CN110551760B - CRISPR/Sa-SeqCas9 gene editing system and application thereof - Google Patents

Abstract

The invention belongs to the technical field of gene editing, and particularly relates to CRISPR (clustered regularly interspaced short palindromic repeats)Sa‑SeqCas9A gene editing system and applications thereof. The gene editing system of the invention isSa‑SeqCas9A complex formed by the protein and the sgRNA can accurately target a DNA sequence and generate cutting, so that double-strand break damage occurs to the DNA; the gene editing is gene editing in a cell or in vitro;Sa‑SeqCas9for fusion proteins, the PAM recognition domain (PAM interacting, PI) of SaCas9 was replaced with the PAM recognition domain of SeqCas9 (SeqCas 9-PI).Sa‑SeqCas9The protein is small and is 1053 amino acids, the identified PAM sequence is simple, theSa‑SeqCas9The protein has an amino acid sequence shown in SEQ ID NO. 1, and the sgRNA has a nucleotide sequence shown in SEQ ID NO. 2. The invention has wide application prospect in the field of gene editing.

Description

CRISPR/Sa-SeqCas9 gene editing system and application thereof

Technical Field

The invention belongs to the technical field of gene editing, and particularly relates to a CRISPR/Sa-SeqCas9 system capable of performing gene editing in cells and related application thereof.

Background

CRISPR/Cas9 is an acquired immune system evolved by bacteria and archaea to protect against foreign virus or plasmid invasion. In a CRISPR/Cas9 system, after a CRISPR (CRISPR-derived RNA), a tracrRNA (trans-activating RNA) and a Cas9 protein form a complex, a PAM (Protospace Adjacent Motif) sequence of a target site is recognized, the CRRNA and the target DNA sequence form a complementary structure, and the Cas9 protein plays a role in cutting DNA so as to break and damage the DNA. Among them, tracrRNA and crRNA can be fused into single-stranded guide RNA (sgRNA) by a linker sequence. When DNA breaks and damages, two major DNA damage repair mechanisms within the cell are responsible for repair: non-homologous end-joining (NHEJ) and Homologous Recombination (HR). Deletion or insertion of a base can be caused as a result of NHEJ repair, and gene knockout can be performed; in the case of providing a homologous template, site-directed insertion of genes and precise base substitution can be performed using HR repair.

Besides basic scientific research, the CRISPR/Cas9 also has wide clinical application prospect. When the CRISPR/Cas9 system is used for gene therapy, cas9 and sgRNA need to be introduced into a human body. The most effective delivery vector for gene therapy is AAV. However, AAV virus-packaged DNA typically does not exceed 4.5kb. SpCas9 is widely used because of its simple PAM sequence (recognition of NGG) and high activity. However, the SpCas9 protein has 1367 amino acids, and the sgRNA and the promoter cannot be effectively packaged into the AAV virus, so that the clinical application of the protein is limited. To overcome this problem, several small Cas9 were invented, including SaCas9 (PAM sequence NNGRRT); st1Cas9 (PAM sequence NNAGAW); nmCas9 (PAM sequence NNNNGATT); nme2Cas9 (PAM sequence NNNNCC); cjCas9 (PAM sequence is NNRYAC), but these Cas9 or PAM sequences are complex (few DNA sequences can be targeted in genome), or the editing efficiency is low, which is difficult to be widely applied. The search for a small Cas9 protein, PAM sequence simple CRISPR/Cas9 system is hopeful to solve the above problems.

Disclosure of Invention

Aiming at the problems, the invention aims to provide a novel CRISPR/Cas9 gene editing system which is high in editing activity, small in Cas9 protein and simple in PAM sequence and application thereof.

The CRISPR/Cas9 gene editing system provided by the invention is a complex formed by a Sa-SeqCas9 protein and a sgRNA, and is marked as a CRISPR/Sa-SeqCas9 gene editing system (namely, the Sa-SeqCas9 protein which realizes gene editing under the combined action of single guide RNA (sgRNA)); the DNA sequence can be precisely targeted, and the cutting is generated, so that the DNA is subjected to double-strand break damage; the gene editing is gene editing in a cell or in vitro; the Sa-SeqCas9 protein is small and 1053 amino acids, the identified PAM sequence is simple (NNGRM), and the Sa-SeqCas9 protein has an amino acid sequence shown in SEQ ID NO:1 or an amino acid sequence which is at least 80 percent identical to the amino acid sequence shown in SEQ ID NO: 1; the sgRNA has a nucleotide sequence shown in SEQ ID NO. 2, or a sgRNA sequence modified based on SEQ ID NO. 2.

In the present invention, the cells include eukaryotic cells and prokaryotic cells; the eukaryotic cells include mammalian cells and plant cells.

In the present invention, the mammalian cell includes a Chinese hamster ovary cell, a baby hamster kidney cell, a mouse Sertoli cell, a mouse mammary tumor cell, a buffalo rat liver cell, a rat liver tumor cell, a monkey kidney CVI line transformed by SV40, a monkey kidney cell, a canine kidney cell, a human cervical cancer cell, a human lung cell, a human liver cell, an HIH/3T3 cell, a human U2-OS osteosarcoma cell, a human A549 cell, a human K562 cell, a human HEK293T cell, a human HCT116 cell, or a human MCF-7 cell or a TRI cell.

In the invention, sa-SeqCas9 in the CRISPR/Cas9 system is a fusion protein, the PI domain of SaCas9 is replaced by the PI domain of SeqCas9, and the SeqCas9 is Staphyloccocus equorumCas9. The Sa-SeqCas9 fusion protein and single guide RNA (sgRNA) act together to achieve gene editing.

In the invention, the SeqCas9 protein belongs to Staphylococcus equine (Staphylococcus equorum), and the search number of the UniProt of the SeqCas9 protein is A0A1E5TL62.

In the invention, the Sa-SeqCas9 protein comprises the Sa-SeqCas9 protein which has no cleavage activity or only has single-strand cleavage activity or double-strand cleavage activity.

In the invention, the accurate positioning DNA sequence comprises a 5' end 20bp or 21bp sequence in the sgRNA and a target DNA sequence which can form a base complementary pairing structure.

In the invention, the accurate positioning target DNA sequence comprises a Sa-SeqCas9 protein and a PAM sequence on a sgRNA complex recognition target DNA sequence.

In the invention, the PAM sequence is NNGRM, and the target DNA sequence is:

NNNNNNNNNNNNNNNNNNNNNNNGRM(SEQ ID NO:3)。

in the invention, the Sa-SeqCas9 protein and sgRNA complex can precisely target DNA sequences, namely the Sa-SeqCas9 protein and sgRNA complex can recognize and combine specific DNA sequences, or other proteins fused with the Sa-SeqCas9 protein or proteins capable of specifically recognizing sgRNA are brought to the position of the target DNA.

In the present invention, the Sa-SeqCas9 protein and sgRNA complex or other protein fused with Sa-SeqCas9 protein or protein specifically recognizing sgRNA can modify and regulate the targeted DNA region, including but not limited to regulation of gene transcription level, DNA methylation regulation, DNA acetylation modification, histone acetylation modification, single base switch or chromatin imaging tracking.

In the present invention, the single base converter includes, but is not limited to, conversion between bases adenine to guanine, or cytosine to thymine, or cytosine to uracil, or other bases.

The gene editing system provided by the invention has high editing activity and has obvious advantages compared with the prior Cas9.

The editing efficiency of the CRISPR/Sa-SeqCas9 system is detected by the techniques of gene synthesis, molecular cloning, cell transfection, PCR product deep sequencing, bioinformatics analysis and the like.

The CRISPR/Sa-SeqCas9 gene editing system provided by the invention can carry out gene editing in cells, and comprises the steps of identifying and positioning target DNA through a compound of Sa-SeqCas9 protein and sgRNA, and editing the DNA; and finally, detecting the editing efficiency. The method comprises the following specific steps:

(1) Synthesizing a humanized Sa-SeqCas9 gene sequence; and cloning to an expression vector to obtain pAAV2_ Sa-SeqCas9_ ITR;

(2) Synthesizing oligonucleotide single-stranded DNA (deoxyribonucleic acid) corresponding to the sgRNA, namely Oligo-F and Oligo-R sequences, annealing the Oligo single-stranded DNA, and connecting the Oligo single-stranded DNA to a BsaI enzyme digestion site of a plasmid pAAV2_ Sa-SeqCas9_ U6_ BsaI to obtain pAAV2_ Sa-SeqCas9-hU6-sgRNA;

(3) Delivering a vector expressing the Sa-SeqCas9 protein, sgRNA into a cell containing a target site;

(4) And carrying out PCR amplification on the edited target site, and detecting the editing efficiency by T7EI enzyme digestion or second-generation sequencing.

In the present invention, any targeted sgRNA can be designed for a DNA sequence to be edited according to specific needs, and modifications well known in the art including, but not limited to, phosphorylation, shortening, lengthening, sulfurization, methylation, and hydroxylation can be performed on the sgRNA to some extent.

In the present invention, the CRISPR/Sa-SeqCas9 system delivered to the cell may include, but is not limited to, a plasmid expressing the Sa-SeqCas9 protein or sgRNA, retrovirus, adenovirus, adeno-associated viral vector or RNA, or Sa-SeqCas9 protein, according to specific needs.

It will be appreciated by those skilled in the art that base N represents any of the four bases A, T, C or G.

Further, in step (3), the delivery means includes, but is not limited to, liposomes, cationic polymers, nanoparticles, multifunctional envelope-type nanoparticles, and viral vectors.

Further, in step (3), the cells include, but are not limited to, human cells, animal cells, plant cells, bacterial cells, and fungal cells.

Further, in the step (2), the sgRNA has a nucleotide sequence shown in SEQ ID NO. 2, or a nucleotide sequence at least 80% identical to the nucleotide sequence shown in SEQ ID NO. 2, or modifications based on the nucleotide sequence, wherein the modifications include but are not limited to phosphorylation, shortening, lengthening, sulfurization or methylation.

More specifically, in one embodiment, oligonucleotide single-stranded DNA sequences corresponding to sgrnas, i.e., oligo-F and Oligo-R, were synthesized as follows:

Oligo-F CACCGCTCGGAGATCATCATTGCG，(SEQ ID NO:4)

Oligo-R AAACCGCAATGATGATCTCCGAGC。(SEQ ID NO:5)

more specifically, in one embodiment, it can be understood by those skilled in the art that Oligo-F and Oligo-R need to be annealed to become double-stranded DNA, and the annealing reaction system is 1. Mu.L of 100. Mu.M Oligo-F, 1. Mu.L of 100. Mu.M Oligo-R, and 28. Mu.L of water, and after shaking and mixing, the mixture is placed in a PCR instrument to run an annealing program; the annealing procedure was as follows: 95 ℃ 5min,85 ℃ 1min,75 ℃ 1min,65 ℃ 1min,55 ℃ 1min,45 ℃ 1min,35 ℃ 1min,25 ℃ 1min,4 ℃ storage, cooling rate 0.3 ℃/s.

More specifically, in one embodiment, the plasmid pAAV2_ Sa-SeqCas9_ ITR needs to be linearized with BsaI restriction enzyme (NEB).

More specifically, in one embodiment, the annealed Oligo-F and Oligo-R products are ligated to the linearized pAAV2_ Sa-SeqCas9_ ITR backbone vector by DNA ligase.

More specifically, in one embodiment, after transformation of the ligation products into competent cells, the correct clones were verified by Sanger sequencing and the plasmids were extracted for use.

More specifically, in one embodiment, the cell in step (3) is HEK293T comprising a target site having the nucleotide sequence shown in SEQ ID NO. 6.

More specifically, in one embodiment, the delivery means in step (3) is a liposome comprising

2000 or PEI.

More specifically, in a specific embodiment of the first aspect of the present invention, the template for PCR in the experimental step (4) is edited HEK293T genomic DNA.

More specifically, in one embodiment, the primer sequences amplified by PCR in step (4) are:

F1-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNGCGAGAAAAGCCTTGTTT；(SEQ ID NO:7)

R1-ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTGAACTTGTGGCCGTTTAC；(SEQ ID NO:8)

F2-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC；(SEQ ID NO:9)

R2-CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTG；(SEQ ID NO:10)

the invention also provides a CRISPR/Sa-SeqCas9 system kit for gene editing, which comprises a Sa-SeqCas9 protein or sgRNA of a target DNA sequence or a target DNA.

The invention also provides application of the CRISPR/Sa-SeqCas9 gene editing system, which comprises gene knockout, site-specific base change, site-specific insertion, gene transcription level regulation, DNA methylation regulation, DNA acetylation modification, histone acetylation modification, single base converter or chromatin imaging tracking.

Drawings

FIG. 1 is a schematic diagram of CRISPR/Sa-SeqCas9 gene editing system cutting targeting DNA. Wherein, the grey oval represents Sa-SeqCas9 protein, the black curved represents sgRNA sequence, and the deepened area in the upper chain of the genome represents PAM sequence NNGG.

FIG. 2 is a map schematic of plasmid pAAV2_ Sa-SeqCas9_ U6_ BsaI. Wherein, the recombinant human RNA comprises AAV2 ITR, CMV enhancer, CMV promoter, SV40 NLS, sa-SeqCas9, nucleoplasmin NLS, 3 xHA, bGH poly (A), human U6 promoter (hU 6), bsaI endonuclease site, sgRNA scaffold sequence and other elements.

FIG. 3 shows the result of partial next generation sequencing after the DNA sequence of the target site has been edited. Wherein the editing result has deletion, insertion or mismatching, and the last 5bp represents a PAM sequence NNGRM.

FIG. 4 shows the cleavage of endogenous site with T7 Endonuclease I. Wherein the arrows indicate the size of the cut fragments.

Detailed Description

The present invention will be further illustrated by the following examples, which are not intended to limit the invention in any way.

Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated. Unless otherwise indicated, reagents and materials used in the following examples are commercially available. The experimental method not specified for the specific conditions is usually carried out under the conventional conditions or the conditions recommended by the manufacturer.

In a specific embodiment, the CRISPR/Sa-SeqCas9 system provided by the invention is a novel gene editing system, method, kit and application thereof.

In a specific embodiment of the invention, the CRISPR/Sa-SeqCas9 system enables gene editing in a cell, the method comprising the steps of:

1. construction of plasmid pAAV2_ Sa-SeqCas9_ ITR

And (1) according to the retrieval number A0A1E5TL62 of the Sa-SeqCas9 gene on UniProt, improving the downloaded SeqCas9 protein sequence to obtain the Sa-SeqCas9 gene, wherein the amino acid sequence of the Sa-SeqCas9 gene is shown as SEQ ID NO: 1.

And (2) carrying out codon optimization on the amino acid sequence of the Sa-SeqCas9 to obtain a coding sequence of the Sa-SeqCas9 highly expressed in human cells, wherein the coding sequence is shown as SEQ ID NO: 11.

And (3) carrying out gene synthesis on the coding sequence of the obtained gene Sa-SeqCas9 in a company, and constructing the coding sequence to a pAAV2_ ITR skeleton plasmid to obtain a plasmid pAAV2_ Sa-SeqCas9_ ITR, wherein the plasmid is shown in figure 2.

2. Preparation of linearized plasmid pAAV2_ Sa-SeqCas9_ ITR

Step (1), carrying out enzyme digestion linearization on the plasmid pAAV2_ Sa-SeqCas9_ ITR by using BasI restriction enzyme, wherein an enzyme digestion system comprises: mu.g of plasmid pAAV2_ Sa-SeqCas9_ ITR, 5. Mu.L of 10 xClutSmart buffer, 1. Mu.L of the endonuclease, water to 50. Mu.L, and reaction at 37 ℃ for 1 hour.

And (2) carrying out electrophoresis on the product after enzyme digestion on a 1% agarose gel at 120V for 30 minutes.

And (3) cutting off the DNA fragment with the size of 7423bp, recycling by using a glue recycling kit according to the steps provided by a manufacturer, and finally eluting by using ultrapure water.

And (4) determining the DNA concentration of the recovered linearized plasmid pAAV2_ Sa-SeqCas9_ ITR by using NanoDrop, and reserving for later use or storing at-20 ℃ for long time.

3. Construction of plasmid pAAV2_ Sa-SeqCas9-hU6-sgRNA

And (1) designing a sgRNA sequence.

Step (2), respectively adding sticky end sequences corresponding to two sides of a linearized plasmid pAAV2_ Sa-SeqCas9_ ITR on a sense strand and an antisense strand for the designed sgRNA sequence pair, and synthesizing two oligonucleotide single-stranded DNAs by a company, wherein the specific sequences are as follows:

Oligo-F CACCGCTCGGAGATCATCATTGCG，(SEQ ID NO:4)

Oligo-R AAACCGCAATGATGATCTCCGAGC。(SEQ ID NO:5)

and (3) annealing the oligonucleotide single-stranded DNA to obtain double-stranded DNA, wherein an annealing reaction system comprises the following steps: mu.L of 100. Mu.M oligo-F, 1. Mu.L of 100. Mu.M oligo-R, 28. Mu.L of water, shaking and mixing, placing in a PCR instrument to run an annealing program: 95 ℃ 5min,85 ℃ 1min,75 ℃ 1min,65 ℃ 1min,55 ℃ 1min,45 ℃ 1min,35 ℃ 1min,25 ℃ 1min,4 ℃ storage, cooling rate 0.3 ℃/s.

And (4) connecting the annealed product with the linearized plasmid pAAV2_ Sa-SeqCas9_ ITR under the action of DNA ligase according to the steps provided by the product.

Step (5), 1. Mu.L of the ligation product was taken for chemical competent transformation, and the growing bacterial clones were subjected to Sanger sequencing validation.

And (6) carrying out sequencing verification on the correctly connected clone shake bacteria, and extracting a plasmid pAAV2_ Sa-SeqCas9-hU6-sgRNA for later use.

4. Plasmid pAAV2_ Sa-SeqCas9-hU6-sgRNA for transfecting and expressing Sa-SeqCas9 protein and sgRNA

Step (1), on day 0, according to transfection needs, the HEK293T cell line containing the sgRNA targeting site is plated in a 6-well plate, the cell density is about 30%, and the sequence of the target site is shown as SEQ ID NO. 6.

Step (2), day 1, transfection was performed in the following transfection system,

i. adding 2 mu g of plasmid pAAV2_ Sa-SeqCas9-hU6-sgRNA to be transfected into 100 mu l of Opti-MEM culture medium, and gently blowing, beating and uniformly mixing;

ii. Subjecting to

2000 flick and mix evenly, suck 5 mul and add to 100 mul Opti-MEM culture medium, mix evenly gently, stand 5min at room temperature;

will dilute

2000 and diluted plasmid, gently whipping and mixing, standing at room temperature for 20min, and then adding to the medium of the cells to be transfected.

And (3) placing the cells in an incubator at 37 ℃ and 5% CO2 for continuous culture.

5. Preparation of a second Generation sequencing library

And (1) collecting the HEK293T cells after editing for 3 days, and extracting the genome DNA by using a DNA kit according to the steps provided by the product.

Step (2), performing first round PCR of PCR library building, performing PCR reaction by using 2xQ5 Mastermix, wherein PCR primers are shown as SEQ ID NO:7-SEQ ID NO:8, and the reaction system is as follows:

the PCR run program was as follows:

and (3) carrying out second round PCR of PCR library building, carrying out PCR reaction by using 2xQ5 Mastermix, wherein PCR primers are shown as SEQ ID NO: 9-SEQ ID NO:10, and the reaction system is as follows:

the PCR run program was as follows:

and (4) purifying DNA fragments with the size of 366bp by using a gel recovery kit for PCR products of the second round according to the steps provided by the manufacturer, and finishing the preparation of the second generation sequencing library.

6. Analysis of the results of the second generation sequencing

Step (1), the prepared second-generation sequencing library was submitted to the company for paired-end sequencing on HiseqXTen.

Step (2) bioinformatics analysis of the next-generation sequencing results, and partial compilation results are shown in FIGS. 2 and 3.

7. Endogenous site validation

Step (1), passing the plasmid pAAV2_ Sa-SeqCas9-hU6-sgRNA for expressing Sa-SeqCas9 and sgRNA through

2000 were transfected into HEK293T cells according to the manufacturer's protocol, wherein,

the sgRNA sequence is: GAGCTGGTGGACCTAGTACA (SEQ ID NO: 12)

The specific sequence of the target site is as follows: GAGCTGGTGGACCTAGTACAATGGA; (SEQ ID NO: 13)

Extracting cell genome DNA after 5 days of editing, and amplifying a target DNA sequence by using primers Test-F and Test-R through a 2x Q5 Master mix; wherein:

the specific sequence of Test-F is: ATCAACCCGGAGCAGATTC (SEQ ID NO: 14)

The specific sequence of Test-R is as follows: CCTCATTGTCCAGAAAGACCA; (SEQ ID NO: 15)

Step (3), recovering the PCR product through agarose gel, and purifying DNA fragment with size of 475 bp;

step (4), carrying out enzyme digestion on the purified DNA fragment according to the instruction of T7 Endonuclease I, then carrying out gel running detection, wherein the result is shown in figure 4, the left side is a negative control group, and sgRNA is not generated during transfection, and no cut fragment is generated after the T7 Endonuclease I cuts the target sequence, which indicates that no editing is generated; the right panel shows the experimental group with sgRNA at transfection, and the T7 Endonuclease I cuts the targeting sequence to generate a cut fragment, indicating that editing has occurred.

Sequence listing

<110> university of Compound Dan

<120> CRISPR/Sa-SeqCas9 gene editing system and application thereof

<130> 1112

<160> 15

<170> PatentIn version 3.5

<210> 1

<211> 1053

<212> PRT

<213> Artificial sequence

<400> 1

Met Lys Arg Asn Tyr Ile Leu Gly Leu Asp Ile Gly Ile Thr Ser Val

1 5 10 15

Gly Tyr Gly Ile Ile Asp Tyr Glu Thr Arg Asp Val Ile Asp Ala Gly

20 25 30

Val Arg Leu Phe Lys Glu Ala Asn Val Glu Asn Asn Glu Gly Arg Arg

35 40 45

Ser Lys Arg Gly Ala Arg Arg Leu Lys Arg Arg Arg Arg His Arg Ile

50 55 60

Gln Arg Val Lys Lys Leu Leu Phe Asp Tyr Asn Leu Leu Thr Asp His

65 70 75 80

Ser Glu Leu Ser Gly Ile Asn Pro Tyr Glu Ala Arg Val Lys Gly Leu

85 90 95

Ser Gln Lys Leu Ser Glu Glu Glu Phe Ser Ala Ala Leu Leu His Leu

100 105 110

Ala Lys Arg Arg Gly Val His Asn Val Asn Glu Val Glu Glu Asp Thr

115 120 125

Gly Asn Glu Leu Ser Thr Lys Glu Gln Ile Ser Arg Asn Ser Lys Ala

130 135 140

Leu Glu Glu Lys Tyr Val Ala Glu Leu Gln Leu Glu Arg Leu Lys Lys

145 150 155 160

Asp Gly Glu Val Arg Gly Ser Ile Asn Arg Phe Lys Thr Ser Asp Tyr

165 170 175

Val Lys Glu Ala Lys Gln Leu Leu Lys Val Gln Lys Ala Tyr His Gln

180 185 190

Leu Asp Gln Ser Phe Ile Asp Thr Tyr Ile Asp Leu Leu Glu Thr Arg

195 200 205

Arg Thr Tyr Tyr Glu Gly Pro Gly Glu Gly Ser Pro Phe Gly Trp Lys

210 215 220

Asp Ile Lys Glu Trp Tyr Glu Met Leu Met Gly His Cys Thr Tyr Phe

225 230 235 240

Pro Glu Glu Leu Arg Ser Val Lys Tyr Ala Tyr Asn Ala Asp Leu Tyr

245 250 255

Asn Ala Leu Asn Asp Leu Asn Asn Leu Val Ile Thr Arg Asp Glu Asn

260 265 270

Glu Lys Leu Glu Tyr Tyr Glu Lys Phe Gln Ile Ile Glu Asn Val Phe

275 280 285

Lys Gln Lys Lys Lys Pro Thr Leu Lys Gln Ile Ala Lys Glu Ile Leu

290 295 300

Val Asn Glu Glu Asp Ile Lys Gly Tyr Arg Val Thr Ser Thr Gly Lys

305 310 315 320

Pro Glu Phe Thr Asn Leu Lys Val Tyr His Asp Ile Lys Asp Ile Thr

325 330 335

Ala Arg Lys Glu Ile Ile Glu Asn Ala Glu Leu Leu Asp Gln Ile Ala

340 345 350

Lys Ile Leu Thr Ile Tyr Gln Ser Ser Glu Asp Ile Gln Glu Glu Leu

355 360 365

Thr Asn Leu Asn Ser Glu Leu Thr Gln Glu Glu Ile Glu Gln Ile Ser

370 375 380

Asn Leu Lys Gly Tyr Thr Gly Thr His Asn Leu Ser Leu Lys Ala Ile

385 390 395 400

Asn Leu Ile Leu Asp Glu Leu Trp His Thr Asn Asp Asn Gln Ile Ala

405 410 415

Ile Phe Asn Arg Leu Lys Leu Val Pro Lys Lys Val Asp Leu Ser Gln

420 425 430

Gln Lys Glu Ile Pro Thr Thr Leu Val Asp Asp Phe Ile Leu Ser Pro

435 440 445

Val Val Lys Arg Ser Phe Ile Gln Ser Ile Lys Val Ile Asn Ala Ile

450 455 460

Ile Lys Lys Tyr Gly Leu Pro Asn Asp Ile Ile Ile Glu Leu Ala Arg

465 470 475 480

Glu Lys Asn Ser Lys Asp Ala Gln Lys Met Ile Asn Glu Met Gln Lys

485 490 495

Arg Asn Ala Ala Thr Asn Glu Arg Ile Glu Glu Ile Ile Arg Thr Thr

500 505 510

Gly Lys Glu Asn Ala Lys Tyr Leu Ile Glu Lys Ile Lys Leu His Asp

515 520 525

Met Gln Glu Gly Lys Cys Leu Tyr Ser Leu Glu Ala Ile Pro Leu Glu

530 535 540

Asp Leu Leu Asn Asn Pro Phe Asn Tyr Glu Val Asp His Ile Ile Pro

545 550 555 560

Arg Ser Val Ser Phe Asp Asn Ser Phe Asn Asn Lys Val Leu Val Lys

565 570 575

Gln Glu Glu Asn Ser Lys Lys Gly Asn Arg Thr Pro Phe Gln Tyr Leu

580 585 590

Ser Ser Ser Asp Ser Lys Ile Ser Tyr Glu Thr Phe Lys Lys His Ile

595 600 605

Leu Asn Leu Ala Lys Gly Lys Gly Arg Ile Ser Lys Thr Lys Lys Glu

610 615 620

Tyr Leu Leu Glu Glu Arg Asp Ile Asn Arg Phe Ser Val Gln Lys Asp

625 630 635 640

Phe Ile Asn Arg Asn Leu Val Asp Thr Arg Tyr Ala Thr Ala Ala Leu

645 650 655

Met Asn Leu Leu Arg Ser Tyr Phe Arg Val Asn Asn Leu Asp Val Lys

660 665 670

Val Lys Ser Ile Asn Gly Gly Phe Thr Ser Phe Leu Arg Arg Lys Trp

675 680 685

Lys Phe Lys Lys Glu Arg Asn Lys Gly Tyr Lys His His Ala Glu Asp

690 695 700

Ala Leu Ile Ile Ala Asn Ala Asp Phe Ile Phe Lys Glu Trp Lys Lys

705 710 715 720

Leu Asp Lys Ala Lys Lys Val Met Glu Asn Gln Met Phe Glu Glu Lys

725 730 735

Gln Ala Glu Ser Met Pro Glu Ile Glu Thr Glu Gln Glu Tyr Lys Glu

740 745 750

Ile Phe Ile Thr Pro His Gln Ile Lys His Ile Lys Asp Phe Lys Asp

755 760 765

Tyr Lys Tyr Ser His Arg Val Asp Lys Lys Pro Asn Arg Glu Leu Ile

770 775 780

Asn Asp Thr Leu Tyr Ser Thr Arg Lys Asp Asp Lys Gly Asn Thr Leu

785 790 795 800

Ile Val Asn Asn Leu Asn Gly Leu Tyr Asp Lys Asp Asn Asp Lys Leu

805 810 815

Lys Lys Leu Ile Asn Lys Ser Pro Glu Lys Leu Leu Met Tyr His His

820 825 830

Asp Pro Gln Thr Tyr Gln Lys Leu Lys Leu Ile Met Glu Gln Tyr Gly

835 840 845

Asp Glu Lys Asn Pro Leu Tyr Lys Tyr Tyr Glu Glu Thr Gly Asn Tyr

850 855 860

Leu Thr Lys Tyr Ser Lys Lys Asp Asn Gly Pro Val Ile Lys Lys Ile

865 870 875 880

Lys Tyr Tyr Gly Asn Lys Leu Asn Ala His Leu Asp Ile Thr Asp Asp

885 890 895

Tyr Pro Asn Ser Arg Asn Lys Val Val Lys Leu Ser Leu Lys Pro Tyr

900 905 910

Arg Phe Asp Val Tyr Leu Asp Asn Gly Val Tyr Lys Phe Val Thr Val

915 920 925

Lys Asn Leu Asn Val Ile Lys Lys Glu Asn Tyr Tyr Glu Val Asn Ser

930 935 940

Lys Cys Tyr Glu Lys Ala Lys Lys Leu Lys Lys Ile Ser Asp Gln Ala

945 950 955 960

Glu Phe Ile Ala Ser Phe Tyr Asn Asn Asp Leu Ile Lys Ile Asp Gly

965 970 975

Glu Leu Tyr Arg Val Ile Gly Val Asn Thr Asp Leu Ile Asn Arg Ile

980 985 990

Glu Val Asn Met Val Asp Ile Thr Tyr Arg Glu Tyr Leu Glu Asn Met

995 1000 1005

Asn Asp Lys Arg Ser Pro Arg Ile Phe Lys Thr Ile Ala Ser Lys

1010 1015 1020

Thr Gln Ser Ile Lys Lys Tyr Ser Thr Asp Ile Leu Gly Thr Leu

1025 1030 1035

Tyr Glu Val Asn Ser Lys Lys His Pro Gln Met Ile Met Lys Gly

1040 1045 1050

<210> 2

<211> 101

<212> RNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (1)..(20)

<223> n is a, c, g, or u

<400> 2

nnnnnnnnnn nnnnnnnnnn guuuuaguac ucuggaaaca gaaucuacua aaacaaggca 60

aaaugccgug uuuaucucgu caacuuguug gcgagauuuu u 101

<210> 3

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (1)..(23)

<223> n is a, c, g, or t

<400> 3

nnnnnnnnnn nnnnnnnnnn nnngrm 26

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<400> 4

caccgctcgg agatcatcat tgcg 24

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<400> 5

aaaccgcaat gatgatctcc gagc 24

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (21)..(25)

<223> n is a, c, g, or t

<400> 6

gctcggagat catcattgcg nnnnn 25

<210> 7

<211> 55

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (34)..(37)

<223> n is a, c, g, or t

<400> 7

acactctttc cctacacgac gctcttccga tctnnnngcg agaaaagcct tgttt 55

<210> 8

<211> 51

<212> DNA

<213> Artificial sequence

<400> 8

actggagttc agacgtgtgc tcttccgatc tctgaacttg tggccgttta c 51

<210> 9

<211> 45

<212> DNA

<213> Artificial sequence

<400> 9

aatgatacgg cgaccaccga gatctacact ctttccctac acgac 45

<210> 10

<211> 52

<212> DNA

<213> Artificial sequence

<400> 10

caagcagaag acggcatacg agatcactgt gtgactggag ttcagacgtg tg 52

<210> 11

<211> 3159

<212> DNA

<213> Artificial sequence

<400> 11

atgaagcgga actacatcct gggcctggac atcggcatca ccagcgtggg ctacggcatc 60

atcgactacg agacacggga cgtgatcgat gccggcgtgc ggctgttcaa agaggccaac 120

gtggaaaaca acgagggcag gcggagcaag agaggcgcca gaaggctgaa gcggcggagg 180

cggcatagaa tccagagagt gaagaagctg ctgttcgact acaacctgct gaccgaccac 240

agcgagctga gcggcatcaa cccctacgag gccagagtga agggcctgag ccagaagctg 300

agcgaggaag agttctctgc cgccctgctg cacctggcca agagaagagg cgtgcacaac 360

gtgaacgagg tggaagagga caccggcaac gagctgtcca ccaaagagca gatcagccgg 420

aacagcaagg ccctggaaga gaaatacgtg gccgaactgc agctggaacg gctgaagaaa 480

gacggcgaag tgcggggcag catcaacaga ttcaagacca gcgactacgt gaaagaagcc 540

aaacagctgc tgaaggtgca gaaggcctac caccagctgg accagagctt catcgacacc 600

tacatcgacc tgctggaaac ccggcggacc tactatgagg gacctggcga gggcagcccc 660

ttcggctgga aggacatcaa agaatggtac gagatgctga tgggccactg cacctacttc 720

cccgaggaac tgcggagcgt gaagtacgcc tacaacgccg acctgtacaa cgccctgaac 780

gacctgaaca atctcgtgat caccagggac gagaacgaga agctggaata ttacgagaag 840

ttccagatca tcgagaacgt gttcaagcag aagaagaagc ccaccctgaa gcagatcgcc 900

aaagaaatcc tcgtgaacga agaggatatt aagggctaca gagtgaccag caccggcaag 960

cccgagttca ccaacctgaa ggtgtaccac gacatcaagg acattaccgc ccggaaagag 1020

attattgaga acgccgagct gctggatcag attgccaaga tcctgaccat ctaccagagc 1080

agcgaggaca tccaggaaga actgaccaat ctgaactccg agctgaccca ggaagagatc 1140

gagcagatct ctaatctgaa gggctatacc ggcacccaca acctgagcct gaaggccatc 1200

aacctgatcc tggacgagct gtggcacacc aacgacaacc agatcgctat cttcaaccgg 1260

ctgaagctgg tgcccaagaa ggtggacctg tcccagcaga aagagatccc caccaccctg 1320

gtggacgact tcatcctgag ccccgtcgtg aagagaagct tcatccagag catcaaagtg 1380

atcaacgcca tcatcaagaa gtacggcctg cccaacgaca tcattatcga gctggcccgc 1440

gagaagaact ccaaggacgc ccagaaaatg atcaacgaga tgcagaagcg gaacgccgcc 1500

accaacgagc ggatcgagga aatcatccgg accaccggca aagagaacgc caagtacctg 1560

atcgagaaga tcaagctgca cgacatgcag gaaggcaagt gcctgtacag cctggaagcc 1620

atccctctgg aagatctgct gaacaacccc ttcaactatg aggtggacca catcatcccc 1680

agaagcgtgt ccttcgacaa cagcttcaac aacaaggtgc tcgtgaagca ggaagaaaac 1740

agcaagaagg gcaaccggac cccattccag tacctgagca gcagcgacag caagatcagc 1800

tacgaaacct tcaagaagca catcctgaat ctggccaagg gcaagggcag aatcagcaag 1860

accaagaaag agtatctgct ggaagaacgg gacatcaaca ggttctccgt gcagaaagac 1920

ttcatcaacc ggaacctggt ggataccaga tacgccaccg ccgccctgat gaacctgctg 1980

cggagctact tcagagtgaa caacctggac gtgaaagtga agtccatcaa tggcggcttc 2040

accagctttc tgcggcggaa gtggaagttt aagaaagagc ggaacaaggg gtacaagcac 2100

cacgccgagg acgccctgat cattgccaac gccgatttca tcttcaaaga gtggaagaaa 2160

ctggacaagg ccaaaaaagt gatggaaaac cagatgttcg aggaaaagca ggccgagagc 2220

atgcccgaga tcgaaaccga gcaggagtac aaagagatct tcatcacccc ccaccagatc 2280

aagcacatta aggacttcaa ggactacaag tacagccacc gggtggacaa gaagcctaat 2340

agagagctga ttaacgacac cctgtactcc acccggaagg acgacaaggg caacaccctg 2400

atcgtgaaca atctgaacgg cctgtacgac aaggacaatg acaagctgaa aaagctgatc 2460

aacaagagcc ccgaaaagct gctgatgtac caccacgacc cccagaccta ccagaaactg 2520

aagctgatta tggaacagta cggcgacgag aagaatcccc tgtacaagta ctacgaggaa 2580

accgggaact acctgaccaa gtactccaaa aaggacaacg gccccgtgat caagaagatt 2640

aagtattacg gcaacaaact gaacgcccat ctggacatca ccgacgacta ccccaacagc 2700

agaaacaagg tcgtgaagct gtccctgaag ccctaccgct tcgacgtgta cctggacaac 2760

ggcgtgtaca agttcgtgac cgtgaagaac ctgaacgtga taaagaagga gaactactac 2820

gaggtgaaca gcaagtgcta cgagaaggcc aagaagctga agaagataag cgaccaggcc 2880

gagttcatcg ccagcttcta caacaacgac ctgataaaga tagacggcga gctgtaccgc 2940

gtgataggcg tgaacaccga cctgataaac cgcatcgagg tgaacatggt ggacatcacc 3000

taccgcgagt acctggagaa catgaacgac aagcgcagcc cccgcatctt caagaccatc 3060

gccagcaaga cccagagcat caagaagtac agcaccgaca tcctgggcac cctgtacgag 3120

gtgaacagca agaagcaccc ccagatgata atgaagggc 3159

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<400> 12

gagctggtgg acctagtaca 20

<210> 13

<211> 25

<212> DNA

<213> Artificial sequence

<400> 13

gagctggtgg acctagtaca atgga 25

<210> 14

<211> 19

<212> DNA

<213> Artificial sequence

<400> 14

atcaacccgg agcagattc 19

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence

<400> 15

cctcattgtc cagaaagacc a 21

Claims (15)

1. A CRISPR/Cas9 gene editing system is used for gene editing in cells or in vitro and is characterized in that the CRISPR/Cas9 system is a Sa-SeqCas9 protein and sgRNA complex, can accurately position a target DNA sequence and generate cutting, so that double strand break damage occurs to DNA; the Sa-SeqCas9 protein is an amino acid sequence shown as SEQ ID NO: 1; the sgRNA is a nucleotide sequence shown in SEQ ID NO. 2.

2. The CRISPR/Cas9 gene editing system of claim 1, wherein the cells comprise eukaryotic cells and prokaryotic cells; the eukaryotic cells include mammalian cells and plant cells; the mammalian cell includes a Chinese hamster ovary cell, a baby hamster kidney cell, a mouse Sertoli cell, a mouse mammary tumor cell, a buffalo rat liver cell, a rat liver tumor cell, a monkey kidney CVI line transformed by SV40, a monkey kidney cell, a canine kidney cell, a human cervical cancer cell, a human lung cell, a human liver cell, an HIH/3T3 cell, a human U2-OS osteosarcoma cell, a human A549 cell, a human K562 cell, a human HEK293T cell, a human HCT116 cell, or a human MCF-7 cell or a TRI cell.

3. The CRISPR/Cas9 gene editing system of claim 1, wherein the precisely located targeting DNA sequence comprises a sequence of 20bp or 21bp at the 5' end of the sgRNA which can form a base complementary pairing structure with the targeting DNA sequence.

4. The CRISPR/Cas9 gene editing system of claim 1, wherein the precisely located targeting DNA sequence comprises a PAM sequence on the Sa-SeqCas9 protein and sgRNA complex recognition targeting DNA sequence.

5. The CRISPR/Cas9 gene editing system of claim 4, wherein the PAM sequence is NNGRM and the targeting DNA sequence is shown in SEQ ID NO 3.

6. The CRISPR/Cas9 gene editing system of claim 1, wherein the sgRNA can be phosphorylated, sulfurized, methylated, or hydroxylated modified.

7. The CRISPR/Cas9 gene editing system according to claim 1, wherein the Sa-SeqCas9 protein and sgRNA complex is capable of precisely locating a target DNA sequence, which means that the Sa-SeqCas9 protein and sgRNA complex can recognize and bind to a specific DNA sequence, or that other proteins fused to the Sa-SeqCas9 protein or proteins specifically recognizing sgrnas are brought to the position of the target DNA.

8. The CRISPR/Cas9 gene editing system of claim 7, wherein the Sa-SeqCas9 protein and sgRNA complex or other protein fused to Sa-SeqCas9 protein or protein specifically recognizing sgRNA can modify and regulate targeted DNA regions including regulation of gene transcription level, single base switch or chromatin imaging tracking.

9. The CRISPR/Cas9 gene editing system of claim 8, wherein the single base switch comprises a switch between bases adenine to guanine, cytosine to thymine, cytosine to uracil, or other bases.

10. A method of gene editing for non-therapeutic purposes by the CRISPR/Cas9 gene editing system of any of claims 1 to 9 in a cell comprising editing DNA by recognition and localization of a targeting DNA by a complex of the Sa-SeqCas9 protein and sgRNA; finally, detecting the editing efficiency; the method comprises the following specific steps:

(1) Synthesizing a humanized SeqCas9-PI gene sequence; and cloning to an expression vector to obtain pAAV2_ Sa-SeqCas9_ ITR;

(2) Synthesizing oligonucleotide single-stranded DNA (deoxyribonucleic acid) corresponding to the sgRNA, namely Oligo-F and Oligo-R sequences, annealing the Oligo single-stranded DNA, and connecting the Oligo single-stranded DNA to a BsaI enzyme digestion site of a plasmid pAAV2_ Sa-SeqCas9_ U6_ BsaI to obtain pAAV2_ Sa-SeqCas9-hU6-sgRNA;

(3) Delivering a vector expressing the Sa-SeqCas9 protein, sgRNA into cells containing the target site;

(4) And carrying out PCR amplification on the edited target site, and detecting the editing efficiency by T7EI enzyme digestion or second-generation sequencing.

11. The method of claim 10 wherein the pAAV2_ Sa-SeqCas9-hU6-sgRNA is an adeno-associated viral backbone plasmid comprising AAV2 ITR, CMV enhancer, CMV promoter, SV40 NLS, sa-SeqCas9, nucleoplasmin NLS, 3 xha, bGH poly (a), human U6 promoter, bsrai endonuclease site, sgRNA scaffold sequence.

12. The method according to claim 10, wherein the CRISPR/Sa-SeqCas9 system delivered to the cells comprises a plasmid, retrovirus, adenovirus, adeno-associated viral vector or RNA or Sa-SeqCas9 protein expressing the Sa-SeqCas9 protein or sgRNA.

13. The method of claim 10, wherein the sgRNA is synthesized with corresponding oligonucleotide single-stranded DNA sequences, i.e., oligo-F and Oligo-R sequences are shown in SEQ ID NO 4 and SEQ ID NO 5;

the target site of the cell in the step (3) has a nucleotide sequence shown by SEQ ID NO. 6;

in the step (4), the template of PCR is edited DNA; the primer sequences for PCR amplification are: SEQ ID NO. 7, 8, 9, 10.

14. A kit based on the CRISPR/Cas9 gene editing system of one of claims 1 to 9, comprising a Sa-SeqCas9 protein and sgrnas targeting the DNA sequence.

15. Use of the CRISPR/Cas9 gene editing system according to any of claims 1 to 9 for non-therapeutic purposes including gene knock-out, site-directed base alteration, site-directed insertion, regulation of gene transcription level, single base switch or chromatin imaging follow-up.

Images