gtcagggtgt cggtttgtaa ggccataaag agtgttgtcc tgtttgccaa gatgcggatg 1320 taagaacgtc ccgctgtgga gccttgatga atcaaggctc catggggaga ggcagcctct 1380 gcctgaactg aggttatgcg tgagcttccg tctgccgggt ttgcccacca gggagagcac 1440 cgaactcggc ttcggcgtac ttacgtacgt aggggaacac ttcgctggtg aggagttcca 1500 tatttttgcg cgtgagatga tcgggcaagc tgccgaactg ggggagcgcg aggatatggc 1560 cgaccttgaa ctccaggaca tatttgagca actgctcgcg cacggtttgc gggctgccga 1620 tgagtaccga accgccggcc tcgacatcat cccaactgcg ggcgtgacct aactgccagt 1680 ttgtcggcgc cttttcgccg ccgagagagt taatttcttg caggcgttgt aaagacttca 1740 gcgaggtata ccccggcggc atccaggtcc gcccttttcc agcgaagcct ttgatgagtt 1800 tatcgatgaa gtaccagacg tgttcctcgg cctcttgccg cgctttctgg tcggtctcgg 1860 ccacgtacat cggcaccagc cacccgagca tttccgggtt gtacgtcctg cccacccgcg 1920 cgacggtttg ctggaaaaag gccgcgttct ggcgaaacga atcaacgtgg gcataggtca 1980 gcgcggcgta gatgaacccg cgctcggcca ccagttccat ggtctcgacg ctgccgacac 2040 ccggaatcca gatcggcggg tggggcttct gtaccggccg cggccaggga ttgacgtact 2100 ggaactgaaa gtgtttaccg tcccacgaaa acggcccggg gtcggtccag gctttgacaa 2160 tcaggtcggt ggcctcacgg aatcgctctc gggcgaaagt gggattgatg ttgtaggaat 2220 aatattccgg cccgccgccg acgacaaagc ctgcgtcaaa cttgccgcga aacatgttgt 2280 cgagcatggc gaactcttcg gcgattttca gcggcacttc ataaagcggc agcccgttac 2340 ccaggaccat tacccgggcc tgctggatgc gttgcgacag cgcggcagca atcaagttcg 2400 gggaaggcat aatgccgtaa gcattttgat gatgctcgtt gatcaccacg ccatcgaagc 2460 ctagttgatc agcgtaggcg agttggttga tgtaacgatg atacacttct ggtccacgtt 2520 cgggatcgaa gagcgtgttc ggacaggtga cccaggcggt atcgtacttc tcggcaaaat 2580 catcgggcaa ataaggccac ggcatcagat gaaacatcca gaatttcatt gattttcccc 2640 ttacatgacg attcgtctgt ggtgtaccac atcaaggtaa ggttgcaaag agcaaagccg 2700 ctggcgtctt acgcgcttgc cgggtagaat ccgcgggaca cttctaccac aaagggggac 2760 gacacatgag tcagattccg gctgatctgc ttgaatttat ggaaaccctg cgcgtgccta 2820 agggggtgaa cccggcggat atgctgctgc gctacgatag tctgatgaac ggcaatccgc 2880 cgcccgtggg cgctgtgcat gacggggtac tgttgcacga ggtggcaggc tggcggctga 2940 ccgccgatat tgccgtgccg tctggtacgg gaccacaccc ggtgttggtt tatttccacg 3000 gcggtggctg gacgatgggg agcccgaaga ctcatctgcg cctcggccgg gagtttgccg 3060 ccgcaggtta tctcaccatc aacctcgatt accgccgcgc gcccaagtac agatttcccg 3120 ccgcctttga tgactgtgtg tttgccacac ggtgggcggt ggagaacgcc gcgcgctatg 3180 gcggagatgc caagcgctta gccgtaggcg gagactcggc gggtggcaat ctggcggccg 3240 cagttttggc ggaaggcacg cagaaaggcg gacctaagat cagcaccgga gtattgctct 3300 acggcgtctt cgactatcac caagccatga catctctggg tgggactgga ccgaacacgc 3360 aattctacct accggaagac caatacgagg cgctacgtca ggactatcgg gttagcccgt 3420 tctatgcctg tgcgaaattc ccgccgtgct atatcggggt gggtacgaag gatccgcttt 3480 tgccgcaatc gttagaacta gccagggcat tgcaggcggc aggaattgag catgacctcc 3540 acgtcgtcga aggcgcgccg cacgccttct tccaactccc gccattgtcg gcgtatagcg 3600 aaggctaccg gcgagcgacg gcgtttctcg acaaacatct caaacactga cgcgggcaaa 3660 agagcagggc acgcctgggg tgcccttttt ctcttgacag gcttcggttc gccgatgtag 3720 taataggggc gctggcgcga tagcagcact gcaaagccgg ctttccgtca ctgagagggc 3780 gacgggattc acggccggct ttcatcgccg cgcaggtgca acaaggcaaa gccggtgggc 3840 gggcctccgc cgaagcaggg cccggaggat gaaactaggg gtgaagtact actctccccc 3900 tctctcatag gaggttgtag tgatgagatg gctatctgct ctgtggctgc tgttgttgct 3960 ccccggccta gccatggctc agggccagca gtgcaccaac ttccaaccga ataggcagcc 4020 gttcttcggc gaacttcatc tgcacaccga gtactcggcg gacgcggcga ccctcgatac 4080 gcgcaacacg cccgccgatg cctaccgctt cgccaagggc gagaaactcg gactgccgcc 4140 ttttatcaat acgtgcaccg acagccagtg tgacagcggc ccacccaaca ccggcccggt 4200 ctcctcccac ttctactgtt tcccgccgga ccgctgcgag ttcaccgcca cacgcacgat 4260 tcagttcccg caaggccggg agctggactt cgcggcgatt acggaccacg ccgaatggtt 4320 cggcgagacc aacatctgct tctgggaaga gacggagacg tgtgaacagg atgcggactg 4380 caacccggga cagacgggac atatctgttt cggcaccaac ctgtcggcga gcgggcaagg 4440 gaagtgtgtc ccccgggggt atgcgagcga agactgtatc cttgcgcggg aggaactggc 4500 gaaactccac acggggttag ggaccgccct cttggccgcg tatgtcacga ctcccacgat 4560 aacacccgac ggcaccgtca ccgagccgca gcgtgccgcc ttctgtcagg cgccgggggc 4620 ggagggaaaa gacacgtgca tatttcaggc gcagaacgtc tggaagcaaa ttcagcaaga 4680 cgcggcgggc gcataccagc cgtgtcagtt cacctctttc gtcgcttacg agtacactgg 4740 gatgccgggg atgctgcggt gcagtaccga cggcgcaccc tgcttaacca atgccgactg 4800 caccggaggg cagagctgcg agacagaccc gaacggcggc gccaacaacc tccaccgcaa 4860 catcatcttc aagaacgccg acgtggtgga tctgccgatc acctacatgg aagcgccgac 4920 gagctgcggc cagggctcgc ctcagtgtaa cggcgcgctc gggtctcctc tgacgctgtt 4980 gcaagattta acgggtcaat gcggccccaa taccccgcat ccgcagtgcg acttcatttc 5040 aatcccgcat aattccaaca tcagcggcgg cgccatgttc gtgctgccgg agagcctgga 5100 cgaggccaca gtccgctccg acaaggagcg gctggtcgaa ctctttcaga tcaaaggcag 5160 ctcggagtgc cgcttttccg ctcaacaccc gggtgcgtgg gggaccattg atgagcagtg 5220 caacttcgaa aatatgaact tcggcaagct gaatgggaaa tatctcacgg accccgatcc 5280 cacaaccgtg tcaccccaga gttatgtccg gaacgcgtta aaggccggca tgcagtacga 5340 gaaagaccat ggggtcaatc ccttcaagct gggattcgtc ggcgccctcg acaaccataa 5400 cggcacgcct ggcgcgagcg aagcggtcca gtatgccaag accggggcgc atggcgactt 5460 gagctttgcc gtatcgggcc agatcttgaa cgagaccaac ctcttgggac tgc 5513 <210> 4 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Lip-1420-sub-ORF1 forward <400> 4 gcgtcaggac atatgagatg gctatctgct ct 32 <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Lip-1420-sub-ORF1 reverse <400> 5 gcgtcaggtc tcgagcagtc ccaagaggtt ggtc 34 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Lip-1420-sub-ORF2 forward <400> 6 gcgtcaggcc atatgaaatt ctggatggat gtttcat 37 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Lip-1420-sub-ORF2 reverse <400> 7 gcgtcaggtc tcgagtgcgt gagcttccgt ctg 33 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Lip-1420-sub-ORF3 forward <400> 8 gcgacaggcc atatgagtca gattccggct ga 32 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Lip-1420-sub-ORF3 reverse <400> 9 gcgtcaggac tcgaggtgtt tgagatgttt gtcg 34 <210> 10 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Lip-1420-sub-ORF4 forward <400> 10 gcgacatcac atatggcctt acaaaccgac a 31 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Lip-1420-sub-ORF4 reverse <400> 11 gcactagcag tcgacgcgct tgagaaattg gctga 35

Claims (9)

Lipase protein consisting of the amino acid sequence of SEQ ID NO: 1.
Gene encoding the lipase protein of claim 1.
The gene of claim 2, wherein the gene consists of the nucleotide sequence of SEQ ID NO: 2. 4.
A recombinant vector comprising the gene of claim 2 or 3.
A transformant, wherein the recombinant vector of claim 4 is introduced into a host cell.
The transformant of claim 5, wherein the host cell is a prokaryotic or eukaryotic cell.
The transformant of claim 6, wherein the prokaryotic cell is Escherichia coli.
1) culturing the transformant of claim 5;
2) A method for producing a lipase protein comprising recovering a lipase protein from the cultured transformant or its culture supernatant.
The method of claim 8, further comprising purifying the recovered lipase protein of step 2).

Images