CN112010953B - Wheat powdery mildew resistance related protein Pm24, and coding gene and application thereof - Google Patents

Abstract

The invention discloses a wheat powdery mildew resistance related protein Pm24, and a coding gene and application thereof. The protein provided by the invention is obtained from wheat, is named as Pm24 protein and is a protein shown in a sequence 3 in a sequence table. The nucleic acid molecule encoding the Pm24 protein also belongs to the protection scope of the invention. The invention also protects the application of the Pm24 protein, and aims to improve the disease resistance of plants to powdery mildew. The invention also provides a method for preparing a transgenic plant, which comprises the following steps: introducing a nucleic acid molecule encoding the Pm24 protein into a recipient plant to obtain a transgenic plant with enhanced resistance to powdery mildew. The method has great application and popularization values for breeding the powdery mildew of the plants.

Description

Wheat powdery mildew resistance related protein Pm24, and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a wheat powdery mildew resistance related protein Pm24, and a coding gene and application thereof.

Background

Wheat is one of the important Chinese food crops, and the production of the wheat is directly related to the guarantee of the absolute safety of national food. Wheat powdery mildew is a fungal disease caused by the highly specialized parasitic bacterium blumeria graminis (Blumeragramisf. In recent years, the transformation of production modes, the improvement of water and fertilizer conditions and the lack of effective new genes for resisting powdery mildew of main popularized varieties cause increasingly serious powdery mildew hazards, which become obstacles for influencing and limiting the stable yield and high yield of wheat. The development and utilization of diversified powdery mildew resistant genes to breed new disease resistant varieties is the most economical, safe and effective way for preventing and treating powdery mildew.

In recent years, wheat powdery mildew is a main disease affecting Chinese wheat production, because the disease scope of wheat powdery mildew in Chinese wheat main producing areas is continuously enlarged and the harm degree is increasingly serious. China has abundant local variety resources of wheat, contains abundant powdery mildew resistance genes, has broad-spectrum and lasting resistance after thousands of years of natural selection and artificial selection, and is an important resource for wheat disease resistance breeding.

Disclosure of Invention

The invention aims to provide a plant powdery mildew resistance related protein Pm24, and a coding gene and application thereof.

The protein provided by the invention is obtained from wheat (Triticum aestivum L.), is named as Pm24 protein, and is shown as any one of (A1) - (A4) as follows:

(A1) a protein consisting of an amino acid sequence shown in a sequence 3 in a sequence table;

(A2) a fusion protein obtained by attaching a tag to the N-terminus or/and the C-terminus of the protein of (A1);

(A3) the protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 3 in the sequence table;

(A4) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of (A1) to (A3) and having the same function.

The labels are specifically shown in table 1.

TABLE 1 sequences of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
PoN-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL
HA	9	YPYDVPDYA

The protein can be synthesized artificially, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

The Pm24 protein is obtained from local varieties of cucurbit heads, odontobutis and/or white cucurbits of Chinese wheat.

The nucleic acid molecule encoding the Pm24 protein also belongs to the protection scope of the invention.

The nucleic acid molecule is as shown in any one of (B1) to (B4) below:

(B1) DNA molecule shown in sequence 1 in the sequence table;

(B2) DNA molecule shown in sequence 2 in the sequence table;

(B3) a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in (B1) or (B2) and which encodes the protein of claim 1;

(B4) DNA molecules which have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA sequences defined in (B1) or (B2) and which encode proteins having the same function.

The stringent conditions are hybridization and washing of the membrane 2 times 5min at 68 ℃ in a solution of 2 XSSC, 0.1% SDS and 2 times 15min at 68 ℃ in a solution of 0.5 XSSC, 0.1% SDS.

Expression cassettes, recombinant vectors or recombinant microorganisms containing the nucleic acid molecules are within the scope of the invention.

The recombinant expression vector containing the nucleic acid molecule can be constructed using existing expression vectors. When the nucleic acid molecule is used for constructing a recombinant expression vector, any one of enhanced, constitutive, tissue-specific or inducible promoters can be added in front of the transcription initiation nucleotide, and can be used alone or combined with other plant promoters; in addition, when recombinant expression vectors are constructed using the nucleic acid molecules, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codons or adjacent regions initiation codons, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate identification and screening of the transgenic plant or the transgenic microorganism, an expression vector to be used may be processed, for example, a gene for expressing an enzyme or a luminescent compound which produces a color change in the plant or the microorganism, a gene for an antibiotic marker having resistance or a chemical-resistant agent marker, etc. From the viewpoint of safety of transgenes, the transformed plants or microorganisms can be directly screened phenotypically without adding any selectable marker gene.

The recombinant vector may specifically be a recombinant expression vector. The recombinant expression vector can be specifically a recombinant plasmid obtained by inserting the nucleic acid molecule into an existing plant expression vector. The existing plant expression vector can be a pCAMBIA1300 vector or a pTCK303 vector.

The invention also protects the application of the Pm24 protein, which is (C1) or (C2):

(C1) regulating and controlling the resistance of the plant to powdery mildew;

(C2) enhancing or reducing the resistance of plants to powdery mildew.

The invention also protects the application of the nucleic acid molecule for coding the Pm24 protein, which is as follows (D1) or (D2):

(D1) cultivating a transgenic plant with altered resistance to powdery mildew;

(D2) cultivating a transgenic plant having increased or decreased resistance to powdery mildew.

The invention also provides a method for preparing a transgenic plant, which comprises the following steps: a nucleic acid molecule coding a Pm24 protein is introduced into a starting plant to obtain a transgenic plant with enhanced resistance to powdery mildew. The nucleic acid molecule may be specifically introduced into the starting plant by any of the above-described recombinant expression vectors. The recombinant expression vector carrying the nucleic acid molecule can be transformed into a starting plant by a conventional biological method such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium mediation and the like.

The invention also provides a plant breeding method, which comprises the following steps: increasing the activity and/or content of the Pm24 protein in the target plant, so that the resistance of the target plant to powdery mildew is enhanced.

The invention also provides a method for preparing a transgenic plant, which comprises the following steps: inhibiting the expression of a nucleic acid molecule which codes the Pm24 protein in a starting plant to obtain a transgenic plant with reduced resistance to powdery mildew.

The invention also provides a plant breeding method, which comprises the following steps: the content and/or activity of the Pm24 protein in the target plant is reduced, so that the resistance of the target plant to powdery mildew is reduced.

Any of the above plants is a dicotyledonous plant or a monocotyledonous plant. The monocot may be a gramineae. The graminaceous plant may be a triticum plant. The wheat may be wheat Fielder.

Any one of the above powdery mildews can be powdery mildews caused by powdery mildew pathogenic bacteria. The powdery mildew pathogenic bacteria can be Blumeria brucei wheat specialization type. The powdery mildew pathogenic bacteria are particularly wheat powdery mildew strains E09 in northern China.

The powdery mildew resistance gene Pm24 in local wheat varieties in China, which is obtained by the invention, is beneficial to analyzing the structure, function and resistance mechanism of the disease resistance gene, can also provide a richer and efficient powdery mildew resistance source for wheat molecular breeding work, and the resistance of wheat to powdery mildew is improved on the premise of ensuring the yield and quality of wheat by introducing the coding gene of the Pm24 protein into wheat. The method has great application and popularization values for breeding the powdery mildew of the plants.

Drawings

FIG. 1 shows the identification result of the head and stone 4185 of Trigonella foenum graecum against powdery mildew E09; wherein, a is the inoculation of powdery mildew E09 for 7 days; b, inoculating powdery mildew E09 for 24h, and dyeing DAB; c, powdery mildew E09 is inoculated for 48h and trypan blue is stained.

FIG. 2 is a map-based clone of wheat powdery mildew resistance gene Pm24 in the head of a local variety of Chinese wheat; wherein a is wheat 1D chromosome; b is Pm24 genetic map; c is Scaffold of aegilops tauschii AL 8/78; d is candidate interval gene annotation of Pm24 gene on the aegilops tauschii AL8/78 genome sequence; e is a candidate interval gene annotation of the Pm24 gene on the Chinese spring genome sequence; f is the structure of candidate gene WTK and the sequence difference of resistant and sensitive parents; g is the structure of candidate gene CNL and the sequence difference of resistant and sensitive parents.

FIG. 3 is the structure diagram of complementary vector pCPL-WTK, complementary vector pCPL-CNL, over-expression vector pOE-WTK and the resistance identification diagram of transgenic plant obtained by transgene to powdery mildew E09; wherein a is a complementary vector pCPL-WTK; b is an over-expression vector pOE-WTK; c is a complementary vector pCPL-CNL; d is a complementary T of part WTK₀Resistance difference of generation transgenic lines (WTK-CLP1, WTK-CLP2, WTK-CLP4) and wheat fielder (fielder); e is partial WTK overexpression T₀Resistance difference between generation transgenic lines (WTK-OE1, WTK-OE2 and WTK-OE3) and wheat fielder (fielder); f is the complement T of part CNL₀Resistance differences between the generation transgenic lines (CNL-CLP1, CNL-CLP6, CNL-CLP15) and wheat fielder (fielder).

FIG. 4 is a graph showing the identification of cucurbit head EMS mutants and their resistance to powdery mildew E09; wherein a is the point mutation of the gourd head EMS mutant on the WTK gene; b is the resistance difference between the gourd head EMS mutant (Mut129, Mut410, Mut477, Mut614, Mut988, Mut1091, Mut1106, Mut1174, Mut1269, Mut1322, Mut1365) and the control (HLT).

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The disease resistance or susceptibility as referred to herein is powdery mildew. The powdery mildew is wheat powdery mildew caused by wheat powdery mildew, namely Blumeria brucei wheat specialization, and the wheat powdery mildew without special identification is wheat powdery mildew strain E09(BgtE09) which is widely popular in northern China.

According to the phenotype, the powdery mildew disease resistance of the plant adopts a grading standard of 0-4 grade. 0 is immunity (no powdery mildew related symptoms of the plant). 0; it is near immunity (allergic necrosis reaction, green reaction). 1 is highly disease-resistant (thin hypha layer, less lesion, permeable to green). 2, moderate disease resistance (thick hypha layer, impermeable to green, able to produce some amount of spores). 3, moderate susceptibility (thick hypha layer, many lesions, high sporulation, but no hypha connected into pieces). 4, high susceptibility to diseases (thick hyphae, dense hyphae, many scabs, high sporulation yield, continuous hyphae). According to the broad classification, 0-2 is disease-resistant, and 3-4 is susceptible.

pCAMBIA1300, pTPCK303, Agrobacterium strain EHA105 were purchased from Pezuki (Beijing) Biotech Ltd.

Tooth roughness is described in the following documents: huang, X.Q., Hsam, S.L.K. & Zeller, F.J.Chromosol location of genes for resistance to power pitch mill in common where 4.Gene Pm24 in Chinese land hybrid gene.aspect.95, 950. 953 (1997);

white gourd is described in the following documents: xue, F.et al, molecular mapping of a powder mill resistance gene in common leather land dry Baihulu and its alloys with Pm24.the or. appl. Genet.125, 1425. 1432 (2012);

gourd heads are described in the following documents: wang, Z.Z.et al.genetic and physical mapping of powder milk resistance gene MlHLT in Chinese leather land road Hulutou.Theor.App.Genet.128, 365-;

stone 4185 is described in the following documents: wang, Z.Z.et al.genetic and physical mapping of powder milk resistance gene MlHLT in Chinese leather land road Hulutou.Theor.App.Genet.128, 365-;

fielder is described in the following documents: he, H.G.et al.Pm21, encoding a systematic CC-NBS-LRR protein, coupling broad-spectrum resistance to floor powder great distance. mol.plant11, 879-.

Example 1 allelic detection and identification of various species of Cucurbita pepo head, Rough teeth and white gourd

In view of the fact that the powdery mildew resistance genes Pm24 (odontobruss) and Pm24b (white gourd) derived from local varieties of Chinese wheat have been positioned on the wheat 1DS chromosome, the gene is a powdery mildew resistance gene derived from the heads of local varieties of gourdBecause whether the genes (named MlHLT) are positioned at the same gene sites as Pm24 and Pm24b or not, hybridization combinations among the 3 local varieties are respectively prepared, and the gourd head is multiplied by the tooth roughness (4,517F)₂Single plant), gourd head x white gourd (4,318F)₂Single plant), rough teeth x gourd head (4,382F)₂Individual plant), Rough teeth x white gourd (4,590F)₂Single plant) and white gourd x gourd head (4,692F)₂Individual plant) F₂The single generation plants are subjected to artificial inoculation identification of a seedling powdery mildew strain E09, and the result shows that F of all hybrid combinations₂No infectious disease individual plants are separated in generations, which indicates that MlHLT derived from the head of a local variety cucurbit, Pm24 and Pm24b are powdery mildew resistant alleles at the same site.

The 3 local varieties are identified by 36 powdery mildew strains, and the results show that the gourd heads, the white gourd and the odontobutis show disease resistance to 36 physiological races of powdery mildew, and prove that the MlHLT or the allele thereof is a powdery mildew broad-spectrum resistance gene.

Example 2 Fine localization of powdery mildew resistance genes

The powdery mildew resistance identification is carried out on the local variety cucurbit head of wheat from Shaanxi in China and the wheat variety stone 4185 from Hebei in China, DAB dyeing and trypan blue dyeing are respectively carried out on the wheat leaves inoculated for 24 hours and 48 hours, and the wheat leaves inoculated for 7 days are observed, and the result is shown in figure 1, the cucurbit head is found to have immunity-level resistance to BgtE09 popular in Beijing area, and the stone 4185 shows high feeling to BgtE 09. Constructing the second-generation hybrid population of calabash heads and stone 4185, and subjecting the second-generation hybrid population to 310F_2∶3The disease resistance of the families was identified by 71F_2∶3The family line shows homozygous disease resistance, 150F_2∶3Family exhibits resistance, separation of sensation, and F₂F for 89 infected individuals_2∶3The pedigree is infected with the disease according to F_2∶3The infection resistance separation ratio (homozygous disease resistance: resistance, infection separation: homozygous infection) after the family is inoculated with the powdery mildew can judge that a dominant powdery mildew resistance site exists in the gourd head.

According to example 1, allelism detection of gourd head, rough teeth and white gourd proves that MlHLT is bit with Pm24 and Pm24bPowdery mildew resistance gene at the Pm24 locus. F utilizing the above 310 individuals₂Population, MlHLT (i.e. Pm24) was mapped to 3.6cM on chromosome 1DS by a comparative genomics approach (shown as a in FIG. 2). To pinpoint the powdery mildew resistance gene Pm24, this resistance site was located between the molecular markers WGGB240 and WGGB245 using molecular markers on the genetic map of the common wheat D genome and markers designed from the already published scaffold sequences of the D genome donor aegilops tauschii AL8/78, wherein the molecular markers WGGB242 and WGGB243 were co-separated from the gene (mapping population total 3720 individuals), the genetic distance between WGGB240 and WGGB245 was 0.06cM (shown in b in FIG. 2), and the corresponding physical interval in aegilops tauschii AL8/78 was 380kb (containing a scaffold3178.1 partial sequence and a scaffold3268.1 partial sequence) (shown in c in FIG. 2).

Example 3 identification of candidate genes for the powdery mildew resistance Gene Pm24

The genomic sequence of aegilops tauschii AL8/78 and the genomic sequence of chinese spring within the physical interval described in example 2 there were 6 candidate genes including 2 genes encoding receptor kinases (RLK1, RLK2), 1 gene encoding tandem kinases (WTK), 1 gene encoding CC-NBS-LRR domain protein (CNL), 1 gene encoding putative protein (HP) and 1 gene encoding 50S Ribosomal Protein (RP) (d and e in fig. 2). The genome sequences of 6 candidate genes (RLK1, WTK, RLK2, CNL, HP and RP) in a disease-resistant wheat variety (gourd head) and a disease-susceptible wheat variety (stone 4185) are analyzed, the result shows that only the genome sequences of the WTK and CNL genes are different between the two wheat varieties (shown as f and g in figure 2), and the WTK and CNL genes are preliminarily confirmed as the candidate genes.

Example 4 transgenic functional validation of powdery mildew candidate genes

In order to determine whether the resistance of the local variety cucurbit of wheat in China to powdery mildew is determined by the candidate gene WTK or the candidate gene CNL, the transgenic function verification of the candidate gene is carried out.

Construction of complementary vector pCPL-WTK, complementary vector pCPL-CNL and over-expression vector pOE-WTK

One), will be as shown in sequence 1 in the sequence tableThe WTK gene shown includes the genome sequence of 3378bp upstream of the start codon, WTK gene region and 1811bp downstream of the stop codon using primers (WTK-CPLTransF1/R1, WTK-CPLTRANF 2/R2, WTK-CPLTRANF 3/R3 and WTK-CPLTRANF 4/R4 for amplification), and then according to Beijing Quanyujin Biotechnology Limited

The method of the Seamless Cloning and Assembly Kit successfully constructed the complementary vector pCPL-WTK for WTK by recombining the candidate gene into linearized pCAMBIA1300, as shown in a in FIG. 3.

Wherein the primer sequences are as follows:

WTK-CPLTransF 1: AATTCGAGCTCGGTACCCGGGTTGTTGGCCAATCGTTATCA (sequence 5)

WTK-CPLTransR 1: AGACCCCTAGTTTCCTGATGATA (sequence 6)

WTK-CPLTransF 2: TATCATCAGGAAACTAGGGGTCT (sequence 7)

WTK-CPLTransR 2: GCATATATTCATAGCAGAGCAGTTG (sequence 8)

WTK-CPLTransF 3: CAACTGCTCTGCTATGAATATATGC (SEQ ID NO: 9)

WTK-CPLTransR 3: CTGTGATGCGTGGTATGTAGTTG (sequence 10)

WTK-CPLTransF 4: CAACTACATACCACGCATCACAG (sequence 11)

WTK-CPLTransR 4: TGCAGGTCGACTCTAGAGGATCGTCCTTCATTGATGTGTTCC (sequence 12)

II), amplifying the genome sequence of CNL gene including 2903bp upstream of start codon, CNL gene region and 2519bp downstream of stop codon as shown in sequence 4 in the sequence table by using a primer (CNL-CPLTransF/R), and then amplifying according to the genome sequence of Beijing Quanjin biotechnology limited

The method of the Seamless Cloning and Assembly Kit successfully constructed the complementary vector pCPL-CNL to the CNL by recombining the candidate gene into linearized pCAMBIA1300, as shown in c in FIG. 3.

Wherein the primer sequences are as follows:

CNL-CPLTransF: CGAATTCGAGCTCGGTACCCGGGGCAATTGTTGCTGTAATGTGGTA (SEQ ID NO: 13)

CNL-CPLTransR: AAACGACGGCCAGTGCCAAGCTCTTCCACTCCAAGGGTACTGACCT (sequence 14)

Thirdly), using a plasmid containing the WTK gene full-length cDNA as a template, amplifying by using a primer WTK-OETransF/R to obtain an ORF containing 2,682bp WTK genes shown as a sequence 2 in a sequence table, and then carrying out homologous recombination on the ORF and a linearized pTPCK303 plasmid to construct an over-expression vector pOE-WTK of the WTK, wherein the Ubiquitin of the corn is used as a promoter of the WTK genes, and is shown as b in figure 3.

Wherein the primer sequences are as follows:

WTK-OETransF: TCTAGAGGATCCCCGGGTACCATGGGCGGATACGAGTTCCA (sequence 15)

WTK-OETransR: TTCGAGCTCTCTAGAACTAGTTTACTTCTTCCATCCGAAGTGT (sequence 16)

Two, T₀Generation of transgenic plants

Plasmids of a complementary vector pCPL-WTK, a complementary vector pCPL-CNL and an over-expression vector pOE-WTK are extracted and purified by a plasmid extraction kit (purchased from Tiangen Biochemical technology (Beijing) Co., Ltd.), are respectively transferred into an agrobacterium strain EHA105, and are transferred into a common wheat Fielder by an agrobacterium infection method to obtain stable complementary T of 7 WTKs₀Generation transgenic line, 15 CNL complementation T₀Generation transgenic line and overexpression T of 12 WTKs₀Generation transgenic lines.

Identification of transgenic plants

The molecular identification and the powdery mildew resistance identification discover that:

1. complementary T of 7 WTKs as shown by d in FIG. 3₀The generation transgenic line (7 strains detect the sequence of WTK), all of which are resistant to diseases, and the phenotype is obviously different from the Fielder; harvesting of T₀Generating transgenic strain seeds, and culturing to obtain T₁Family generation, for 7T₁The disease resistance of the surrogate lines was identified by 7T₁Disease-resistant individuals and disease-susceptible individuals exist in the ancestry system, WTK sequences are detected in the disease-resistant individuals, and WTK sequences are not detected in the disease-susceptible individuals.

2. Complementary T of 15 CNL strains as shown in f in FIG. 3₀The generation transgenic line (14 strains detect the sequence of CNL), whether detecting CNL or not, all the lines are still infected with diseases, and the phenotype is not different from Fielder; harvesting of T₀Generating transgenic strain seeds, and culturing to obtain T₁Family generation, for 14T₁The generation line is identified by 14T₁All individuals in the ancestral line are infected with diseases, and the phenotype is consistent with Fielder.

3. As shown in e in FIG. 3, over-expression T of 12 WTK₀Transgenic plants (12 plants detect the sequence of WTK), all of which are resistant to diseases, and the phenotype is obviously different from that of Fielder; harvesting of T₀Generating transgenic strain seeds, and culturing to obtain T₁Family generation, for 12T₁The disease resistance of the ancestor line is identified by 12T₁Disease-resistant individuals and disease-susceptible individuals exist in the ancestry system, WTK sequences are detected in the disease-resistant individuals, and WTK sequences are not detected in the disease-susceptible individuals.

The results prove that the candidate gene WTK is the powdery mildew resistance gene MlHLT in the local variety cucurbit head of wheat in China. Genome sequences of 3378bp upstream of the WTK gene, a WTK gene region and 1811bp downstream of a stop codon are respectively obtained from the odontobutis and the white gourd, and sequence comparison analysis shows that the WTK gene sequences in the gourd head, the odontobutis and the white gourd are completely the same, and further shows that MlHLT, Pm24 and Pm24b are powdery mildew resistance genes Pm24.

EXAMPLE 5 EMS infection mutant analysis of powdery mildew Gene

15000 cucurbit seed granules of disease-resistant material are mutagenized by chemical mutagen Ethyl Methyl Sulfonate (EMS) to obtain 1366 parts of M₂Replacing materials; will M₂The disease resistance of the ancestral strain was identified by artificially inoculating powdery mildew strain E09 in the seedling greenhouse, the results are shown in FIG. 4, and the 11 screened EMS mutants (named Mut129, Mut410, Mut477, Mut614, Mut988, Mut1091, Mut1106, Mut1174, Mut1269, Mut1322 and Mut1365) which are infected with powdery mildew all have point mutations on the WTK gene, wherein the point mutations of 2 EMS mutants (Mut410 and Mut1091) cause premature termination of the encoded proteins, and 1 EMS mutant (Mut110, Mut1091) has point mutation6) The point mutation of (A) changes the shearing mode of WTK, the point mutations of the other 8 EMS mutants (Mut129, Mut477, Mut614, Mut988, Mut1174, Mut1269, Mut1322 and Mut1365) all cause the variation of non-isoamino acid, and further proves that the candidate gene WTK is powdery mildew resistance gene MlHLT in local variety gourd heads of wheat in China, namely Pm24, the nucleotide sequence of the gene is shown as sequence 1 in a sequence table, and the Open Reading Frame (ORF) is shown as sequence 2 in the sequence table; the protein encoded by the gene is named as Pm24 protein, and the amino acid sequence of the Pm24 protein is shown as sequence 3 in a sequence table.

Sequence listing

<110> institute of genetics and developmental biology of Chinese academy of sciences

<120> wheat powdery mildew resistance related protein Pm24, and coding gene and application thereof

<130> CNYFY191056

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 15599

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ttgttggcca atcgttatca ccggtactac caggggcgga gacagggagg ggcgagcagg 60

ggtctgaccc ctgccaatcg ctcgcccccc tcaacgattt gtagcaggta gtgcgtaaca 120

gccgcagcta atcacataat taacccattt ctttttgagc gtaacataag cccatataga 180

aacaattaac tggaccagca ccaaagcaga gaagcccacc caacaatcca tgtacgacgg 240

ttgtgcctag ctatttttta gctcggccca gtgcctaatc cgtcagtacg tacatgcgtg 300

ttctgcactt ctcctagggc gttcttcgcc gccgccgctt gcttgtactg ctagggtcta 360

gggtgtttgc cattgtctct ggccgctact cgacacgaca acaacaccgt ccaccactga 420

tttgcagtac gcagttgacg cacgggcatg ggcggacggc ttgacgctgg cggatctaga 480

tctcgggtga gcaggataga tgcaggtata ttacattgat agtagttatt actctctatg 540

ttctaaaata attgtagctc tacgtttgtc ctaagtaaaa ctaatttaag tttaatgatg 600

tttatagaaa aatatggtaa gatctacaaa attaaatata catagtgtgc atatttttta 660

aagattctaa taaagctatg gtgtttcaaa atattgatat atttttctac aaactggtaa 720

aacttgaaga agtttaactt agaataaatt tagagcttct attattttaa aacagaggga 780

gtgagacttt tctttggata aaaagacctt actatgctta attaatgttt catataaaac 840

agtaaattag tctagtaatt atgtgtctat ttgtactagt caaagatgaa gcggaagaat 900

caacaacaaa tggggtaaat tctttttcaa tccaattggt tcaatttcaa gctccaacat 960

tattactact aatagtatat tttttatagt tccaaacaat aattttatgt attatcatcg 1020

atgctatcgt gagacttaat atattgtgat attctgtcat ttgcgtcaac aatggtgtct 1080

cgccctcctc atgctgaaat cctggctccc cccctgggta ctactacaat gaaatcatga 1140

cgcatgcaga acccgacgga caactgcttc ccttaatcga gagtgggaca cttgcaaact 1200

cgcaacttta cccctagacc caccaaatta cgacgcttac aaacacacgg gattcagaaa 1260

cttttactga agcaaaatgc tctgattttg catattttga agccgatgca catttaccgt 1320

cctagcaatc ccatgctcag attgcgtata ctgaagcaaa caagctgtcg ggggaggagg 1380

cagcgagaag ctccataaaa cacaaaaata gaatcgccca aacgagcaga acacgctgct 1440

ggcaacagtt tggttggata atggtgaggt gatcggcagc aggaacttgc agtggccatg 1500

gaaaaaacta agtaagagag aaaaagaaga agaaaagtca gttagttcat acggtgttac 1560

agcctggtaa ggataaggtc agcaggatga taaggcacat gtggtggtgg agaagtgggc 1620

acttgttgct tggctacgta cacacctaga cgtacatgag aaagaacatc tcaaaaataa 1680

tcaaacaaac atgtgatgta ttaaatcctg tttcctcaag tgggacagag gatttgacca 1740

cattgtttgg atttcttgtg ataattcaag tcttttttct attagccatg ttcaagaatt 1800

cgcacgataa ttaaccagtt aacttgcgat taatccttat ccgtagggtc accaagtagt 1860

caataaactg ataaatcatt taattaatta attaattaaa tggccattaa cttactgatt 1920

agcctattaa ttccctactc accagccaac cgagcagcca ctggcgtacc aacgggtgtg 1980

ccaggtgttg aaaaatattt ttgcaccatg taaaaattag ctgattttta aggcccatgc 2040

aaggtaattg aaatagactt catttctttt aaatgtgcac accgttcatt ttatttctag 2100

attcgccatt gcgagcagct accagttaac gatttcctta acaatgatga ttagtatatg 2160

tgttactaaa gagccacaaa gttgagatga ctgtgctgtg tgtgaaaaaa aaatatgaat 2220

cgggtaaatt cgtggcatga aaaagccgca atattaaaat gcaagattga tcctaaaacc 2280

aattaagtga atggttgtct caatacaacc ttaaatatat taaaacaagt ttcattatca 2340

aaatatatat taaaaagttc cctttcttcc tcaaatttga gcaggcacct gtgcttctcc 2400

aaagattatt tcgcctcttc tcgcccatgg cgtctcctct tcccacagac gttgtcgcag 2460

ccccattcac cccctcagtc atgcacatgc gccccgttga tgtctggccg ccgagtacat 2520

aaattcataa ataaattcaa cgagacggat ccgatgatct cctcaagagc gtgcttttaa 2580

aatgcaggct gccgcgaacc aatctgtgat tggatagtta gaaggtctgc ggtaacccca 2640

tccaaccaga ttcatccagt cccaaactta atattgatgc tcacattttt ctagatttat 2700

ttcaggcttt cgtcaatctc aacatgctat gtcggctcag actctcgaag gtatttatag 2760

ggtagggtat acgtgtatgt gttcacagag gtgtgagtgc tcgtttatgt gagcgacttc 2820

gactgtgtcg tgttaaaaaa aatgcaagct gcctctgtcc ccgccgtttt tttaattatt 2880

aatctggcat gtgtatggta attcaacaag ttgatcgggt cttaggaaat gcaaggtccc 2940

tcggtcacca ggccgaccgg tctttttttt ttcagacaaa gggccgaccg atcatttatt 3000

agtactctgc ttatcgggcc attggcacag ctctagagct ccggatctgg atcgacttgt 3060

tatgctcccc ccggtcaacg cctttgcctg ctgagcctgg gaatgattga tccgctcatg 3120

atctacaaga cgagaagcaa gcccagtttt gctcctagct agctgctttc tcctcctcct 3180

ccaatctcca ggtgagtaat taagatgcaa ctaggtagct gctttctggt aagactttag 3240

ctacctactt atcttctgct tgatttgctt tgtgcagcaa cgaatgaagg agaagctggc 3300

aaccatattc atatccataa tccatatcta tatgcgagct attgcttgct agaaagcttc 3360

ttgctcgcat actcggaaat gggcggatac gagttccaga gggcggagct agatgcactg 3420

gaaggcgtcg tacgcgatcc aactgcggag ccaatgagtc tgacgttgcc gcttctcagg 3480

cacataacaa atgatttctc ccctgaattt gaaattagta aagatgattc tgcagtggtt 3540

tacctggtac gactaaactc atatctcgtt tattattaat ataagcaaat cctatctcgt 3600

taattagtac tctgcttatg tggtcgaata tatatgtagg gggtgcttcc aagtgggttc 3660

cgtgttgctg tcaagaagtc tcactttcgt ttttgcttgg atgatgaaga tgcattcaca 3720

aatgaagttt ctattgcaat gaaggctgct cataagaaca cagtgcgagt cataggctac 3780

tgtcatcaca cgcatgagca aattgccgaa tacgaaggaa aacaagtttt cgcagaggtc 3840

agagaaaggt tgatctgtac cgagtatgtg cctaacggac cccttagtgg acatatcgaa 3900

ggtaagatat gtgcgcaaat ggatggatac gagttccaga gggcagaact agatgcacta 3960

gaacgcgtcg tacgcgatac aagtgcggag ccaatgagtc tgacgttgcc gcttctcagg 4020

cacataacaa atgatttctc cgatgaatct cgaattggcc gaggtggatt cgcagtggtt 4080

tacctggtat gattaaactc atacagtatc tccttagata ttaagcaatt cctatcttgt 4140

caattactaa cttcttattg tggtcaaata tacagggggt gcttccaagt gggttacgta 4200

ttgctgttaa gaggcttagc aatattgctt atatgaacga aagtgcattt caaaatgaag 4260

tgtttatcac aatgaaggcc actcacaaga acacagtgcg attcatgggc tactgtagtc 4320

aaatacaagg taaactcatc gaacacgacg ggcaacatgt tttcgcacag ctcgaggaaa 4380

ggttgatctg tgtggaatat gcgcctaaag gaacccttga tgcacatatc ggtaagatcg 4440

ataacacggc atgcccgccc tagcaataat tccctctctt tattttggtg tttctgtttg 4500

tgtggctgtt ttttactttg tgctcacaga acaaagaatg aataccagtg gaacaaaaaa 4560

gtagactata attttagcgc aactgaaacc aacatgacca gtcgtagaac acaaatttag 4620

acaaagtgga ccaaatcata agaaatatta aaacattaat tttttagaac ataaggcaca 4680

aaattatagt gctcgtgaat caaaacttgg ctacaagtgg aacacctatt gtaataaatg 4740

caagaaaact attagaggct tgtgcaataa aatttcggtg cccatggaac aaatcaaaat 4800

tctagtggaa caaaagtttt aactaagtga atgagcaaag tatatcactt gcaggaacaa 4860

attgaaacta ctactgctgc cacttcacca cttcttgtgc tgactttgcc atcctcacgt 4920

ggtaccaatt tccttcagtt ttcgtgtgtg ccaatgaatt cagatttcca aacaagtgga 4980

ggttttttct tccttcccca atatccctcg ttctacccaa ctatataatg gggcagagaa 5040

ggataagcaa agtaggcggt agaacaaaaa attaatgtaa ttgggacaaa atttaatcag 5100

taaatgctca ctagtctgag gataaacgaa agcatgaaac aaggaaaaga tgaggatgag 5160

caactattgg aataaaagca aaattaaact agcagagcaa agtaaagttg caaccaaatc 5220

atcagcgagc accacatcag cgcgctagtc tcccctcccg gtggtaaccg ctattggtgg 5280

ctcaccggcg tctaaggccc ctaggcggat gaagactaga tggctttcct tgccgatcta 5340

catgacatct ggcccttggc ttattggtgg cgatttcaac atgatcgtct ctgaggcgga 5400

caagaataac ccgcacgtga accggcggat catgcatagc tttcgatgct tccttgtcga 5460

cgaggaactt catgacattt gtatgcatgg taggtgctac acatggtcca gcgagcgcaa 5520

gattcctact cttgtcaaga acaaccgcat cgtctcctcc tcctcgaagg atgcgcatcc 5580

ccactgcctg ctgtagtgcc tctattcagc tgcttcagag cactggccgc tccttcttga 5640

ttgtgtcccg tgtacccatg ggatcaagcg gttccacttc gagtgatttt ggccgaagct 5700

tgatgatttc caactagtcg cctctgaggc ttggaactcc attgagcatg cccctgatgc 5760

atttcgccat atcgtcgtgc gccttaagtc taccacacgt cgtctccaga gctggagtgc 5820

caagtctatt ggccaaatct cggtgcagct tcagatcgcg tgtgagctca ttgctcattt 5880

ggacgccgct cagcactttc ggccgctctc gacctcggag gcctggttgc gacataggct 5940

gaaggccgcc taccttggcc ttgcctcgct cgagtgttcc atcattcggc aacgcacgag 6000

gtttgcctac gaggtttgcc tgtctcaggg aggctgatgc tggccctacc ttcttcaaca 6060

tgcatgcatg cctcgtacca taagcagaaa aaccgcatct tcgagctcaa ggtgggtgat 6120

agagttgtct ccacgccgga ggcgtttgcc actgcgggat tttgatcact tcaccggtgc 6180

ccttgagacc tccgaggacc gcgacttctc catctccctt cgggatctgc atgctggtgc 6240

tttcgatatc aaggcccttg atgagccatt tttttaggcc gaaatttggc gcgttgtcaa 6300

ggctctaccc tccagtaaga cgccggggcc atccctcaat gcgtgaggct ttcaaaaact 6360

caacgaggca tacattaccc tgctccccaa acggcatgcc gacgcaacca cactcttcta 6420

cttttggtcc attagcctca tccatctgat ggcgaagttg ttcgccaagg cgctctctct 6480

ctctctctct ctctctcgct ctctctctct ctctgcaaac ggcgtgtgtt ctgcacaatc 6540

tcaaggttcc tcgggtgatg ctgaagcttg acatcgttag ggccttcgac tcggtgtctt 6600

agccctttct tctggcccga atgtccctct cgtccgcaga aagggcgtgt gattcttggg 6660

caatgtcaag gcgaaggata acgagaaggg ctgcatgaag atgcaacttt gccttggaga 6720

agaggccctt actccatctc gccaagtgcc accccgtttt cctgagctta tggaaaagcc 6780

gctggcaagg ctccgtgtgc tcgcatggct catcccaagc ctttgacacg atgtcaaaga 6840

agccggggag acaggacaga aaattctcaa atttgaaaca tcttggtcgc ttgggcccct 6900

tgtcatcagc gaggaggaga gggcagtgat ccgaaagtga ataggagatg gagtggagca 6960

catgggagtt aaaatgcatg tcccaatcgg catttcggaa catcaagtca agcttgcaaa 7020

gagttgggtt ttgacgctcg ttgctccaag tgaatcgtat gttttgcatt accatgcctt 7080

ctatttttat ctcaagcacg atagatttgg ttgaagtcgc ccatgacaat ccatttagtg 7140

ccattgttgg gtttttgtga gattagctcg ttaaagaagt caccctttct gtcggaggcc 7200

gtgggaacat agacactagt gatcatgaag taggtatcgg tgtgaatcac attgaccatt 7260

gccgagaggc agaactcagt aaacttgacg tctgaaatac ggacgacact atcgtcccaa 7320

agcatgagta ggccccctct ggttccaata gccggacgct gacaaaactc gagagcctat 7380

tgccgccgag gtaggaggcg atgaatcggt ccactgattc catcttggac tcctgaaagc 7440

aaacaatgtg gcaagaggag gaggcaatcg tctcatgaac cgtcgcccgt ctacctgggt 7500

tgccaaattt tgataattgg tttgatgcca aaaattggca tgccaaattt tggcaactgc 7560

caaatattgg ctagagattg attgcttgcc aattttcatt gccaatctca gaaaaagttg 7620

tcaaatgtga agttgccaac atttgacaat aaaaattggc aagcaaccaa tctctagtta 7680

atatttggca cttgccaaaa tttggcatgc caacttttag catcaaacca attatgctct 7740

taacccttgc agatttcaac tcaaaaaaaa ttatgttttg ttctatcatc aggaaactag 7800

gggtctcgtg gcactcacaa ttagagcccg tcggggttgc atgaagtgtg cttgctgaac 7860

cagctctttg cacaacaaag agagaaataa tctggaagct gcgtggagtt tgaggtcagg 7920

gtggctgctg tctagagtag aggttgcaac ttgcaagcga tctttgcaca accatgatct 7980

tcattaagca ctggcgacga tgaacaccca agttacaacc aacaggaacg ttacagcaac 8040

tagttcctct tggttaaggg ataacagaga gctttgctaa catcagggca actagtgctt 8100

tggctctgtg aagtggggag aaacaatgga ggcacttgcc caccaattga ggggggattt 8160

gaggccgcct gtgaggagct ggaggggggg tttggcaggc caggggaggg gaggggaggt 8220

tgtcgctgcg tccagccagg ctccaggggg catcctgtac ttcctctgca aggcgatgcg 8280

cgggggcggc gtttgcagcg gaagacccgg ggcggggttg ccgcccgggc attgatggcg 8340

gcctcctctt gaatgcgttg cagagacgcg tcgggggcga cgatgatgga agcgacgcgc 8400

acgcctcccc ctcgaaggac aggcggcgtc tccagaacct cgtcagcaag ctcagctgcc 8460

tggatccgga gacgtgcagc ggccgatcca gaccgggcac cagtggcacg acagtggaca 8520

cagggataac aaccggggaa aaaaaattct ccggcaagcg gggcggcggc ggtggcagct 8580

catgttgtcc ggcgagcccc gaatggcacg cgtcgggagg ggctggtggg tgggtcgccc 8640

actcatgttg tccggtgatt tttccagctg tgccagctaa gtttttcaag tgtttgcgat 8700

ttaggaattt tgagaggata catgcttcgc tgtttgatct atttctatct atctcatgta 8760

agcctttcga gatgacaagc agatcaactt catgacatta tcaatacttc tgcaggtgac 8820

tatggtgaac ttgactggaa ccagcgttat caaattctaa aaggaatttg tcaaggtttg 8880

catcatctcc atgacgaaat gcacgttttt catggagata tcaaaccagc caatatatta 8940

ataggggata accttgtgcc taaaatctat gacttcggtc tctcccagat gtttgaagaa 9000

gaagaaacgg aacgtattgt tgaaaatatc gccggaacat tgtaagctaa cccgttcctc 9060

tttgttattt tgttttgttt ctgctgacac aggtacttcg ataaccaaaa tgcattagag 9120

ttagtcggcc gattgcctca catctaacat atgtgcagcg gatatatggc accggagttt 9180

tgtactaata atatggtgtc atttaaggct gagatataca gtttgggcgt tgtgatcggg 9240

gagttattga tcgggaagtg gtttgatgag gatgtgagaa aactatttgt acagcaactt 9300

aagggtttga gaaaaacatt ggtaaaagaa ggagcgtttt catcatggga aaacaaatac 9360

caccaagtta gaacatgtat ggagattggg caggactgca tagaccccaa cccacataaa 9420

aggcccactt tgttggagat tatccagcgg cttaatgaag cggaagatat gaactattct 9480

gcagcatcac tttggcaggt atggaaaatc gaaagcataa ggaaacaact gttctttatc 9540

taccatttca ctttagctaa cgtactgttt gagaagaatc agtcttagcc aagcttacat 9600

cctcacagac acagtacaga agtacatttc ttttctttag ccattacgat taacataaag 9660

agttcacaaa gccatctcca acgaaagata tgtgctaatt aaactaaatt ggaagagaaa 9720

atacataaca aagcgaagac accatgtaaa ttagagaaga aacaaactct tggtactcct 9780

tcagcgaggg aagacacctt gtcaacttag cagaaacaaa ctcttggtac tccttcagcg 9840

agggaagaca ccttgtcaac ttagcagaaa ccttacgact ctagtcctac atgacatgtc 9900

taagagaata ttgatgtcat gcattgcata atgcttacat ggtaagttat atataagtgc 9960

agtcaggaga cgaggaatcc gatttatcgg atacagaagc tttggagaca gagacaacat 10020

ccgagtttct tccaagtgac gaagaacccg cctctgtggg caagaccgga gaaacaagca 10080

cacaggagcc tgataaaccg gacctaataa gtaagttgcc agcatcggtg gacctgtctg 10140

acctaaaagt cctggagaaa atcacagatg atttttcaca cgaaagaata gttgggaagg 10200

acggtacatt caaaggttgt cataaggcat ttgtttataa ggtacacata gttgtaagtt 10260

actatgcagt gctttgcttt gctgatgtcc tttgagttca acatattctt ccatcttaat 10320

tatactccta acacacacac gcatactaaa tgtacattta tttgaacagg gtgacattcc 10380

acttagagaa atgatagccg tgaagaggtt aattggagtg gagattccat ttgaaaagtt 10440

taagagggaa gcagaacagt tcattagtct cgatcataag aatatagtaa aggttgccag 10500

ctactgccac gaccagtcta gaggacatag actggtacag ttcaaaggaa aaccgctacc 10560

acaactcttt aacggtcccg aacaactgct ctgctatgaa tatatgcaca acggaagcct 10620

tcgcgactat cttatgggta atgataccga tcactaatca actactgttt tctttaacat 10680

ccgtaaacaa ttactgtttt ctttaacatc tgtaatcaac tagtgacaat tgctttcgat 10740

ggaagagagc tgcacatcca gtacaaatca tatatatgga tgcaaatatt taggaactgc 10800

ttgcaatgga agccaggtta gaagaaccct agcgcttgga aggcagcatc aaacctctcc 10860

cctcccctgg gtcgcccccg cgcggcgacc agggggaacc ctagcgccgc caagccctcg 10920

gctccctctc ccacctctcc tgcccgccgc cgccggggcg cgccgtcggg caaagcccgg 10980

ttggcgtcgg cggcggcggg atctctcctc cccgcagcgg ccggacctgg cgcgggtggc 11040

gttcggcggc ggttggcggc gcgttggtga cggggcgcgc cggcgagggc tcagggggtg 11100

acggcaggag ctgcttcccc cggtggtcgc gtggggggcc attcggggcg cgcctatggt 11160

ggccatggtc gatctgtttt agatctgacc gccggtgcct cgggcggcgc ggggatctca 11220

gggcggcgac ctcgatcgat ggcgcgccgt gcggcctgcc tggcgggcgg cacccgcggg 11280

tgcagatggg gggccttcca cggctgtgtg ggcggtgtgg aggtggcggc gctacgacgg 11340

ctcctcgacg gccgcccgga gtcccatggg aggtgtcgtc tcagactcga tctactccgg 11400

ttcgtgctgg ctacagtagc gactacggtc gacaccaata ctgcctggac ggatctggcg 11460

ggtgggcatg gatccggggg aaactccagg ccggcgtggc ggccgcacca aagtcaacgc 11520

ccttggcgcc gattaccttc ctggaggctt cggtgtggat catacgcccc ccacctctac 11580

catgagcgca agcgaaagcc tctgttcctc tgtttgggcg acgatgacac tttggtgtca 11640

tgttccttcc tgaaggcatc ggccgaggac cgctcagggt ggtggagttg ctggtagttc 11700

ggagtcgaca cgagatggca tgtaggtgga gcagtgtgcc atcaacagta tcatcgacgg 11760

tgggtctcgg cggcatggcg cagtggagtc tcggcgtccg atgcgcggag atggactcgc 11820

gcaggaggag gtagctgtct ggcgtcgtgg tggcgtcgac ggtagctaga ccgtgcaagg 11880

gagatgcaac agtacaactc tgaagatgga ttggtggcag gtggctgcgg cagcctcata 11940

cccggcaggc gtcctggttg aggagtgcgc tggactggta gcaggtgccc catacccggc 12000

aggcgtcctg gttgaggagt gcgctggact ggtagcaggt gccccatacc cggcaggcgt 12060

cctggttggg acctcaggtc ttagatgttt aggtttggct gcgatgtctg tttggtatta 12120

ggcccagact atcagtgccc cttcatcaat tggataggtg tagcgacaat tattgcttag 12180

acggtggctt tagtcttgct gttgtatgac tttgtaaggt cttatgagaa taattaataa 12240

agtggccgta tgcatcgccc agatacagag gccgggggtc atcctccttt tcttaaaaaa 12300

aggaactgct tgcaaaaata aaaataaaat tgaacaattt aaagttcaat aagctagctc 12360

cttgctcatt gatctctcca tgtctacttg ttgtgttact aggtcaagga tctcgtgtaa 12420

ttgattggca aatgcgctac aaattgatca aagggacttg cgcaggctta cattaccttc 12480

acaagggccg tgcaggttgt ccaattgttc atttgaattt aagcccgtca aatgtattgc 12540

tggaccacaa ctacatacca cgcatcacag ggttcgattt ttcgaagctc attggtgaaa 12600

agaacaccaa atcagtggta cttaagctga atggacccat gtatgtatgc tctcagtgct 12660

actggtttaa aattagctct tgaatttgct catgatacat gtctatgttt tggaaaaatg 12720

tcttatgttt tgtggcagat cggtttagct agtctttttt ctgtgagaaa cgtttagcaa 12780

gtctattgac cgtaatatgc tttaattaaa ctgatgtgtt catatatttt tgcagagcgt 12840

acctgccacc ggatttcttc cattcgaagg gtactgatct taaatatctt gctacggtag 12900

atatatacag cttgggtctt atgattttag aaatcgcaac acaacaagag atcaaaggca 12960

tccatggagt gcttattaag agtgtaagac aaatttatta accctctgat catgagatag 13020

cttttattgc ttgacataaa agaacaaaaa aattcaacct tttaaaactt tgatgatcaa 13080

atatactcta cagatagagg aaaactggag ggaggagtca caaataacac ggctgtatac 13140

ctcactaggg gccgacgagc tgcggcaagt aaaaatgtgc attgatattg gcctagactg 13200

tgtcaagtca aaccctgaaa agagacctac agctggggcc atcatgctct ggcttgacaa 13260

agagagcaaa ccggtcccag tttcaagggc aggtgcagga gtgctgccaa gacctccggt 13320

ccctactaat atcaaccatg caggtcgcat ccaaggtatt ccgattgaga agtctcaagt 13380

gttaattcct tcgtttgcat gcaatgaata ttcttcggtg aaaatacaaa atcttcatct 13440

acttctgttt atgtattact aagcagccgc aagctattcc ctacttctca attgttaatt 13500

ccttcattag catgcagtga atattctttg gtgaaaattg catctatgaa aggaaattaa 13560

aatacagtgt cttcatctat tactatttct attcatccaa gctgatcagt aaaagcatcc 13620

acatgttata agggcaatct atatgtggta tttaaaatgt tatttctgtc gcttttcaca 13680

tcgtatatgc aatctaagat aatgctctcc ctctcactgt aaataaatat gttaccagaa 13740

aaggagaagg cgggattcct gaaacgacac ttcggatgga agaagtaacc acctgcgctg 13800

gcttgtattc ctgtgaatat tatagatggt tcgacaaagc tcgtggttaa ccgaaggagg 13860

atatttgaga gcttttgtgt tagaacatgg ccatcttgtg cgtccgcagc agccggggtc 13920

atcaggaggg agtgctcact gcatggacca gatcacgctc tgtcagccat gggagtcgtg 13980

cgcacatagt gccacacatg taacgtttag ttgtgtgatc tgaactgtta tgtgtcgtgt 14040

aacctacctc atgtgtgtgt atgataaaga aagaaccaca tcagtggaag agttaaacca 14100

atcgtatggt atgacaggtg agacgtcaca tatgtggaag caaaaaagag ttggaggtaa 14160

ggtggttttc gtacatactg gttctgatcc ctctcatatt tttgtatcct tattatctac 14220

tccctctgtc ccataatgta agagtgtttt tgacattagt gtcaaaaact gtgtcaaaaa 14280

cgctcttaca ttactggacg gagggagcat gtaagtttcg tattaatcgt actatgcgcc 14340

atcttgctct atgaatccct atgcgagact tctttcttct cacaattgat ttattatttt 14400

atggtaatct tgtttcacat ttattgacgt gattttatca ccatatcttg gtgttctttc 14460

cttaaacacc caaacatatc cgaaaatggt ttcccacgaa aacaggcaaa agaaaggtgc 14520

acaagcacgg taaaatccgg gaaagcttac tacgtaggca caaaacaaag ggtaacaaca 14580

tcataaaatt tggactcatc gcaactcacg aggggctaag tgctagcatg cctcgtgcac 14640

aagatggggc tgcttctggt ccacctagct agctccaaca atagtagcct tggctcacat 14700

ctacactact attaaaaaaa caaacataaa ctccctacag ctacaccaac aactgtacac 14760

gcgattatca agaacgtcag accaatctaa ttaaatcaaa tccgagagtc tatattatat 14820

caatagtctg ccatacaagt taacggtcca gattaaatgt tctgccgggg cagaccacct 14880

cgcgcacctc tttgtccaca attaatgggg atatatggta accaccacgc gcacctcttg 14940

gtactcaatt agtgaggata ttaatcccgt aattttctct ctggcctttg ccttagttgt 15000

tgttaataag tgccttgcgg ttactcctct gatgccccaa ggaccgctgc cgcctacttc 15060

tcctcctctg ttgccgagtc aattgcaaga aaccaccaca tttgcggcta ggtttgcaga 15120

aaaccaccaa ctcgttaatc cgttgcagaa aacaccgaaa aatttgttaa gtcattgcaa 15180

aaagcactga tcggatgatt tggcccgttt aatcactttc ttacaagtgg ggccagattg 15240

taaggaattg acttagcaaa aaaataacac atacacccct agatctaaaa aacaaaagca 15300

atcagaccct cccccgtgga acactgacgc cttgtacact acgcgtcgcc gcggcgctgc 15360

tgctatccgc cgccgctatg ctccgggccg ggaggatgag ggaggaggag cccagctggt 15420

tcgggcgctt cgacgaggac ctgccgtcgc cggacgagct cattccgctc tcacactggc 15480

tcatcacccg cgatctcccc gccgccttca acatccccac gcacggggcc ggccgctcag 15540

cgatcttggc aaaggaaaga gggagcgagg cgtcgccggg gaacacatca atgaaggac 15599

<210> 2

<211> 2682

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgggcggat acgagttcca gagggcggag ctagatgcac tggaaggcgt cgtacgcgat 60

ccaactgcgg agccaatgag tctgacgttg ccgcttctca ggcacataac aaatgatttc 120

tcccctgaat ttgaaattag taaagatgat tctgcagtgg tttacctggg ggtgcttcca 180

agtgggttcc gtgttgctgt caagaagtct cactttcgtt tttgcttgga tgatgaagat 240

gcattcacaa atgaagtttc tattgcaatg aaggctgctc ataagaacac agtgcgagtc 300

ataggctact gtcatcacac gcatgagcaa attgccgaat acgaaggaaa acaagttttc 360

gcagaggtca gagaaaggtt gatctgtacc gagtatgtgc ctaacggacc ccttagtgga 420

catatcgaag gtaagatatg tgcgcaaatg gatggatacg agttccagag ggcagaacta 480

gatgcactag aacgcgtcgt acgcgataca agtgcggagc caatgagtct gacgttgccg 540

cttctcaggc acataacaaa tgatttctcc gatgaatctc gaattggccg aggtggattc 600

gcagtggttt acctgggggt gcttccaagt gggttacgta ttgctgttaa gaggcttagc 660

aatattgctt atatgaacga aagtgcattt caaaatgaag tgtttatcac aatgaaggcc 720

actcacaaga acacagtgcg attcatgggc tactgtagtc aaatacaagg taaactcatc 780

gaacacgacg ggcaacatgt tttcgcacag ctcgaggaaa ggttgatctg tgtggaatat 840

gcgcctaaag gaacccttga tgcacatatc ggtgactatg gtgaacttga ctggaaccag 900

cgttatcaaa ttctaaaagg aatttgtcaa ggtttgcatc atctccatga cgaaatgcac 960

gtttttcatg gagatatcaa accagccaat atattaatag gggataacct tgtgcctaaa 1020

atctatgact tcggtctctc ccagatgttt gaagaagaag aaacggaacg tattgttgaa 1080

aatatcgccg gaacattcgg atatatggca ccggagtttt gtactaataa tatggtgtca 1140

tttaaggctg agatatacag tttgggcgtt gtgatcgggg agttattgat cgggaagtgg 1200

tttgatgagg atgtgagaaa actatttgta cagcaactta agggtttgag aaaaacattg 1260

gtaaaagaag gagcgttttc atcatgggaa aacaaatacc accaagttag aacatgtatg 1320

gagattgggc aggactgcat agaccccaac ccacataaaa ggcccacttt gttggagatt 1380

atccagcggc ttaatgaagc ggaagatatg aactattctg cagcatcact ttggcagtca 1440

ggagacgagg aatccgattt atcggataca gaagctttgg agacagagac aacatccgag 1500

tttcttccaa gtgacgaaga acccgcctct gtgggcaaga ccggagaaac aagcacacag 1560

gagcctgata aaccggacct aataagtaag ttgccagcat cggtggacct gtctgaccta 1620

aaagtcctgg agaaaatcac agatgatttt tcacacgaaa gaatagttgg gaaggacggt 1680

acattcaaag gttgtcataa ggcatttgtt tataagggtg acattccact tagagaaatg 1740

atagccgtga agaggttaat tggagtggag attccatttg aaaagtttaa gagggaagca 1800

gaacagttca ttagtctcga tcataagaat atagtaaagg ttgccagcta ctgccacgac 1860

cagtctagag gacatagact ggtacagttc aaaggaaaac cgctaccaca actctttaac 1920

ggtcccgaac aactgctctg ctatgaatat atgcacaacg gaagccttcg cgactatctt 1980

atgggtcaag gatctcgtgt aattgattgg caaatgcgct acaaattgat caaagggact 2040

tgcgcaggct tacattacct tcacaagggc cgtgcaggtt gtccaattgt tcatttgaat 2100

ttaagcccgt caaatgtatt gctggaccac aactacatac cacgcatcac agggttcgat 2160

ttttcgaagc tcattggtga aaagaacacc aaatcagtgg tacttaagct gaatggaccc 2220

atagcgtacc tgccaccgga tttcttccat tcgaagggta ctgatcttaa atatcttgct 2280

acggtagata tatacagctt gggtcttatg attttagaaa tcgcaacaca acaagagatc 2340

aaaggcatcc atggagtgct tattaagagt atagaggaaa actggaggga ggagtcacaa 2400

ataacacggc tgtatacctc actaggggcc gacgagctgc ggcaagtaaa aatgtgcatt 2460

gatattggcc tagactgtgt caagtcaaac cctgaaaaga gacctacagc tggggccatc 2520

atgctctggc ttgacaaaga gagcaaaccg gtcccagttt caagggcagg tgcaggagtg 2580

ctgccaagac ctccggtccc tactaatatc aaccatgcag gtcgcatcca agaaaaggag 2640

aaggcgggat tcctgaaacg acacttcgga tggaagaagt aa 2682

<210> 3

<211> 893

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Gly Gly Tyr Glu Phe Gln Arg Ala Glu Leu Asp Ala Leu Glu Gly

1 5 10 15

Val Val Arg Asp Pro Thr Ala Glu Pro Met Ser Leu Thr Leu Pro Leu

20 25 30

Leu Arg His Ile Thr Asn Asp Phe Ser Pro Glu Phe Glu Ile Ser Lys

35 40 45

Asp Asp Ser Ala Val Val Tyr Leu Gly Val Leu Pro Ser Gly Phe Arg

50 55 60

Val Ala Val Lys Lys Ser His Phe Arg Phe Cys Leu Asp Asp Glu Asp

65 70 75 80

Ala Phe Thr Asn Glu Val Ser Ile Ala Met Lys Ala Ala His Lys Asn

85 90 95

Thr Val Arg Val Ile Gly Tyr Cys His His Thr His Glu Gln Ile Ala

100 105 110

Glu Tyr Glu Gly Lys Gln Val Phe Ala Glu Val Arg Glu Arg Leu Ile

115 120 125

Cys Thr Glu Tyr Val Pro Asn Gly Pro Leu Ser Gly His Ile Glu Gly

130 135 140

Lys Ile Cys Ala Gln Met Asp Gly Tyr Glu Phe Gln Arg Ala Glu Leu

145 150 155 160

Asp Ala Leu Glu Arg Val Val Arg Asp Thr Ser Ala Glu Pro Met Ser

165 170 175

Leu Thr Leu Pro Leu Leu Arg His Ile Thr Asn Asp Phe Ser Asp Glu

180 185 190

Ser Arg Ile Gly Arg Gly Gly Phe Ala Val Val Tyr Leu Gly Val Leu

195 200 205

Pro Ser Gly Leu Arg Ile Ala Val Lys Arg Leu Ser Asn Ile Ala Tyr

210 215 220

Met Asn Glu Ser Ala Phe Gln Asn Glu Val Phe Ile Thr Met Lys Ala

225 230 235 240

Thr His Lys Asn Thr Val Arg Phe Met Gly Tyr Cys Ser Gln Ile Gln

245 250 255

Gly Lys Leu Ile Glu His Asp Gly Gln His Val Phe Ala Gln Leu Glu

260 265 270

Glu Arg Leu Ile Cys Val Glu Tyr Ala Pro Lys Gly Thr Leu Asp Ala

275 280 285

His Ile Gly Asp Tyr Gly Glu Leu Asp Trp Asn Gln Arg Tyr Gln Ile

290 295 300

Leu Lys Gly Ile Cys Gln Gly Leu His His Leu His Asp Glu Met His

305 310 315 320

Val Phe His Gly Asp Ile Lys Pro Ala Asn Ile Leu Ile Gly Asp Asn

325 330 335

Leu Val Pro Lys Ile Tyr Asp Phe Gly Leu Ser Gln Met Phe Glu Glu

340 345 350

Glu Glu Thr Glu Arg Ile Val Glu Asn Ile Ala Gly Thr Phe Gly Tyr

355 360 365

Met Ala Pro Glu Phe Cys Thr Asn Asn Met Val Ser Phe Lys Ala Glu

370 375 380

Ile Tyr Ser Leu Gly Val Val Ile Gly Glu Leu Leu Ile Gly Lys Trp

385 390 395 400

Phe Asp Glu Asp Val Arg Lys Leu Phe Val Gln Gln Leu Lys Gly Leu

405 410 415

Arg Lys Thr Leu Val Lys Glu Gly Ala Phe Ser Ser Trp Glu Asn Lys

420 425 430

Tyr His Gln Val Arg Thr Cys Met Glu Ile Gly Gln Asp Cys Ile Asp

435 440 445

Pro Asn Pro His Lys Arg Pro Thr Leu Leu Glu Ile Ile Gln Arg Leu

450 455 460

Asn Glu Ala Glu Asp Met Asn Tyr Ser Ala Ala Ser Leu Trp Gln Ser

465 470 475 480

Gly Asp Glu Glu Ser Asp Leu Ser Asp Thr Glu Ala Leu Glu Thr Glu

485 490 495

Thr Thr Ser Glu Phe Leu Pro Ser Asp Glu Glu Pro Ala Ser Val Gly

500 505 510

Lys Thr Gly Glu Thr Ser Thr Gln Glu Pro Asp Lys Pro Asp Leu Ile

515 520 525

Ser Lys Leu Pro Ala Ser Val Asp Leu Ser Asp Leu Lys Val Leu Glu

530 535 540

Lys Ile Thr Asp Asp Phe Ser His Glu Arg Ile Val Gly Lys Asp Gly

545 550 555 560

Thr Phe Lys Gly Cys His Lys Ala Phe Val Tyr Lys Gly Asp Ile Pro

565 570 575

Leu Arg Glu Met Ile Ala Val Lys Arg Leu Ile Gly Val Glu Ile Pro

580 585 590

Phe Glu Lys Phe Lys Arg Glu Ala Glu Gln Phe Ile Ser Leu Asp His

595 600 605

Lys Asn Ile Val Lys Val Ala Ser Tyr Cys His Asp Gln Ser Arg Gly

610 615 620

His Arg Leu Val Gln Phe Lys Gly Lys Pro Leu Pro Gln Leu Phe Asn

625 630 635 640

Gly Pro Glu Gln Leu Leu Cys Tyr Glu Tyr Met His Asn Gly Ser Leu

645 650 655

Arg Asp Tyr Leu Met Gly Gln Gly Ser Arg Val Ile Asp Trp Gln Met

660 665 670

Arg Tyr Lys Leu Ile Lys Gly Thr Cys Ala Gly Leu His Tyr Leu His

675 680 685

Lys Gly Arg Ala Gly Cys Pro Ile Val His Leu Asn Leu Ser Pro Ser

690 695 700

Asn Val Leu Leu Asp His Asn Tyr Ile Pro Arg Ile Thr Gly Phe Asp

705 710 715 720

Phe Ser Lys Leu Ile Gly Glu Lys Asn Thr Lys Ser Val Val Leu Lys

725 730 735

Leu Asn Gly Pro Ile Ala Tyr Leu Pro Pro Asp Phe Phe His Ser Lys

740 745 750

Gly Thr Asp Leu Lys Tyr Leu Ala Thr Val Asp Ile Tyr Ser Leu Gly

755 760 765

Leu Met Ile Leu Glu Ile Ala Thr Gln Gln Glu Ile Lys Gly Ile His

770 775 780

Gly Val Leu Ile Lys Ser Ile Glu Glu Asn Trp Arg Glu Glu Ser Gln

785 790 795 800

Ile Thr Arg Leu Tyr Thr Ser Leu Gly Ala Asp Glu Leu Arg Gln Val

805 810 815

Lys Met Cys Ile Asp Ile Gly Leu Asp Cys Val Lys Ser Asn Pro Glu

820 825 830

Lys Arg Pro Thr Ala Gly Ala Ile Met Leu Trp Leu Asp Lys Glu Ser

835 840 845

Lys Pro Val Pro Val Ser Arg Ala Gly Ala Gly Val Leu Pro Arg Pro

850 855 860

Pro Val Pro Thr Asn Ile Asn His Ala Gly Arg Ile Gln Glu Lys Glu

865 870 875 880

Lys Ala Gly Phe Leu Lys Arg His Phe Gly Trp Lys Lys

885 890

<210> 4

<211> 9704

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcaattgttg ctgtaatgtg gtactatgtt tccatagagt gccacttatg atgtggtctg 60

tagctacaac ttttcacttg gcatgcaaca gttctgtagg ccatgctact gctgctttgg 120

catgcatttc acttgttgca atgctgctgc tgctgctgtg cttgccatgc tgctgttgtt 180

gtgcactact ctagatagca gcagtagtag atattcaatt ggcagttaac atttaaattc 240

ataaaacctc agtgcactga atttttgcta aatagataac tgaatttttg ttaacattta 300

aattcagtta actgaagatt cagttaactg aatttgtagt taactgaaga tatctcattt 360

aaattcaatt aactaaagat tcagataact aaatttgtag ttaactgaag ataactcatt 420

taaattcagt taactgaaga ttcagataac tcagtttgta gttaactgaa gatttctcat 480

ttaaatttag ttaactgaat cttcagataa ctgaacttca gttaactaca aactaagtta 540

attgacactg taaaaattgc acttatctgg agacattcag ataactagta acactagaag 600

cagtcataca gatttagtta actaaaagca gtcatacaaa ttcagtgcat tacataatac 660

tggcattaca ccaacaaatt cagtacaact aattaataga tctccttcaa tgaattactc 720

aaattcatct aagatctcct tcaccctcct tatcttgctc ttggtctctt ccttgtgcct 780

gaacaaatca ccaatcatgt actctagttt cttcttctcc ttcttcagct catccctgtg 840

tgacaccact ttgtccatct cttccttcat cttgtccatc tgttgcttca tctcatccct 900

ctctttctct gccttagccc tcacaacctg atgaatgcta gtgttagatt tatcagacaa 960

cttcttcttc tcaagctctt tctttaggtc agaaagagca agtcttgcat tgcccaactc 1020

agtaattgcc tgctccttgt cagccaccat cttagcaaaa tctagcttaa aaaacctcag 1080

atctttttcc atcttttcct tctctctcac aaccctaaca ttttcttccg caagaaccaa 1140

attctccctg atccttagct tgttctcatc atcatacatg ccccaaaccc tagctaaact 1200

catcttcaga gtggcaggcc attcagggtc aatccactcc acaaagttgc atttaggtat 1260

ttcctaccaa ataagaaaga aaacaacttt agataaatga aaaagcttgg agcagtattg 1320

attcagttaa attcatttaa attcagttaa gttcacttaa ctgaatttaa atctagttaa 1380

gttcacttaa ctgaatttaa atccagttaa gttcagttat ttcatttcaa ttcagttaag 1440

ttcagttatt tcatttaaat tcagttaagt tcagttagtt catttaaatt cagttatgtt 1500

cacaaacaag atgctgttaa ctcaaaaatt cagttaagtt cacaaactag atgctcttaa 1560

ctgaaaatgc actcctccac agttacatgg cacactctta tacagatcat agtaagatga 1620

cacattgcaa gtttggattt aactgtagat ctactaacct tttgtgcaca agcaagatac 1680

ctccttccac tatcaactga ttcaaaggac acaaacttct cacacacaca atggtgttca 1740

catctagctg caagatctgg agcaaggcct ctccactcag agcagaaaat ggtggcagga 1800

gcaggagcct acaacattgt gtacaacata ttctagtcag caaagaggca ggcatcgcat 1860

acctaactac tgcatcatct atgctgaaat tttgctactc aagaacatac ccccttcccc 1920

atttttgctc aatccctaac tgccagaggc atagtcaaga actaacctca cttgtcacag 1980

agtagccgtc ggacgacgag ctggatcctt cactccagga taccatgggg gcgagctgga 2040

gggcggcgtt gagctggagg cggcggcgag ctggacggcg gcggcgagct tgctggcggc 2100

gtggagaagc tgctgctgga gctcaggggg gcagggggta gatggggaac gagtggagct 2160

ggagctggag ctagaccgga cgccaactca attccgacag atttaattct ggtgttgtgt 2220

actgcgggtt gattagagga aacagcaggg gggtttctgc aaaagtgtgt gcgacgaccg 2280

ggccgtccac ctggctgcca gttgtccagt tgccattatc ctgggactaa aatgtcacat 2340

tgactgcaag ttagggtatg gtggggttga gttttgtaag tttgggatta aattatcaca 2400

ttctgggcaa gttagggtac ctggagtgct tttacctcat aataaattgc ttctttgcta 2460

ctccctccgt tccaaaatag atggctcgac tttgtactaa ctttagtaca aagttagtat 2520

aaagttgggt catctatttc atcaattttt tttaaagctg gagctagctg aaaacatttg 2580

aataaaatga atttgatggc atcgagctga ttttagagca atcctaacca atcccttagg 2640

gcatctatgt tagtcttgtt gataaaatat tcatatcatc aaccaacaag ctattataca 2700

accattccaa tagattgtat ctaagctatc caatagatga tgagaaaata aatgtgattg 2760

ctctttattt caccttggag cttgtgcaaa ggttgttggt tattttacat ataactttgc 2820

cctctcttca catttattac atgccacgtt atcactatgt cctagatggc caaatttaca 2880

gacacctatt ttacaactgt tggagatgcc cttaatccca tctcaacgga cgtcgcctat 2940

gtgagaggca ctaattagca gacctactct gctctctgag tcttgattga gccattgacc 3000

acgaacacac acacgggaca ggataaggca gagaagctgg tgagcaggcg cgagggcggc 3060

agcaatggag gagatcgtgc ttggactgtc caagacggtg gtggagggga cgctggtcaa 3120

ggtgaaggcc gcgattgacg aggaggcgaa gctgaagctt gccgtgcaga gcgacctggt 3180

gttcatcacg ggggaattcg agatgatgca gtcgttcctc aacgtcgccg acgcggagcg 3240

catcaagaac aacgccgtca agacgtgggt gcggcagctc cgcgacctgg cctacgacac 3300

cgaagactgc atcgagctgg tggtccacct ggatcccaag cccagatggt ggcgccgcct 3360

gctggtcctg ccttgcctgc cggcggtgtc gctgcccatg gacaacgcgg cggcggagat 3420

aaaggagctc aaggaccggg tggagttcgt gagccagagg aacatgcgct acaagctcat 3480

caccgacttc ggcggcgcca agtccgtcgc gcagcagcag cttgaccggg ccgccggagc 3540

tctcgacatc gccgtggagg aggcggcgaa gaaaggtcgt agcttggtgg atctgaccga 3600

gttgatcccc agaatggaag accgccctga gctcggcgtg atctcggtgt gggggaccgg 3660

cggcgacctt ggggtggcgt ccatcgtcag gaaggcctac gacgaccctg aaatttgcaa 3720

gaacttccat agtcgtggct gggccaagtt gacccaccct ttcgatccgc ggaagatcct 3780

ccggagcttg ttcattcagt tctgcactaa cactgctgct ccacagaagc aaggggaaac 3840

tctggatgta gattcccttc taaggatgga gaagacggtg gtggaagaag gggagctggt 3900

caagcagttt gtgagtcatg tgagcaccca caggttcctc gttgtcctcg aaggcgtgtc 3960

aaccatggcg gaatgggatg ccctccggat gtacctgcca gacatgggta acgggagcca 4020

gatcatcgta tccacacagc attttgacat cgcgagcttg tgcaccgggc agctgcacaa 4080

agtttcagag ttgagaaaat tcacacctga ccactctgtt tgtgtctttt tcaaggaagt 4140

atgtaattaa gcacaccgtg acactttatt cacttgtcat ttattcattg tctgaagaaa 4200

tgcaacgctg gaggtgtaac ttttgttgat ttgtcaggtt tccggaggtg atgatcctgg 4260

aaatgcaatg ttggagggag atgacgaaac tgaacttatt gggcgcgaca cagaagagga 4320

cgagcttatg gagcagattg atgaggtttc ccgtgtgatc tccgtatggg ggattgctgg 4380

tgtaggaaaa tcggcacttg tcagaagtgc ctactgcaag tatctgcagg accgccccaa 4440

cttcgccggg ttaaatctga cctacataca cgggcgcgtg aacgtgcccc atcccttcaa 4500

tctgagggag ttctgccgca gcttgctcct gaacttgtcc tctgaacctg ctaaaaccaa 4560

agaggacgcc gtcgctgaac tggcaaacat gaccaatcca attgatgtct gccgtaagct 4620

tcttagcgac gatcaacagc agaagcagtg ccttattgtt attgatgacc tgcagttcac 4680

tgaagaatgg gacagaataa aacaagcctt gtcatttggt aaagaatgtt gtatcatagt 4740

tgttacaaat gattcaagtg ttgccaaata ttgttcaggg caagatcaga aactcatgtt 4800

caacgtcaaa ggtcttggtg acgagcatgc ccttgacctc ttcaacacgg tactcgctgc 4860

tctaaaataa ccattcctgc aaattcaact ccttattaga gtcctatatt tactttttct 4920

gtataccaca gcacggatct tcagtcccag atgtagctat agagcatgtt tggttcatag 4980

tcatactcat accgtgtcta attttgccac tttcttgtat agcagcctgt atcctcagcc 5040

agtctcacac tttcgcaaaa ccgggggcaa agtattaact gccaacttct ttgtcggact 5100

gaataaaaat gtatcaaact taagtcatgc tttttggaac acggcaaaaa caacatggta 5160

tacatacaac cagtacagga acttatgtga tggttagcag gatagtatag gaataatgaa 5220

ggcatgaatt agccagaagc ggtgtttgaa tgcttcaggg gaaaaatagt tacatatttg 5280

taaagtacct tccaaaattt atagaaaata attcttctat gcagttgtac atttcaaaga 5340

ccgtgactaa ctatgtcaag tttggccact tttcaataaa attccggtag ctagggaacc 5400

ctctctatcc cccatgacca ttcggaaaga aaaacgaccc tagctatttg gaactctcct 5460

tatgactgaa ttctcaaatt ataaacaatg ctcattgctc gtaattaaca tatcaaggtc 5520

agatgccaag aaataagatt aggataccag cgttactctc tctgttctaa aatagattat 5580

tcattctaag atgactttat caacgattca atgttgcacg attttcacta cacaactttg 5640

attgttatca tttggcaagg ctatgtaaca gaaaaatagt tttcattaaa aaactaatga 5700

tatcattctg tgtgatgaga agtgtttttt tattaatcag tggtcataga tagagaagtt 5760

tagttggaca attcctaaaa ccacagttta ttttcaggta tatgacggcg tgggtaacca 5820

catcacacgg gatgaggaca tgatcaatca gtcgaagcta atgttaaaca aatgcggcgg 5880

actacccaag gtgatagttg caattggttg tttcttggcc aagagtctga attgggaggc 5940

catgaatact aactttattc accagttgga aaacaacccg gagctggcta gtgtacatag 6000

catgtttagt tggctagact cctacttcca caattgtcct gacgaactca agccatgcat 6060

cttctatttg tcaatcttcc ctcgacgcca tggcattcgt cgaaggcgtc tggtgaggcg 6120

gtggattgcc gagggctact caagagacac cgacgggaat ctcgcggaag tgaacgggga 6180

aaattacttc tccaggctcg tcaacctcag catgctcaca gatgctgagc gtgatgtcaa 6240

cgtggctggg acagcgactg gggctggtac tgggaggaga atggccatgt gcaacgtcaa 6300

cgatttcttc cgggagtaca ttgtgtcgcg gcgaatggag gagaaccatg tgtttgcact 6360

ggaggggagg tgcagccaga ccacgcggcg cactggacgg cacctggtca tcgacaaaag 6420

ctgggacggg gacgagagcg tgttcaacag gatcgagttc tcgcgactgc ggtcggtgac 6480

ggtgttcgga ccctggaagc cattcctggc ctccgacaag atgagggtgc tccgcgtgct 6540

tgatctggaa ggcactgagg gtctgacaga caacgacatc aagaacatcg tcaaacggct 6600

gcctcgacta aagttcctct ccctgcgagg atgcaagcac atctttcggc tgccaaaatc 6660

cctgggtcgc ctgaggcagc tccagaccct ggatgtgagg cacactgccg tagccgggct 6720

gccagcgacc gtcgtgaagc tacagaagct gcagtatgtt cgtgccggca acacaccaga 6780

ggagtatgcc gtcagcgaca gcacggaatc tagcacctca gtacccacct gtttctcatg 6840

tggccctgtt ggcaatcaca ttgtcggcgt tgaggtgcct cgcggggtcg agaatctgac 6900

caacctgcac acactgggcg tcatcaaagc cactgtggca ggactcaagg agctcaagaa 6960

gcttacccag ctgcgcaagc tcggcgtgtc tggcataaac cggaggaacc acaaagagct 7020

ctgcgccgtc atctcgggcc acggccatct ggaatctctg tcgatatggt ttgacaagga 7080

caccgagagg attgctgacc cttgttcgcc gagcaatgat gacttcaagc ctccagagaa 7140

gctacggagg ctcaaactcc atgggcacac tgacaacctg ccagcatggg ttagcactct 7200

caaaatattt gtcactcaag atcaatgacc tagctcttct gcgtcgacga agaagtctca 7260

ctatgctgca ttaggtatta agttctcttt tgttggcttt ctagcgactg cctatatgtg 7320

ttcctaaact tgaatgtatt tggtgttagt aggtttttgc cctgtagagt gcttcgacat 7380

caattgcact cacagcggtt tcctgccagt gcctcaactc agagctctct tttcgatctt 7440

cttttgctgc tttgtaagaa ctgattgttt ttgttggttg aaagaaaaaa tgggtagaag 7500

tgttaagtag tctacatggt tgctggtcaa gatccatgat ctagttcatc tgcataaatt 7560

aagcggttcc tatatggaaa cctgttctga aggtttgcat gtttgctgga gaaagaaaaa 7620

ctagcttgcg ggagaaagtc gatcatcaga aaactgaaga attctgttct gaaggtcaat 7680

atctttttga gttaaaaatc ctgttatttt ttgccgaagc tcgagatcag ccgcatcttc 7740

gtttcttctc ttgctagttc atccatgatc tcttgttata ttaaaaataa aaatcaaaac 7800

cattaacttt gttgaatgtt tctccagccc cgcgtaaact atatacacat tgcatgaact 7860

atacacaaaa aactgcccct tgaaagttac aactctaaaa catcaaggca aaacagagca 7920

ccgagcacga agagcagaaa acagagtaac cgatgttcca gcagcctgca agtgacgcca 7980

gttgacgcct gctgcaagag atcaattgga agaaactttc gccattgcag ctgccacgca 8040

aatgtcttca gtaacttgag cattactttc ttctgaaaag tcccctcaat ggcgtctgtt 8100

tctccttttc tgacaaaata aaggttacaa aaccagtgag atcatcaaca aatgtctatt 8160

agcttcacca gatcggaact gcggttcact tttgagtatc cattgtggct gcattaccca 8220

tcgacttaaa agtactccct ccgttccaaa atagatgact caactttgta caaagttagt 8280

ataaagttgg gtcatctatt ttggaacgga gggaatagat gggaacactt ttttttccgg 8340

aaacagtttt ttttcttcat ttgagcatac tgattttttt tttcaatttt tgttgatagt 8400

ataagaagga attaacactt caagttgtgg gatcggagta ccttgtatgt ggtcatctgc 8460

aggggtggca ttagcacgga gtggaggttc ggcaactcat ggtctttgac ctgggactgg 8520

tttgctccct ttgtcaagcc atcgtatgat ctccccggca gtaggtctgt ctccaggcat 8580

tgactttaca caatgtaggc cgatatcaat gcacattttt acttgcgctt ggaatttatc 8640

ctccagtgag ccatacaacg ttgctatttg tgaatcttgc ctccaattgt tctcgaccta 8700

catgatacat cagagccaag atttaaagac aaaataatgc cacctattat ataatcctaa 8760

gtcctaagag tatacaactt atagattcac aaaaaactta atgaatactc cctccattcc 8820

acaatgtagt gcctatagat ttttatgaaa gtcaaacttt gtcaactttg accaagtgta 8880

tagagaaaac tgtctacatc tacaatacca aatatgtaca ttctgaaaat ataacttatg 8940

atgtattcaa tgatgtgctt ttggtattct agatgtattt tcttttcttt ataaacatgg 9000

tcaaagtttg taatgtttga cttttgcaaa aaatctatag gcactacatt atggaacgga 9060

gggagtatat tgtatctcta aaagagatga tagtaatact agccatcgga tggcgtgaga 9120

tggatggtaa tattctagta tatctcacct ttcaagaggt aacagtaaca ctagccattg 9180

gatgacgcga aatggacggt tcgtattaat tgggaccatc ttacaacttc tcatctcttt 9240

actatgctca atatacttca ttaattatcc tacgcccaac gggagtaaaa ttataaaaaa 9300

tcatgtgaat ccttattttt ttgcaatcta ctgtagtact tacatgtaca tatatgcagc 9360

acaaactatg tgaaacatat agactcaaat gaagaataca tattagcttt tttatgtaca 9420

cacgtgtata agtgatgagg taatgaaaat acgtacacac agaggacaaa acattttctt 9480

ttttatgtac acacgtagat aaaagaggaa ttttccttgt tattttccct taatcaacaa 9540

aagcattgca tgatcggaag attgaataag ttttctcagt cttaataagt atgtcatggt 9600

tgcccttgat ctcttgatgt gttgcaatct ctagaatcat aagacccaag ctgtatatgt 9660

ccaccgtagc tagatatttg aggtcagtac ccttggagtg gaag 9704

<210> 5

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aattcgagct cggtacccgg gttgttggcc aatcgttatc a 41

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

agacccctag tttcctgatg ata 23

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tatcatcagg aaactagggg tct 23

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcatatattc atagcagagc agttg 25

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

caactgctct gctatgaata tatgc 25

<210> 10

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

ctgtgatgcg tggtatgtag ttg 23

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

caactacata ccacgcatca cag 23

<210> 12

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgcaggtcga ctctagagga tcgtccttca ttgatgtgtt cc 42

<210> 13

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cgaattcgag ctcggtaccc ggggcaattg ttgctgtaat gtggta 46

<210> 14

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aaacgacggc cagtgccaag ctcttccact ccaagggtac tgacct 46

<210> 15

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tctagaggat ccccgggtac catgggcgga tacgagttcc a 41

<210> 16

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ttcgagctct ctagaactag tttacttctt ccatccgaag tgt 43

Claims (8)

1. An application of protein in regulating resistance of wheat to powdery mildew, wherein an amino acid sequence of the protein is shown as a sequence 3 in a sequence table.

2. The application of the protein in enhancing or reducing the resistance of wheat to powdery mildew is disclosed, wherein the amino acid sequence of the protein is shown as a sequence 3 in a sequence table.

3. Use of a nucleic acid molecule encoding a protein according to claim 1 for breeding wheat with altered resistance to powdery mildew.

4. Use of a nucleic acid molecule encoding a protein according to claim 1 for breeding transgenic wheat with increased or decreased resistance to powdery mildew.

5. Use according to claim 3 or 4, characterized in that: the nucleic acid molecule is as follows (B1) or (B2):

(B1) DNA molecule shown in sequence 1 in the sequence table;

(B2) DNA molecule shown in sequence 2 in the sequence table.

6. A method for preparing transgenic wheat, comprising the steps of: the introduction of a nucleic acid molecule according to claim 4 or 5 into wheat to obtain transgenic wheat with increased resistance to powdery mildew.

7. A method for preparing transgenic wheat, comprising the steps of: inhibiting the expression of the nucleic acid molecule of claim 4 or 5 in the starting wheat to obtain a transgenic wheat with reduced resistance to powdery mildew.

8. A wheat breeding method is characterized by comprising the following steps: increasing the content of the protein of claim 1 in the target wheat so that the target wheat has an increased resistance to powdery mildew; or, reducing the content of the protein of claim 1 in the target wheat, so that the resistance of the target wheat to powdery mildew is reduced.

Images