CN110499335B - CRISPR/SauriCas9 gene editing system and application thereof - Google Patents

Abstract

The invention belongs to the technical field of gene editing, and particularly relates to CRISPR (clustered regularly interspaced short palindromic repeats)SauriCas9 gene editing systems and uses thereof. The gene editing system of the invention isSauriA complex formed by the Cas9 protein and the sgRNA can accurately target a DNA sequence and generate cutting, so that the DNA is subjected to double-strand break damage; the gene editing is gene editing in a cell or in vitro;Saurithe Cas9 protein is small, 1061 amino acids are adopted, the identified PAM sequence is simple, theSauriThe Cas9 protein has an amino acid sequence shown in SEQ ID NO. 1, and the sgRNA has a nucleotide sequence shown in SEQ ID NO. 2. The invention has wide application prospect in the field of gene editing.

Description

CRISPR/SauriCas9 gene editing system and application thereof

Technical Field

The invention belongs to the technical field of gene editing, and particularly relates to a CRISPR/SauriCas9 system capable of carrying out gene editing in cells and related application thereof.

Background

CRISPR/Cas9 is an acquired immune system evolved by bacteria and archaea to protect against foreign virus or plasmid invasion. In the CRISPR/Cas9 system, after a complex is formed by crRNA (CRISPR-derived RNA), tracrRNA (trans-activating RNA) and Cas9 protein, a PAM (promoter Adjacent Motif) sequence of a target site is recognized, the crRNA and the target DNA sequence form a complementary structure, and the Cas9 protein plays a function of cutting DNA, so that the DNA is subjected to breakage damage. Among them, tracrRNA and crRNA can be fused into single-stranded guide RNA (sgRNA) by a linker sequence. When DNA breaks and damages, two major DNA damage repair mechanisms within the cell are responsible for repair: non-homologous end-joining (NHEJ) and Homologous Recombination (HR). Deletion or insertion of a base can be caused as a result of NHEJ repair, and gene knockout can be carried out; in the case of providing a homologous template, site-directed insertion of genes and precise base substitution can be performed using HR repair.

Besides basic scientific research, the CRISPR/Cas9 also has wide clinical application prospect. When the CRISPR/Cas9 system is used for gene therapy, cas9 and sgRNA need to be introduced into a body. The most effective delivery vector for gene therapy is currently the AAV virus. However, AAV virus-packaged DNA typically does not exceed 4.5kb. SpCas9 is widely used because of its simple PAM sequence (recognition of NGG) and high activity. However, the SpCas9 protein has 1367 amino acids, and the sgRNA and the promoter cannot be effectively packaged into the AAV virus, so that the clinical application of the protein is limited. To overcome this problem, several small Cas9 were invented, including SaCas9 (PAM sequence NNGRRT); st1Cas9 (PAM sequence NNAGAW); nmCas9 (PAM sequence NNNNGATT); nme2Cas9 (PAM sequence NNNNCC); cjCas9 (PAM sequence is NNRYAC), but these Cas9 or PAM sequences are complex (few DNA sequences can be targeted in genome), or editing efficiency is low, and wide application is difficult. The search for a CRISPR/Cas9 system with a small Cas9 protein and a simple PAM sequence is hopeful for solving the problems.

Disclosure of Invention

Aiming at the problems, the invention aims to provide a novel CRISPR/Cas9 gene editing system which is high in editing activity, small in Cas9 protein and simple in PAM sequence and application thereof.

The CRISPR/Cas9 gene editing system provided by the invention is a complex formed by the SauriCas9 protein and the sgRNA, and is marked as the CRISPR/SauriCas9 gene editing system (namely, the SauriCas9 protein which realizes gene editing under the combined action with single guide RNA (sgRNA)); the DNA sequence can be precisely targeted, and the cutting is generated, so that the DNA is subjected to double-strand break damage; the gene editing is gene editing in a cell or in vitro; the SauriCas9 protein is small, 1061 amino acids and simple in identified PAM sequence (NNGG), and has an amino acid sequence shown in SEQ ID NO. 1 or an amino acid sequence which is at least 80 percent identical to the amino acid sequence shown in SEQ ID NO. 1; the sgRNA has a nucleotide sequence shown in SEQ ID NO. 2, or a sgRNA sequence modified based on SEQ ID NO. 2.

In the present invention, the cells include eukaryotic cells and prokaryotic cells; the eukaryotic cells include mammalian cells and plant cells.

In the present invention, the mammalian cell includes a Chinese hamster ovary cell, a baby hamster kidney cell, a mouse Sertoli cell, a mouse mammary tumor cell, a buffalo rat liver cell, a rat liver tumor cell, a monkey kidney CVI line transformed by SV40, a monkey kidney cell, a canine kidney cell, a human cervical cancer cell, a human lung cell, a human liver cell, an HIH/3T3 cell, a human U2-OS osteosarcoma cell, a human A549 cell, a human K562 cell, a human HEK293T cell, a human HCT116 cell, or a human MCF-7 cell or a TRI cell.

In the invention, the CRISPR/Cas9 system is a Staphylococcus auriculariasis SaCas9 (SauriCas 9) protein which can realize gene editing by the coaction with single guide RNA (sgRNA).

In the invention, the SauriCas9 protein belongs to Staphylococcus aureus (Staphylococcus aureus), and the search number of the Uniprot of the SauriCas9 protein is A0A2T4M4R5.

In the present invention, the sauri cas9 protein includes a sauri cas9 protein having no cleavage activity or having only a single strand cleavage activity or having a double strand cleavage activity.

In the invention, the precise positioning DNA sequence comprises a sequence of 20bp or 21bp at the 5' end of the sgRNA and a target DNA sequence which can form a base complementary pairing structure.

In the invention, the accurate positioning target DNA sequence comprises a PAM sequence on a SauriCas9 protein and sgRNA complex recognition target DNA sequence.

In the invention, the PAM sequence is NNGG or NNNGG, and the target DNA sequence is:

NNNNNNNNNNNNNNNNNNNNNNNGG(SEQ ID NO:3)。

in the invention, the SauriCas9 protein and sgRNA complex can precisely target DNA sequences, namely the SauriCas9 protein and sgRNA complex can recognize and combine specific DNA sequences, or other proteins fused with the SauriCas9 protein or proteins capable of specifically recognizing sgRNA are brought to the positions of the target DNA.

In the present invention, the saurcicas 9 protein and sgRNA complex or other proteins fused with saurcicas 9 protein or proteins specifically recognizing sgrnas can modify and regulate the targeted DNA region, including but not limited to regulation of gene transcription level, DNA methylation regulation, DNA acetylation modification, histone acetylation modification, single base converter or chromatin imaging tracking.

In the present invention, the single base converter includes, but is not limited to, conversion between bases adenine to guanine, or cytosine to thymine, or cytosine to uracil, or other bases.

The gene editing system provided by the invention has high editing activity and has obvious advantages compared with the prior Cas 9.

The editing efficiency of the CRISPR/SauriCas9 system is detected by the technologies of gene synthesis, molecular cloning, cell transfection, PCR product deep sequencing, bioinformatics analysis and the like.

The CRISPR/SauriCas9 gene editing system provided by the invention can carry out gene editing in cells, and comprises the steps of identifying and positioning a target DNA through a compound of SauriCas9 protein and sgRNA, and editing the DNA; and finally, detecting the editing efficiency.

The method comprises the following specific steps:

(1) Synthesizing a humanized SauriCas9 gene sequence; and cloning to an expression vector to obtain pAAV2_ SauriCas9_ ITR;

(2) Synthesizing oligonucleotide single-stranded DNA (deoxyribonucleic acid) corresponding to the sgRNA, namely Oligo-F and Oligo-R sequences, annealing and connecting to a BsaI enzyme digestion site of a plasmid pAAV2_ SauriCas9_ U6_ BsaI to obtain pAAV2_ SauriCas9-hU6-sgRNA;

(3) Delivering a vector expressing the SauriCas9 protein, sgRNA, into a cell containing a target site;

(4) And carrying out PCR amplification on the edited target site, and detecting the editing efficiency by T7EI enzyme digestion or second-generation sequencing.

In the present invention, any targeted sgRNA can be designed for a DNA sequence to be edited according to specific needs, and modifications well known in the art including, but not limited to, phosphorylation, shortening, lengthening, sulfurization, methylation, and hydroxylation can be performed on the sgRNA to some extent.

In the present invention, the CRISPR/saurtias 9 system that can be delivered to cells includes, but is not limited to, plasmids expressing saurtias 9 protein or sgRNA, retroviruses, adenoviruses, adeno-associated viral vectors or RNA or saurtias 9 protein, according to specific needs.

It will be appreciated by those skilled in the art that the base N represents any of the four bases A, T, C or G.

Further, in step (3), the delivery means includes, but is not limited to, liposomes, cationic polymers, nanoparticles, multifunctional envelope-type nanoparticles, and viral vectors.

Further, in step (3), the cells include, but are not limited to, human cells, animal cells, plant cells, bacterial cells, and fungal cells.

Further, in the step (2), the sgRNA has a nucleotide sequence shown in SEQ ID NO. 2, or a nucleotide sequence at least 80% identical to the nucleotide sequence shown in SEQ ID NO. 2, or modifications based on the nucleotide sequence, including but not limited to phosphorylation, shortening, lengthening, sulfurization or methylation.

More specifically, in one embodiment, oligonucleotide single-stranded DNA sequences corresponding to sgrnas, i.e., oligo-F and Oligo-R, were synthesized as follows:

Oligo-F CACCGCTCGGAGATCATCATTGCG，(SEQ ID NO:4)

Oligo-R AAACCGCAATGATGATCTCCGAGC。(SEQ ID NO:5)。

more specifically, in one embodiment, it can be understood by those skilled in the art that Oligo-F and Oligo-R need to be annealed to become double-stranded DNA, and the annealing reaction system is 1. Mu.L of 100. Mu.M Oligo-F, 1. Mu.L of 100. Mu.M Oligo-R, and 28. Mu.L of water, and after shaking and mixing, the mixture is placed in a PCR instrument to run an annealing program; the annealing procedure was as follows: 95 ℃ 5min,85 ℃ 1min,75 ℃ 1min,65 ℃ 1min,55 ℃ 1min,45 ℃ 1min,35 ℃ 1min,25 ℃ 1min,4 ℃ storage, cooling rate 0.3 ℃/s.

More specifically, in one embodiment, the plasmid pAAV2_ saurtia 9_ ITR needs to be linearized with BsaI restriction enzyme (NEB).

More specifically, in one embodiment, the annealed Oligo-F and Oligo-R products are ligated to the linearized pAAV2_ SauriCas9_ ITR backbone vector by DNA ligase.

More specifically, in one embodiment, after transformation of the ligation products into competent cells, the correct clones were verified by Sanger sequencing and the plasmids were extracted for use.

More specifically, in one embodiment, the cell in step (3) is HEK293T comprising a target site having the nucleotide sequence set forth in SEQ ID NO. 7.

More specifically, in one embodiment, the delivery means in step (3) is a liposome, comprising

2000 or PEI.

More specifically, in a specific embodiment of the first aspect of the present invention, the template for PCR in the experimental step (4) is edited HEK293T genomic DNA.

More specifically, in one embodiment, the primer sequences for PCR amplification in step (4) are:

F1-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNGCGAGAAAAGCCTTGTTT(SEQ ID NO:7)

R1-ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTGAACTTGTGGCCGTTTAC

(SEQ ID NO:8)

F2-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC(SEQ ID NO:9)

R2-CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTG(SEQ ID NO:10)。

the invention also provides a CRISPR/saurtia 9 system kit for gene editing, which comprises sgRNA or targeted DNA of a saurtia 9 protein or targeted DNA sequence.

The invention also provides applications of the CRISPR/SauriCas9 gene editing system, which comprises gene knockout, site-specific base change, site-specific insertion, gene transcription level regulation, DNA methylation regulation, DNA acetylation modification, histone acetylation modification, single-base converters or chromatin imaging tracking.

Drawings

Figure 1 is a schematic diagram of CRISPR/saurii cas9 gene editing system cleaving targeted DNA. Wherein the grey ovals represent the saurtias 9 protein, the black bends represent the sgRNA sequence, and the darkened regions in the upper genome chain represent the PAM sequence NNGG.

FIG. 2 is a map of plasmid pAAV2_ SauriCas9_ U6_ BsaI. Wherein, the recombinant expression vector comprises AAV2 ITR, CMV enhancer, CMV promoter, SV40 NLS, sauriCas9, nucleoplasmin NLS, 3 xHA, bGH poly (A), human U6 promoter (hU 6), bsaI endonuclease site, sgRNA scaffold sequence and other elements.

FIG. 3 shows the result of partial next generation sequencing after the DNA sequence of the target site has been edited. Wherein the editing result has deletion, insertion or mismatching, and the last 4bp represents a PAM sequence NNGG.

FIG. 4 shows the result of cleavage of endogenous site with T7 Endonuclease I. Wherein the arrows indicate the size of the cut fragments.

Detailed Description

The present invention will be further illustrated by the following examples, which are not intended to limit the invention in any way.

Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated. Unless otherwise indicated, reagents and materials used in the following examples are commercially available. The experimental method not specified for the specific conditions is usually carried out under the conventional conditions or the conditions recommended by the manufacturer.

In a specific embodiment, the CRISPR/saurii cas9 system provided by the invention is a novel gene editing system, method, kit and application thereof.

In a specific embodiment of the invention, the CRISPR/SauriCas9 system is capable of gene editing in a cell, the method comprising the steps of:

1. construction of plasmid pAAV2_ SaCas9-R5_ ITR

Step (1), downloading the amino acid sequence of the SauriCas9 gene according to the retrieval number A0A2T4M4R5 of the SauriCas9 gene on UniProt, and showing in SEQ ID NO: 1.

And (2) carrying out codon optimization on the amino acid sequence of the SauriCas9 to obtain a coding sequence of the SauriCas9 highly expressed in human cells, wherein the coding sequence is shown as SEQ ID NO. 11.

And (3) carrying out gene synthesis on the coding sequence of the obtained gene SauriCas9 in a company, and constructing the coding sequence to a pAAV2_ ITR skeleton plasmid to obtain a plasmid pAAV2_ SauriCas9_ ITR, wherein the plasmid is shown in figure 2.

2. Preparation of linearized plasmid pAAV2_ SauriCas9_ ITR

Step (1), carrying out enzyme digestion linearization on the plasmid pAAV2_ SauriCas9_ ITR by using BasI restriction enzyme, wherein an enzyme digestion system comprises: mu.g of plasmid pAAV2_ SauriCas9_ ITR, 5. Mu.L of 10 xClSmart buffer, 1. Mu.L of the endonuclease, water to 50. Mu.L, reacted at 37 ℃ for 1 hour.

And (2) carrying out electrophoresis on the product after enzyme digestion on a 1% agarose gel at 120V for 30 minutes.

And (3) cutting off the DNA fragment with the size of 7447bp, recycling by using a glue recycling kit according to the steps provided by a manufacturer, and finally eluting by using ultrapure water.

And (4) determining the DNA concentration of the recovered linearized plasmid pAAV2_ SauriCas9_ ITR by using NanoDrop for standby or storing at-20 ℃ for a long time.

3. Construction of plasmid pAAV2_ SaCas9-hU6-sgRNA

And (1) designing a sgRNA sequence.

Step (2), adding linearized plasmids pAAV2 \ "to the sense strand and antisense strand of the designed sgRNA sequence pair

The cohesive end sequences corresponding to the two sides of the SauriCas9_ ITR, and two oligonucleotide single-stranded DNAs are synthesized by the company, and the specific sequences are as follows:

Oligo-F CACCGCTCGGAGATCATCATTGCG，(SEQ ID NO:4)

Oligo-R AAACCGCAATGATGATCTCCGAGC。(SEQ ID NO:5)

step (3), annealing the oligonucleotide single-stranded DNA to obtain double-stranded DNA, and carrying out an annealing reaction system: after shaking and mixing 1. Mu.L of 100. Mu. Mooligo-F, 1. Mu.L of 100. Mu. Mooligo-R and 28. Mu.L of water, the mixture was placed in a PCR instrument to run an annealing program: 95 ℃ 5min,85 ℃ 1min,75 ℃ 1min,65 ℃ 1min,55 ℃ 1min,45 ℃ 1min,35 ℃ 1min,25 ℃ 1min,4 ℃ storage, cooling rate 0.3 ℃/s.

And (4) connecting the annealed product with the linearized plasmid pAAV2_ SauriCas9_ ITR under the action of DNA ligase according to the steps provided by the product.

Step (5), 1. Mu.L of the ligation product was taken for chemical competent transformation, and the growing bacterial clones were subjected to Sanger sequencing validation.

And (6) carrying out sequencing verification on the correctly connected clone shake bacteria, and extracting a plasmid pAAV2_ SauriCas9-hU6-sgRNA for later use.

4. Plasmid pAAV2_ SauriCas9-hU6-sgRNA for transfecting and expressing SauriCas9 protein and sgRNA

Step (1), on day 0, according to transfection needs, the HEK293T cell line containing the sgRNA targeting site is plated in a 6-well plate, the cell density is about 30%, and the sequence of the target site is shown as SEQ ID NO. 6.

Step (2), day 1, transfection was performed in the following transfection system,

i. adding 2 mu g of plasmid pAAV2_ SaCas9-hU6-sgRNA to be transfected into 100 mu l of Opti-MEM culture medium, and gently blowing, beating and uniformly mixing;

ii. Mixing

2000 flick and mix evenly, suck 5 mul and add to 100 mul Opti-MEM culture medium, mix evenly gently, stand 5min at room temperature;

will dilute

2000 and diluted plasmid, gently blowing, mixing, standing at room temperature for 20min, and adding into cells to be transfectedIn a culture medium.

And (3) placing the cells in a 5% CO2 incubator at 37 ℃ for continuous culture.

5. Preparation of a second Generation sequencing library

And (1) collecting the HEK293T cells after editing for 3 days, and extracting the genome DNA by using a DNA kit according to the steps provided by the product.

Step (2), performing first round PCR of PCR library building, performing PCR reaction by using 2xQ5 Mastermix, wherein PCR primers are shown as SEQ ID NO:7-SEQ ID NO:8, and the reaction system is as follows:

the PCR run program was as follows:

and (3) carrying out second round PCR of PCR library building, carrying out PCR reaction by using 2xQ5 Mastermix, wherein PCR primers are shown as SEQ ID NO: 9-SEQ ID NO:10, and the reaction system is as follows:

the PCR run program was as follows:

and (4) purifying DNA fragments with the size of 366bp by using a gel recovery kit for the PCR products of the second round according to the steps provided by the manufacturer, and preparing the second generation sequencing library.

6. Analysis of the results of the second generation sequencing

Step (1), the prepared second-generation sequencing library was submitted to the company for paired-end sequencing on HiseqXTen.

Step (2) bioinformatics analysis of the next-generation sequencing results, and partial compilation results are shown in FIGS. 2 and 3.

7. Endogenous site validation

Step (1), passing plasmid pAAV2_ SaCas9-hU6-sgRNA for expressing SauriCas9 and sgRNA through

2000 were transfected into HEK293T cells according to the manufacturer's protocol, wherein,

the sgRNA sequence is: AGATGCGGGTGATGATGCCT (SEQ ID NO: 12)

The specific sequence of the target site is as follows: AGATGCGGGTGATGATGCTTGG; (SEQ ID NO: 13)

Extracting cell genome DNA after 5 days of editing, and amplifying a target DNA sequence by using primers Test-F and Test-R through a 2x Q5 Master mix; wherein:

the specific sequence of Test-F is: CAGGGAGTCGACGACGAGTTGAA (SEQ ID NO: 14)

The specific sequence of Test-R is as follows: TAATTGCTGGCCTATCCACGC; (SEQ ID NO: 15)

Step (3), recovering the PCR product through agarose gel, and purifying DNA fragment with the size of 570 bp;

step (4), the purified DNA fragment is subjected to enzyme digestion according to the instruction of T7 Endocule I, then gel running detection is carried out, the result is shown in figure 4, the left side is a negative control group, sgRNA does not exist during transfection, and no cut fragment exists after the T7 Endocule I cuts a targeting sequence, which indicates that no editing occurs; the right panel is the experimental group, sgRNA was present during transfection, and the T7 endonucleolytic I cleaved after cleavage of the targeting sequence, indicating that editing has occurred.

SEQUENCE LISTING

<110> university of double denier

<120> CRISPR/SauriCas9 gene editing system and application thereof

<130> 1119

<160> 15

<170> PatentIn version 3.5

<210> 1

<211> 1061

<212> PRT

<213> Artificial sequence

<400> 1

Met Gln Glu Asn Gln Gln Lys Gln Asn Tyr Ile Leu Gly Leu Asp Ile

1 5 10 15

Gly Ile Thr Ser Val Gly Tyr Gly Leu Ile Asp Ser Lys Thr Arg Glu

20 25 30

Val Ile Asp Ala Gly Val Arg Leu Phe Pro Glu Ala Asp Ser Glu Asn

35 40 45

Asn Ser Asn Arg Arg Ser Lys Arg Gly Ala Arg Arg Leu Lys Arg Arg

50 55 60

Arg Ile His Arg Leu Asn Arg Val Lys Asp Leu Leu Ala Asp Tyr Gln

65 70 75 80

Met Ile Asp Leu Asn Asn Val Pro Lys Ser Thr Asp Pro Tyr Thr Ile

85 90 95

Arg Val Lys Gly Leu Arg Glu Pro Leu Thr Lys Glu Glu Phe Ala Ile

100 105 110

Ala Leu Leu His Ile Ala Lys Arg Arg Gly Leu His Asn Ile Ser Val

115 120 125

Ser Met Gly Asp Glu Glu Gln Asp Asn Glu Leu Ser Thr Lys Gln Gln

130 135 140

Leu Gln Lys Asn Ala Gln Gln Leu Gln Asp Lys Tyr Val Cys Glu Leu

145 150 155 160

Gln Leu Glu Arg Leu Thr Asn Ile Asn Lys Val Arg Gly Glu Lys Asn

165 170 175

Arg Phe Lys Thr Glu Asp Phe Val Lys Glu Val Lys Gln Leu Cys Glu

180 185 190

Thr Gln Arg Gln Tyr His Asn Ile Asp Asp Gln Phe Ile Gln Gln Tyr

195 200 205

Ile Asp Leu Val Ser Thr Arg Arg Glu Tyr Phe Glu Gly Pro Gly Asn

210 215 220

Gly Ser Pro Tyr Gly Trp Asp Gly Asp Leu Leu Lys Trp Tyr Glu Lys

225 230 235 240

Leu Met Gly Arg Cys Thr Tyr Phe Pro Glu Glu Leu Arg Ser Val Lys

245 250 255

Tyr Ala Tyr Ser Ala Asp Leu Phe Asn Ala Leu Asn Asp Leu Asn Asn

260 265 270

Leu Val Val Thr Arg Asp Asp Asn Pro Lys Leu Glu Tyr Tyr Glu Lys

275 280 285

Tyr His Ile Ile Glu Asn Val Phe Lys Gln Lys Lys Asn Pro Thr Leu

290 295 300

Lys Gln Ile Ala Lys Glu Ile Gly Val Gln Asp Tyr Asp Ile Arg Gly

305 310 315 320

Tyr Arg Ile Thr Lys Ser Gly Lys Pro Gln Phe Thr Ser Phe Lys Leu

325 330 335

Tyr His Asp Leu Lys Asn Ile Phe Glu Gln Ala Lys Tyr Leu Glu Asp

340 345 350

Val Glu Met Leu Asp Glu Ile Ala Lys Ile Leu Thr Ile Tyr Gln Asp

355 360 365

Glu Ile Ser Ile Lys Lys Ala Leu Asp Gln Leu Pro Glu Leu Leu Thr

370 375 380

Glu Ser Glu Lys Ser Gln Ile Ala Gln Leu Thr Gly Tyr Thr Gly Thr

385 390 395 400

His Arg Leu Ser Leu Lys Cys Ile His Ile Val Ile Asp Glu Leu Trp

405 410 415

Glu Ser Pro Glu Asn Gln Met Glu Ile Phe Thr Arg Leu Asn Leu Lys

420 425 430

Pro Lys Lys Val Glu Met Ser Glu Ile Asp Ser Ile Pro Thr Thr Leu

435 440 445

Val Asp Glu Phe Ile Leu Ser Pro Val Val Lys Arg Ala Phe Ile Gln

450 455 460

Ser Ile Lys Val Ile Asn Ala Val Ile Asn Arg Phe Gly Leu Pro Glu

465 470 475 480

Asp Ile Ile Ile Glu Leu Ala Arg Glu Lys Asn Ser Lys Asp Arg Arg

485 490 495

Lys Phe Ile Asn Lys Leu Gln Lys Gln Asn Glu Ala Thr Arg Lys Lys

500 505 510

Ile Glu Gln Leu Leu Ala Lys Tyr Gly Asn Thr Asn Ala Lys Tyr Met

515 520 525

Ile Glu Lys Ile Lys Leu His Asp Met Gln Glu Gly Lys Cys Leu Tyr

530 535 540

Ser Leu Glu Ala Ile Pro Leu Glu Asp Leu Leu Ser Asn Pro Thr His

545 550 555 560

Tyr Glu Val Asp His Ile Ile Pro Arg Ser Val Ser Phe Asp Asn Ser

565 570 575

Leu Asn Asn Lys Val Leu Val Lys Gln Ser Glu Asn Ser Lys Lys Gly

580 585 590

Asn Arg Thr Pro Tyr Gln Tyr Leu Ser Ser Asn Glu Ser Lys Ile Ser

595 600 605

Tyr Asn Gln Phe Lys Gln His Ile Leu Asn Leu Ser Lys Ala Lys Asp

610 615 620

Arg Ile Ser Lys Lys Lys Arg Asp Met Leu Leu Glu Glu Arg Asp Ile

625 630 635 640

Asn Lys Phe Glu Val Gln Lys Glu Phe Ile Asn Arg Asn Leu Val Asp

645 650 655

Thr Arg Tyr Ala Thr Arg Glu Leu Ser Asn Leu Leu Lys Thr Tyr Phe

660 665 670

Ser Thr His Asp Tyr Ala Val Lys Val Lys Thr Ile Asn Gly Gly Phe

675 680 685

Thr Asn His Leu Arg Lys Val Trp Asp Phe Lys Lys His Arg Asn His

690 695 700

Gly Tyr Lys His His Ala Glu Asp Ala Leu Val Ile Ala Asn Ala Asp

705 710 715 720

Phe Leu Phe Lys Thr His Lys Ala Leu Arg Arg Thr Asp Lys Ile Leu

725 730 735

Glu Gln Pro Gly Leu Glu Val Asn Asp Thr Thr Val Lys Val Asp Thr

740 745 750

Glu Glu Lys Tyr Gln Glu Leu Phe Glu Thr Pro Lys Gln Val Lys Asn

755 760 765

Ile Lys Gln Phe Arg Asp Phe Lys Tyr Ser His Arg Val Asp Lys Lys

770 775 780

Pro Asn Arg Gln Leu Ile Asn Asp Thr Leu Tyr Ser Thr Arg Glu Ile

785 790 795 800

Asp Gly Glu Thr Tyr Val Val Gln Thr Leu Lys Asp Leu Tyr Ala Lys

805 810 815

Asp Asn Glu Lys Val Lys Lys Leu Phe Thr Glu Arg Pro Gln Lys Ile

820 825 830

Leu Met Tyr Gln His Asp Pro Lys Thr Phe Glu Lys Leu Met Thr Ile

835 840 845

Leu Asn Gln Tyr Ala Glu Ala Lys Asn Pro Leu Ala Ala Tyr Tyr Glu

850 855 860

Asp Lys Gly Glu Tyr Val Thr Lys Tyr Ala Lys Lys Gly Asn Gly Pro

865 870 875 880

Ala Ile His Lys Ile Lys Tyr Ile Asp Lys Lys Leu Gly Ser Tyr Leu

885 890 895

Asp Val Ser Asn Lys Tyr Pro Glu Thr Gln Asn Lys Leu Val Lys Leu

900 905 910

Ser Leu Lys Ser Phe Arg Phe Asp Ile Tyr Lys Cys Glu Gln Gly Tyr

915 920 925

Lys Met Val Ser Ile Gly Tyr Leu Asp Val Leu Lys Lys Asp Asn Tyr

930 935 940

Tyr Tyr Ile Pro Lys Asp Lys Tyr Glu Ala Glu Lys Gln Lys Lys Lys

945 950 955 960

Ile Lys Glu Ser Asp Leu Phe Val Gly Ser Phe Tyr Tyr Asn Asp Leu

965 970 975

Ile Met Tyr Glu Asp Glu Leu Phe Arg Val Ile Gly Val Asn Ser Asp

980 985 990

Ile Asn Asn Leu Val Glu Leu Asn Met Val Asp Ile Thr Tyr Lys Asp

995 1000 1005

Phe Cys Glu Val Asn Asn Val Thr Gly Glu Lys Arg Ile Lys Lys

1010 1015 1020

Thr Ile Gly Lys Arg Val Val Leu Ile Glu Lys Tyr Thr Thr Asp

1025 1030 1035

Ile Leu Gly Asn Leu Tyr Lys Thr Pro Leu Pro Lys Lys Pro Gln

1040 1045 1050

Leu Ile Phe Lys Arg Gly Glu Leu

1055 1060

<210> 2

<211> 101

<212> RNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (1)..(20)

<223> n is a, c, g, or u

<400> 2

nnnnnnnnnn nnnnnnnnnn guuuuaguac ucuggaaaca gaaucuacua aaacaaggca 60

aaaugccgug uuuaucucgu caacuuguug gcgagauuuu u 101

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (1)..(23)

<223> n is a, c, g, or t

<400> 3

nnnnnnnnnn nnnnnnnnnn nnngg 25

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<400> 4

caccgctcgg agatcatcat tgcg 24

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<400> 5

aaaccgcaat gatgatctcc gagc 24

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (21)..(25)

<223> n is a, c, g, or t

<400> 6

gctcggagat catcattgcg nnnnn 25

<210> 7

<211> 55

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (34)..(37)

<223> n is a, c, g, or t

<400> 7

acactctttc cctacacgac gctcttccga tctnnnngcg agaaaagcct tgttt 55

<210> 8

<211> 51

<212> DNA

<213> Artificial sequence

<400> 8

actggagttc agacgtgtgc tcttccgatc tctgaacttg tggccgttta c 51

<210> 9

<211> 45

<212> DNA

<213> Artificial sequence

<400> 9

aatgatacgg cgaccaccga gatctacact ctttccctac acgac 45

<210> 10

<211> 52

<212> DNA

<213> Artificial sequence

<400> 10

caagcagaag acggcatacg agatcactgt gtgactggag ttcagacgtg tg 52

<210> 11

<211> 3183

<212> DNA

<213> Artificial sequence

<400> 11

atgcaggaga accagcagaa gcagaactac atcctgggcc tggacatcgg aatcaccagc 60

gtcggctacg gactgatcga tagcaagaca agagaagtga tcgacgccgg cgttagactc 120

tttccagaag ctgatagcga gaacaactcc aaccgcagaa gcaagcgggg cgccagacgg 180

ttaaaacgga gaagaatcca ccggctgaac cgggtcaaag acctgctcgc tgattaccag 240

atgatcgatc ttaacaatgt tcctaagagc accgacccct acaccatcag agtgaagggc 300

ctccgggagc ctctgacaaa agaagaattc gccatcgccc tcctgcatat cgctaagaga 360

agaggcctgc acaacatcag tgtgtccatg ggcgacgaag agcaggacaa tgaactgagc 420

accaagcagc agctgcaaaa gaatgcccag caactgcagg acaagtatgt gtgcgaactg 480

cagttagaac ggctgaccaa catcaacaag gtcagaggcg agaagaacag atttaagaca 540

gaggactttg tgaaagaagt gaaacagctg tgcgaaaccc agagacagta ccacaacatc 600

gacgaccaat tcatccagca gtacatcgac ctggtgtcta caagacggga gtacttcgag 660

ggccccggca acggctctcc atacggctgg gacggcgacc tgctgaagtg gtacgagaag 720

ctgatgggca gatgcaccta tttccccgaa gaactgaggt ccgtgaagta cgcctacagc 780

gccgacctct tcaacgccct gaacgacctg aacaacctcg ttgtgaccag ggatgacaat 840

ccaaagcttg agtactacga gaagtaccac attattgaga acgtgttcaa gcaaaagaag 900

aatcccacac tcaaacaaat cgccaaagag atcggcgtgc aagattacga catccggggc 960

tatagaatca caaagagcgg caaacctcag ttcacctctt ttaagctgta tcacgacctg 1020

aagaacatct tcgagcaggc caaatacctg gaagatgtgg aaatgctgga cgagatcgcc 1080

aagatcctga ccatctacca ggatgagatt agcatcaaga aagccctgga ccagctgccc 1140

gaactgctga cagagagcga gaaatctcag atcgcacagc tcaccggcta tacaggcacc 1200

cacagactga gcctgaagtg catccacatt gtgatcgacg agctgtggga gagccccgag 1260

aaccagatgg aaatctttac cagactgaat ctgaaaccta agaaggtgga aatgagcgag 1320

atcgacagca tacccaccac cctggtcgac gagttcatcc tctcacctgt ggtgaagcgg 1380

gccttcatcc agagcatcaa ggtaatcaac gcagtgatca atcggttcgg cctgccagag 1440

gacatcatca tcgagctggc cagagaaaag aatagcaagg atcggagaaa gttcattaac 1500

aagctgcaga aacaaaatga ggccacaaga aagaaaatcg aacagctgct ggccaagtac 1560

ggcaacacca atgccaagta catgatcgag aagatcaagc tgcacgacat gcaggagggc 1620

aagtgcctgt acagcctgga ggctattcct ctggaagacc tgctgagcaa cccgacacac 1680

tacgaagttg accacattat ccccagatct gtgagctttg acaacagcct gaacaacaaa 1740

gtgctggtga aacaaagcga aaacagcaag aagggcaatc gcacccctta ccagtacctg 1800

agcagcaacg agtctaagat tagctacaac cagtttaagc agcacatcct gaacctgagc 1860

aaggccaagg acagaatcag caagaaaaaa agagatatgc tgctggaaga gagagatatc 1920

aacaagttcg aagtgcagaa ggaattcatt aaccggaacc tggtggatac acggtacgcc 1980

accagagaac tgtctaacct gctgaagacc tacttcagca cccatgacta cgccgtgaag 2040

gtgaagacca tcaacggcgg cttcactaac cacctgagga aggtgtggga tttcaagaag 2100

cacagaaacc acggctacaa gcaccacgcc gaagatgccc tggtgatcgc caacgccgac 2160

ttcctgttta agacacataa ggccctgcgg agaaccgata agatcctgga acaacctggc 2220

ctggaagtga atgatacaac cgtgaaagtg gacaccgagg aaaaatacca ggagctgttc 2280

gagacaccta agcaagtgaa gaacatcaag cagttccggg acttcaagta cagccaccga 2340

gtggacaaga agcctaaccg gcagcttatc aacgacacac tgtactccac cagagagatt 2400

gatggcgaaa cctacgtggt gcagaccctt aaggatctgt acgccaagga caacgagaaa 2460

gtgaagaagc tgttcaccga aagacctcag aagatcctga tgtaccagca cgaccctaag 2520

accttcgaga aactgatgac aatcctgaac cagtacgctg aggccaagaa ccctctggct 2580

gcttattacg aggacaaagg cgagtacgtg accaagtacg ccaagaaagg caatggacct 2640

gccatccaca agatcaagta tatcgataag aagcttggat cttacctgga tgttagcaac 2700

aagtatcctg agacacagaa caagcttgtg aagctgtccc tgaagagctt tagattcgac 2760

atctacaagt gtgaacaggg ctacaagatg gtgtccatcg gatacctgga cgtgctgaag 2820

aaagataact actactacat ccctaaggac aagtacgagg ccgagaagca gaaaaagaag 2880

atcaaggaat ctgatctttt tgtgggcagc ttctactaca acgacctcat catgtacgag 2940

gatgaactgt tcagagtgat aggagtgaac agcgacatca acaatctggt tgagctaaac 3000

atggtcgaca ttacctacaa ggacttctgc gaggtgaaca acgtgacagg cgagaaaaga 3060

atcaaaaaga ctatcggcaa gcgcgtggtc ctgatcgaga agtacaccac agatattcta 3120

ggcaacctgt acaagactcc cctgcctaag aagccccagc ttatcttcaa gcggggagaa 3180

ctg 3183

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence

<400> 12

agatgcgggt gatgatgctc t 21

<210> 13

<211> 25

<212> DNA

<213> Artificial sequence

<400> 13

agatgcgggt gatgatgctc tttgg 25

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

cagggagtcg acgagttgaa 20

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence

<400> 15

taattgctgg cctatccacg c 21

Claims (16)

1. A CRISPR/Cas9 gene editing system for gene editing in cells or in vitro, characterized in that the CRISPR/Cas9 system isSauriThe Cas9 protein and sgRNA complex can accurately position a target DNA sequence, generate cutting and enable the DNA to generate double-strand break damage; the above-mentionedSauriThe amino acid sequence of the Cas9 protein is shown as SEQ ID NO:1 is shown in the specification; the sgRNA nucleotide sequence is shown in SEQ ID NO:2 is shown in the specification; the precisely-positioned targeting DNA sequence comprisesSauriThe Cas9 protein and sgRNA complex recognizes a PAM sequence on the target DNA sequence; the PAM sequence is NNGG, and the target DNA sequence is SEQ ID NO:3, respectively.

2. The CRISPR/Cas9 gene editing system of claim 1, wherein the cells comprise eukaryotic cells and prokaryotic cells; the eukaryotic cells include mammalian cells and plant cells; the mammalian cell includes a chinese hamster ovary cell, a baby hamster kidney cell, a mouse Sertoli cell, a mouse mammary tumor cell, a buffalo rat hepatocyte, a rat hepatoma cell, a monkey kidney CVI line transformed by SV40, a monkey kidney cell, a canine kidney cell, a human cervical cancer cell, a human lung cell, a human hepatocyte, a HIH/3T3 cell, a human U2-OS osteosarcoma cell, a human a549 cell, a human K562 cell, a human HEK293T cell, a human HCT116 cell, or a human MCF-7 cell or a TRI cell.

3. The CRISPR/Cas9 gene editing system of claim 1, wherein the CRISPR/Cas9 gene editing system is characterized in thatSauriCas9 proteins include those having single-strand cleavage activity or having double-strand cleavage activitySauriA Cas9 protein.

4. The CRISPR/Cas9 gene editing system of claim 1, wherein the precisely positioned DNA sequence comprises a sequence of 20bp or 21bp at the 5' end of sgRNA which can form a base complementary pairing structure with a target DNA sequence.

5. The CRISPR/Cas9 gene editing system of claim 1, wherein the sgRNA can be phosphorylated, sulfurized, methylated, or hydroxylated modified.

6. The CRISPR/Cas9 gene editing system of claim 1, wherein the CRISPR/Cas9 gene editing systemSauriCas9 protein and sgRNA complex can accurately target DNA sequenceSauriThe Cas9 protein and sgRNA complex can recognize and bind to a specific DNA sequence, or to be bound toSauriOther proteins of the Cas9 protein fusion or proteins that specifically recognize sgrnas are brought into position to target DNA.

7. The CRISPR/Cas9 gene editing system of claim 6, wherein the CRISPR/Cas9 gene editing systemSauriCas9 protein and sgRNA complex or withSauriOther proteins of Cas9 protein fusion or proteins that specifically recognize sgrnas can modify and regulate targeted DNA regions, including regulation of gene transcription levels, single base switches, or chromatin imaging tracking.

8. The CRISPR/Cas9 gene editing system of claim 7, wherein the single base switch comprises a switch between bases adenine to guanine, cytosine to thymine, cytosine to uracil or other bases.

9. CRISPR/according to one of claims 1 to 8SauriA method of gene editing in a cell by a Cas9 gene editing system comprisingSauriIdentifying and positioning the target DNA by a compound of the Cas9 protein and the sgRNA, and editing the DNA; finally, detecting the editing efficiency; the method comprises the following specific steps:

(1) Synthetic human sourceOfSauriA Cas9 gene sequence; and cloning the gene into an expression vector to obtain pAAV2 \ u SauriCas9_ITR；

(2) Synthesizing single-stranded DNA of oligonucleotides corresponding to sgRNA, namely Oligo-F and Oligo-R sequences, annealing and connecting to plasmid pAAV2 \\ uSauriBsaI restriction site of Cas9_ U6_ BsaI to obtain pAAV2 \ U SauriCas9-hU6-sgRNA；

(3) Will expressSauriDelivery of Cas9 protein, vector of sgRNA into cells containing the target site;

(4) Carrying out PCR amplification on the edited target site, and detecting the editing efficiency by T7EI enzyme digestion or second-generation sequencing; the method is for non-therapeutic purposes.

10. The method of claim 9 wherein said pAAV2_ \, is SauriCas9-hU6-sgRNA is an adeno-associated virus backbone plasmid, which comprises AAV2 ITR, CMV enhancer, CMV promoter, SV40 NLS, sauriCas9, nucleoplasmin NLS, 3 xHA, bGH poly (A), human U6 promoter, bsaI endonuclease site, sgRNA scaffold sequence.

11. The method of claim 9, wherein the CRISPR ∑ is delivered to a cellSauriCas9 system includes expressionSauriCas9 protein or sgRNA plasmid, retrovirus, adenovirus, adeno-associated virus vector or RNA orSauriA Cas9 protein.

12. The method of claim 9, wherein the sgRNA is synthesized as a single-stranded oligonucleotide DNA sequence, i.e., oligo-F and Oligo-R sequences are SEQ ID NO:4 and SEQ ID NO:5, respectively.

13. The method of claim 9, wherein the target site of the cell in step (3) has the amino acid sequence of SEQ ID NO: 6.

14. The method according to claim 9, wherein the template for PCR in step (4) is edited DNA; the primer sequences for PCR amplification are: SEQ ID NO: 7. the amino acid sequence of SEQ ID NO:8, SEQ ID NO: 9. SEQ ID NO:10.

15. comprising a CRISPR according to one of claims 1 to 8SauriKit of a Cas9 gene editing system, the kit comprisingSauriA Cas9 protein and a sgRNA targeting a DNA sequence.

16. CRISPR/ion according to one of claims 1 to 8SauriApplications of the Cas9 gene editing system, including gene knockout, site-specific base change, site-specific insertion, regulation of gene transcription level, single base conversion or chromatin imaging tracking, are non-therapeutic applications.

Images