CN109517814B

CN109517814B - Mutant of organophosphorus degrading enzyme and application thereof

Info

Publication number: CN109517814B
Application number: CN201811435625.5A
Authority: CN
Inventors: 唐雪明; 马樱芳; 秦斌钰
Original assignee: Guiyi Technology Shanghai Co ltd
Current assignee: Guiyi Technology Shanghai Co ltd
Priority date: 2018-11-28
Filing date: 2018-11-28
Publication date: 2021-06-01
Anticipated expiration: 2038-11-28
Also published as: CN109517814A

Abstract

The invention relates to a mutant of organophosphorus degrading enzyme and application thereof. Specifically, the mutant organophosphorus degrading enzyme is mutated at one or more sites selected from the group consisting of: methionine (M) at position 139, histidine (H) at position 229, isoleucine (I) at position 259, or a combination thereof. Compared with wild organophosphorus degrading enzyme, the mutant organophosphorus degrading enzyme has stronger enzyme activity for degrading organophosphorus pesticide, and the degrading capability of the mutant organophosphorus degrading enzyme is at least improved by 12-65 times. In addition, the invention also relates to an expression system which is very suitable for expressing the organophosphorus degrading enzyme mutant, and the organophosphorus degrading enzyme has very high activity and strong capability of degrading organophosphorus pesticide.

Description

Mutant of organophosphorus degrading enzyme and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a mutant of organophosphorus degrading enzyme and application thereof.

Background

Agricultural chemicals play a significant role in agricultural production, and according to the statistics of the food and agricultural organization of the united nations, the annual loss caused by pest and weed damage accounts for about 36 percent of the total crop yield in the world under the condition of no agricultural chemicals, and the annual loss is up to 1250 billion dollars (Cooper and Dobson, 2007; Eddleston and Bateman, 2007). In order to ensure stable yield and high harvest of crops and sufficient food supply, various pesticides are produced and used in large quantities at home and abroad. In the beginning of the 60s of the 20 th century, organic chlorine pesticides are forbidden in many countries, thereby promoting the rapid development of organic phosphorus pesticides at home and abroad. However, the organophosphorus pesticide is a highly toxic compound, and the wax of the plant epidermis and natural environmental conditions (wind, rain and rain) make the effective utilization rate of the pesticide only 10-20%, most of the pesticide flows into soil and water, thus seriously damaging the ecological system of the farmland and finally causing threat to human health through the food chain.

Organophosphorus pesticides are essential to global agricultural production, so that how to degrade organophosphorus pesticides by manual methods is urgent on the premise of reasonably using organophosphorus pesticides. The degradation methods of organophosphorus pesticides commonly used include three, namely, oxidative degradation, photocatalytic degradation and biocatalytic degradation. The biodegradation method has the advantages of mild reaction conditions, difficult secondary pollution and the like, and is the main research direction at present. In the early stage, the separation and screening of organophosphorus degrading microorganisms are mainly focused, and various microorganisms such as bacteria, fungi, actinomycetes, algae and the like can degrade organophosphorus pesticides. It has been found that these microorganisms are capable of degrading organophosphorus pesticides because they are capable of producing an enzyme which hydrolyzes the phosphate bond (organophosphorus degrading enzyme) and hydrolyze the phosphate bond of organophosphorus pesticides to detoxify them. In the early research, organophosphorus degrading enzymes are extracted from wild strains, but the problems of low yield, high extraction cost and the like exist. The research on the enzyme has entered the molecular level in recent years, and the gene engineering technology and the enzyme engineering technology are adopted to transform the organophosphorus degrading enzyme gene and then carry out heterologous expression in hosts such as escherichia coli so as to realize the industrial production of the organophosphorus degrading enzyme.

Therefore, there is a need in the art to develop an organophosphorus degrading enzyme, an expression system thereof and a preparation method thereof, which can effectively degrade organophosphorus pesticides.

Disclosure of Invention

The invention aims to provide an organophosphorus degrading enzyme for effectively degrading organophosphorus pesticide, an expression system and a preparation method thereof.

In a first aspect of the present invention there is provided a mutant organophosphorus degrading enzyme, which mutant organophosphorus degrading enzyme is mutated in correspondence with one or more sites selected from the group consisting of: methionine (M) at position 139, histidine (H) at position 229, isoleucine (I) at position 259, or a combination thereof.

In another preferred example, the amino acid sequence of the wild-type organophosphorus degrading enzyme is derived from Agrobacterium tumefaciens (Agrobacterium tumefaciens).

In another preferred example, the amino acid sequence of the wild-type organophosphorus degrading enzyme is shown in SEQ ID No. 1.

In another preferred embodiment, the mutant organophosphorus degrading enzyme is mutated in the amino acid sequence corresponding to methionine 139 (M) in the wild-type organophosphorus degrading enzyme.

In another preferred embodiment, the mutant organophosphorus degrading enzyme further comprises a mutation corresponding to histidine (H) at position 229 and/or isoleucine (I) at position 259 in the amino acid sequence of the wild-type organophosphorus degrading enzyme.

In another preferred embodiment, the 139 th methionine (M) is mutated to threonine (T); and/or

Said 229 th histidine (H) is mutated to arginine (R); and/or

The 259 th isoleucine (I) is mutated into aspartic acid (D).

In another preferred embodiment, the mutation in said mutated organophosphorus degrading enzyme is selected from the group consisting of: M139T, H229R, I259D or a combination thereof.

In another preferred embodiment, the mutation in said mutated organophosphorus degrading enzyme comprises at least M139T.

In another preferred embodiment, the mutated organophosphorus degrading enzyme is selected from the group consisting of:

(1) a polypeptide having an amino acid sequence as set forth in any one of SEQ ID No. 2-5; or

(2) A polypeptide derived from the polypeptide having the amino acid sequence shown in SEQ ID No. 2, which has the function of the polypeptide shown in (1), formed by substituting, deleting or adding one or more, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-8, more preferably 1-3, and most preferably 1 amino acid residue in the amino acid sequence shown in SEQ ID No. 2.

In another preferred embodiment, the mutated organophosphorus degrading enzyme has an amino acid sequence identical or substantially identical to the sequence shown in SEQ ID NO. 1 except for the mutation (e.g., positions 139, 229, 259).

In another preferred embodiment, the substantial identity is a difference of at most 50 (preferably 1 to 20, more preferably 1 to 10) amino acids, wherein the difference comprises a substitution, deletion or addition of an amino acid, and the mutant organophosphorus degrading enzyme still has a phosphoester bond hydrolyzing activity.

In another preferred embodiment, the amino acid sequence of the mutant organophosphorus degrading enzyme is shown in any one of SEQ ID No. 2-5.

In another preferred embodiment, the amino acid sequence of the mutated organophosphorus degrading enzyme has at least 70%, preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99% or more sequence identity with the sequence shown in any one of SEQ ID No. 2-5.

In a second aspect of the invention, there is provided an isolated polynucleotide encoding an organophosphorus degrading enzyme according to the first aspect of the invention.

In another preferred embodiment, the polynucleotide is a polynucleotide encoding a polypeptide as set forth in any one of SEQ ID No. 2-5.

In another preferred embodiment, the polynucleotide encodes a polypeptide as set forth in SEQ ID No. 2, and the polynucleotide is selected from the group consisting of:

(a) a polynucleotide having a sequence as set forth in SEQ ID No. 6;

(b) polynucleotide having a nucleotide sequence homology of 95% or more (preferably 98% or more, more preferably 99% or more) with the sequence shown in SEQ ID No. 6; and/or

(c) A polynucleotide complementary to any one of the polynucleotides of (a) - (b).

In another preferred embodiment, the polynucleotide comprises a DNA sequence, an RNA sequence, or a combination thereof.

In another preferred embodiment, said polynucleotide additionally comprises an auxiliary element selected from the group consisting of: a signal peptide, a tag sequence (e.g., 6His), or a combination thereof.

In a third aspect of the invention, there is provided a vector comprising a polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the vector comprises one or more promoters operably linked to the nucleic acid sequence, enhancer, transcription termination signal, polyadenylation sequence, origin of replication, selectable marker, nucleic acid restriction site, and/or homologous recombination site.

In another preferred embodiment, the vector comprises a plasmid, a viral vector.

In another preferred embodiment, the vector comprises an expression vector, a shuttle vector and an integration vector.

In another preferred embodiment, the vector is a pMA5, pHT01 or pHY-P43 vector containing or inserted with a polynucleotide as described in the second aspect of the invention.

In a fourth aspect of the invention, there is provided a host cell comprising a vector according to the third aspect of the invention or having a polynucleotide according to the second aspect of the invention integrated into its genome.

In another preferred embodiment, the host cell is selected from the group consisting of: prokaryotic cells, eukaryotic cells, or a combination thereof.

In another preferred embodiment, the host cell is a eukaryotic cell, such as a yeast cell, a plant cell or an animal cell.

In another preferred embodiment, the host cell is a prokaryotic cell, such as bacillus subtilis, preferably b.subtilis168 or b.subtilis WB600, more preferably b.subtilis 168.

In a fifth aspect of the present invention, there is provided a method of producing a mutated organophosphorus degrading enzyme according to the first aspect of the present invention, comprising the steps of: (i) culturing a host cell according to the fourth aspect of the invention, thereby expressing a mutated organophosphorus degrading enzyme; and

(ii) optionally, isolating the mutated organophosphorus degrading enzyme.

In another preferred embodiment, the host cell is b.

In another preferred example, in step (i), the medium in which the host cell is cultured is TB medium or wheat protein hydrolysate medium.

In another preferred embodiment, said TB medium comprises a modified or unmodified TB medium.

In another preferred embodiment, the TB medium contains: 2.2 to 2.6 percent of yeast extract, 1.0 to 1.4 percent of tryptone, 0.3 to 0.5 percent of glycerol, K₂HPO₄70-74mM and KH₂PO₄15-20mM, based on the total weight percentage of the culture medium.

In another preferred embodiment, the modified TB medium contains: angel yeast powder 2.2-2.6 wt%, wheat hydrolyzed protein powder 1.0-1.4 wt%, glycerin 0.3-0.5 wt%, and K₂HPO₄70-74mM and KH₂PO₄15-20mM, based on the total weight of the medium.

In another preferred embodiment, the wheat protein hydrolysate culture medium comprises: 1.0-1.5 wt% of wheat hydrolyzed protein powder, 0.3-0.8 wt% of Angel yeast powder and 0.8-1.2 wt% of sodium chloride, based on the total weight of the culture medium.

In another preferred embodiment, in step (i), the culture period is 24-72 h.

In another preferred embodiment, in step (ii), the enzyme activity of the mutated organophosphorus degrading enzyme is above 42.16U/mL.

In another preferred example, the method further comprises the steps of: (iii) (iii) purifying the mutated organophosphorus degrading enzyme of step (ii).

In a sixth aspect, the present invention provides a formulation comprising (a) a mutated organophosphorus degrading enzyme according to the first aspect of the present invention, and (b) an agriculturally acceptable carrier.

In a seventh aspect of the invention, there is provided a use of a mutated organophosphorus degrading enzyme according to the first aspect of the invention or a formulation according to the sixth aspect of the invention, for degrading an organophosphorus pesticide.

In a first aspect of the present invention there is provided a method of degrading an organophosphorus pesticide, which comprises contacting the mutant organophosphorus degrading enzyme of the first aspect of the present invention or the formulation of the sixth aspect of the present invention with an organophosphorus pesticide, thereby degrading the organophosphorus pesticide.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows the effect of different media on the production of enzyme by recombinant strain B.subtilis168/pMA 5-opdA.

FIG. 2 shows the SDS-PAGE results of the fermentation supernatants at different times for recombinant B.subtilis168/pMA 5-opdA. Wherein M: standard protein molecular weight; lanes 1-7 correspond to different fermentation times, respectively 0h/8h/24h/32h/48h/56h/72 h; lane 8: coli BL21(DE3)/pET28a-opdA induced total protein.

FIG. 3 shows the enzyme activity and dry weight of cells in B.subtilis168/pMA5-opdA fermentor.

Detailed Description

The present inventors have made extensive and intensive studies and have unexpectedly obtained a mutant of an organophosphorus degrading enzyme derived from Agrobacterium tumefaciens. Compared with wild organophosphorus degrading enzyme, the mutant organophosphorus degrading enzyme has stronger enzyme activity for degrading organophosphorus pesticide, and the degrading capability of the mutant organophosphorus degrading enzyme is at least improved by 12-65 times. In addition, the invention also screens expression vectors and host cells suitable for expressing the mutant organophosphorus degrading enzyme in a large quantity, and finally obtains an expression system very suitable for expressing the mutant organophosphorus degrading enzyme, and the organophosphorus degrading enzyme has very high activity and strong capability of degrading organophosphorus pesticide. On this basis, the inventors have completed the present invention.

Term(s) for

In order that the disclosure may be more readily understood, certain terms are first defined. As used in this application, each of the following terms shall have the meaning given below, unless explicitly specified otherwise herein. Other definitions are set forth throughout the application.

The term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

As used herein, the term "comprising" or "includes" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….

Sequence identity (or homology) is determined by comparing two aligned sequences along a predetermined comparison window (which may be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

Organophosphorus degrading enzymes (OpdA)

Organophosphorus degrading enzymes (EC 3.1.8.1) are biological hydrolases which hydrolyze toxic, water-insoluble organophosphorus macromolecules into low-toxic, even non-toxic, water-soluble macromolecules by cleaving the phosphoester bonds (P ═ O or P ═ S) in the organophosphorus species. Because various organophosphorus pollutants have similar structures and only have different substituents, one organophosphorus degrading enzyme can hydrolyze various organophosphorus substances to different degrees, can fundamentally solve the organophosphorus pesticide residue problem and restore water bodies and soil polluted by organophosphorus, and can even be used in the fields of professional decontamination of special dangerous chemicals and the like.

Wild type organophosphorus degrading enzyme

As used herein, "wild-type organophosphorus degrading enzyme" refers to a naturally occurring, unartificially engineered organophosphorus degrading enzyme. The source of the wild-type organophosphorus degrading enzyme is not particularly limited, and one preferred source is Agrobacterium tumefaciens (Agrobacterium tumefaciens).

In a preferred embodiment of the invention, the amino acid sequence of the wild-type organophosphorus degrading enzyme is shown in SEQ ID No. 1.

MQTRRDALKSAAAITLLGGLAGCASMARPIGTGDLINTVRGPIPVSEAGFTLTHEHICGSSAGFLRAWPEFFGSRKALAEKAVRGLRHARSAGVQTIVDVSTFDIGRDVRLLAEVSRAADVHIVAATGLWFDPPLSMRMRSVEELTQFFLREIQHGIEDTGIRAGIIKVATTGKATPFQELVLKAAARASLATGVPVTTHTSASQRDGEQQAAIFESEGLSPSRVCIGHSDDTDDLSYLTGLAARGYLVGLDRMPYSAIGLEGNASALALFGTRSWQTRALLIKALIDRGYKDRILVSHDWLFGFSSYVTNIMDVMDRINPDGMAFVPLRVIPFLREKGVPPETLAGVTVANPARFLSPTVRAVVTRSETSRPAAPIPRQDTER(SEQ ID NO.:1)

Mutant organophosphorus degrading enzymes

As used herein, the terms "mutein", "inventive organophosphorus degrading enzyme", "mutated organophosphorus degrading enzyme", "mutant organophosphorus degrading enzyme", and "mutant of organophosphorus degrading enzyme" are used interchangeably and refer to a mutant organophosphorus degrading enzyme that does not occur naturally and is a protein that has been artificially engineered from the protein shown in SEQ ID No. 1. In particular, the mutated organophosphorus degrading enzyme is as described in the first aspect of the present invention.

It is to be understood that the numbering of the amino acids in the mutated organophosphorus degrading enzyme of the present invention is made based on the wild-type organophosphorus degrading enzyme (preferably, SEQ ID No.: 1). When a particular mutein has 80% or more homology to the sequence shown in SEQ ID NO. 1, the amino acid numbering of the mutein may be misaligned relative to the amino acid numbering of SEQ ID NO. 1, e.g., by 1-5 positions towards the N-terminus or C-terminus of the amino acid, and one of ordinary skill in the art would generally appreciate that such misalignment is within a reasonable range and that muteins having the same or similar glycosyltransferase activity with 80% (e.g., 90%, 95%, 98%) homology due to the misalignment of the amino acid numbering should not be outside the scope of the muteins of the present invention, using sequence alignment techniques that are conventional in the art.

In the present invention, the mutein is as defined in the first aspect of the invention.

In another preferred embodiment, the mutant organophosphorus degrading enzyme is shown in any one of SEQ ID No. 2-5.

MQTRRDALKSAAAITLLGGLAGCASMARPIGTGDLINTVRGPIPVSEAGFTLTHEHICGSSAGFLRAWPEFFGSRKALAEKAVRGLRHARSAGVQTIVDVSTFDIGRDVRLLAEVSRAADVHIVAATGLWFDPPLSMRTRSVEELTQFFLREIQHGIEDTGIRAGIIKVATTGKATPFQELVLKAAARASLATGVPVTTHTSASQRDGEQQAAIFESEGLSPSRVCIGHSDDTDDLSYLTGLAARGYLVGLDRMPYSAIGLEGNASALALFGTRSWQTRALLIKALIDRGYKDRILVSHDWLFGFSSYVTNIMDVMDRINPDGMAFVPLRVIPFLREKGVPPETLAGVTVANPARFLSPTVRAVVTRSETSRPAAPIPRQDTER(SEQ ID NO.:2)

MQTRRDALKSAAAITLLGGLAGCASMARPIGTGDLINTVRGPIPVSEAGFTLTHEHICGSSAGFLRAWPEFFGSRKALAEKAVRGLRHARSAGVQTIVDVSTFDIGRDVRLLAEVSRAADVHIVAATGLWFDPPLSMRMRSVEELTQFFLREIQHGIEDTGIRAGIIKVATTGKATPFQELVLKAAARASLATGVPVTTHTSASQRDGEQQAAIFESEGLSPSRVCIGRSDDTDDLSYLTGLAARGYLVGLDRMPYSAIGLEGNASALALFGTRSWQTRALLIKALIDRGYKDRILVSHDWLFGFSSYVTNIMDVMDRINPDGMAFVPLRVIPFLREKGVPPETLAGVTVANPARFLSPTVRAVVTRSETSRPAAPIPRQDTER(SEQ ID NO.:3)

MQTRRDALKSAAAITLLGGLAGCASMARPIGTGDLINTVRGPIPVSEAGFTLTHEHICGSSAGFLRAWPEFFGSRKALAEKAVRGLRHARSAGVQTIVDVSTFDIGRDVRLLAEVSRAADVHIVAATGLWFDPPLSMRMRSVEELTQFFLREIQHGIEDTGIRAGIIKVATTGKATPFQELVLKAAARASLATGVPVTTHTSASQRDGEQQAAIFESEGLSPSRVCIGHSDDTDDLSYLTGLAARGYLVGLDRMPYSADGLEGNASALALFGTRSWQTRALLIKALIDRGYKDRILVSHDWLFGFSSYVTNIMDVMDRINPDGMAFVPLRVIPFLREKGVPPETLAGVTVANPARFLSPTVRAVVTRSETSRPAAPIPRQDTER(SEQ ID NO.:4)

MQTRRDALKSAAAITLLGGLAGCASMARPIGTGDLINTVRGPIPVSEAGFTLTHEHICGSSAGFLRAWPEFFGSRKALAEKAVRGLRHARSAGVQTIVDVSTFDIGRDVRLLAEVSRAADVHIVAATGLWFDPPLSMRTRSVEELTQFFLREIQHGIEDTGIRAGIIKVATTGKATPFQELVLKAAARASLATGVPVTTHTSASQRDGEQQAAIFESEGLSPSRVCIGRSDDTDDLSYLTGLAARGYLVGLDRMPYSADGLEGNASALALFGTRSWQTRALLIKALIDRGYKDRILVSHDWLFGFSSYVTNIMDVMDRINPDGMAFVPLRVIPFLREKGVPPETLAGVTVANPARFLSPTVRAVVTRSETSRPAAPIPRQDTER(SEQ ID NO.:5)

It is understood that the muteins of the invention generally have a higher homology (identity) with the sequence shown in SEQ ID No. 1, preferably said muteins have a homology of at least 80%, preferably at least 85% to 90%, more preferably at least 95%, more preferably at least 98%, most preferably at least 99% with the sequence shown in SEQ ID No. 1.

The muteins of the present invention are synthetic or recombinant proteins, i.e., they may be chemically synthesized products or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants). Depending on the host used in the recombinant production protocol, the muteins of the invention may be glycosylated or may be non-glycosylated. The mutant proteins of the present invention may or may not also include an initial methionine residue.

The invention also includes fragments, derivatives and analogues of the muteins. As used herein, the terms "fragment," "derivative," and "analog" refer to a protein that retains substantially the same biological function or activity as the mutein.

The mutein fragment, derivative or analogue of the invention may be (i) a mutein wherein one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a mutein having a substituent group in one or more amino acid residues, or (iii) a mutein wherein the mature mutein is fused to another compound, such as a compound that extends the half-life of the mutein, e.g. polyethylene glycol, or (iv) a mutein wherein an additional amino acid sequence is fused to the mutein sequence, such as a leader or secretory sequence or a sequence used to purify the mutein or a proprotein sequence, or a fusion protein with an antigenic IgG fragment. Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the teachings herein. In the present invention, conservatively substituted amino acids are preferably generated by amino acid substitutions according to Table I.

TABLE I

In addition, the mutant protein can be modified. Modified (generally without altering primary structure) forms include: chemically derivatized forms of the mutein such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those resulting from glycosylation modifications during synthesis and processing of the mutein or during further processing steps. Such modification may be accomplished by exposing the mutein to an enzyme that performs glycosylation, such as mammalian glycosylase or deglycosylase. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are muteins which have been modified to increase their resistance to proteolysis or to optimize solubility.

Polynucleotide

The present invention also relates to polynucleotides encoding the mutant organophosphorus degrading enzymes of the present invention.

The term "polynucleotide encoding a mutein" may be a polynucleotide comprising a polynucleotide encoding a mutein of the invention, or may also comprise additional coding and/or non-coding sequences.

In a preferred embodiment of the invention, the polynucleotide is a polynucleotide encoding a polypeptide as shown in any one of SEQ ID No. 2-5.

(a) a polynucleotide having a sequence as set forth in SEQ ID No. 6;

ATGCAAACGAGAAGAGATGCACTTAAGTCTGCGGCCGCAATAACTCTGCTCGGCGGCTTGGCTGGGTGTGCAAGCATGGCCCGACCAATCGGTACAGGCGATCTGATTAATACTGTTCGCGGCCCCATTCCAGTTTCGGAAGCGGGCTTCACACTGACCCATGAGCATATCTGCGGCAGTTCGGCGGGATTCCTACGTGCGTGGCCGGAGTTTTTCGGTAGCCGCAAAGCTCTAGCGGAAAAGGCTGTGAGAGGATTACGCCATGCCAGATCGGCTGGCGTGCAAACCATCGTCGATGTGTCGACTTTCGATATCGGTCGTGACGTCCGTTTATTGGCCGAAGTTTCGCGGGCCGCCGACGTGCATATCGTGGCGGCGACTGGCTTATGGTTCGACCCGCCACTTTCAATGCGAACGCGCAGCGTCGAAGAACTGACCCAGTTCTTCCTGCGTGAAATCCAACATGGCATCGAAGACACCGGTATTAGGGCGGGCATTATCAAGGTCGCGACCACAGGGAAGGCGACCCCCTTTCAAGAGTTGGTGTTAAAGGCAGCCGCGCGGGCCAGCTTGGCCACCGGTGTTCCGGTAACCACTCACACGTCAGCAAGTCAGCGCGATGGCGAGCAGCAGGCAGCCATATTTGAATCCGAAGGTTTGAGCCCCTCACGGGTTTGTATCGGTCACAGCGATGATACTGACGATTTGAGCTACCTAACCGGCCTCGCTGCGCGCGGATACCTCGTCGGTTTAGATCGCATGCCGTACAGTGCGATTGGTCTAGAAGGCAATGCGAGTGCATTAGCGCTCTTTGGTACTCGGTCGTGGCAAACAAGGGCTCTCTTGATCAAGGCGCTCATCGACCGAGGCTACAAGGATCGAATCCTCGTCTCCCATGACTGGCTGTTCGGGTTTTCGAGCTATGTCACGAACATCATGGACGTAATGGATCGCATAAACCCAGATGGAATGGCCTTCGTCCCTCTGAGAGTGATCCCATTCCTACGAGAGAAGGGCGTCCCGCCGGAAACGCTAGCAGGCGTAACCGTGGCCAATCCCGCGCGGTTCTTGTCACCGACCGTGCGGGCCGTCGTGACACGATCTGAAACTTCCCGCCCTGCCGCGCCTATTCCCCGTCAAGATACCGAACGATGA(SEQ ID NO.:6)

The polynucleotide of the present invention may be in the form of DNA or RNA. In another preferred embodiment, the nucleotide is DNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence encoding the polypeptide set forth in any of SEQ ID No. 2-5 or a degenerate variant. As used herein, "degenerate variant" refers in the present invention to nucleic acid sequences which encode a polypeptide having the sequence set forth in any one of SEQ ID nos. 2-5, but with differences in the sequence of the corresponding coding region.

The invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of the polypeptides or muteins of the same amino acid sequence as the present invention. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the mutein it encodes.

The nucleic acid sequence may be DNA, RNA, cDNA or PNA. The nucleic acid sequence may be genomic, recombinant or synthetic. The nucleic acid sequence may be isolated or purified. The nucleic acid sequence may be single-stranded or double-stranded. Preferably, the nucleic acid sequence will encode a light sensitive protein as described herein. Nucleic acid sequences can be derived by Cloning, for example using standard Molecular Cloning techniques including restriction, ligation, gel electrophoresis, for example as described in Sambrook et al Molecular Cloning: A Laboratory manual, Cold Spring harbor Laboratory Press). The nucleic acid sequence may be isolated, for example, using PCR techniques. Isolation means the isolation of a nucleic acid sequence from any impurities and from other nucleic acid sequences and/or proteins that are naturally found in association with the nucleic acid sequence in its source. Preferably, it will also be free of cellular material, culture media, or other chemicals from the purification/production process. The nucleic acid sequence may be synthetic, for example produced by direct chemical synthesis. The nucleic acid sequence may be provided as naked nucleic acid or may be provided complexed with a protein or lipid.

The full-length nucleotide sequence of the polypeptide of the present invention or a fragment thereof can be obtained by PCR amplification, recombination, or artificial synthesis. For the PCR amplification method, primers can be designed based on the disclosed nucleotide sequences, particularly open reading frame sequences, and the sequences can be amplified using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art as a template. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. At present, DNA sequences encoding the polypeptides of the present invention (or fragments or derivatives thereof) have been obtained entirely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art.

The invention also relates to vectors comprising the polynucleotides of the invention, and to genetically engineered host cells with the vector or polypeptide coding sequences of the invention. The polynucleotide, vector or host cell may be isolated.

As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in the natural state in the living cell is not isolated or purified, but the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in the natural state.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

At present, DNA sequences encoding the proteins of the present invention (or fragments or derivatives thereof) have been obtained completely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. Furthermore, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

Methods for amplifying DNA/RNA using PCR techniques are preferably used to obtain the polynucleotides of the invention. Particularly, when it is difficult to obtain a full-length cDNA from a library, it is preferable to use the RACE method (RACE-cDNA terminal rapid amplification method), and primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

Vectors and host cells

The invention also provides a vector containing the mutant organophosphorus degrading enzyme gene and a host cell containing the vector.

In a preferred embodiment of the present invention, the vector has the ability to be expressed in Bacillus subtilis, more preferably in Bacillus subtilis 168.

The sequence of the mutant organophosphate degrading enzyme gene of the present invention can be obtained by conventional methods, such as total artificial synthesis or PCR synthesis, which can be used by those skilled in the art. The primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The polynucleotide sequences of the present invention may be used to express or produce a protein of interest by conventional recombinant DNA techniques, including the steps of:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding a protein of the invention, or with a recombinant expression vector comprising the polynucleotide;

(2) culturing the host cell in a suitable medium;

(3) separating and purifying protein from culture medium or cell.

Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a protein of the invention and appropriate transcription/translation control signals, preferably commercially available vectors: bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. Representative examples of such promoters are: lac or trp promoter of E.coli; PL promoter of lambda phage: eukaryotic promoters include CMV early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs of retrovirus, and other known promoters capable of controlling the expression of genes in prokaryotic or eukaryotic cells or viruses. Expression vectors also include ribosome binding sites for translation initiation and transcription terminators and enhance transcription in higher eukaryotes by inserting enhancer sequences into the vector. Enhancers are cis-acting elements of DNA expression, usually about 10-300bp, that act on a promoter to increase gene transcription. Such as an adenovirus enhancer. In addition, the expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells.

The invention also provides a recombinant vector, which comprises the DNA sequence of the mutant organophosphorus degrading enzyme gene. In a preferred embodiment, the promoter downstream of the recombinant vector comprises a multiple cloning site or at least one enzyme cleavage site. When the target gene needs to be expressed, the target gene is connected into a proper multiple cloning site or enzyme cutting site, so that the target gene and the promoter are operably connected.

The term "operably linked" means that the gene of interest to be expressed transcriptionally is linked to its control sequences in a manner conventional in the art to be expressed.

In another preferred embodiment, the recombinant vector comprises in the 5 'to 3' direction: a promoter, a gene of interest, and a terminator. If desired, the recombinant vector may further comprise the following elements: a protein purification tag; a 3' polyadenylation signal; an untranslated nucleic acid sequence; transport and targeting nucleic acid sequences; selection markers (antibiotic resistance genes, fluorescent proteins, etc.); an enhancer; or operator.

Methods for preparing recombinant vectors are well known to those of ordinary skill in the art. The expression vector may be a bacterial plasmid, a bacteriophage, a yeast plasmid, a plant cell virus, a mammalian cell virus, or other vector. In another preferred embodiment, the vector comprises an expression vector, a shuttle vector and an integration vector.

In a preferred embodiment, the expression vector of the organophosphorus degrading enzyme and its mutant may be pET, pCW, pUC, pPIC9k, pMA5, pHT01, pHY-P43, or other vectors. In general, any plasmid and vector may be used as long as it can replicate and is stable in the host.

One of ordinary skill in the art can construct vectors containing the promoter and/or gene sequence of interest of the present invention using well known methods. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like.

The expression vector of the present invention can be used to transform an appropriate host cell so that the host transcribes the target RNA or expresses the target protein. The host cell may be a prokaryotic cell, such as E.coli, C.glutamicum, Brevibacterium flavum, Streptomyces, Agrobacterium: or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells, preferably rape, tobacco, soybean; insect cells such as Drosophila S2 or Sf 9; animal cells such as CHO, COS or Bowes melanoma cells. In a preferred embodiment, the expression host may be E.coli, B.subtilis, Pichia pastoris, Streptomyces, or other host cells. It will be clear to one of ordinary skill in the art how to select an appropriate vector and host cell. Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryote (e.g., Escherichia coli), CaCl may be used₂The treatment can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods (e.g., microinjection, electroporation, liposome encapsulation, etc.). The method is carried out by growing or culturing the cells according to host cells by methods known to those skilled in the art. For example, the microbial cells are usually at a temperature of 0 to 100 ℃ and preferably 10 to 60 ℃ and oxygen. The culture medium contains carbon source such as glucose; nitrogen sources, usually in the form of organic nitrogen, such as yeast extract, amino acids; salt (salt)Such as ammonium sulfate, trace elements such as iron, magnesium salts; vitamins if desired. The pH of the medium can be kept at a fixed value during this period, that is, controlled or not during the cultivation. The culture may be carried out as a batch culture, a semi-discontinuous culture or a continuous culture. After culturing, the cells are collected, disrupted or used directly. The transformed plant may be transformed by methods such as Agrobacterium transformation or biolistic transformation, for example, leaf disc method, immature embryo transformation, flower bud soaking method, etc. The transformed plant cells, tissues or organs can be regenerated into plants by conventional methods to obtain transgenic plants.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the polynucleotide of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

The invention mainly has the following advantages:

1. the invention provides an organophosphorus degrading enzyme mutant derived from agrobacterium tumefaciens, which has obviously improved organophosphorus degrading activity and stronger organophosphorus degrading capability, the enzyme activity of the mutant is at least improved by more than 12-65 times compared with that of wild organophosphorus degrading enzyme, the shake flask level is up to 16.26U/mL, and the degradation rate of standard organophosphorus substrates is up to more than 95%.

2. According to the invention, a large number of promoters, vectors and culture media are screened, and a bacillus subtilis expression system very suitable for expressing the organophosphorus degrading enzyme mutant is obtained. After the expression system is fermented for 24 hours, the enzyme activity of the organophosphorus degrading enzyme mutant reaches 42.16U/mL, the fermentation period is short, the expression system is not in an inclusion body form, and the organophosphorus degrading enzyme mutant does not need to be subjected to denaturation and renaturation treatment and is easy to separate and purify subsequently.

3. The method for preparing the organophosphorus degrading enzyme mutant is simple, short in fermentation period, high in production efficiency, low in cost and very suitable for large-scale industrial preparation, and the enzyme activity of fermentation reaches 42.16U/mL every day.

4. According to the invention, bacillus subtilis is selected as a fermentation strain, and the bacillus subtilis is a food-grade microorganism, so that the bacillus subtilis is safer.

The invention is further illustrated with reference to specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.

Experimental materials and methods

1. Experimental Material

TB culture medium: yeast extract 2.4%, tryptone 1.2%, glycerol 0.4%, K₂HPO₄ 72mM，KH₂PO₄17mM。

TB modified medium: angel yeast powder 2.4%, wheat hydrolyzed protein powder 1.2%, and the rest components are TB.

Wheat hydrolyzed protein culture medium: 1.3 percent of wheat hydrolyzed protein powder, 0.5 percent of Angel yeast powder and 1 percent of sodium chloride.

The plasmids used or constructed in the present invention are as follows:

the primers and sequencing services used in the present invention were manufactured by Shanghai Biotechnology engineering (Shanghai) Inc., as follows:

2. experimental methods

2.1 construction and transformation of recombinant expression vector of organophosphatase

2.1.1 organophosphatase Gene Synthesis:

the opdA gene sequence (GenBank: AY043245.2) derived from Agrobacterium tumefaciens (Agrobacterium tumefaciens) was obtained from the NCBI database, and the nucleotide sequences encoding the wild-type OpdA enzyme and mutants 1 to 3 were synthesized in their entirety based on the amino acid sequence of the mutants.

2.1.2 extraction of plasmid DNA:

fresh single E.coli colonies containing the recombinant plasmid pET-28a-opdA were inoculated into LB liquid medium containing 100. mu.g/mL Amp, cultured overnight at 37 ℃ and 200rpm, and after collecting the cells, the cells were extracted according to the instructions of the plasmid extraction kit (Axygen)

2.1.3 amplification of target fragment:

reaction system (50 μ L): PrimeSTAR Max 25. mu.L; 1 mu L of each primer; 0.5-1 μ L of template; sterile water make up to 50 μ L.

2.1.4 target fragment and vector gel recovery and purification: refer to Axygen corresponding kit instructions for operation.

2.1.5 ligation of target fragment to vector:

ligation reaction (10 μ L): 1 μ L of T4DNA ligase; 10 × Buffer 1 μ L; carrier: fragment ≈ 1:3 (molar ratio). Ligation was performed overnight at 16 ℃ and blunt-ended for 20-24 h.

Transformation of coli competent cells: refer to Takara transformation instructions for operation.

2.1.7 colony PCR:

preparing a reaction system (without adding a template) by adopting Taq premixed enzyme of Takara according to a ratio, subpackaging the reaction system into PCR tubes with 10 mu L of each tube, dipping different single bacterial colonies into the reaction system by using sterile toothpicks, and carrying out amplification reaction. The reaction is carried out. The reaction conditions are as follows: 94 ℃ for 2 min; 30s at 94 ℃; 30s at 55 ℃; 30-35 cycles of 72 ℃ for 1.2 min; 10min at 72 ℃. Negative and positive controls must be set for each set of experiments.

Preparation and transformation of subtilis competent cells: the recombinant bacillus subtilis is obtained by adopting a chemical transformation method, which comprises the following steps:

(1) picking a single colony to 2mL of SPI culture medium, and culturing at 37 ℃ and 200rpm overnight;

(2) transferring 100 μ L of culture solution into 5mL of SPI culture medium, culturing at 37 deg.C and 200rpm for 4-5h to late stage of logarithmic growth;

(3) adding 200 μ L culture solution into 2mL SPII culture medium, culturing at 37 deg.C and 200rpm for 1.5 h;

(4) adding 20 μ L10 mM EGTA into the culture solution, culturing at 37 deg.C and 150rpm for 10 min;

(5) the culture solution is subpackaged at 500 μ L per tube, 8-10 μ L plasmid is added, cultured at 37 deg.C and 150rpm for 1-1.5h, the bacterial solution is uniformly spread on a plate with corresponding resistance, and cultured in a constant temperature incubator at 37 deg.C.

2.1.9 construction and transformation of recombinant expression vector of organophosphorus degrading enzyme

(1) Construction and transformation of pMA5-opdA expression vector:

plasmid pET28a-opdA is used as a template, MA-F and MA-R are used as primers, NdeI and BamHI enzyme cutting sites are introduced, a target fragment opdA is obtained by referring to a 2.1.3 amplification system and program amplification, the recovered opdA fragment and pMA5 empty vector are subjected to double enzyme cutting at the same time, purification and connection are carried out, a product is transformed into E.coli DH5 alpha competent cells, and a positive clone is selected by colony PCR for enzyme cutting identification and sequencing verification.

Transforming B.subtilis168 competent cells by the obtained vector according to step 2.1.8, coating a plate added with corresponding antibiotics, culturing overnight at 37 ℃, selecting a single colony on the next day for further colony PCR verification to obtain the bacillus subtilis engineering bacteria which are respectively named as B.subtilis168/pMA 5-opdA.

(2) Construction and transformation of pHY-P43-opdA expression vector:

using HY-F and HY-R as primers, and introducing BamHI and EcoRI cleavage sites, the rest is the same as (1). The resulting recombinant strain was named B.subtilis 168/pHY-P43-opdA.

(3) Construction and transformation of pHT01-opdA expression vector:

using HT-F and HT-R as primers, BamHI and SmaI cleavage sites were introduced, and the recombinant strain obtained was named B.subtilis 168/pHT01-opdA, as in (1).

2.2 culture method

2.2.1 Strain activation: the glycerol tube strain which is environment-friendly and stored in an ultra-low temperature refrigerator is taken by using an inoculation environment, streaked on a fresh LB solid plate and cultured overnight at 37 ℃.

2.2.2 seed culture: a fresh loop of the colony was inoculated into LB liquid medium, incubated overnight at 37 ℃ and 200rpm (about 15 hours), and the liquid content was 50mL/250 mL.

2.2.3 shake flask fermentation culture: inoculating to fermentation medium at 2%, fermenting at 37 deg.C and 200rpm for 72 hr, and keeping the liquid content as above.

2.2.450L fermenter culture: preparing seed solution, inoculating to 50L fermentation tank with 10% inoculum size, loading liquid amount of 15L/50L, fermenting at 37 deg.C, ventilating amount of 1.0vvm, stirring at 300rpm, and adding glucose according to pH variation during fermentation.

2.3 Experimental analysis methods

2.3.1 method for measuring Dry weight of cell

Taking 1.0mL of fermentation liquor in a 1.5mL centrifuge tube, centrifuging at 500rpm for 30s to precipitate hydrolyzed wheat protein powder in the fermentation liquor, sucking supernatant into a new centrifuge tube, centrifuging at 12000rpm for 1min, placing thalli in a 105 ℃ oven, drying to constant weight, weighing and calculating the dry weight (DCW) of thalli cells, and taking the average value of three weighing results as the final dry weight of the thalli cells, wherein the unit is g/L.

2.3.2 determination of Activity of organophosphorus degrading enzyme

Organophosphorus degrading enzyme biopsy assay: taking 100 mu L of enzyme solution to be detected, adding 5 mu L of 10mg/mL methylParathion and 900. mu.L 50mM Tris-HCl (pH9.0) buffer system, react for 10min at 37 ℃, 1mL 10% trichloroacetic acid is immediately added to stop the reaction, and 1mL Na is added₂CO₃Color development of the solution and determination of OD₄₀₅And calculating the concentration of the p-nitrophenol generated by hydrolysis and the activity of the OpdA enzyme through a p-nitrophenol standard curve.

Definition of the OpdA enzyme activity units: the amount of enzyme required for the organophosphorus degrading enzyme to hydrolyze a substrate (methyl parathion) to 1. mu. mol of p-nitrophenol per minute at pH9.0 and 37 ℃ is defined as one enzyme activity unit (U).

Example 1 determination of enzyme Activity of mutants 1-3 of OpdA

The specific mutations of the wild type, mutant 1, mutant 2 and mutant 3 of the organophosphate degrading enzyme OpdA are shown in table 1. Wherein, the 139 th methionine (M) of the mutant 1 is mutated into threonine (T); mutant 2 has a 229 th histidine (H) mutated to arginine (R); isoleucine (I) at position 259 of mutant 3 was mutated to aspartic acid (D).

Nucleotide sequences encoding wild-type OpdA enzyme and mutant 1-3 are respectively synthesized according to the amino acid sequences of the wild-type OpdA and the mutant 1-3, the fragments are respectively connected to a vector pMA5, a recombinant vector is constructed and then transformed into a B.subtilis168 host to obtain the corresponding engineering strain. Respectively activating wild type strains and mutant strains on a flat plate, preparing seed liquid, transferring 2 percent of inoculum concentration to a TB fermentation medium, fermenting for 72 hours, sampling every 12 hours, centrifuging, and taking fermentation supernatant to detect the enzyme activity of the OpdA according to a 2.3.2 experimental method.

TABLE 1 location and Change of mutated amino acids

Organophosphorus degrading enzymes	Mutations	SEQ ID NO.:
			Wild type	-	1
Mutant 1	M139T	2
			Mutant 2	H229R	3
Mutant 3	I259D	4

As a result, at the shake flask level, when TB is used as a fermentation medium, the enzyme activity of the wild type OpdA is only 0.28U/mL, and the enzyme activities of the mutant 2 and the mutant 3 are respectively 3.15U/mL and 4.08U/mL. The enzyme activity of the mutant 1 is 16.26U/mL, and is obviously improved compared with the wild type, the mutant 1 and the mutant 2. Thus, mutant 1(M139T) was selected for subsequent studies.

Example 2 comparison of OpdA production by three B.subtilis expression vectors

The effect of three expression vectors, pMA5, pHY-p43 and pHT01, on enzyme production was compared using B.subtilis168 as the host for expression of the OpdA. The pMA5 and pHY-P43 vectors contain strong constitutive promoters HpaII and P43 respectively, and the vector pHT01 contains an inducible promoter Pgrac, and the expression is induced by an inducer IPTG at low temperature (28 ℃).

The constructed recombinant vectors pHY-p43-opdA and pHT01-opdA are respectively transformed into freshly prepared B.subtilis168 competent cells, and LB plates with corresponding resistance are coated. Recombinant strains B.subtilis 168/pHY-p43-opdA and B.subtilis 168/pHT01-opdA are obtained through colony PCR verification. Fermenting three recombinant strains again, wherein B.sub.tAfter the ilis 168/pHT01-opdA is inoculated with a fermentation medium, the mixture is cultured for 3-4 h at 37 ℃ until the OD is reached₆₀₀Approximatively equals 1.0, 0.1mM IPTG was added, induction was carried out at 28 ℃ for 48h, and the organophosphorus degrading enzyme activity was 6.56U/mL. In the same time of fermentation, the activity of B.subtilis 168/pHY-p43-opdA enzyme is almost 0, and the activity of B.subtilis168/pMA5-opdA is 15.93U/mL (see Table 2), which is 2.43 times of the activity of B.subtilis 168/pHT01-opdA enzyme. From the above results, compared with the other two expression vectors, pMA5 is more suitable for expression of opdA gene, and the enzyme activity is significantly higher than that of other expression vectors.

Effect of different expression vectors in subtilis on the expression level of OpdA

EXAMPLE 3 comparison of enzyme production in three different fermentation media

This example compares the effect of three different media on B.subtilis168/pMA5-opdA enzyme production.

As can be seen from FIG. 1, when TB is taken as a fermentation medium, the activity of the recombinant OpdA enzyme increases with the increase of the fermentation time within 0-56h, and reaches a maximum value of 16.01U/mL at 56 h; the enzyme production trend of the improved TB culture medium is the same as that of TB, and the enzyme activity is the maximum at 56h and is 17.36U/mL; the wheat hydrolyzed protein culture medium has low enzyme production level, and the enzyme activity reaches the maximum value of 7.86U/mL when fermented for 24 hours. Therefore, compared with the other two culture mediums, the modified TB culture medium is more suitable for the fermentation and enzyme production of the engineering bacteria.

The modified TB culture medium was sampled from the fermentation supernatant at different times for detection of protein glue, and the results are shown in FIG. 2, and E.coli BL21(DE3)/pET28a-opdA cell-breaking supernatant was used as a positive control. The organophosphorus degrading enzyme OpdA has the brightest band at about 48h, and is basically consistent with the enzyme activity result.

Example 4B enzyme production experiment of subtilis168/pMA5-opdA Strain in 50L fermentor

Based on the culture medium composition and raw material cost optimized by the shake flask fermentation, an enzyme production experiment is carried out on a 50L fermentation tank by using improved TB, and the liquid loading capacity of the fermentation tank culture medium is 15L.

Activated B.subtilis168/pMA5-opdA single colonies were inoculated into fresh LB medium and cultured overnight at 37 ℃ at 200rpm to obtain a seed culture solution. The inoculated amount was 10% and the mixture was fermented at 37 ℃ and 300rpm with an aeration rate of 1.0vvm, and glucose was fed according to the change in pH.

The result is shown in figure 3, the OpdA enzyme activity is 52.51U/mL when the fermentation is carried out for 24h, the time for the enzyme activity to reach the maximum value is 32h earlier than that of the shake flask, and the fermentation period is greatly shortened.

Example 5 purification of recombinant organophosphorus degrading enzyme OpdA

To obtain higher purity OpdA, the fermentation broth was salted out with ammonium sulfate in this example. Centrifuging the fermentation liquid at 4 deg.C and 8000rpm for 5min, collecting a certain amount of supernatant, precipitating with 30%, 40%, 50% and 60% saturated ammonium sulfate at 4 deg.C overnight, dialyzing the treated precipitate in Tris-HCl buffer (50mM, pH9.0), desalting, changing buffer solution every 4 hr, and detecting the sample by SDS-PAGE electrophoresis after dialysis. After the fermentation liquor is subjected to ammonium sulfate precipitation treatment with the saturation of 50%, the supernatant of the fermentation liquor has the best precipitation effect, the precipitation rate of target protein is the highest, and the removal rate of impurity protein is relatively low, so that the saturation is selected to carry out salting-out treatment on the fermentation liquor.

Example 6 degradation experiment of recombinant organophosphorus degrading enzyme OpdA on methyl parathion and other pesticides

In order to examine the degradation effect of the organophosphorus degrading enzyme (mutant 1) on organophosphorus pesticides, the Shanghai Qing was taken as an experimental object in the study, and the Shanghai Qing was soaked with parathion, methyl parathion, dichlorvos, chlorpyrifos and trichlorfon respectively. The specific operation is as follows: several equal parts of shanghai green (200g) without pesticide are immersed in the organophosphorus pesticide solution with the same concentration for 2s, and the shanghai green is taken out and naturally dried in a fume hood until the surface of the shanghai green has no solution, so that the shanghai green can contain the organophosphorus pesticide with the same amount as much as possible. The medicinal materials soaked in the Shanghai Qing are respectively soaked and cleaned by organophosphorus degrading enzyme, the Shanghai Qing before cleaning and after 10min is soaked in acetonitrile solution for 60s after drying, the concentration of organophosphorus pesticide in acetonitrile is detected by gas chromatography (the chromatographic condition refers to the agricultural industry standard NY/T761-2008 of the people's republic of China), the degrading rate of the enzyme is calculated, and the result is shown in Table 3.

TABLE 3 degradation experiments of recombinant OpdA on organophosphorus pesticides of different toxicity

Example 7

The OpdA mutants 4-6 are amino acid mutations at 2 mutation sites. The mutation of the OpdA mutant 4 was M139T and H229R. Mutations of the OpdA mutant 5 were M139T and I259D. Mutations in the OpdA mutant 6 were H229R and I259D.

The amino acid sequence of the OpdA mutant 7 is shown in SEQ ID No. 5, and the mutations of the OpdA mutant 7 include M139T, H229R and I259D.

The enzyme activity of the above-described OpdA mutants 4-7 was determined in the same manner as in example 1. The results show that the enzyme activity of the OpdA mutants 4-6 (with 2 site mutations) is higher than that of the mutants 1-3 (single site mutations). The enzyme activity of the OpdA mutant 7 (with 3 site mutations) is significantly higher than that of the OpdA mutants 1-3 and 4-6, the OpdA mutant has stronger organophosphorus degradation capability, and the degradation rate of standard organophosphorus substrates is over 95%.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Si Yi technology (Shanghai) Ltd

<120> mutant of organophosphorus degrading enzyme and application thereof

<130> P2018-1497

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 384

<212> PRT

<213> Agrobacterium tumefaciens (Agrobacterium tumefaciens)

<400> 1

Met Gln Thr Arg Arg Asp Ala Leu Lys Ser Ala Ala Ala Ile Thr Leu

1 5 10 15

Leu Gly Gly Leu Ala Gly Cys Ala Ser Met Ala Arg Pro Ile Gly Thr

20 25 30

Gly Asp Leu Ile Asn Thr Val Arg Gly Pro Ile Pro Val Ser Glu Ala

35 40 45

Gly Phe Thr Leu Thr His Glu His Ile Cys Gly Ser Ser Ala Gly Phe

50 55 60

Leu Arg Ala Trp Pro Glu Phe Phe Gly Ser Arg Lys Ala Leu Ala Glu

65 70 75 80

Lys Ala Val Arg Gly Leu Arg His Ala Arg Ser Ala Gly Val Gln Thr

85 90 95

Ile Val Asp Val Ser Thr Phe Asp Ile Gly Arg Asp Val Arg Leu Leu

100 105 110

Ala Glu Val Ser Arg Ala Ala Asp Val His Ile Val Ala Ala Thr Gly

115 120 125

Leu Trp Phe Asp Pro Pro Leu Ser Met Arg Met Arg Ser Val Glu Glu

130 135 140

Leu Thr Gln Phe Phe Leu Arg Glu Ile Gln His Gly Ile Glu Asp Thr

145 150 155 160

Gly Ile Arg Ala Gly Ile Ile Lys Val Ala Thr Thr Gly Lys Ala Thr

165 170 175

Pro Phe Gln Glu Leu Val Leu Lys Ala Ala Ala Arg Ala Ser Leu Ala

180 185 190

Thr Gly Val Pro Val Thr Thr His Thr Ser Ala Ser Gln Arg Asp Gly

195 200 205

Glu Gln Gln Ala Ala Ile Phe Glu Ser Glu Gly Leu Ser Pro Ser Arg

210 215 220

Val Cys Ile Gly His Ser Asp Asp Thr Asp Asp Leu Ser Tyr Leu Thr

225 230 235 240

Gly Leu Ala Ala Arg Gly Tyr Leu Val Gly Leu Asp Arg Met Pro Tyr

245 250 255

Ser Ala Ile Gly Leu Glu Gly Asn Ala Ser Ala Leu Ala Leu Phe Gly

260 265 270

Thr Arg Ser Trp Gln Thr Arg Ala Leu Leu Ile Lys Ala Leu Ile Asp

275 280 285

Arg Gly Tyr Lys Asp Arg Ile Leu Val Ser His Asp Trp Leu Phe Gly

290 295 300

Phe Ser Ser Tyr Val Thr Asn Ile Met Asp Val Met Asp Arg Ile Asn

305 310 315 320

Pro Asp Gly Met Ala Phe Val Pro Leu Arg Val Ile Pro Phe Leu Arg

325 330 335

Glu Lys Gly Val Pro Pro Glu Thr Leu Ala Gly Val Thr Val Ala Asn

340 345 350

Pro Ala Arg Phe Leu Ser Pro Thr Val Arg Ala Val Val Thr Arg Ser

355 360 365

Glu Thr Ser Arg Pro Ala Ala Pro Ile Pro Arg Gln Asp Thr Glu Arg

370 375 380

<210> 2

<211> 384

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 2

Met Gln Thr Arg Arg Asp Ala Leu Lys Ser Ala Ala Ala Ile Thr Leu

1 5 10 15

Leu Gly Gly Leu Ala Gly Cys Ala Ser Met Ala Arg Pro Ile Gly Thr

20 25 30

Gly Asp Leu Ile Asn Thr Val Arg Gly Pro Ile Pro Val Ser Glu Ala

35 40 45

Gly Phe Thr Leu Thr His Glu His Ile Cys Gly Ser Ser Ala Gly Phe

50 55 60

Leu Arg Ala Trp Pro Glu Phe Phe Gly Ser Arg Lys Ala Leu Ala Glu

65 70 75 80

Lys Ala Val Arg Gly Leu Arg His Ala Arg Ser Ala Gly Val Gln Thr

85 90 95

Ile Val Asp Val Ser Thr Phe Asp Ile Gly Arg Asp Val Arg Leu Leu

100 105 110

Ala Glu Val Ser Arg Ala Ala Asp Val His Ile Val Ala Ala Thr Gly

115 120 125

Leu Trp Phe Asp Pro Pro Leu Ser Met Arg Thr Arg Ser Val Glu Glu

130 135 140

Leu Thr Gln Phe Phe Leu Arg Glu Ile Gln His Gly Ile Glu Asp Thr

145 150 155 160

Gly Ile Arg Ala Gly Ile Ile Lys Val Ala Thr Thr Gly Lys Ala Thr

165 170 175

Pro Phe Gln Glu Leu Val Leu Lys Ala Ala Ala Arg Ala Ser Leu Ala

180 185 190

Thr Gly Val Pro Val Thr Thr His Thr Ser Ala Ser Gln Arg Asp Gly

195 200 205

Glu Gln Gln Ala Ala Ile Phe Glu Ser Glu Gly Leu Ser Pro Ser Arg

210 215 220

Val Cys Ile Gly His Ser Asp Asp Thr Asp Asp Leu Ser Tyr Leu Thr

225 230 235 240

Gly Leu Ala Ala Arg Gly Tyr Leu Val Gly Leu Asp Arg Met Pro Tyr

245 250 255

Ser Ala Ile Gly Leu Glu Gly Asn Ala Ser Ala Leu Ala Leu Phe Gly

260 265 270

Thr Arg Ser Trp Gln Thr Arg Ala Leu Leu Ile Lys Ala Leu Ile Asp

275 280 285

Arg Gly Tyr Lys Asp Arg Ile Leu Val Ser His Asp Trp Leu Phe Gly

290 295 300

Phe Ser Ser Tyr Val Thr Asn Ile Met Asp Val Met Asp Arg Ile Asn

305 310 315 320

Pro Asp Gly Met Ala Phe Val Pro Leu Arg Val Ile Pro Phe Leu Arg

325 330 335

Glu Lys Gly Val Pro Pro Glu Thr Leu Ala Gly Val Thr Val Ala Asn

340 345 350

Pro Ala Arg Phe Leu Ser Pro Thr Val Arg Ala Val Val Thr Arg Ser

355 360 365

Glu Thr Ser Arg Pro Ala Ala Pro Ile Pro Arg Gln Asp Thr Glu Arg

370 375 380

<210> 3

<211> 384

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 3

Met Gln Thr Arg Arg Asp Ala Leu Lys Ser Ala Ala Ala Ile Thr Leu

1 5 10 15

Leu Gly Gly Leu Ala Gly Cys Ala Ser Met Ala Arg Pro Ile Gly Thr

20 25 30

Gly Asp Leu Ile Asn Thr Val Arg Gly Pro Ile Pro Val Ser Glu Ala

35 40 45

Gly Phe Thr Leu Thr His Glu His Ile Cys Gly Ser Ser Ala Gly Phe

50 55 60

Leu Arg Ala Trp Pro Glu Phe Phe Gly Ser Arg Lys Ala Leu Ala Glu

65 70 75 80

Lys Ala Val Arg Gly Leu Arg His Ala Arg Ser Ala Gly Val Gln Thr

85 90 95

Ile Val Asp Val Ser Thr Phe Asp Ile Gly Arg Asp Val Arg Leu Leu

100 105 110

Ala Glu Val Ser Arg Ala Ala Asp Val His Ile Val Ala Ala Thr Gly

115 120 125

Leu Trp Phe Asp Pro Pro Leu Ser Met Arg Met Arg Ser Val Glu Glu

130 135 140

Leu Thr Gln Phe Phe Leu Arg Glu Ile Gln His Gly Ile Glu Asp Thr

145 150 155 160

Gly Ile Arg Ala Gly Ile Ile Lys Val Ala Thr Thr Gly Lys Ala Thr

165 170 175

Pro Phe Gln Glu Leu Val Leu Lys Ala Ala Ala Arg Ala Ser Leu Ala

180 185 190

Thr Gly Val Pro Val Thr Thr His Thr Ser Ala Ser Gln Arg Asp Gly

195 200 205

Glu Gln Gln Ala Ala Ile Phe Glu Ser Glu Gly Leu Ser Pro Ser Arg

210 215 220

Val Cys Ile Gly Arg Ser Asp Asp Thr Asp Asp Leu Ser Tyr Leu Thr

225 230 235 240

Gly Leu Ala Ala Arg Gly Tyr Leu Val Gly Leu Asp Arg Met Pro Tyr

245 250 255

Ser Ala Ile Gly Leu Glu Gly Asn Ala Ser Ala Leu Ala Leu Phe Gly

260 265 270

Thr Arg Ser Trp Gln Thr Arg Ala Leu Leu Ile Lys Ala Leu Ile Asp

275 280 285

Arg Gly Tyr Lys Asp Arg Ile Leu Val Ser His Asp Trp Leu Phe Gly

290 295 300

Phe Ser Ser Tyr Val Thr Asn Ile Met Asp Val Met Asp Arg Ile Asn

305 310 315 320

Pro Asp Gly Met Ala Phe Val Pro Leu Arg Val Ile Pro Phe Leu Arg

325 330 335

Glu Lys Gly Val Pro Pro Glu Thr Leu Ala Gly Val Thr Val Ala Asn

340 345 350

Pro Ala Arg Phe Leu Ser Pro Thr Val Arg Ala Val Val Thr Arg Ser

355 360 365

Glu Thr Ser Arg Pro Ala Ala Pro Ile Pro Arg Gln Asp Thr Glu Arg

370 375 380

<210> 4

<211> 384

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 4

Met Gln Thr Arg Arg Asp Ala Leu Lys Ser Ala Ala Ala Ile Thr Leu

1 5 10 15

Leu Gly Gly Leu Ala Gly Cys Ala Ser Met Ala Arg Pro Ile Gly Thr

20 25 30

Gly Asp Leu Ile Asn Thr Val Arg Gly Pro Ile Pro Val Ser Glu Ala

35 40 45

Gly Phe Thr Leu Thr His Glu His Ile Cys Gly Ser Ser Ala Gly Phe

50 55 60

Leu Arg Ala Trp Pro Glu Phe Phe Gly Ser Arg Lys Ala Leu Ala Glu

65 70 75 80

Lys Ala Val Arg Gly Leu Arg His Ala Arg Ser Ala Gly Val Gln Thr

85 90 95

Ile Val Asp Val Ser Thr Phe Asp Ile Gly Arg Asp Val Arg Leu Leu

100 105 110

Ala Glu Val Ser Arg Ala Ala Asp Val His Ile Val Ala Ala Thr Gly

115 120 125

Leu Trp Phe Asp Pro Pro Leu Ser Met Arg Met Arg Ser Val Glu Glu

130 135 140

Leu Thr Gln Phe Phe Leu Arg Glu Ile Gln His Gly Ile Glu Asp Thr

145 150 155 160

Gly Ile Arg Ala Gly Ile Ile Lys Val Ala Thr Thr Gly Lys Ala Thr

165 170 175

Pro Phe Gln Glu Leu Val Leu Lys Ala Ala Ala Arg Ala Ser Leu Ala

180 185 190

Thr Gly Val Pro Val Thr Thr His Thr Ser Ala Ser Gln Arg Asp Gly

195 200 205

Glu Gln Gln Ala Ala Ile Phe Glu Ser Glu Gly Leu Ser Pro Ser Arg

210 215 220

Val Cys Ile Gly His Ser Asp Asp Thr Asp Asp Leu Ser Tyr Leu Thr

225 230 235 240

Gly Leu Ala Ala Arg Gly Tyr Leu Val Gly Leu Asp Arg Met Pro Tyr

245 250 255

Ser Ala Asp Gly Leu Glu Gly Asn Ala Ser Ala Leu Ala Leu Phe Gly

260 265 270

Thr Arg Ser Trp Gln Thr Arg Ala Leu Leu Ile Lys Ala Leu Ile Asp

275 280 285

Arg Gly Tyr Lys Asp Arg Ile Leu Val Ser His Asp Trp Leu Phe Gly

290 295 300

Phe Ser Ser Tyr Val Thr Asn Ile Met Asp Val Met Asp Arg Ile Asn

305 310 315 320

Pro Asp Gly Met Ala Phe Val Pro Leu Arg Val Ile Pro Phe Leu Arg

325 330 335

Glu Lys Gly Val Pro Pro Glu Thr Leu Ala Gly Val Thr Val Ala Asn

340 345 350

Pro Ala Arg Phe Leu Ser Pro Thr Val Arg Ala Val Val Thr Arg Ser

355 360 365

Glu Thr Ser Arg Pro Ala Ala Pro Ile Pro Arg Gln Asp Thr Glu Arg

370 375 380

<210> 5

<211> 384

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 5

Met Gln Thr Arg Arg Asp Ala Leu Lys Ser Ala Ala Ala Ile Thr Leu

1 5 10 15

Leu Gly Gly Leu Ala Gly Cys Ala Ser Met Ala Arg Pro Ile Gly Thr

20 25 30

Gly Asp Leu Ile Asn Thr Val Arg Gly Pro Ile Pro Val Ser Glu Ala

35 40 45

Gly Phe Thr Leu Thr His Glu His Ile Cys Gly Ser Ser Ala Gly Phe

50 55 60

Leu Arg Ala Trp Pro Glu Phe Phe Gly Ser Arg Lys Ala Leu Ala Glu

65 70 75 80

Lys Ala Val Arg Gly Leu Arg His Ala Arg Ser Ala Gly Val Gln Thr

85 90 95

Ile Val Asp Val Ser Thr Phe Asp Ile Gly Arg Asp Val Arg Leu Leu

100 105 110

Ala Glu Val Ser Arg Ala Ala Asp Val His Ile Val Ala Ala Thr Gly

115 120 125

Leu Trp Phe Asp Pro Pro Leu Ser Met Arg Thr Arg Ser Val Glu Glu

130 135 140

Leu Thr Gln Phe Phe Leu Arg Glu Ile Gln His Gly Ile Glu Asp Thr

145 150 155 160

Gly Ile Arg Ala Gly Ile Ile Lys Val Ala Thr Thr Gly Lys Ala Thr

165 170 175

Pro Phe Gln Glu Leu Val Leu Lys Ala Ala Ala Arg Ala Ser Leu Ala

180 185 190

Thr Gly Val Pro Val Thr Thr His Thr Ser Ala Ser Gln Arg Asp Gly

195 200 205

Glu Gln Gln Ala Ala Ile Phe Glu Ser Glu Gly Leu Ser Pro Ser Arg

210 215 220

Val Cys Ile Gly Arg Ser Asp Asp Thr Asp Asp Leu Ser Tyr Leu Thr

225 230 235 240

Gly Leu Ala Ala Arg Gly Tyr Leu Val Gly Leu Asp Arg Met Pro Tyr

245 250 255

Ser Ala Asp Gly Leu Glu Gly Asn Ala Ser Ala Leu Ala Leu Phe Gly

260 265 270

Thr Arg Ser Trp Gln Thr Arg Ala Leu Leu Ile Lys Ala Leu Ile Asp

275 280 285

Arg Gly Tyr Lys Asp Arg Ile Leu Val Ser His Asp Trp Leu Phe Gly

290 295 300

Phe Ser Ser Tyr Val Thr Asn Ile Met Asp Val Met Asp Arg Ile Asn

305 310 315 320

Pro Asp Gly Met Ala Phe Val Pro Leu Arg Val Ile Pro Phe Leu Arg

325 330 335

Glu Lys Gly Val Pro Pro Glu Thr Leu Ala Gly Val Thr Val Ala Asn

340 345 350

Pro Ala Arg Phe Leu Ser Pro Thr Val Arg Ala Val Val Thr Arg Ser

355 360 365

Glu Thr Ser Arg Pro Ala Ala Pro Ile Pro Arg Gln Asp Thr Glu Arg

370 375 380

<210> 6

<211> 1155

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

atgcaaacga gaagagatgc acttaagtct gcggccgcaa taactctgct cggcggcttg 60

gctgggtgtg caagcatggc ccgaccaatc ggtacaggcg atctgattaa tactgttcgc 120

ggccccattc cagtttcgga agcgggcttc acactgaccc atgagcatat ctgcggcagt 180

tcggcgggat tcctacgtgc gtggccggag tttttcggta gccgcaaagc tctagcggaa 240

aaggctgtga gaggattacg ccatgccaga tcggctggcg tgcaaaccat cgtcgatgtg 300

tcgactttcg atatcggtcg tgacgtccgt ttattggccg aagtttcgcg ggccgccgac 360

gtgcatatcg tggcggcgac tggcttatgg ttcgacccgc cactttcaat gcgaacgcgc 420

agcgtcgaag aactgaccca gttcttcctg cgtgaaatcc aacatggcat cgaagacacc 480

ggtattaggg cgggcattat caaggtcgcg accacaggga aggcgacccc ctttcaagag 540

ttggtgttaa aggcagccgc gcgggccagc ttggccaccg gtgttccggt aaccactcac 600

acgtcagcaa gtcagcgcga tggcgagcag caggcagcca tatttgaatc cgaaggtttg 660

agcccctcac gggtttgtat cggtcacagc gatgatactg acgatttgag ctacctaacc 720

ggcctcgctg cgcgcggata cctcgtcggt ttagatcgca tgccgtacag tgcgattggt 780

ctagaaggca atgcgagtgc attagcgctc tttggtactc ggtcgtggca aacaagggct 840

ctcttgatca aggcgctcat cgaccgaggc tacaaggatc gaatcctcgt ctcccatgac 900

tggctgttcg ggttttcgag ctatgtcacg aacatcatgg acgtaatgga tcgcataaac 960

ccagatggaa tggccttcgt ccctctgaga gtgatcccat tcctacgaga gaagggcgtc 1020

ccgccggaaa cgctagcagg cgtaaccgtg gccaatcccg cgcggttctt gtcaccgacc 1080

gtgcgggccg tcgtgacacg atctgaaact tcccgccctg ccgcgcctat tccccgtcaa 1140

gataccgaac gatga 1155

<210> 7

<211> 32

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

ggaattccat atgcaaacga gaagagatgc ac 32

<210> 8

<211> 28

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

cgggatcctc atcgttcggt atcttgac 28

<210> 9

<211> 30

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

cgggatccat gcaaacgaga agagatgcac 30

<210> 10

<211> 29

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

tcccccgggt catcgttcgg tatcttgac 29

<210> 11

<211> 28

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 11

cggaattctc atcgttcggt atcttgac 28

Claims

1. A mutant organophosphorus degrading enzyme, wherein said mutant organophosphorus degrading enzyme has the following mutations based on the amino acid sequence of a wild-type organophosphorus degrading enzyme:

the 139 th methionine (M) is mutated to threonine (T),

229 th histidine (H) to arginine (R),

Isoleucine (I) at position 259 is mutated to aspartic acid (D),

Methionine (M) at position 139 to threonine (T) and methionine (H) at position 229 to arginine (R),

Methionine (M) at position 139 to threonine (T) and isoleucine (I) at position 259 to aspartic acid (D),

The 229 th histidine (H) is mutated to arginine (R) and the 259 th isoleucine (I) is mutated to aspartic acid (D),

Methionine (M) 139 to threonine (T) and histidine 229 (H) to arginine (R) and isoleucine (I) 259 to aspartic acid (D);

wherein the wild organophosphorus degrading enzyme is derived from agrobacterium tumefaciens, and the amino acid sequence is shown as SEQ ID NO. 1.

2. The organophosphorus degrading enzyme according to claim 1, wherein the amino acid sequence of said mutated organophosphorus degrading enzyme is represented by any one of SEQ ID NOs 2 to 5.

3. An isolated polynucleotide encoding the organophosphorus degrading enzyme of claim 1.

4. A vector comprising the polynucleotide of claim 3.

5. A host cell comprising the vector of claim 4, or having the polynucleotide of claim 3 integrated into its genome.

6. The host cell of claim 5, wherein the host cell is, e.g., Bacillus subtilis.

7. A method of producing a mutated organophosphorus degrading enzyme according to claim 1, comprising the steps of: (i) culturing the host cell of claim 5, thereby expressing a mutated organophosphorus degrading enzyme; and

(ii) isolating the mutated organophosphorus degrading enzyme.

8. The method of claim 7, wherein the method further comprises the steps of: (iii) (iii) purifying the mutated organophosphorus degrading enzyme of step (ii).

9. A formulation comprising (a) the mutant organophosphorus degrading enzyme of claim 1, and (b) an agriculturally acceptable carrier.

10. Use of a mutated organophosphorus degrading enzyme according to claim 1 or a formulation according to claim 9 for degrading an organophosphorus pesticide.

11. A method of degrading an organophosphorus pesticide, the method comprising contacting the mutant organophosphorus degrading enzyme of claim 1 or the formulation of claim 9 with the organophosphorus pesticide, thereby degrading the organophosphorus pesticide.