CN110527697B

CN110527697B - RNA fixed-point editing technology based on CRISPR-Cas13a

Info

Publication number: CN110527697B
Application number: CN201810503339.1A
Authority: CN
Inventors: 李轩; 荆新云; 张牛冰
Original assignee: Center for Excellence in Molecular Plant Sciences of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2018-05-23
Filing date: 2018-05-23
Publication date: 2023-07-07
Anticipated expiration: 2038-05-23
Also published as: CN110527697A

Abstract

The invention relates to a CRISPR-Cas13 a-based fixed-point RNA editing technology. Disclosed is a CRISPR-Cas13 a-based RNA fixed-point editing method. In the method, when RNA is edited at fixed points, the Cas13a mutant brings the catalytic domain of ADAR2 to a designated RNA position under the guidance of crRNA to finish editing from fixed point A to fixed point I. The Cas13a mutant has no ssRNA cleavage activity, ssRNA binding activity, and is fused to the catalytic domain of adenine deaminase ADAR 2. On this basis, the invention also optimizes crRNA design.

Description

RNA fixed-point editing technology based on CRISPR-Cas13a

Technical Field

The invention belongs to the technical field of gene modification, and in particular relates to a CRISPR-Cas13 a-based RNA fixed-point editing technology.

Background

For most organisms, genetic information is transferred from DNA to RNA and from RNA to protein, thereby completing the control of the phenotype of the individual by the genetic information. The control of the biological individual can be started from three layers of DNA control, RNA control and protein control. A number of different techniques and tools have been developed for the control of both DNA and RNA. The techniques for manipulation of DNA are: 1) DNA recombination techniques for Red/ET developed on the basis of phage Red protein and Rac protein that can be operated in strains of RecBCD-. 2) Relies on homing endonuclease (meganuclease) -mediated DNA recombination techniques. 3) DNA editing techniques based on site-specific recombination, among which Flp/FRT and Cre/loxP techniques are more commonly used in microorganisms. 4) CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) -based DNA editing techniques. CRISPR is a regularly clustered, intermittent short palindromic repeat, an adaptive immunization modality in most bacteria and archaea. Studies on CRISPR systems have developed a range of gene editing tools based on enzymes such as CRISPR-cas9, CRISPR-Cpf1, and the like. These editing tools make gene editing of microorganisms, animals, plants, etc. simple and easy. 5) DNA site-directed modification technology based on CRISPR. The technology utilizes the characteristic that dCS 9 loses cleavage activity but still retains binding activity, adenine deaminase, cytosine deaminase and methylase are fused to dCS 9 protein, and then the adenine-to-hypoxanthine, cytosine-to-thymine and cytosine methylation modification is completed by bringing the dCS 9 to a target position of DNA. The technology can complete the editing and modification of the DNA without cutting the DNA.

However, with the application of these DNA editing techniques, they have also been found to have disadvantages such as irreversible manipulation, mortality due to important gene manipulation, and large toxic and side effects caused by off-target. To solve the short plates existing in DNA regulatory technologies, regulatory technologies for RNA have also been developed in the art such as: 1) RNA interference (RNAi) technology. RNA interference is a technique that induces efficient, specific degradation of homologous mRNA from double-stranded RNA. The RNA interference technology has the advantages of high efficiency, specificity, transmissibility and the like. 2) RNA site-directed base editing techniques. The technology is to fuse the catalytic subunit of adenine deaminase to the N protein of phage. The crRNA with the box B is designed, the box B on the crRNA is combined with the lambda N protein and brings adenine deaminase to a specific RNA target position, and then the deamination reaction of adenine at a specific site is completed. However, this technique uses complementary pairing of double-stranded RNAs to recognize targets, and thus has the disadvantage of low binding force and easy target removal.

Discovery and research of the type VI CRISPR system provides a new approach for the development of RNA manipulation tools. Enzymes of the Cas13 family have targeting properties, such as LshCas13a protein derived from ciliated bacteria (Leptotrichia shahii) are used as in vitro nucleic acid detection tools and in vivo RNA tracing tools; another protein of the Cas13 family, cas13b derived from Proteus (Prevoltella sp.P5-125), was used as site-directed editing animal transcript RNA.

However, there is still a need in the art for further improved techniques of gene engineering to increase the efficiency of site-directed editing of genes.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a CRISPR-Cas13 a-based fixed-point RNA editing technology.

In a first aspect of the present invention, there is provided a method for RNA site-directed editing based on CRISPR technology, comprising taking a Cas13a variant as nuclease at the time of RNA site-directed editing, and (1) the Cas13a variant has no ssRNA cleavage activity, has ssRNA binding activity; (2) The Cas13a variant is fused to the catalytic domain of adenine deaminase ADAR 2.

In a preferred embodiment, the RNA site-directed editing based on CRISPR technology comprises:

(a) Preparing a fusion gene encoding a fusion protein of a Cas13a variant fused to a catalytic domain of an adenine deaminase ADAR 2;

(b) Preparing crrnas targeting the target gene (including cas13a targeting sequence to the binding site and paired sequences necessary for ADAR2 editing function that form double-stranded regions of the editing site);

(c) Introducing the fusion gene of (a) and the crRNA of (b) into a cell to be subjected to gene editing, thereby performing site-directed editing on the target gene in the cell.

In another preferred embodiment, the crRNA has a length of 20-100 bp; preferably 28 to 91bp; or the crRNA contains bases designed for specific editing sites, and the bases are positioned between 15-55, preferably between 18-48, on the crRNA.

In another preferred embodiment, the Cas13a variant corresponds to wild-type Cas13a, having a mutation, deletion or insertion of an amino acid residue in positions 1250-1300 of its amino acid sequence such that the Cas13a variant has no ssRNA cleavage activity, has ssRNA binding activity; preferably, the Cas13a variant corresponds to wild-type Cas13a, with mutations, deletions or insertions of amino acid residues in positions 1260-1290 of its amino acid sequence; preferably, there is a mutation, deletion or insertion of an amino acid residue at positions 1270 to 1280 in the amino acid sequence thereof; preferably, there is a mutation of the amino acid residue at position 1278 in the amino acid sequence.

In another preferred example, the catalytic domain of adenine deaminase ADAR2 has the amino acid sequence of positions 299-701 of the full-length ADAR2 sequence (human, genBank: U82120).

In another preferred embodiment, in (2), the Cas13a variant is at the N-terminus or C-terminus of the fusion protein; or (b)

The catalytic domain of the adenine deaminase ADAR2 comprises the amino acid sequence of 299-701 th site of the full-length adenine deaminase ADAR 2.

In another preferred embodiment, the method for improving the efficiency of RNA site-directed editing does not include: methods for direct purposes of diagnosis or therapy.

In another aspect of the invention, a fusion protein for RNA site-directed editing based on CRISPR technology comprises a Cas13a variant and a catalytic domain of adenine deaminase ADAR 2; and, the Cas13a variant has no ssRNA cleavage activity, has ssRNA binding activity.

In a preferred embodiment, the Cas13a variant corresponds to wild-type Cas13a, having a mutation, deletion or insertion of an amino acid residue in positions 1250-1300 of its amino acid sequence such that the Cas13a variant has no ssRNA cleavage activity, has ssRNA binding activity; preferably, the Cas13a variant corresponds to wild-type Cas13a, with mutations, deletions or insertions of amino acid residues in positions 1260-1290 of its amino acid sequence; preferably, there is a mutation, deletion or insertion of an amino acid residue at positions 1270 to 1280 in the amino acid sequence thereof; preferably, there is a mutation of the amino acid residue at position 1278 in the amino acid sequence.

In another preferred example, the catalytic domain of adenine deaminase ADAR2 has the amino acid sequence of positions 299-701 of the full-length sequence (GenBank accession number: U82120).

In another preferred embodiment, the mutation is from arginine to alanine.

In another preferred embodiment, the Cas13a variant is at the N-terminus or C-terminus of the fusion protein; or (b)

The catalytic domain of the adenine deaminase ADAR comprises the amino acid sequence of the 299 th-701 th positions of the adenine deaminase ADAR 2.

In another preferred embodiment, the Cas13a variant is located at the N-terminus of the fusion protein.

In another preferred embodiment, the fusion protein further comprises a Linker sequence with a length of 3-40 aa between the Cas13a variant and the catalytic domain of adenine deaminase ADAR 2.

In another aspect of the invention, there is provided a polynucleotide encoding a fusion protein of any of the preceding.

In another aspect of the invention, a recombinant plasmid is provided comprising the polynucleotide.

In another aspect of the invention, a host cell is provided comprising said recombinant plasmid, or said polynucleotide integrated into its genome.

In another aspect of the invention, there is provided the use of a fusion protein as defined in any preceding claim, or a gene encoding the fusion protein or a plasmid containing the fusion protein, for increasing the efficiency of RNA site-directed editing based on CRISPR technology.

In a preferred embodiment, the use does not include: use for diagnostic or therapeutic purposes.

In another aspect of the invention there is provided a plasmid for performing RNA site-directed editing based on CRISPR technology comprising the following set of operably linked elements: a promoter having a leader that can be cut out by itself; the DR sequence of Cas13 a; crRNA occupying sequence; ribozymes having 5' -end cleavage function.

In a preferred embodiment, the promoter is a schizosaccharomyces triple promoter and the crRNA spacer is a cleavage site.

In another preferred embodiment, the method is used for introducing crRNA into cells to be subjected to gene editing, and the crRNA has accurate sequence.

In another aspect of the invention there is provided a kit for performing RNA site-directed editing based on CRISPR technology comprising a fusion protein as defined in any preceding claim, a polynucleotide as defined herein, or a recombinant plasmid as defined herein.

In a preferred embodiment, the kit further comprises the plasmid for RNA site-directed editing based on CRISPR technology.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, schematic diagram of dCAS13 a-hADR 2d expression vector construction.

FIG. 2, construction schematic diagram of green fluorescent protein mutant eGFPW58X gene expression vector.

FIG. 3, schematic diagram of construction of green fluorescent protein mutant eGFPW58X gene and crRNA expression vector.

FIG. 4, schematic diagrams of Tf1 mutant and crRNA expression vector constructions.

FIG. 5, crispr-Cas13a based RNA site-directed editing technique for restoring transcripts of mutated green fluorescent protein genes.

FIG. 6, crispr-Cas13a based RNA site-directed editing technique was used for editing transcripts of schizosaccharomyces endogenous gene tdh1.

FIG. 7, crispr-Cas13a based RNA site-directed editing technique, restores the transposition function of the schizosaccharomyces retrotransposon.

In each figure, "gRNA" is equivalent to "crRNA".

Detailed Description

Through intensive research, the inventor discloses a CRISPR-Cas13 a-based RNA fixed-point editing method. In the method, a Cas13a variant is used as nuclease during RNA fixed-point editing, and the Cas13a variant has no ssRNA cutting activity and ssRNA binding activity and is fused with a catalytic domain of adenine deaminase ADAR 2. On the basis, the invention also optimizes plasmids for RNA fixed-point editing and the like.

As used herein, the term "operably linked" or "operably linked" refers to a functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example: the promoter region is placed in a specific position relative to the nucleic acid sequence of the gene of interest such that transcription of the nucleic acid sequence is directed by the promoter region, whereby the promoter region is "operably linked" to the nucleic acid sequence.

As used herein, the term "element" refers to a series of functional nucleic acid sequences useful for expression of a protein, where the term "element" is systematically constructed to form an expression construct. The sequences of the "elements" may be those provided in the present invention, and include variants thereof, as long as the variants substantially retain the function of the "elements" obtained by inserting or deleting some bases (e.g., 1 to 50bp; preferably 1 to 30bp, more preferably 1 to 20bp, still more preferably 1 to 10 bp), or performing random or site-directed mutation, etc.

As used herein, the term "target gene" refers to an endogenous gene on the genome that is the gene of interest, i.e., that is the subject of gene editing.

As used herein, a "guide RNA (crRNA) sequence" is a sequence that is complementary to the reverse of the targeted sequence of the site being edited. It includes the sequence that targets cas13a to the binding site and the pairing sequence that forms the double-stranded region of the editing site necessary for ADAR2 editing function. Crrnas based on this design can help dCas13a recognize the target sequence and bring the hADAR2d to that target position and provide the double stranded RNAs required for the editing site, directing the hADAR2d to complete site-directed editing of RNA editing. Preferably, the length of the single guide RNA target sequence is 20-100 bp; preferably 28 to 91bp.

The invention is based on effector protein Cas13a of type VI CRISPR family, the Cas13a has the function of binding and cutting ssRNA, and a mutant (dCAs 13 a) of the Cas13a is prepared on the basis, and loses the ssRNA cutting activity but retains the ssRNA binding activity.

The invention also selects an adenine deaminase (ADAR 2), and the ADAR2 enzyme has the function of catalyzing adenine deamination on RNA molecules and generating hypoxanthine. The present inventors cut out the RNA binding domain of the ADAR2 enzyme, leaving only the catalytic domain of adenine deaminase (ADAR 2 d). Preferably, the excised RNA binding domain is located between 1-500 amino acids of ADAR 2.

The invention provides a fusion protein for improving the RNA site-directed editing efficiency based on CRISPR technology, which comprises a Cas13a variant and an RNA binding domain of adenine deaminase ADAR 2; and, the Cas13a variant has no ssRNA cleavage activity, has ssRNA binding activity.

As a preferred mode of the invention, the Cas13a variant corresponds to wild-type Cas13a, and there is a mutation, deletion or insertion of amino acid residues in amino acid sequence positions 1250-1300 thereof, such that the Cas13a variant has no ssRNA cleavage activity, has ssRNA binding activity.

The Cas13a variant and the RNA binding domain of adenine deaminase ADAR2 may be directly linked or linked by a polypeptide Linker (Linker). As a preferred mode of the present invention, they are connected by a Linker. The linker comprises 3-40 aa amino acids in length; such as 4, 6, 10, 15, 20, 25, 30, 35aa.

As a preferred mode, the Cas13a variant is located at the N-terminus of the fusion protein; the RNA binding domain of the adenine deaminase ADAR2 is positioned at the C end of the fusion protein. Alternatively, the positions of the two proteins may be interchanged.

In another aspect, the invention provides an isolated nucleic acid encoding the fusion protein, also the complementary strand thereof. The DNA sequence for encoding the fusion protein can be synthesized by full sequence synthesis, or DNA sequences for encoding TAT and LPTS amino acids can be obtained by a PCR amplification method respectively, and then the DNA sequences are spliced to form the DNA sequence for encoding the fusion protein.

After the DNA sequence encoding the fusion protein of the invention is obtained, it is ligated into a suitable expression vector and transferred into a suitable host cell. Thus, the invention also provides vectors comprising nucleic acid molecules encoding the fusion proteins. The vector may further comprise an expression control sequence operably linked to the sequence of the nucleic acid molecule to facilitate expression of the fusion protein. A variety of suitable vectors may be used, such as some for cloning and expression of bacterial, fungal, yeast and mammalian cells. Various vectors known in the art such as commercially available vectors may be used. For example, a commercially available vector is selected, and then the nucleotide sequence encoding the novel fusion protein of the present invention is operably linked to an expression control sequence to form a protein expression vector.

In addition, recombinant cells comprising nucleic acid sequences encoding the fusion proteins are also encompassed by the present invention. In the present invention, the term "host cell" includes both prokaryotic and eukaryotic cells. Common prokaryotic host cells include E.coli, bacillus subtilis, and the like. Common eukaryotic host cells include yeast cells, insect cells, and mammalian cells. In a preferred embodiment of the invention, yeast cells are used as host cells. It is to be understood that the present invention is not limited to the cells defined in the examples.

In a preferred embodiment of the present invention, schizosaccharomyces (Schizosaccharomyces pombe) was used as a host for research. It is a single-cell eukaryotic organism. Compared with Saccharomyces cerevisiae, schizosaccharomyces cerevisiae has more conserved biochemical pathways similar to animal cells, and becomes a model system. Research on schizosaccharomyces has led scientists to make important progress in cell cycle regulation, chromatin structure, histone modification, cell division, and the like. Meanwhile, some new genetic manipulation tools developed in yeast have great influence on scientific development. However, there is currently no tool that allows site-directed RNA editing in schizosaccharomyces. Therefore, the tool for site-directed editing of transcriptomes based on Cas13 enzyme of type VI CRISPR system of the present invention can make up for the vulnerability of this aspect by taking the inferior yeast as a research tool.

The fusion protein, or the encoding gene or the plasmid containing the fusion protein can be used for improving the RNA fixed-point editing efficiency based on the CRISPR technology.

When the complex of CRISPR-Cas13a and crRNA binds to a target sequence, the crRNA has a very sensitive region to mismatch ("seed region"), and the mismatch between the crRNA and the non-target makes the complex of CRISPR-Cas13a and crRNA bind very poorly to the non-target sequence. The CRRNA based on CRISPR-Cas13a has higher specificity and lower off-target efficiency due to the specificity of the CRRNA of CRISPR-Cas13a combined with a target sequence.

The binding force (KD-7 nM) between the complex of the CRISPR-Cas13a (constructed as fusion protein) and the crRNA and the target sequence is larger than that between the crRNA and the target sequence (KD-9 nM). This feature enables the CRISPR-Cas13 a-based fixed-point RNA editing technique of the present invention to have higher editing efficiency.

The site-directed RNA editing techniques of the present invention are capable of correcting mutated proteins within schizosaccharomyces cells, editing multiple copies of genes, making diploid phenotypes of haploid cells, and the like.

The CRISPR-Cas13 a-based fixed-point RNA editing technique of the invention restores the transposable activity of the yeast retrotransposon Tf 1. The technology can also be used for operating and interfering with research on reverse transcription RNA viruses, and provides an effective tool for research on RNA viruses.

The invention also optimizes RNA fixed-point editing and retrotransposon interference technology based on CRISPR-Cas13 a. The invention selects a schizosaccharomyces triple promoter, and RNA transcribed from the promoter has a leader which can be cut off by itself. This promoter is followed by the DR sequence of CRISPR-Cas13 a. After the DR sequence, a crRNA spacer sequence is inserted (place holder with BspQI), and crRNA can be ligated into BspQI cleavage sites. A ribozyme that cleaves its 5' end follows the crRNA insertion site. The purpose of this design is to generate crrnas with accurate sequences.

In a preferred embodiment of the present invention, the modification as above is performed using the pBluescript sk vector as a backbone plasmid. For convenience of gene manipulation, it is preferable that the 1032 th base T of the vector is also mutated to base A, and 2114 base A is mutated to base G, thereby disrupting the BspQI and BsaI cleavage sites of the pBluescript sk vector. The optimal crRNA length used in the present invention is between 28-91 bp. The optimal positions of the bases on the crRNA corresponding to the editing site A are between 18 and 48.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedures, which do not address the specific conditions in the examples below, are generally carried out according to conventional conditions such as those described in J.Sam Brookfield et al, molecular cloning guidelines, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Example 1 Crispr-Cas13 a-based RNA site-directed editing technique for restoring mutated Green fluorescent protein Gene transcripts

1. Expression of dCAS13 a-hADR 2d fusion proteins in schizosaccharomyces cells

1. Construction of pDOAL-HFF 1-dCAS13 a-hADR 2d vector expressing dCAS13 a-hADR 2d fusion protein

In the examples below, the Cas13a variant is referred to as "dCas13a", and the mutation at position 1278 of its amino acid sequence.

A gene for dCAS13 a-hADR 2d fusion protein (dCAS 13a coding sequence is located at the 5' end) was synthesized by a gene synthesis method (Jin Weizhi), and the gene sequence comprises a yeast linker sequence (underlined part) with the following sequence (SEQ ID NO: 1):

in the above sequence, the base in the frame line is the base of the mutant site, and the underlined is the linker sequence. Wherein, the 1 st to 1389 th are dCAS13a sequence and the 1406 th to 1808 th are hDAR 2d sequence.

The pDIAL-HFF 1 plasmid (RIKEN BRC (RDB: 6179)) was digested with NdeI and NcoI. And (3) enzyme cutting for 30 minutes at 37 ℃ and recycling fragments by using glue. The gene sequence of the fusion protein is connected with plasmid which is cut by enzyme to obtain recombinant pDOAL-HFF 1-dCAS13 a-hDAR 2d vector, and the construction flow is shown in figure 1.

2. Transformation of pDOAL-HFF 1-dCAS13 a-hADR 2d plasmid into Schizosaccharomyces

The pDOAL-HFF 1-dCAs13 a-hADR 2d plasmid was cleaved with NotI, 370C,30 min, and the DNA fragment was recovered by gel. The linear pDOAL-HFF 1-dCAS13 a-hADR 2d fragment was transformed into Schizosaccharomyces. 500ng of merozoite cells of the logarithmic growth phase of the linear pDIAL-HFF 1-dAS 13 a-hADR 2d fragment were transformed with lithium acetate and the dCS 13 a-hADR 2d fusion gene was integrated into the leu1 site of the yeast genome.

3. Expression of dCAS13a-hADAR2d fusion proteins

In this example, schizosaccharomyces was cultivated using MM medium to express dCas13a-hADAR2d fusion proteins.

2. Expression of eGFPW58X gene in schizosaccharomyces cell

Amplification by over-lap PCR method to obtain eGFPW58X Gene

A. Amplification of the 5' fragment of the GFPW58X Gene

eGFP-P5(ATCATGCTAGCGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT(SEQ ID NO:2))：1μL；

eGFP-mut-P3(TCAGGGTGGTCACGAGGGTGGGCTAGGGCACGGGCAGCTTGC(SEQ ID NO:3))：1μL；

PCR was performed to obtain an amplified product (GFPW 58X gene 5' fragment).

B. Amplification of the 3' fragment of the GFPW58X Gene

eGFP-mut-P5(ACCGGCAAGCTGCCCGTGCCCTAGCCCACCCTCGTGACCACCCTGA(SEQ ID NO:4))：1μL；

eGFP-P3(TGTAGTCAGATCTTATCCGGACTTGTACAGCTCGTCCATG(SEQ ID NO:5))：1μL；

PCR was performed to obtain an amplified product (GFPW 58X gene 3' fragment).

Overlap-PCR amplification of the complete eGFPW58X Gene

eGFP-P5(AAGCTCTAGAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT(SEQ ID NO:6))：1μL；

eGFP-P3(TTCGAGCTCAGATCTTTATCCGGACTTGTACAGCTCGTCCATG(SEQ ID NO:7))：1μL；

PCR reaction was performed to obtain an amplified product (eGFPW 58X gene).

The PCR product of the gene eGFPW58X was digested with NheI/BglII.

The NheI and BglII digested pDOAL-HFF 1 plasmid.

4. The digested pDOAL-HFF 1 plasmid is connected with the digested eGFPW58X gene to obtain a recombinant pDOAL-HFF 1-eGFPW58X plasmid, and the construction flow is shown in figure 2.

The pDOAL-HFF 1-eGFPW58X plasmid was transformed into a Schizosaccharomyces cell, thereby expressing the eGFPW58X gene in the cell.

3. Expression of crRNA of CRISPR-Cas13a targeting eGFPW58X gene transcript in schizosaccharomyces cells

1. Construction of pSK-crRNA-backbone plasmid

The pBluescript sk vector was used as a base plasmid, and the synthetic sequence was inserted into its ClaI/EcoRV as follows: TTTTGCTTATGTTGGTGGTAGTTGGCATGCGTAGACTGATGACTAGTCAGCAAGGAGCGTAGAACAGTCACACTCGTTATATATGTGCTTCCAAGAAAACTCAAGAATTTACCATTAGCAAACACTTTTTTGAAATGTTAGACATTTAAATGACGAAGGCATATAGAAGCTTTGAATAGGTGTTGTAAAGTGTTGATTTATGTGACGCTGAGGGTGCGCATGAAAGGAATGTTGGGTCACGATTATTAAACAGTTTGCTAGCTTGGACACTTGAGTATTGGAAGTTGTTGAATTCTAAAAAACTTTCAGTTGATTTGAATAGTTGCTGTTGCCAAAAAACATAACCTGTACCGAAGAAccaccccaatatcgaaggggactaaaacAGAAGAGCTGAATTCAGCTCTTCAGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACagagacctgaattcaggtctcaCCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGG (SEQ ID NO: 8)

Of the above sequences, the 1 st to 358 th are schizosaccharomyces triple promoters (containing leader sequences) and RNA transcribed from the promoters has a leader which can be self-excised; the 359 th-386 th is the DR (repeat in the same direction) sequence of CRISPR-Cas13 a. After the DR sequence, positions 387-410 are crRNA occupying sequences (place holder with BspQI), and crRNA can be connected to BspQI restriction sites; after the crRNA insertion site, positions 411 to 478 are ribozymes that cleave the 5' end of itself. Meanwhile, a point mutation kit is used for mutating 1032 bases T on the pBluescript sk carrier into bases A and 2114 bases A into bases G, so as to destroy BspQI and BsaI cleavage sites at corresponding positions on the pBluescript sk carrier. The pSK-crRNA-backbone plasmid was obtained.

2. Primers were designed to target the crRNA of the evfpw 58X gene (crRNA (evfpw 58X)) and the sequences were as follows (capital letters indicate crRNA sequence):

eGFPW58X-crRNA-P5:aacGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAG CTTGCCGGTGGTGCAGATGAACTTCAGGGTCA(SEQ ID NO:9)

eGFPW58X-crRNA-P3:gccTGACCCTGAAGTTCATCTGCACCACCGGCAAGCT GCCCGTGCCCTGGCCCACCCTCGTGACCACC(SEQ ID NO:10)

3. the plasmid pSK-crRNA (eGFPW 58X) was constructed as follows:

A. dissolving the eGFPW58X-crRNA-P5 and eGFPW58X-crRNA-P3 primers into 10 mu M mother solution with water, adding 10 mu L of each to 80 mu L of 0.5 xTE (PH 8.0), and obtaining the final concentration of 1 mu M; it was placed in a PCR apparatus and treated at 98℃for 3 minutes, and naturally cooled to room temperature.

BspQI digested pSK-crRNA-backbone plasmid.

C. The digested pSK-crRNA-backbone vector was ligated with annealed eGFPW58X crRNA primer. Ligation was performed at 22℃for 30min, and pSK-crRNA (eGFPW 58X) was generated by transformation.

4. Cloning the expression cassette of the target crRNA onto the yeast pDUAL-HFF 1-evfppw 58X vector, resulting in pDUAL-HFF 1-evfppw 58X-crRNA (evfppw 58X):

a expression cassette for pcr amplification of target crRNA: PCR amplification was performed using pSK-crRNA (eGFPW 58X) as a template and pDIAL-SpeI-T3 (CGCTAGGGATAACAGGGTAATATAATTAACCCTCACTAAAGG (S EQ ID NO: 11)) and pDIAL-PspXI-T7 (CCTCCAATCTTGTGTTCTTCAAATAATACG ACTCACTATAGG (SEQ ID NO: 12)) as primers to obtain a crRNA expression cassette targeting the eGFPW58X gene.

The SpeI/PspXI enzyme-digested pDUAL-HFF1-eGFPW58X vector. The fragments were recovered from the gel.

C. Homologous recombination reaction:

ligation at 37℃for 30min, transformation produced pDIAL-HFF 1-eGFPW58X-crRNA (eGFPW 58X), and the construction scheme was as shown in FIG. 3.

5. The pDOAL-HFF 1-eGFPW58X-crRNA (eGFPW 58X) plasmid was transformed into Schizosaccharomyces (containing integrally expressed dCAS13 a-hDAR 2 d). 100ng of pDOAL-HFF 1-eGFPW58X-crRNA (eGFPW 58X) plasmid was transformed into merozoite cells at the initial logarithmic growth phase by the method of lithium acetate, and the plasmid was allowed to exist episomally.

4. Cultivation of schizosaccharomyces cells and detection of editing efficiency of specific base A of target RNA

1.MM medium transgenic schizosaccharomyces cells, which integrate expression of dCas13a-hADAR2d, free expression of crRNA-target, were cultivated at 32 ℃ to reach log phase growth.

2. Merozoite cells were collected by centrifugation.

3. Extracting RNA by a Qiagen kit, and carrying out RT-PCR amplification on a target sequence; reverse transcription to obtain cDNA; further, the amplified products were obtained by amplifying the primers eGFP-RT-p5 (CAAGGGCGAGGAGGATAACA) and eGFP-RT-p3 (AACTCCA GCAGGACCATGTGAT).

4. Sequencing, calculating the efficiency of RNA editing according to the peak height.

The RNA editing efficiency is calculated by measuring the peak height H corresponding to the base A at a specific position in the sequencing peak diagram _A Peak height H corresponding to base G _G . Calculate H _G /(H _G +H _A ) The ratio of (2) is the editing efficiency.

In this example, the negative control was the eGFPW58X gene transcript sequencing peak, and the positive control was the eGFP gene transcript sequencing peak. The experimental group is a peak pattern of RT-PCR sequencing of the eGFPW58X gene transcript after the combined action of dCAs13 a-hADR 2d and crRNA, as shown in FIG. 5. Negative controls included a negative control with dCas13a only, a negative control with hADAR2d only, and three negative controls with dCas13a-hADAR2 d. Experimental results indicate that dCS 13a, hADR 2d alone, dCS 13 a-hADR 2d, does not allow editing of the eGFPW58X gene transcript, and only the eGFPW58X gene transcript can be edited if dCS 13 a-hADR 2d and crRNA coexist.

Example 2 Crispr-Cas13a based RNA directed editing technique for schizosaccharomyces endogenous gene tdh1 transcript

1. Expression of dCAS13 a-hADR 2d fusion proteins in schizosaccharomyces cells

dCAS13 a-hADR 2d fusion protein was expressed in schizosaccharomyces cells using the same procedure as in example 1.

2. Expression of crRNA of CRISPR-Cas13a targeting tdh1 gene transcript in schizosaccharomyces cells

1. Primers were designed to target crrnas of the tdh1 gene, the sequences were as follows (uppercase letters indicate crrnas):

tdh1-crRNA-P5:aacGAATTGCCATTTTGAATCAAGTGTAAATCAATACCATGG ATGAATGATCTATACAGAAGCGATGC(SEQ ID NO:13)；

tdh1-crRNA-P3:gccGCATCGCTTCTGTATAGATCATTCATCCATGGTATTGAT TTACACTTGATTCAAAATGGCAATTC(SEQ ID NO:14)；

2. the plasmid pSK-crRNA (tdh 1) was constructed as follows:

A. the tdh1-crRNA-P5 and tdh1-crRNA-P3 primers were dissolved in water to give 10. Mu.M mother solutions, and 10. Mu.L of each was added to 80. Mu.L of 0.5 XTE (pH 8.0) to give a final concentration of 1. Mu.M; it was placed in a PCR apparatus and treated at 98℃for 3 minutes, and naturally cooled to room temperature.

BspQI digested pSK-crRNA-backbone plasmid.

C. The digested pSK-crRNA-backbone vector was ligated with annealed tdh1crRNA primer. Ligation was performed at 22℃for 30min, and pSK-crRNA (tdh 1) was generated by transformation.

3. Cloning the expression cassette of the target crRNA onto the yeast pDIAL-HFF 1 vector produced pDIAL-HFF 1-eGFPW58X-crRNA- (tdh 1).

A expression cassette for pcr amplification of target crRNA: the crRNA expression cassette targeting the tdh1 gene was obtained using pSK-crRNA (tdh 1) as a template and pDIAL-SpeI-T3 (CGCTAGGGATAACAGGGTAATATAATTAACCCTCACTAAAGG (SEQ ID NO: 15)) and pDIAL-PspXI-T7 (CCTCCAATCTTGTGTTCTTCAAA TAATACGACTCACTATA GG (SEQ ID NO: 16)) as primers.

The SpeI/PspXI enzyme-digested pDUAL-HFF1 vector. The fragments were recovered from the gel.

C. Homologous recombination reactions.

Ligation was performed at 37℃for 30min, and transformation yielded pDIAL-HFF 1-crRNA-tdh1.

4. The pDIAL-HFF 1-crRNA (tdh 1) plasmid was transformed into Schizosaccharomyces (containing integrally expressed dCAs13 a-ADARD). 100ng of pDOAL-HFF 1-crRNA (tdh 1) plasmid was transformed into merozoite cells at the initial stage of logarithmic growth by the method of lithium acetate, and the plasmid was allowed to exist freely.

3. Cultivation of schizosaccharomyces cells and detection of editing efficiency of specific base A of target RNA

Mm medium transgenic schizosaccharomyces cells, which integrate expression of dCas13a-hADAR2d, free expression of crRNA-targets, were cultivated at 32 ℃ to reach the logarithmic growth phase.

2. Merozoite cells were collected by centrifugation.

Extracting RNA by using a Qiagen kit, and performing RT-PCR amplification on a target sequence; reverse transcription to obtain cDNA; further amplified with primers tdh1-79-RT-p5 (TGCCTAGCATCGCTTCTGTA (SEQ ID NO: 17)) and tdh1-79-RT-p3 (CATCAATGACGAGCTTACCAT (SEQ ID NO: 18)), to obtain amplified products.

In this example, the RT-PCR sequencing peak diagram of the tdh1 gene transcript is shown in FIG. 6 (79 positions marked with asterisks), and the editing efficiency of 79 bases A to G of the tdh1 gene transcript is 59%.

Example 3 Crispr-Cas13a based RNA fixed-point editing technique for restoring the transposition function of schizosaccharomyces retrotransposons

1. Expression of dCAS13 a-hADR 2d fusion proteins in schizosaccharomyces cells

2. Expression of mutant retrotransposon TF1 in schizosaccharomyces cells (G1165A)

Amplification of Tf1 (G1165A) Gene by over-lap PCR

A. Amplification of the 5' fragment of the Tf1 (G1165A) Gene

PCR amplification was performed using pHL414 (Professor Henry L.Levin's lab) as a template and TF1-XhoI-nmt1-P5 (ATCATCATATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT (SEQ ID NO: 19)) and Tf1-1165-mutant-P3 (TCAGGGTGGTCACGAGGGTGGGCTAGGGCACGGGCAG C TTGCCGGT (SEQ ID NO: 20)) as primers to obtain a Tf1 (G1165A) gene 5' fragment.

B. PCR amplification was performed using pHL414 as a template, tf1-1165-mutant-P5 (ACCGGCAAGCTGCCCGTGC CCTAGCCCACCCTCGTGACCACCCTGA (SEQ ID NO: 21)) and neo-P3 (TGT AGTCCATGGTTATCCGGACTTGTACAGCTCGTCCATG (SEQ ID NO: 22)) as primers, to obtain an amplified Tf1 (G1165A) gene 3' fragment.

Overlap-PCR amplified the complete Tf1 (G1165A) gene.

TF1-XhoI-nmt1-P5(ATCATCATATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGT(SEQ ID NO:23))：1μL；

neo-P3(TGTAGTCCATGGTTATCCGGACTTGTACAGCTCGTCCATG(SEQ ID NO:24))1μL；

PCR was performed to obtain an amplified product (Tf 1 (G1165A) gene).

XhoI cleavage of pHL414 plasmid.

3. And (3) carrying out homologous recombination connection reaction, and connecting the digested pHL414 plasmid with Tf1 (G1165A) genes. 370C was ligated for 30min and transformed to yield pHL414-Tf1 (G1165A).

The pHL414-Tf1 (G1165A) plasmid was transformed into a Schizosaccharomyces cell, thereby expressing the Tf1 (G1165A) gene in the cell.

3. Expression of crRNA of CRISPR-Cas13a targeting Tf1 (G1165A) gene transcript in schizosaccharomyces cells

1. Primers were designed to target crrnas of Tf1 (G1165A) genes, the sequences were as follows (capital letters are crRNA sequences):

Tf1(G1165A)-crRNA-P5:aacTGTCGTTCTCCTTTAAAAACTTATTGTTTTTCCA ATTGCTTCCAGTCTTTGTTTTTAAAAGATTC(SEQ ID NO:25)

Tf1(G1165A)-crRNA-P3:gccGAATCTTTTAAAAACAAAGACTGGAAGCAATTG GAAAAACAATAAGTTTTTAAAGGAGAACGACA(SEQ ID NO:26)

2. plasmid pSK-crRNA (Tf 1 (G1165A) was constructed and the specific procedure was as follows.

A. The Tf1 (G1165A) -crRNA-P5 and Tf1 (G1165A) -crRNA-P3 primers were dissolved in water to give 10. Mu.M mother liquor, and 10. Mu.L of each was added to 80. Mu.L of 0.5 XTE (pH 8.0) at a final concentration of 1. Mu.M; it was placed in a PCR apparatus and treated at 98℃for 3 minutes, and naturally cooled to room temperature.

BspQI digested pSK-crRNA-backbone plasmid.

C. The digested pSK-crRNA-backbone vector was ligated with annealed Tf1 (G1165A) crRNA primer. Ligation was performed at 22℃for 30min, and pSK-crRNA (Tf 1 (G1165A)) was generated by transformation.

3. Cloning the expression cassette for the target crRNA onto the yeast pHL414-Tf1 (G1165A) vector, resulting in pHL414-Tf1 (G1165A) -crRNA (Tf 1 (G1165A)):

a expression cassette for pcr amplification of target crRNA: PCR amplification was performed using pSK-crRNA (Tf 1 (G1165A)) as a template and pDIAL-SpeI-T3 (CGCTAGGGATAACAGGGTAATATAATTAACCCTCACTAAAGG (SEQ ID NO: 27)) and pDIAL-PspXI-T7 (CCTCCAATCTTGTGTTCTTCAAATAATACGACTCACTATAGG (SEQ ID NO: 28)) as primers to obtain a crRNA expression cassette targeting the Tf1 (G1165A) gene.

NheI cleaves pHL414-Tf1 (G1165A) vector.

C. The digested pHL414-Tf1 (G1165A) plasmid was ligated to a crRNA expression cassette targeting Tf1 (G1165A gene at. 22℃for 30min, and transformed to produce pHL414-Tf1 (G1165A) -crRNA (Tf 1 (G1165A)), the construction scheme of which is shown in FIG. 4.

7. pHL414-Tf1 (G1165A) -crRNA (Tf 1 (G1165A)) plasmid was transformed into Schizosaccharomyces (containing integrally expressed dCAs13 a-hADR 2 d). 100ng of pHL414-Tf1 (G1165A) -crRNA (Tf 1 (G1165A)) plasmid was transformed into merozoite cells at the initial stage of logarithmic growth by the method of lithium acetate, and the plasmid was allowed to exist episomally.

2. Merozoite cells were collected by centrifugation.

Extracting RNA by using a Qiagen kit, and performing RT-PCR amplification on a target sequence; reverse transcription to obtain cDNA; further, primers Tf1-RT-p5 (AtccaactaggtttaccattcttcttaatagttcatccCaagtaagagaagaa tcttgacaaaag (SEQ ID NO: 29)) and Tf1-RT-p3 (tcgagcacataaacttcctaccagacctt)Ggttaca aagtgtgatatacggtggagtttatccaa(SEQ ID NO: 30)) to obtain an amplified product.

Ext> Asext> aext> resultext>,ext> asext> shownext> inext> FIG.ext> 7ext>,ext> theext> negativeext> controlext> showedext> thatext> inext> theext> presenceext> ofext> dCASext> 13ext> aext> -ext> hDARext> 2ext> dext> andext> inext> theext> absenceext> ofext> crRNAext>,ext> noext> RNAext> editingext> occurredext> atext> positionext> 1165ext> (ext> blackext> asteriskext>)ext> inext> theext> negativeext> controlext> asext> seenext> onext> theext> sequencingext> peakext> mapext> ofext> tfext> 1ext> -ext> 1165ext> (ext> Gext> -ext> Aext>)ext> geneext> transcriptsext>.ext> Ext> theext> experimentalext> groupext> showedext> thatext> inext> theext> presenceext> ofext> bothext> dCASext> 13ext> aext> -ext> hDARext> 2ext> dext> andext> crRNAext>,ext> theext> significantext> doubleext> peaksext> (ext> redext> asterisksext>)ext> atext> positionext> 1165ext> wereext> seenext> onext> theext> sequencingext> peakext> mapext> ofext> tfext> 1ext> -ext> 1165ext> (ext> Gext> -ext> Aext>)ext> geneext> transcriptsext>,ext> i.e.ext>,ext> RNAext> editingext> occurredext> withext> anext> editingext> efficiencyext> ofext> 48.2ext>%ext>.ext> Ext> inext> bothext> theext> negativeext> controlext> andext> theext> positiveext> controlext>,ext> theext> transpositionext> ofext> tfext> 1ext> -ext> 1165ext> (ext> Gext> -ext> Aext>)ext> showedext> thatext> theext> negativeext> controlext> didext> notext> transposeext>,ext> butext> theext> sampleext> groupext> didext> obviouslyext> transposeext> withext> transpositionext> efficiencyext> ofext> 1.65x10ext> ^-4 。

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Sequence listing

<110> Shanghai life science institute of China academy of sciences

<120> CRISPR-Cas13a based RNA fixed point editing technique

<130> 183384

<160> 30

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1808

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Met Gly Asn Leu Phe Gly His Lys Arg Trp Tyr Glu Val Arg Asp Lys

1 5 10 15

Lys Asp Phe Lys Ile Lys Arg Lys Val Lys Val Lys Arg Asn Tyr Asp

20 25 30

Gly Asn Lys Tyr Ile Leu Asn Ile Asn Glu Asn Asn Asn Lys Glu Lys

35 40 45

Ile Asp Asn Asn Lys Phe Ile Arg Lys Tyr Ile Asn Tyr Lys Lys Asn

50 55 60

Asp Asn Ile Leu Lys Glu Phe Thr Arg Lys Phe His Ala Gly Asn Ile

65 70 75 80

Leu Phe Lys Leu Lys Gly Lys Glu Gly Ile Ile Arg Ile Glu Asn Asn

85 90 95

Asp Asp Phe Leu Glu Thr Glu Glu Val Val Leu Tyr Ile Glu Ala Tyr

100 105 110

Gly Lys Ser Glu Lys Leu Lys Ala Leu Gly Ile Thr Lys Lys Lys Ile

115 120 125

Ile Asp Glu Ala Ile Arg Gln Gly Ile Thr Lys Asp Asp Lys Lys Ile

130 135 140

Glu Ile Lys Arg Gln Glu Asn Glu Glu Glu Ile Glu Ile Asp Ile Arg

145 150 155 160

Asp Glu Tyr Thr Asn Lys Thr Leu Asn Asp Cys Ser Ile Ile Leu Arg

165 170 175

Ile Ile Glu Asn Asp Glu Leu Glu Thr Lys Lys Ser Ile Tyr Glu Ile

180 185 190

Phe Lys Asn Ile Asn Met Ser Leu Tyr Lys Ile Ile Glu Lys Ile Ile

195 200 205

Glu Asn Glu Thr Glu Lys Val Phe Glu Asn Arg Tyr Tyr Glu Glu His

210 215 220

Leu Arg Glu Lys Leu Leu Lys Asp Asp Lys Ile Asp Val Ile Leu Thr

225 230 235 240

Asn Phe Met Glu Ile Arg Glu Lys Ile Lys Ser Asn Leu Glu Ile Leu

245 250 255

Gly Phe Val Lys Phe Tyr Leu Asn Val Gly Gly Asp Lys Lys Lys Ser

260 265 270

Lys Asn Lys Lys Met Leu Val Glu Lys Ile Leu Asn Ile Asn Val Asp

275 280 285

Leu Thr Val Glu Asp Ile Ala Asp Phe Val Ile Lys Glu Leu Glu Phe

290 295 300

Trp Asn Ile Thr Lys Arg Ile Glu Lys Val Lys Lys Val Asn Asn Glu

305 310 315 320

Phe Leu Glu Lys Arg Arg Asn Arg Thr Tyr Ile Lys Ser Tyr Val Leu

325 330 335

Leu Asp Lys His Glu Lys Phe Lys Ile Glu Arg Glu Asn Lys Lys Asp

340 345 350

Lys Ile Val Lys Phe Phe Val Glu Asn Ile Lys Asn Asn Ser Ile Lys

355 360 365

Glu Lys Ile Glu Lys Ile Leu Ala Glu Phe Lys Ile Asp Glu Leu Ile

370 375 380

Lys Lys Leu Glu Lys Glu Leu Lys Lys Gly Asn Cys Asp Thr Glu Ile

385 390 395 400

Phe Gly Ile Phe Lys Lys His Tyr Lys Val Asn Phe Asp Ser Lys Lys

405 410 415

Phe Ser Lys Lys Ser Asp Glu Glu Lys Glu Leu Tyr Lys Ile Ile Tyr

420 425 430

Arg Tyr Leu Lys Gly Arg Ile Glu Lys Ile Leu Val Asn Glu Gln Lys

435 440 445

Val Arg Leu Lys Lys Met Glu Lys Ile Glu Ile Glu Lys Ile Leu Asn

450 455 460

Glu Ser Ile Leu Ser Glu Lys Ile Leu Lys Arg Val Lys Gln Tyr Thr

465 470 475 480

Leu Glu His Ile Met Tyr Leu Gly Lys Leu Arg His Asn Asp Ile Asp

485 490 495

Met Thr Thr Val Asn Thr Asp Asp Phe Ser Arg Leu His Ala Lys Glu

500 505 510

Glu Leu Asp Leu Glu Leu Ile Thr Phe Phe Ala Ser Thr Asn Met Glu

515 520 525

Leu Asn Lys Ile Phe Ser Arg Glu Asn Ile Asn Asn Asp Glu Asn Ile

530 535 540

Asp Phe Phe Gly Gly Asp Arg Glu Lys Asn Tyr Val Leu Asp Lys Lys

545 550 555 560

Ile Leu Asn Ser Lys Ile Lys Ile Ile Arg Asp Leu Asp Phe Ile Asp

565 570 575

Asn Lys Asn Asn Ile Thr Asn Asn Phe Ile Arg Lys Phe Thr Lys Ile

580 585 590

Gly Thr Asn Glu Arg Asn Arg Ile Leu His Ala Ile Ser Lys Glu Arg

595 600 605

Asp Leu Gln Gly Thr Gln Asp Asp Tyr Asn Lys Val Ile Asn Ile Ile

610 615 620

Gln Asn Leu Lys Ile Ser Asp Glu Glu Val Ser Lys Ala Leu Asn Leu

625 630 635 640

Asp Val Val Phe Lys Asp Lys Lys Asn Ile Ile Thr Lys Ile Asn Asp

645 650 655

Ile Lys Ile Ser Glu Glu Asn Asn Asn Asp Ile Lys Tyr Leu Pro Ser

660 665 670

Phe Ser Lys Val Leu Pro Glu Ile Leu Asn Leu Tyr Arg Asn Asn Pro

675 680 685

Lys Asn Glu Pro Phe Asp Thr Ile Glu Thr Glu Lys Ile Val Leu Asn

690 695 700

Ala Leu Ile Tyr Val Asn Lys Glu Leu Tyr Lys Lys Leu Ile Leu Glu

705 710 715 720

Asp Asp Leu Glu Glu Asn Glu Ser Lys Asn Ile Phe Leu Gln Glu Leu

725 730 735

Lys Lys Thr Leu Gly Asn Ile Asp Glu Ile Asp Glu Asn Ile Ile Glu

740 745 750

Asn Tyr Tyr Lys Asn Ala Gln Ile Ser Ala Ser Lys Gly Asn Asn Lys

755 760 765

Ala Ile Lys Lys Tyr Gln Lys Lys Val Ile Glu Cys Tyr Ile Gly Tyr

770 775 780

Leu Arg Lys Asn Tyr Glu Glu Leu Phe Asp Phe Ser Asp Phe Lys Met

785 790 795 800

Asn Ile Gln Glu Ile Lys Lys Gln Ile Lys Asp Ile Asn Asp Asn Lys

805 810 815

Thr Tyr Glu Arg Ile Thr Val Lys Thr Ser Asp Lys Thr Ile Val Ile

820 825 830

Asn Asp Asp Phe Glu Tyr Ile Ile Ser Ile Phe Ala Leu Leu Asn Ser

835 840 845

Asn Ala Val Ile Asn Lys Ile Arg Asn Arg Phe Phe Ala Thr Ser Val

850 855 860

Trp Leu Asn Thr Ser Glu Tyr Gln Asn Ile Ile Asp Ile Leu Asp Glu

865 870 875 880

Ile Met Gln Leu Asn Thr Leu Arg Asn Glu Cys Ile Thr Glu Asn Trp

885 890 895

Asn Leu Asn Leu Glu Glu Phe Ile Gln Lys Met Lys Glu Ile Glu Lys

900 905 910

Asp Phe Asp Asp Phe Lys Ile Gln Thr Lys Lys Glu Ile Phe Asn Asn

915 920 925

Tyr Tyr Glu Asp Ile Lys Asn Asn Ile Leu Thr Glu Phe Lys Asp Asp

930 935 940

Ile Asn Gly Cys Asp Val Leu Glu Lys Lys Leu Glu Lys Ile Val Ile

945 950 955 960

Phe Asp Asp Glu Thr Lys Phe Glu Ile Asp Lys Lys Ser Asn Ile Leu

965 970 975

Gln Asp Glu Gln Arg Lys Leu Ser Asn Ile Asn Lys Lys Asp Leu Lys

980 985 990

Lys Lys Val Asp Gln Tyr Ile Lys Asp Lys Asp Gln Glu Ile Lys Ser

995 1000 1005

Lys Ile Leu Cys Arg Ile Ile Phe Asn Ser Asp Phe Leu Lys Lys Tyr

1010 1015 1020

Lys Lys Glu Ile Asp Asn Leu Ile Glu Asp Met Glu Ser Glu Asn Glu

1025 1030 1035 1040

Asn Lys Phe Gln Glu Ile Tyr Tyr Pro Lys Glu Arg Lys Asn Glu Leu

1045 1050 1055

Tyr Ile Tyr Lys Lys Asn Leu Phe Leu Asn Ile Gly Asn Pro Asn Phe

1060 1065 1070

Asp Lys Ile Tyr Gly Leu Ile Ser Asn Asp Ile Lys Met Ala Asp Ala

1075 1080 1085

Lys Phe Leu Phe Asn Ile Asp Gly Lys Asn Ile Arg Lys Asn Lys Ile

1090 1095 1100

Ser Glu Ile Asp Ala Ile Leu Lys Asn Leu Asn Asp Lys Leu Asn Gly

1105 1110 1115 1120

Tyr Ser Lys Glu Tyr Lys Glu Lys Tyr Ile Lys Lys Leu Lys Glu Asn

1125 1130 1135

Asp Asp Phe Phe Ala Lys Asn Ile Gln Asn Lys Asn Tyr Lys Ser Phe

1140 1145 1150

Glu Lys Asp Tyr Asn Arg Val Ser Glu Tyr Lys Lys Ile Arg Asp Leu

1155 1160 1165

Val Glu Phe Asn Tyr Leu Asn Lys Ile Glu Ser Tyr Leu Ile Asp Ile

1170 1175 1180

Asn Trp Lys Leu Ala Ile Gln Met Ala Arg Phe Glu Arg Asp Met His

1185 1190 1195 1200

Tyr Ile Val Asn Gly Leu Arg Glu Leu Gly Ile Ile Lys Leu Ser Gly

1205 1210 1215

Tyr Asn Thr Gly Ile Ser Arg Ala Tyr Pro Lys Arg Asn Gly Ser Asp

1220 1225 1230

Gly Phe Tyr Thr Thr Thr Ala Tyr Tyr Lys Phe Phe Asp Glu Glu Ser

1235 1240 1245

Tyr Lys Lys Phe Glu Lys Ile Cys Tyr Gly Phe Gly Ile Asp Leu Ser

1250 1255 1260

Glu Asn Ser Glu Ile Asn Lys Pro Glu Asn Glu Ser Ile Ala Asn Tyr

1265 1270 1275 1280

Ile Ser His Phe Tyr Ile Val Arg Asn Pro Phe Ala Asp Tyr Ser Ile

1285 1290 1295

Ala Glu Gln Ile Asp Arg Val Ser Asn Leu Leu Ser Tyr Ser Thr Arg

1300 1305 1310

Tyr Asn Asn Ser Thr Tyr Ala Ser Val Phe Glu Val Phe Lys Lys Asp

1315 1320 1325

Val Asn Leu Asp Tyr Asp Glu Leu Lys Lys Lys Phe Lys Leu Ile Gly

1330 1335 1340

Asn Asn Asp Ile Leu Glu Arg Leu Met Lys Pro Lys Lys Val Ser Val

1345 1350 1355 1360

Leu Glu Leu Glu Ser Tyr Asn Ser Asp Tyr Ile Lys Asn Leu Ile Ile

1365 1370 1375

Glu Leu Leu Thr Lys Ile Glu Asn Thr Asn Asp Thr Leu Lys Ser Gly

1380 1385 1390

Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Leu His Leu

1395 1400 1405

Asp Gln Thr Pro Ser Arg Gln Pro Ile Pro Ser Glu Gly Leu Gln Leu

1410 1415 1420

His Leu Pro Gln Val Leu Ala Asp Ala Val Ser Arg Leu Val Leu Gly

1425 1430 1435 1440

Lys Phe Gly Asp Leu Thr Asp Asn Phe Ser Ser Pro His Ala Arg Arg

1445 1450 1455

Lys Val Leu Ala Gly Val Val Met Thr Thr Gly Thr Asp Val Lys Asp

1460 1465 1470

Ala Lys Val Ile Ser Val Ser Thr Gly Thr Lys Cys Ile Asn Gly Glu

1475 1480 1485

Tyr Met Ser Asp Arg Gly Leu Ala Leu Asn Asp Cys His Ala Glu Ile

1490 1495 1500

Ile Ser Arg Arg Ser Leu Leu Arg Phe Leu Tyr Thr Gln Leu Glu Leu

1505 1510 1515 1520

Tyr Leu Asn Asn Lys Asp Asp Gln Lys Arg Ser Ile Phe Gln Lys Ser

1525 1530 1535

Glu Arg Gly Gly Phe Arg Leu Lys Glu Asn Val Gln Phe His Leu Tyr

1540 1545 1550

Ile Ser Thr Ser Pro Cys Gly Asp Ala Arg Ile Phe Ser Pro His Glu

1555 1560 1565

Pro Ile Leu Glu Glu Pro Ala Asp Arg His Pro Asn Arg Lys Ala Arg

1570 1575 1580

Gly Gln Leu Arg Thr Lys Ile Glu Ser Gly Glu Gly Thr Ile Pro Val

1585 1590 1595 1600

Arg Ser Asn Ala Ser Ile Gln Thr Trp Asp Gly Val Leu Gln Gly Glu

1605 1610 1615

Arg Leu Leu Thr Met Ser Cys Ser Asp Lys Ile Ala Arg Trp Asn Val

1620 1625 1630

Val Gly Ile Gln Gly Ser Leu Leu Ser Ile Phe Val Glu Pro Ile Tyr

1635 1640 1645

Phe Ser Ser Ile Ile Leu Gly Ser Leu Tyr His Gly Asp His Leu Ser

1650 1655 1660

Arg Ala Met Tyr Gln Arg Ile Ser Asn Ile Glu Asp Leu Pro Pro Leu

1665 1670 1675 1680

Tyr Thr Leu Asn Lys Pro Leu Leu Ser Gly Ile Ser Asn Ala Glu Ala

1685 1690 1695

Arg Gln Pro Gly Lys Ala Pro Asn Phe Ser Val Asn Trp Thr Val Gly

1700 1705 1710

Asp Ser Ala Ile Glu Val Ile Asn Ala Thr Thr Gly Lys Asp Glu Leu

1715 1720 1725

Gly Arg Ala Ser Arg Leu Cys Lys His Ala Leu Tyr Cys Arg Trp Met

1730 1735 1740

Arg Val His Gly Lys Val Pro Ser His Leu Leu Arg Ser Lys Ile Thr

1745 1750 1755 1760

Lys Pro Asn Val Tyr His Glu Ser Lys Leu Ala Ala Lys Glu Tyr Gln

1765 1770 1775

Ala Ala Lys Ala Arg Leu Phe Thr Ala Phe Ile Lys Ala Gly Leu Gly

1780 1785 1790

Ala Trp Val Glu Lys Pro Thr Glu Gln Asp Gln Phe Ser Leu Thr Pro

1795 1800 1805

<210> 2

<211> 43

<212> DNA

<213> Primer (Primer)

<400> 2

atcatgctag cgtgagcaag ggcgaggagc tgttcaccgg ggt 43

<210> 3

<211> 42

<212> DNA

<213> Primer (Primer)

<400> 3

tcagggtggt cacgagggtg ggctagggca cgggcagctt gc 42

<210> 4

<211> 46

<212> DNA

<213> Primer (Primer)

<400> 4

accggcaagc tgcccgtgcc ctagcccacc ctcgtgacca ccctga 46

<210> 5

<211> 40

<212> DNA

<213> Primer (Primer)

<400> 5

tgtagtcaga tcttatccgg acttgtacag ctcgtccatg 40

<210> 6

<211> 42

<212> DNA

<213> Primer (Primer)

<400> 6

aagctctaga gtgagcaagg gcgaggagct gttcaccggg gt 42

<210> 7

<211> 43

<212> DNA

<213> Primer (Primer)

<400> 7

ttcgagctca gatctttatc cggacttgta cagctcgtcc atg 43

<210> 8

<211> 552

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ttttgcttat gttggtggta gttggcatgc gtagactgat gactagtcag caaggagcgt 60

agaacagtca cactcgttat atatgtgctt ccaagaaaac tcaagaattt accattagca 120

aacacttttt tgaaatgtta gacatttaaa tgacgaaggc atatagaagc tttgaatagg 180

tgttgtaaag tgttgattta tgtgacgctg agggtgcgca tgaaaggaat gttgggtcac 240

gattattaaa cagtttgcta gcttggacac ttgagtattg gaagttgttg aattctaaaa 300

aactttcagt tgatttgaat agttgctgtt gccaaaaaac ataacctgta ccgaagaacc 360

accccaatat cgaaggggac taaaacagaa gagctgaatt cagctcttca ggccggcatg 420

gtcccagcct cctcgctggc gccggctggg caacatgctt cggcatggcg aatgggacag 480

agacctgaat tcaggtctca cctgtcaccg gatgtgcttt ccggtctgat gagtccgtga 540

ggacgaaaca gg 552

<210> 9

<211> 68

<212> DNA

<213> Primer (Primer)

<400> 9

aacggtggtc acgagggtgg gccagggcac gggcagcttg ccggtggtgc agatgaactt 60

cagggtca 68

<210> 10

<211> 68

<212> DNA

<213> Primer (Primer)

<400> 10

gcctgaccct gaagttcatc tgcaccaccg gcaagctgcc cgtgccctgg cccaccctcg 60

tgaccacc 68

<210> 11

<211> 42

<212> DNA

<213> Primer (Primer)

<400> 11

cgctagggat aacagggtaa tataattaac cctcactaaa gg 42

<210> 12

<211> 42

<212> DNA

<213> Primer (Primer)

<400> 12

cctccaatct tgtgttcttc aaataatacg actcactata gg 42

<210> 13

<211> 68

<212> DNA

<213> Primer (Primer)

<400> 13

aacgaattgc cattttgaat caagtgtaaa tcaataccat ggatgaatga tctatacaga 60

agcgatgc 68

<210> 14

<211> 68

<212> DNA

<213> Primer (Primer)

<400> 14

gccgcatcgc ttctgtatag atcattcatc catggtattg atttacactt gattcaaaat 60

ggcaattc 68

<210> 15

<211> 42

<212> DNA

<213> Primer (Primer)

<400> 15

cgctagggat aacagggtaa tataattaac cctcactaaa gg 42

<210> 16

<211> 42

<212> DNA

<213> Primer (Primer)

<400> 16

cctccaatct tgtgttcttc aaataatacg actcactata gg 42

<210> 17

<211> 20

<212> DNA

<213> Primer (Primer)

<400> 17

tgcctagcat cgcttctgta 20

<210> 18

<211> 21

<212> DNA

<213> Primer (Primer)

<400> 18

catcaatgac gagcttacca t 21

<210> 19

<211> 43

<212> DNA

<213> Primer (Primer)

<400> 19

atcatcatat ggtgagcaag ggcgaggagc tgttcaccgg ggt 43

<210> 20

<211> 46

<212> DNA

<213> Primer (Primer)

<400> 20

tcagggtggt cacgagggtg ggctagggca cgggcagctt gccggt 46

<210> 21

<211> 46

<212> DNA

<213> Primer (Primer)

<400> 21

accggcaagc tgcccgtgcc ctagcccacc ctcgtgacca ccctga 46

<210> 22

<211> 40

<212> DNA

<213> Primer (Primer)

<400> 22

tgtagtccat ggttatccgg acttgtacag ctcgtccatg 40

<210> 23

<211> 43

<212> DNA

<213> Primer (Primer)

<400> 23

atcatcatat ggtgagcaag ggcgaggagc tgttcaccgg ggt 43

<210> 24

<211> 40

<212> DNA

<213> Primer (Primer)

<400> 24

tgtagtccat ggttatccgg acttgtacag ctcgtccatg 40

<210> 25

<211> 68

<212> DNA

<213> Primer (Primer)

<400> 25

aactgtcgtt ctcctttaaa aacttattgt ttttccaatt gcttccagtc tttgttttta 60

aaagattc 68

<210> 26

<211> 68

<212> DNA

<213> Primer (Primer)

<400> 26

gccgaatctt ttaaaaacaa agactggaag caattggaaa aacaataagt ttttaaagga 60

gaacgaca 68

<210> 27

<211> 42

<212> DNA

<213> Primer (Primer)

<400> 27

cgctagggat aacagggtaa tataattaac cctcactaaa gg 42

<210> 28

<211> 42

<212> DNA

<213> Primer (Primer)

<400> 28

cctccaatct tgtgttcttc aaataatacg actcactata gg 42

<210> 29

<211> 65

<212> DNA

<213> Primer (Primer)

<400> 29

atccaactag gtttaccatt cttcttaata gttcatccca agtaagagaa gaatcttgac 60

aaaag 65

<210> 30

<211> 65

<212> DNA

<213> Primer (Primer)

<400> 30

tcgagcacat aaacttccta ccagaccttg gttacaaagt gtgatatacg gtggagttta 60

tccaa 65

Claims

1. A method for RNA site-directed editing based on CRISPR technology for non-diagnostic and therapeutic purposes is characterized by comprising the steps of taking Cas13a variant as nuclease during RNA site-directed editing and,

(1) The Cas13a variant has no ssRNA cleavage activity and ssRNA binding activity;

(2) The Cas13a variant is fused to the catalytic domain of adenine deaminase ADAR 2; the amino acid sequence of the catalytic domain of the adenine deaminase ADAR2 is a full-length ADAR2 sequence GenBank: positions 299 to 701 of U82120;

the Cas13a variant is based on a wild Cas13a, wherein the mutation of an amino acid residue exists in the 1278 th position of the amino acid sequence of the Cas13a variant, and the amino acid sequence of the Cas13a variant is shown as the 1 st-1389 th position in SEQ ID NO. 1.

2. The method of claim 1, wherein the CRISPR technology based RNA site-directed editing comprises:

(b) Preparing crRNA of a target gene;

3. The method of claim 2, wherein the crRNA has a length of 20 to 100bp.

4. The method of claim 3, wherein the crRNA has a length of 28 to 91bp.

5. The method of claim 2, wherein the crRNA contains a base designed for a specific editing site, the base being located between positions 15 and 55 on the crRNA.

6. The method of claim 2, wherein the crRNA contains a base designed for a specific editing site, the base being located between positions 18 and 48 on the crRNA.

7. The method of claim 2, wherein the crRNA targeting the target gene comprises a cas13a targeting sequence to the binding site and a pairing sequence necessary for ADAR2 editing function that forms a double-stranded region of the editing site.

8. The method of claim 1, wherein in (2), the Cas13a variant is at the N-terminus or the C-terminus of the fusion protein.

9. A fusion protein for RNA site-directed editing based on CRISPR technology, characterized in that it comprises a Cas13a variant and a catalytic domain of adenine deaminase ADAR 2; and, the Cas13a variant has no ssRNA cleavage activity and ssRNA binding activity; the amino acid sequence of the catalytic domain of the adenine deaminase ADAR2 is a full-length ADAR2 sequence GenBank: positions 299 to 701 of U82120; the Cas13a variant corresponds to a wild-type Cas13a, wherein the mutation of an amino acid residue exists in the 1278 th position of the amino acid sequence of the Cas13a variant, and the amino acid sequence of the Cas13a variant is shown as the 1 st-1389 th position in SEQ ID NO. 1.

10. The fusion protein of claim 9, wherein the Cas13a variant is at the N-terminus or the C-terminus of the fusion protein.

11. A polynucleotide encoding the fusion protein of any one of claims 9-10.

12. A recombinant plasmid comprising the polynucleotide of claim 11.

13. A host cell comprising the recombinant plasmid of claim 12, or having integrated into its genome the polynucleotide of claim 11.

14. Use of the fusion protein of any one of claims 9 to 10, or a gene encoding the same or a plasmid containing the fusion protein, for increasing the efficiency of RNA site-directed editing based on CRISPR technology.

15. A kit for performing RNA site-directed editing based on CRISPR technology, comprising: the fusion protein of any one of claims 9 to 10, the polynucleotide of claim 11, or the recombinant plasmid of claim 12.

16. The kit of claim 15, further comprising: a plasmid for RNA site-directed editing based on CRISPR technology comprising the following set of operably linked elements:

a promoter having a leader that can be cut out by itself;

the DR sequence of Cas13 a;

crRNA occupying sequence;

ribozymes having 5' -end cleavage function.